WO2020218549A1 - 単一生物単位の遺伝情報またはその他の生体分子の情報を使用した、サンプルのスクリーニング法 - Google Patents
単一生物単位の遺伝情報またはその他の生体分子の情報を使用した、サンプルのスクリーニング法 Download PDFInfo
- Publication number
- WO2020218549A1 WO2020218549A1 PCT/JP2020/017788 JP2020017788W WO2020218549A1 WO 2020218549 A1 WO2020218549 A1 WO 2020218549A1 JP 2020017788 W JP2020017788 W JP 2020017788W WO 2020218549 A1 WO2020218549 A1 WO 2020218549A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- information
- cell
- genetic information
- biomolecule
- analysis
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12M—APPARATUS FOR ENZYMOLOGY OR MICROBIOLOGY; APPARATUS FOR CULTURING MICROORGANISMS FOR PRODUCING BIOMASS, FOR GROWING CELLS OR FOR OBTAINING FERMENTATION OR METABOLIC PRODUCTS, i.e. BIOREACTORS OR FERMENTERS
- C12M1/00—Apparatus for enzymology or microbiology
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12M—APPARATUS FOR ENZYMOLOGY OR MICROBIOLOGY; APPARATUS FOR CULTURING MICROORGANISMS FOR PRODUCING BIOMASS, FOR GROWING CELLS OR FOR OBTAINING FERMENTATION OR METABOLIC PRODUCTS, i.e. BIOREACTORS OR FERMENTERS
- C12M1/00—Apparatus for enzymology or microbiology
- C12M1/34—Measuring or testing with condition measuring or sensing means, e.g. colony counters
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/02—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6834—Enzymatic or biochemical coupling of nucleic acids to a solid phase
- C12Q1/6837—Enzymatic or biochemical coupling of nucleic acids to a solid phase using probe arrays or probe chips
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
- C12Q1/6874—Methods for sequencing involving nucleic acid arrays, e.g. sequencing by hybridisation
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N35/00—Automatic analysis not limited to methods or materials provided for in any single one of groups G01N1/00 - G01N33/00; Handling materials therefor
- G01N35/08—Automatic analysis not limited to methods or materials provided for in any single one of groups G01N1/00 - G01N33/00; Handling materials therefor using a stream of discrete samples flowing along a tube system, e.g. flow injection analysis
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N37/00—Details not covered by any other group of this subclass
Definitions
- the present disclosure is based on the structures and sequences of nucleic acids or other biomolecules prepared in parallel from various organisms and bioequivalents (eg, microorganisms, cell structures, artificial cells, etc.), individually with reference to the structures and sequences. It relates to a method of detecting and selecting an individual-specifically.
- a simple operation is performed to analyze a single biological unit captured in a gel, and the genetic information of a single biological unit or other biomolecules is analyzed.
- a library of molecular information can be prepared.
- data will be accumulated according to the composition ratio of a single biological unit contained in the original sample. .. That is, if the sample contains a single biological unit that exists as a preferred species, the genetic information of many single biological units or other biomolecular information (eg, sequence data) is derived from that single biological unit.
- the present disclosure simply relies on a set containing two or more single biological units based on the genetic information of the single biological unit or other biomolecular information (eg, a nucleic acid sequence or a particular subsequence).
- biomolecular information eg, a nucleic acid sequence or a particular subsequence.
- a method for producing a subset containing a single biounit which comprises the step of producing a subset containing at least one biounit.
- cells are encapsulated in the droplets one by one, the droplets are gelled to form a gel capsule, the gel capsule is immersed in a lysis reagent to dissolve the cells in the gel capsule, and the cells in the gel capsule are dissolved.
- a gel capsule containing an amplified and retained 1-cell genome-derived polynucleotide is prepared by the method of amplifying the polynucleotide of.
- the present disclosure has been completed by detecting and selecting a sample to be analyzed in detail from the nucleic acid amplification product by any of the methods described in the present specification.
- the present disclosure also presents, in another aspect, information on nucleic acids or other biomolecules derived from two or more single biological units (cells or cell-like structures) (eg, nucleic acid sequences or specific subsequences).
- Embodiments of the present disclosure include the following.
- (Item 1) Includes the step of generating a subset containing at least one single biological unit from a set containing two or more single biological units based on the genetic information of the single biological unit or information on other biomolecules. , How to generate a subset containing a single biounit.
- (Item 2) A) The process of providing each of two or more single biological units separately, B) A step of selecting two or more separately provided single biological units based on genetic information derived from the single biological unit or information on other biomolecules. C) A method comprising the step of analyzing the selected single biological unit, if necessary. (Item 3) A) above (A) Encapsulating one cell or cell-like structure in a droplet using a sample containing two or more cells or components.
- the solubilizing reagents are lysoteam, labiase, yatarase, achromopeptidase, protease, nuclease, zymolyase, chitinase, lysostaphin, mutanolaicin, sodium dodecyl sulfate, sodium lauryl sulfate, potassium hydroxide, sodium hydroxide, phenol, chloroform, guanidine hydrochloride.
- nucleic acid information is selected from the presence or absence of a particular gene sequence, the yield of a particular gene or the total nucleic acid yield.
- Reagents for specifically detecting the presence or absence of the specific gene sequence, molecular weight measuring means (agarose gel electrophoresis, microchip electrophoresis), gene amplification method (PCR, qPCR) The method according to item 10, wherein the method is detected by means selected from the group consisting of gene sequencing (Sanger sequencing, NGS).
- the reagent for specifically detecting the particular gene sequence is selected from the group consisting of antibodies, nucleic acid probes, DNA-binding fluorescent dyes, and fluorescent dye-binding nucleotides.
- (Item 15) The method of item 14, wherein the genetic information or other biomolecule information is nucleic acid information.
- A) comprises sequencing nucleic acids derived from cells or cell-like structures to obtain nucleic acid information.
- B) comprises assessing the presence or absence of a specific gene sequence and / or identity with a specific gene sequence.
- the steps of analyzing the selected genetic information or other biomolecule information include analysis of the possibility of disease, diagnosis of health condition, identification of a person, selection of treatment method, analysis of microflora, detection of gene mutation, and pathogen.
- a device for sorting genetic information or other biomolecular information by a single biological unit A) A provider that provides genetic information or other biomolecule information derived from two or more single biological units as a set of genetic information or other biomolecule information for each single biological unit. B) A sorting unit that sorts the genetic information or other biomolecular information for each single biological unit based on all or part of the genetic information or other biomolecular information. C) An apparatus including an analysis unit for analyzing the selected genetic information or other biomolecule information, if necessary.
- (Item 20) The device according to item 19, wherein the genetic information or other biomolecule information is nucleic acid information.
- the analysis unit that analyzes the selected genetic information or information on other biomolecules is capable of analyzing the possibility of a disease, diagnosing a health condition, identifying a person, selecting a treatment method, analyzing a microflora, and detecting a gene mutation.
- apparatus. (Item 24) A program that implements on a computer a method of sorting genetic information or other biomolecular information by cell or cell-like structure.
- A) comprises sequencing nucleic acids derived from cells or cell-like structures to obtain nucleic acid information.
- B) comprises assessing the presence or absence of a particular gene sequence and / or identity with a particular gene sequence.
- the steps of analyzing the selected genetic information or other biomolecule information include analysis of the possibility of disease, diagnosis of health condition, identification of a person, selection of treatment method, analysis of microflora, detection of gene mutation, and pathogen.
- the program according to any one of items 24-27, which comprises an analysis selected from the group consisting of detection of, drug candidate-producing microorganisms, search for industrial enzyme-producing microorganisms, microbial product assurance and environmental hygiene assessment. .. (Item 29) A recording medium containing a program that implements a computer-implemented method for sorting genetic information or other biomolecule information by cell or cell-like structure.
- A) comprises sequencing nucleic acids derived from cells or cell-like structures to obtain nucleic acid information.
- B) comprises evaluating the presence or absence of a specific gene sequence and / or identity with a specific gene sequence.
- the steps of analyzing the selected genetic information or other biomolecule information include analysis of the possibility of disease, diagnosis of health condition, identification of a person, selection of treatment method, analysis of microflora, detection of gene mutation, and pathogen.
- the record according to any one of items 29 to 32 including analysis selected from the group consisting of detection of, drug candidate producing microorganisms, search for industrial enzyme producing microorganisms, microbial product assurance and environmental hygiene assessment. Medium.
- nucleic acid amplification, detection, selection, etc. can be performed while holding individual single biological units (for example, "single cell") as a set, and when it is desired to acquire rare bacterial data, host DNA When a large amount of such substances are mixed, data on only specific bacteria is required, and it can be applied when evaluation of diversity is unnecessary.
- the present disclosure can also narrow down the innumerable samples to be used for whole-genome sequencing prior to whole-genome sequencing. Further, in the present disclosure (in the case of dry), after decoding the entire genome sequence, the information to be analyzed can be narrowed down from the digital sequence information.
- the micro flow path is composed of a first flow path 5, a second flow path 6, a third flow path 7, and a fourth flow path 8, and the micro flow path 2 in which adjacent flow paths are arranged at right angles is shown. Fine droplets are introduced by introducing the intestinal microbial suspension 1 from the first flow path 5, introducing oil 10 from the second flow path 6 and the fourth flow path 8 and shearing the intestinal microbial suspension 1. 3 is produced. It is a figure which shows the microdroplet 3 housed in a tube 9.
- a plurality of microdroplets 3 and oil 10 are housed in the tube 9, but the microdroplets 3 have a lighter specific gravity than the oil 10 and therefore accumulate in the upper layer.
- the fine droplets 3 gelled by cooling the tube 9 on ice are the gel capsules 11.
- the lytic reagent 13 is allowed to permeate into each gel capsule 11.
- the microdroplets 3 containing the cells 4 are prepared by introducing oil 10 and shearing the intestinal microbial suspension 1 and housed in a tube 9.
- the tube 9 is then cooled on ice to make a gel capsule 11.
- the gel capsule 11 After removing the oil 10, centrifugation is performed with PBS to make the gel capsule 11 suspended in the aqueous layer 12, and the gel capsule 11 is immersed in the lytic reagent 13 to bring the lytic reagent 13 into each gel capsule 11.
- the part other than the object to be collected such as the cell wall of the cell 4 is lysed, and the genomic DNA 14 is eluted into the gel capsule 11.
- the amplification reagent 15 is added to the tube 9 to carry out a whole genome amplification reaction.
- the gel capsule 11 containing the genomic DNA 14 is collected on the plate 16 and the secondary amplification by the MDA method is performed in the well of each plate 16.
- the production device 18 includes a droplet production unit 19 that encloses one cell 4 in the microdroplets 3 by the microchannel 2, and the generated microdroplets 3 are housed in the tube 9.
- the manufacturing apparatus 18 includes a gel capsule generation unit 20 that gels the fine droplets 3 to generate a gel capsule 11, and the gel capsule generation unit 20 can cool the fine droplets 3 in a state of being housed in the tube 9.
- the manufacturing apparatus 18 includes a dissolving reagent immersion unit 23 in which the lytic reagent 13 is injected into the tube 9 containing the gel capsule 11 and the gel capsule 11 is immersed in the lytic reagent 13. Further, the manufacturing apparatus 18 includes a removing unit 25 having a centrifugal cleaning unit 26 for removing contaminants including oil 10 and lytic reagent 13 from the gel capsule 11.
- the production apparatus 18 includes an amplification reagent dipping unit 27 for immersing the genomic DNA 14 held in the gel capsule 11 in the amplification reagent 15, and the amplification reagent 15 is an amplification reagent injection unit 28. Is injected into the tube 9 from.
- the production device 18 includes a sorting unit 29 that sorts gel capsules 11 that retain the genomic DNA 14 amplified above a predetermined level.
- the sorting unit 29 sorts the gel capsule 11 having the flow cytometer 30 and holding the genomic DNA 14 amplified more than a predetermined value, and collects it on the plate 16.
- the gel capsule 11 that does not retain the genomic DNA 14 amplified above a predetermined level is collected in another container 31.
- FIG. 7 shows an overall view of a method for screening amplified DNA based on sequence.
- the amplified DNA is screened prior to whole-genome sequencing and / or after full-genome sequencing. Screening (wet) prior to whole-genome sequencing is performed using a portion of the amplified DNA sample and involves experiments such as sequencing and agarose gel electrophoresis. Screening (dry) after decoding the entire genome sequence targets digital sequence data and does not involve actual experiments.
- FIG. 8 shows a schematic diagram of performing the steps for preparing amplified DNA. DNA derived from a single biological unit by encapsulating the sample in a droplet one by one, gelling the droplet to generate a gel capsule, and dissolving the single biological unit in the gel capsule with a solubilizing reagent.
- FIG. 9 shows a schematic diagram of wet screening. Experiments such as sequencing and agarose gel electrophoresis will be performed using a portion of the amplified DNA sample. A target sample can be screened from an infinite number of samples based on the presence or absence of a specific gene sequence, the amount of a specific gene, the yield of amplified DNA, and the like.
- FIG. 10 is a schematic diagram of the sequence determination after selection.
- FIG. 11 is a schematic diagram showing a dry screening step.
- FIG. 12 is a diagram showing the completion rate and the contamination rate of the entire genome sequence for each sample derived from bacteria. CheckM was used to evaluate the genome decoding rate (complete rate) and the degree of contamination.
- FIG. 13 is an electrophoretic image of the genomic data of the target bacterium. The rightmost lane is a PC using Escherichia coli, and the 4, 19, and 20th lanes from the left except for the marker are derived from bacteria.
- cell refers to a particle that contains a molecule that carries the genetic information and is any particle that can be replicated (whether or not it is possible alone).
- the term “cell” as used herein includes cells of unicellular organisms, bacteria, cells derived from multicellular organisms, fungi and the like.
- cell-like structure refers to any particle containing a molecule having genetic information.
- cell-like structures include organelles such as mitochondria, cell nuclei, and chloroplasts, and viruses.
- the "single biological unit” refers to a unit having genetic information or other biomolecular information.
- a single biological unit may include cells, cell-like structures, etc., but is not limited to these, including artificially produced cells (so-called artificial cells) and digital cells (provided as information).
- a “single biological unit” refers to a unit having a structure corresponding to structural information and can be a tangible (in the case of wet treatment) or an intangible concept (in the case of dry treatment). ..
- genetic information or other biomolecule information refers to information that defines a biomolecule or an analog thereof. Genetic information or other biomolecule information may include, but is not limited to, structural information of nucleic acids, amino acids, lipids or sugar chains or their analogs, but is not limited to in vivo molecules such as metabolites or their analogs. It can also include information on the diversity of body interactions.
- genetic information or other biomolecule information refers to a structure that corresponds to genetic information or other biomolecular information.
- genetic information is also referred to as "nucleic acid information”, and both are synonymous.
- biomolecule refers to a molecule possessed by any organism or virus.
- In vivo molecules can include nucleic acids, proteins, sugar chains, lipids, and the like.
- biomolecular analog refers to a natural or non-natural variant of a biomolecule.
- Analogs of in vivo molecules can include modified nucleic acids, modified amino acids, modified lipids or modified sugar chains.
- aggregate refers to an aggregate containing two or more single biological units, cells or structures for cells.
- subset when used in conjunction with a “set,” refers to a portion of a set that has a smaller number of single biological units, cells or cell structures.
- gel refers to a colloidal solution (sol) in which a polymer substance or colloidal particles interact with each other to form a network structure as a whole and contain a large amount of a liquid phase as a solvent or a dispersion medium. A state in which fluidity is lost.
- gelling means changing a solution into a “gel” state.
- the "gel capsule” refers to a gel-like fine particle structure capable of holding a cell or a cell-like structure therein.
- gene analysis means examining the state of nucleic acids (DNA, RNA, etc.) in a biological sample.
- the gene analysis can include those that utilize a nucleic acid amplification reaction.
- Examples of gene analysis including these include sequencing, genotyping / polymorphism analysis (SNP analysis, copy number polymorphism, restriction enzyme fragment length polymorphism, repeat number polymorphism), expression analysis, fluorescence quenching probe ( Quenching Probe: Q-Probe), SYBR green method, melting curve analysis, real-time PCR, quantitative RT-PCR, digital PCR and the like can be mentioned.
- single biological unit level refers to genetic information contained in one single biological unit or information on other biomolecules, as opposed to genetic information contained in another single biological unit or other information. It refers to processing in a state that can be distinguished from the information of biomolecules.
- single cell level refers to genetic information contained in one cell or cell-like structure or information on other biomolecules, as opposed to genetic information contained in another cell or cell-like structure. Or, it means that the processing is performed in a state of being distinguished from the information of other biomolecules. For example, when amplifying a polynucleotide at the "single biological unit level” or “single cell level”, the polynucleotide in one single biological unit or cell or cell-like structure, and another single organism, respectively. Each amplification takes place with the polynucleotides in the unit, or other cell or cell-like structure, distinguishable.
- single biounit analysis refers to genetic information or other biomolecule information contained in one single biological unit (eg, cell or cell-like structure) as another single organism. It refers to analysis in a state of being distinguished from genetic information contained in a unit (for example, a cell or a cell-like structure) or information on other biomolecules.
- single cell analysis refers to genetic information or other biomolecule information contained in one cell or cell-like structure, and genetic information or other information contained in another cell or cell-like structure. It refers to analysis in a state that is distinguished from the information on biomolecules.
- genetic information refers to information on a nucleic acid encoding a gene or other information contained in one cell or cell-like structure, and refers to the presence or absence of a specific gene sequence, the yield of a specific gene, or the total nucleic acid. Including yield.
- biomolecule information refers to a biomolecule contained in one cell or cell-like structure (in addition to nucleic acid, proteins, sugars, lipids and the like are also included in addition to nucleic acid) or the like. Refers to information on analogs, including the presence or absence of structure or sequence of a particular biomolecule, structural or sequence identity, yield of a particular biomolecule and yield of all biomolecules.
- nucleic acid information refers to information on nucleic acids contained in one cell or cell-like structure, and includes the presence or absence of a specific gene sequence, the yield of a specific gene, or the total nucleic acid yield.
- identity refers to the structural or sequence similarity between two biomolecules. If the subject is a sequence, identity can also be determined by comparing the positions in each sequence that can be aligned for comparison.
- the present disclosure generally comprises at least one single biological unit from a set containing two or more single biological units, based on the genetic information of the single biological unit or other biomolecular information.
- a method for producing a subset containing a single biological unit which comprises the step of producing a subset containing.
- a single biological unit can be a cell or cell-like structure, in which case the disclosure is based on the nucleic acid sequence of the cell or cell-like structure from a collection comprising two or more cells or cell-like structures.
- Provide a method of producing a subaggregate containing a cell or cell-like structure comprising the step of producing a subaggregate containing at least one cell or cell-like structure.
- This method may be performed wet, dry (information processing), or both.
- subsets are generated from the set obtained at the single biological unit (single cell in the case of cells) level obtained based on a specific sequence or other structural information to streamline further analysis. Can be transformed into. It will be described individually below.
- screening refers to an experiment involving physical manipulation, that is, screening using, for example, at least a part of a biomolecule. Screening (wet) does not cover digital biomolecular data. Screening prior to analysis of genetic information or other biomolecule information (eg, omics analysis) allows only the sample of interest to be analyzed, leading to a reduction in time and cost required for the experiment. Screening (wet) may be performed before or after analysis of the genetic information or other biomolecules (eg, omics analysis).
- Screening may be any screening using a part of biomolecules.
- the biomolecule may be a nucleic acid, protein, amino acid, sugar chain, lipid or the like.
- screening can be performed based on the presence or absence of a specific gene sequence, the yield of a specific gene sequence, the yield of total DNA, and the like.
- the present disclosure A) provides each of two or more single biological units (eg, cells or cell-like structures) separately, and B) said separately provided 2 Selection of one or more single biological units (eg, cells or cell-like structures) based on genetic information or other biomolecule information derived from the single biological unit (eg, cells or cell-like structures) Provided is a method comprising the steps of C) analyzing the selected single biological unit (eg, cell or cell-like structure), if desired.
- step A) encloses one single biological unit (eg, a cell or cell-like structure) in a droplet using (a) a sample containing two or more cells or components.
- the polynucleotide in the component is eluted in the gel capsule and retained in the gel capsule with the substance binding to the polynucleotide removed, and (d) the polynucleotide is brought into contact with the amplification reagent. Amplification of the polynucleotide in the gel capsule may be included.
- the step of contacting the polynucleotide with an amplification reagent to amplify the polynucleotide in a gel capsule can also amplify the polynucleotide while maintaining a gel state in the gel capsule. ..
- the droplet is a single organism by flowing one single organism unit (eg, a cell or cell-like structure) into a microchannel and shearing the suspension with oil. It can be made by encapsulating a unit (eg, a cell or cell-like structure).
- the gel capsule may be a hydrogel capsule.
- the disclosure A) presents genetic information or other biomolecule information from two or more single biounits (eg, cells or cell-like structures) to the single biounit (eg, cell or cell-like structure). , Cells or cell-like structures) as a set of genetic information or other biomolecular information, and B) the nucleic acid based on all or part of the genetic information or other biomolecular information.
- a method comprising a step of analyzing genetic information or other biomolecular information in a cell-like structure) is provided.
- the step of separately providing each of two or more single biological units is carried out, for example, by the technique using gel encapsulation described herein. can do.
- genetic information or other biomolecule information is selected from the group consisting of nucleic acid information, protein information, lipid information and sugar chain information.
- the genetic information or other biomolecule information is nucleic acid information.
- nucleic acid information is selected from the presence or absence of a particular gene sequence, the yield of a particular gene, or the total nucleic acid yield.
- a single biological unit (eg, a cell or cell-like structure) may be selected in the absence of a particular gene sequence, or a single biological unit (eg, in the absence of a particular gene sequence).
- Cells or cell-like structures may be selected.
- a single biological unit (eg, a cell or cell-like structure) may be selected if the yield of a particular gene is greater than the baseline yield, or a single biological unit (eg, a cell or cell-like structure). For example, cells or cell-like structures) may be selected.
- a single biological unit eg, a cell or cell-like structure
- a single biological unit eg, cell or cell-like structure
- Cells or cell-like structures may be selected.
- a reagent for specifically detecting the presence or absence of a specific gene sequence, a molecular weight measuring means (agarose gel electrophoresis, microchip electrophoresis), a gene amplification method (PCR, qPCR), gene sequencing (Sanger sequencing, NGS) by means selected from the group.
- reagents that specifically detect a particular gene sequence include antibodies, probes, DNA-binding fluorescent dyes, fluorescent dye-binding nucleotides.
- the yield of a specific gene or the total nucleic acid yield can be measured by absorbance measurement, fluorescence measurement, agarose gel electrophoresis, or microchip electrophoresis.
- sorting is performed by first dispensing gel capsules containing amplified polynucleotides onto plates using flow cytometry, a continuous automatic dispenser, a microfluidic device, and then from the polynucleotides of each sorted gel capsule.
- a specific gene is amplified by PCR or the like, and the gene sequence is determined by Sanger sequence or NGS or the molecular weight is determined by electrophoresis or absorbance / fluorescent nucleic acid quantification.
- nucleic acid information two or more separately provided single biomolecules (eg, cells or cell-like structures) are referred to as nucleic acid information or nucleic acid information derived from the single biounit (eg, cells or cell-like structures).
- the step of selecting based on the information of other biomolecules is to screen using, for example, a probe capable of detecting a specific sequence (for example, a probe capable of recognizing 18S or other specific gene products). Can go and carry out.
- the genetic information or other biomolecule information is protein information.
- protein information is selected from total protein amount, specific protein amount, or presence or absence of specific protein.
- the protein may be whole or partial (eg, subunit, domain).
- the protein information may be information about the primary, secondary, tertiary or quaternary structure of the protein.
- a single biological unit (eg, a cell or cell-like structure) may be selected if a particular protein is present, otherwise a single biological unit (eg, a cell or cell-like structure) may be selected. You may select the thing).
- a single biological unit (eg, a cell or cell-like structure) may be selected if the total protein content is greater than the baseline yield, or a single biological unit (eg, cell or cell-like structure) if lower. Cells or cell-like structures) may be selected.
- a single biological unit eg, a cell or cell-like structure
- a single biological unit eg, cell or cell-like structure
- Cells or cell-like structures may be selected.
- the presence or absence of a specific protein can be detected by means of antibodies, peptides, nucleic acids and the like.
- total protein content or specific protein content can be detected using means such as protein concentration measuring means (BCA assay, Bradford, ELISA), nucleic acid amplification and the like.
- sorting begins by first sorting the gel capsules into plates with flow cytometry, a continuous automatic dispenser, a microfluidic device. Furthermore, a specific protein is extracted from each of the separated gel capsules. Using a part of this protein, the total amount of protein by protein concentration measurement or specific protein detection using antibody or diffusion is performed to evaluate the presence or absence of the specific protein. With reference to the result, the sample is selected and transferred to another plate or the like.
- the genetic information or other biomolecule information is sugar chain information.
- the sugar chain information is selected from the presence or absence of sugar chains, the amount of specific sugar chains or the amount of total sugar chains. In a particular embodiment, it may be the whole sugar chain or a part of it. In one embodiment, the sugar chain information can be detected by any means.
- the genetic information or other biomolecule information is lipid information.
- the lipid information is selected from the presence or absence of lipids, the amount of specific lipids or the amount of total lipids. In certain embodiments, it may be whole or part of the lipid. In one embodiment, lipid information can be detected by any means.
- a single biological unit (eg, a cell or cell-like structure) may be selected using multiple genetic information or other biomolecular information.
- the selection may be performed multiple times and the genetic information or other biomolecule information used in each selection may be the same or different.
- a step of analyzing the selected single biological unit can be carried out, and for example, it can be analyzed by a gene analysis method.
- the analysis of a single biological unit is an arbitrary omics analysis (eg, genome analysis, proteomics analysis, transcriptome analysis, glycome analysis, lipidome analysis or metabolome analysis). ) May be.
- the information obtained from the analysis may be used to create a data library. In other embodiments, the analysis may be followed by an additional selection and analysis.
- digital biomolecule data can be obtained by analysis.
- the digital biomolecular data may be genomic information, transcriptome information, proteome information, glycome information or lipidome information.
- the technique of the present disclosure can be used for analysis of sub-strains.
- the purpose was to obtain genomic data of one or more specific microorganisms of interest to those skilled in the art among animal symbiotic microorganisms such as gut flora and marine / soil microorganisms, they were amplified with gel capsules.
- By confirming the presence or absence of the target gene fragment in advance for the polynucleotide it is possible to reduce the cost required for acquisition of unnecessary gene sequence data and data analysis.
- gene sequence data can be acquired in a single biological unit, and by mutual comparison of mutation sites, sub-strains can be identified and their diversity. Evaluation is possible. For example, it can be used for gene mutation analysis of pathogens and search for high-producing strains of industrial enzymes.
- the number occupied in the sample becomes clear. Furthermore, by acquiring gene sequence data for each single organism and performing comparative genome analysis such as storage of metabolic pathways, genomic identity, and evolutionary phylogenetic classification, differences in microorganisms can be clarified, and diversity of host samples can be obtained. And analyze the relationship with the background information of the sample.
- the sample may be feces, saliva, sputum or skin, oral cavity, nasal cavity, ears, genital lavage, surgical cleaning solution, tissue extract or blood of a specific disease patient, and microorganisms contained in the sample. It is assumed that it will be analyzed.
- This disclosure is for detecting a target in a sample in which cells and organelles derived from multiple organisms are mixed. It can be applied.
- the analysis sample is feces, saliva, sputum or skin, oral cavity, nasal cavity, ears, genital lavage fluid, surgical cleaning solution, tissue extract or blood, and the microorganisms contained in the sample are analyzed. Contains cells, intracellular small organs, and nucleic acids from many host animals in the sample. Some of these can also be encapsulated inside the gel capsule to perform polynucleotide amplification.
- Stepwise detection of a target from a sample containing a mixture of cells and organelles derived from multiple organisms This disclosure describes a target from a sample containing a mixture of cells and organelles derived from multiple organisms. It can be applied to stepwise detection. Analysis samples include feces, saliva, sputum and skin, oral cavity, nasal cavity, ears, genital lavage fluid, surgical cleaning fluid, tissue extract and blood, or crushed fluid of plants, insects, and animals containing symbiotic microorganisms. , It is assumed that both the microorganism and the host cell contained in the sample are to be analyzed.
- each gel capsule is encapsulated with host-derived cells, organelles, nucleic acids, and nucleic acids derived from symbiotic microorganisms. All of these can be encapsulated inside the gel capsule and polynucleotide amplification can be performed. Therefore, by stepwise detecting and selecting gene fragments derived from the target host and gene fragments derived from microorganisms in the gel capsule containing the amplified polynucleotide, only the gene sequence data to be analyzed can be specifically detected. You can get it and reduce the cost of it. For example, the reference gene detection is repeated a plurality of times, and a sample is selected as needed.
- a gene fragment derived from a microorganism is amplified and detected in a gel capsule with respect to the residual sample, and then selected as necessary.
- the order after the second time can be changed as needed.
- the target may be a combination of two or more microorganisms or host-derived substances.
- the present disclosure is also applicable to evaluation of preservation of specific species.
- the specified organism contains an amplified polynucleotide by using the disclosed technology.
- the content rate can be shown by detecting and selecting from the gel capsule.
- it is possible to evaluate the degree of coincidence with the standard at the genome level, preservation, and the like. It is expected to be used for quality assurance of microbial preparations.
- the present disclosure provides a dry (in silico) method of producing a subset containing a single biological unit.
- Screening (dry) refers to screening using digital biomolecule data performed after analysis of genetic information or other biomolecule information (eg, omics analysis). Screening (wet) targets digital sequence data. Screening after analysis of genetic information or other biomolecules can reduce the time required for experiments because more samples can be screened in a shorter amount of time.
- the digital biomolecule data used in the present disclosure may be genomic information, proteome information, glycome information or lipidome information.
- the disclosure A) presents genetic information or other biomolecule information from two or more single biounits (eg, cells or cell-like structures) to the single biounit (eg, cell or cell-like structure). , Cells or cell-like structures) as a set of genetic information or other biomolecular information, and B) the inheritance based on all or part of the genetic information or other biomolecular information.
- a method including a step of analyzing information.
- A) genetic information or other biomolecule information derived from two or more single biological units is presented to the single biological unit (eg, cells or cell-like).
- the step of providing as a set of genetic information or other biomolecule information for each structure is carried out by separately providing two or more single biological units to obtain genetic information or other biomolecule information. It can be performed, for example, by encapsulating each of two or more single biological units and analyzing the genetic information or other biomolecule information in each capsule.
- the step of separately providing each of two or more single biological units is carried out, for example, by the technique using gel encapsulation described herein. can do.
- the single biological unit may be a cell or cell-like structure or the like, or may be cell information such as a digital cell.
- the cell information may be artificially designed or digitized information of natural cells or cell-like structures.
- the genetic information or other biomolecule information is digital information.
- the genetic information or other biomolecule information is information obtained by any omics analysis (eg, genome analysis, proteome analysis, transcriptome analysis, glycome analysis, lipidome analysis or metabolome analysis). There may be.
- the genetic information or other biomolecule information may be from cells or cell-like structures, or may be artificially designed.
- genetic information or other biomolecule information is selected from the group consisting of nucleic acid information, protein information, lipid information and sugar chain information.
- step A) involves sequencing nucleic acids from a single biological unit (eg, a cell or cell-like structure) to obtain nucleic acid information.
- step A) uses a detection molecule for a protein, sugar chain or lipid derived from a single biological unit (eg, cell or cell-like structure) to provide protein information, sugar chain information or lipid. Including getting information.
- B) genetic information or other biomolecular information is provided for each single biological unit (eg, cell or cell-like structure) based on all or part of the genetic information or other biomolecular information.
- the step of sorting can be carried out, for example, based on the identity of genetic information or other biomolecular information.
- the genetic information or other biomolecule information can be nucleic acid information.
- nucleic acid information is selected from the presence or absence of a particular gene sequence, the amount of a particular gene or the identity with a particular gene sequence, or a combination thereof.
- the genetic information or other biomolecule information may be a contig produced by assembling sequence data.
- the genetic information or other biomolecule information may be the genome decoding rate (complete rate) and the degree of contamination calculated from Contig.
- step B) comprises assessing the presence or absence of a particular gene sequence and / or identity with a particular gene sequence.
- identity with a particular gene sequence can be assessed using BLAST, DIAMOND, BWA, bowtie2, hmmer.
- step B) may sort nucleic acid information by single biological unit (eg, cell or cell-like structure) based on the presence or absence of a particular gene sequence.
- step B) provides nucleic acid information based on the identity of a particular gene sequence with nucleic acid information derived from two or more single biological units (eg, cells or cell-like structures). It may be sorted by 3 single biological units (eg, cells or cell-like structures).
- the identity is 50% or higher, 55% or higher, 60% or higher, 65% or higher, 70% or higher, 75% or higher, 80% or higher, 85% or higher, 90% or higher, 91% or higher, It may be 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, 100%.
- the identity is 50% or less, 45% or less, 40% or less, 35% or less, 30% or less, 25% or less, 20% or less, 15% or less, 10% or less, 9% or less, It may be 8% or less, 7% or less, 6% or less, 5% or less, 4% or less, 3% or less, 2% or less, 1% or less, 0%.
- step B) includes evaluating the presence or absence of a specific amino acid sequence or the like.
- step B) includes evaluating the presence or absence of a specific sugar chain or the like. In one embodiment, step B) comprises assessing the presence or absence of a particular lipid or the like.
- the samples may be selected by comparing the contigs between the samples. In one embodiment, selection may be performed using the genome decoding rate (complete rate) and the degree of contamination. In some embodiments, the genome decoding rate (complete rate) and the degree of contamination may be evaluated using CheckM.
- the complete rates are 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95. %, 96%, 97%, 98% or 99% or more samples may be selected. In a preferred embodiment, samples with a completion rate of 90% or more may be selected.
- samples with a contamination rate of 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2% or 1% or less may be selected. In a preferred embodiment, samples having a contamination rate of 5% or less may be selected.
- a step of analyzing the selected genetic information or information of other biomolecules can be performed, and this step can be performed by, for example, a search engine such as blast or an analysis web such as Ensembl.
- assembly evaluation tools such as QUAST and CheckM, annotation tools such as Prokka, InterProScan, and DFAST, and metabolic / physiological function potential evaluation systems such as MetaCyc and MAPLE can be used.
- QUAST and CheckM assembly evaluation tools
- annotation tools such as Prokka, InterProScan, and DFAST
- metabolic / physiological function potential evaluation systems such as MetaCyc and MAPLE
- the genes in the genome are identified, and the conservativeness as a metabolic pathway is evaluated by MAPLE.
- the conservativeness and identity of each gene will be evaluated, and comparative genome analysis with related species will be performed.
- the analysis involves clustering based on genetic information or other biomolecular information, searching for markers, comparative analysis of identical strains of microorganisms (eg, analysis of subspecies in a group of microbial strains related to a disease or the like).
- Search for microorganisms having a specific gene for example, secondary metabolites and enzymes produced by microorganisms
- analysis of individually selected bacteria, archia, fungi, other eukaryotic cells, etc. from among various biological species Includes detection of microorganisms from human-derived samples (eg, search for pathogenic microorganisms in blood and sputum and analysis of microorganisms that coexist inside tissues).
- the number occupied in the sample becomes clear. Furthermore, by acquiring gene sequence data for each single organism and performing comparative genome analysis such as storage of metabolic pathways, genomic identity, and evolutionary phylogenetic classification, differences in microorganisms can be clarified, and diversity of host samples can be obtained. And analyze the relationship with the background information of the sample.
- the sample may be feces, saliva, sputum or skin, oral cavity, nasal cavity, ears, genital lavage, surgical cleaning solution, tissue extract or blood of a specific disease patient, and microorganisms contained in the sample. It is assumed that it will be analyzed.
- the characteristics of the sample when analyzing the microbial diversity, for example, as an example of analyzing the microbial flora in feces, proceed with the analysis as in Examples 1 to 3 below.
- the characteristics of individual specimens can be known by estimating the lineage of intestinal bacteria in the 1-cell amplified genomic library, analyzing the diversity, and comparing them.
- DPBS phosphate buffered saline
- the supernatant was filtered using a filter having a diameter of 5 ⁇ m (SMWP04700, Sigma-Aldrich) and then centrifuged at 10,000 ⁇ g for 5 minutes (75004263, Thermo Fisher Scientific) to remove the supernatant.
- the pellets are resuspended in 10 mL PBS, dispensed in 1 mL each in a 1.5 mL tube (MCT-150-C, Axygen), and then centrifuged at 10,000 xg for 5 minutes to collect soil bacteria.
- Bacteria Bacterial pellets were combined into a single 1.5 mL tube, washed twice by centrifugation with PBS, and then suspended in PBS to obtain a cell suspension of soil bacteria.
- the cell concentration in the prepared cell suspension was measured (microscope: CKX41, OLYMPUS, bacterial calculator A161,2-5679-01, AS ONE), and ultra-low melting point agarose (A5030) was adjusted to a final concentration of 1.5%.
- -10G, Sigma-Aldrich was added to prepare a soil bacterial suspension used for gel capsule preparation (cell final concentration: 1.5 ⁇ 10 3 cells / ⁇ L). Subsequently, the analysis can proceed in the same procedure as the flow described in Examples 1 to 3.
- a microbial suspension For aquatic microorganisms, prepare a microbial suspension according to the following procedure. After that, the work is performed in the same operation as in Examples 1 to 3. In the experiment, 4 L of seawater or fresh water was collected in a sterilized plastic tank, filtered using a 5 ⁇ m diameter filter (SMWP04700, Sigma-Aldrich), and then filtered through a 0.22 ⁇ m diameter filter (GSWP04700, Sigma-Aldrich). By doing so, the bacterial fraction was trapped on the filter.
- SSWP04700 5 ⁇ m diameter filter
- GSWP04700 Sigma-Aldrich
- a 0.22 ⁇ m diameter filter is placed in a 25 mL tube (2362-025, Iwaki) containing 10 mL of Phosphate Buffered Saline (DPBS) (Dulbecco's Phosphate-Buffered Saline, 14190-144, Thermo Fisher Scientific). , Suspended well. Bacteria derived from seawater or freshwater are collected by dispensing 1 mL of a 10 mL bacterial suspension into a 1.5 mL tube (MCT-150-C, Axygen) and centrifuging at 10,000 xg for 5 minutes. Bacteria.
- DPBS Phosphate Buffered Saline
- Bacterial cell suspensions derived from seawater or freshwater are obtained by collecting the bacterial cell pellets in a single 1.5 mL tube, washing them by centrifugation twice with PBS, and then suspending them in PBS. did.
- the cell concentration in the prepared cell suspension was measured (microscope: CKX41, OLYMPUS, bacterial calculator A161,2-5679-01, AS ONE), and ultra-low melting point agarose (A5030) was adjusted to a final concentration of 1.5%.
- -10G, Sigma-Aldrich was added to prepare seawater or freshwater-derived bacterial suspensions used for gel capsule preparation (cell final concentration: 1.5 ⁇ 10 3 cells / ⁇ L). Subsequently, the analysis can proceed in the same procedure as the flow described in Examples 1 to 3.
- the analysis is carried out as in Examples 1 to 3, and as shown in Table 1, the lineage of intestinal bacteria in the 1-cell amplified genomic library is estimated.
- Table 1 the lineage of intestinal bacteria in the 1-cell amplified genomic library is estimated.
- BLAST homology search in BLAST, the presence of microorganisms classified into Lachnospiraceae (Lachnospiraceae) and Bacteroides (Bacteroides) is specifically detected.
- Specific procedures include (1) homology search of single organism-derived gene sequences using BLAST and hmmer, or (2) mapping of single-organism-derived sequence data using BWA and bowtie2. To evaluate the homology between a single organism-derived gene sequence and a target gene sequence, and screen samples carrying a specific gene.
- a homology search for a single organism-derived gene sequence is performed based on a gene that metabolizes dietary fiber inulin or a gene marker that identifies the microbial Bacteroides species.
- the microorganisms and gene groups responsible for the degradation of the dietary inulin could be identified, and their functions could be estimated from the homology of known genes and the prediction of the three-dimensional structure based on the amino acid sequence.
- This disclosure can also be applied to evaluation of gene mutation in single cell unit. Mutational diversity on the genome sequence can be evaluated on a single cell basis to track the genomic heterogeneity of cells in the sample and the development and progression of mutant lines. By selectively amplifying and detecting the target gene mutation site of the target cell for the gel capsule containing the amplified polynucleotide, only the gene sequence data to be analyzed can be specifically acquired, and the cost for it can be reduced. can do. It can be used for cancer evolution analysis, detection of drug-resistant mutations, and detection of gene-mutated microorganisms and virus strains.
- a homology search for a single organism-derived gene sequence is performed based on a gene that metabolizes dietary fiber inulin or a gene marker that identifies the microbial Bacteroides species.
- a gene that metabolizes dietary fiber inulin or a gene marker that identifies the microbial Bacteroides species.
- Detection of coral coexisting microorganisms Contains 5 mL of seawater obtained by collecting 1.5 cm coral branches (obtained from Ishikawara in the sea area around Sesoko, Motobu-cho, Kunigami-gun, Okinawa) and filtering with a 0.22 ⁇ m diameter filter (DURAPORE membrane filter, GVW P04700, MERCK). It was collected in a 25 mL tube (2 362-025, IWAKI). After sufficiently crushing the coral branches using a scalpel (replacement blade scalpel holder (61-3813-28), replacement blade No. 10 (1-8545-11), AS ONE)), leave it on ice for 3 minutes. Then, large particles such as bone fragments were precipitated.
- a scalpel replacement blade scalpel holder (61-3813-28), replacement blade No. 10 (1-8545-11), AS ONE
- the supernatant was collected in a 1.5 mL tube (122-10, SSIbio) and centrifuged at 8,000 xg for 5 min (himac CF15RX, Koki Holdings). The supernatant was removed leaving the pellets, and 800 ⁇ L of seawater filtered through a 0.22 ⁇ m diameter filter (DURAPORE membrane filter, GVWP04700, MERCK) was added to suspend the pellets again. Next, 250 xg was centrifuged for 5 minutes, and the supernatant was collected in a new 1.5 mL tube.
- DURAPORE membrane filter GVWP04700, MERCK
- the concentration of bacterial cells in the prepared suspension was measured (microscope: CKX41, OLYMPUS, bacterial calculator A161,-5679-01, AS ONE), and ultra-low melting point agarose (A5030) was adjusted to a final concentration of 1.5%.
- -10G, SIGMA-ALDRICH was added to prepare a mixed suspension of cells and cell-like structures used for gel capsule preparation (final bacterial cell concentration: 4.5 ⁇ 10 3 cells / ⁇ L). Subsequently, the process proceeds according to the method described in Examples 1 to 3. Subsequently, the following processing is performed.
- nuclease-free water UltraPureDNase / RNase-Free Distilled Water, 10977-015, Thermo Fisher Scientific
- 1 ⁇ L of the DNA amplification product in the library master plate was added to the library master plate.
- a 40-fold diluted solution was prepared.
- the DNA concentration was quantified by a Qubit fluorometer (Q33226, Thermo Fisher Scientific) and a Qubit dsDNA HS Assay Kit (Q32854, Thermo Fisher Scientific) using 1 ⁇ L of the diluent.
- PCR was performed on the V3V4 region of the 16S rRNA gene using 1 ⁇ L of the diluted solution as a template (6.25 ⁇ L PrimeSTAR Max DNA Polymerase (R045B, Takara Bio), 0.5 ⁇ L 10 ⁇ M Primer Forward (5).
- '-TCGTCGGCAGGCCGTCAGATAGTGTAGTAAGAGACAGCCTACGGGGNGNGGCWGCAG-3'(SEQ ID NO: 1) 0.5 ⁇ L 10 ⁇ M Primer Revere (5'-GTCTCGTGGGCTCGAGTAGGAGT RNase-Free Distilled Water (10977-015, ThermoFisher Scientific) (S1000 Thermal Cycler, Bio-Rad).
- PCR reaction conditions are 95 ° C.
- Stepwise detection of a target from a sample containing a mixture of cells and organelles derived from multiple organisms This disclosure describes a target from a sample containing a mixture of cells and organelles derived from multiple organisms. It can be applied to stepwise detection. Analysis samples include feces, saliva, sputum and skin, oral cavity, nasal cavity, ears, genital lavage fluid, surgical cleaning fluid, tissue extract and blood, or crushed fluid of plants, insects, and animals containing symbiotic microorganisms. , It is assumed that both the microorganism and the host cell contained in the sample are to be analyzed.
- each gel capsule is encapsulated with host-derived cells, organelles, nucleic acids, and nucleic acids derived from symbiotic microorganisms. All of these can be encapsulated inside the gel capsule and polynucleotide amplification can be performed. Therefore, by stepwise detecting and selecting gene fragments derived from the target host and gene fragments derived from microorganisms in the gel capsule containing the amplified polynucleotide, only the gene sequence data to be analyzed can be specifically detected. You can get it and reduce the cost of it. For example, the reference gene detection is repeated a plurality of times, and a sample is selected as needed.
- a gene fragment derived from a microorganism is amplified and detected in a gel capsule with respect to the residual sample, and then selected as necessary.
- the order after the second time can be changed as needed.
- the target may be a combination of two or more microorganisms or host-derived substances. Specifically, there is a method such as repeating the procedure shown in Application Example 5.
- the present disclosure is also applicable to evaluation of preservation of specific species.
- the purpose was to prove or reject a specific species of drug, pesticide, food, etc.
- a specific organism can be detected and selected from a gel capsule containing an amplified polynucleotide, and the content rate can be shown.
- the degree of coincidence with the standard at the genome level, preservation, and the like. It is expected to be used for quality assurance of microbial preparations.
- the abundance ratio of the target bacterium may be evaluated by the procedure shown in the examples.
- the technique of the present invention can be used for analysis of sub-strains.
- the purpose was to obtain genomic data of one or more specific microorganisms of interest to those skilled in the art among animal symbiotic microorganisms such as gut flora and marine / soil microorganisms, they were amplified with gel capsules.
- By confirming the presence or absence of the target gene fragment in advance for the polynucleotide it is possible to reduce the cost required for acquisition of unnecessary gene sequence data and data analysis.
- gene sequence data can be acquired in a single biological unit, and by mutual comparison of mutation sites, sub-strains can be identified and their diversity. Evaluation is possible. For example, it can be used for gene mutation analysis of pathogens and search for high-producing strains of industrial enzymes.
- the following procedure can be used for analysis of human intestinal flora composition.
- Human feces were collected in a stool collection container (FS-0007 or FS-0008, Technosurgarabo).
- the preservation solution was removed, and the container was washed once with 1000 ⁇ L of DPBS.
- Frozen stool in 1.5 ml tube was naturally thawed by placing it on ice for 30 minutes. Fresh stools that do not contain a preservative solution are not treated before crushing.
- DPBS Phosphate Buffered Saline
- the cell concentration in the prepared cell suspension was measured (microscope: CKX41, OLYMPUS, bacterial calculator A161,2-5679-01, AS ONE), and ultra-low melting point agarose (A5030) was adjusted to a final concentration of 1.5%.
- -10G, SIGMA-ALDRICH an intestinal microbial suspension used for gel capsule preparation was prepared (cell final concentration: 1.5 ⁇ 10 3 cells / ⁇ L).
- microdroplets were prepared and human intestinal microbial cells were encapsulated in the microdroplets.
- a microchannel consisting of a first channel, a second channel, a third channel, and a fourth channel, in which adjacent channels are arranged at right angles, is used, but they are connected in a substantially T shape. It is also possible to use a microchannel.
- the microchannel of this example used had a width of 34 ⁇ m and a height of 50 ⁇ m, but the size of the microchannel can be appropriately changed depending on the size of the microdroplets to be produced and the size of one cell to be encapsulated.
- the intestinal microbial suspension was introduced from the first channel (aqueous phase inlet), and Pico-Surf1 (2% in Novec7500) (Sphere Fluidics) from the second channel and the fourth channel (oil phase inlet). ) (Hereinafter referred to as "oil") is introduced to shear the intestinal microbial suspension to prepare fine droplets having a diameter of 50 ⁇ m, and the third flow path 7 is allowed to flow to form a tube having a capacity of 0.2 mL. Collected in. Approximately 450,000 microdroplets were produced at a rate of 500 droplets / second. The cell concentration in the microdroplets is 0.1 cells / droplet.
- the diameter of the microdroplets is made uniform to 50 ⁇ m, so that each cell can be easily encapsulated in the microdroplets.
- the diameter of the microdroplets is, for example, 1 to 250 ⁇ m, preferably 10 to 200 ⁇ m.
- microdroplets and oil are stored in the tube, but the microdroplets have a lighter specific gravity than oil, so they accumulate in the upper layer.
- the tube was cooled on ice for 15 minutes, and microdroplets were gelled with ultra-low melting point agarose.
- the gelled microdroplets are gel capsules. Since the diameter of the microdroplets is 50 ⁇ m, the diameter of the gel capsule is also 50 ⁇ m. The diameter of the gel capsule is preferably 1 to 250 ⁇ m. By making the diameter of the gel capsule uniform, the penetration rate of the lytic reagent described later into each gel capsule can be made more uniform.
- the gel capsule was sequentially immersed in a lytic reagent as a lysis reagent, and a part other than the object to be collected such as a cell wall of a cell was dissolved inside the gel capsule, and genomic DNA was eluted into the gel capsule.
- lysozyme (10 U / ⁇ L) (R1804M, Epicenter), which is one of the lytic reagents, was added to the tube to lyse the cells.
- achromopeptidase (850 U / mL) (015-09951, Fujifilm Wako Pure Chemical Industries, Ltd.), which is one of the lytic reagents, was added to the tube.
- protease K (1 mg / mL) (MC5005, Promega) and sodium dodecyl sulfate (SDS) 0.5% (71736-100ML, SIGMA-ALDRICH), which are one of the lytic reagents, to the tube to add cells.
- the gel capsule was immersed in Buffer D2 (QIAGEN), which is an aqueous solution containing potassium hydroxide, which is one of the lytic reagents, to dissolve the residual components and denature the genomic DNA.
- Buffer D2 QIAGEN
- the lytic test solution used in this example was lysozyme, achromopeptidase, proteinase K, sodium dodecyl sulfate, and Buffer D2.
- Potassium hydroxide is also used in a normal DNA amplification reaction step, but since it also has a lytic effect, it was used as one of the lytic reagents in this example. Since the gel capsule is immersed in the lytic reagent for a short time, the eluted genomic DNA is not discharged from the gel capsule by the lytic reagent and is retained in the gel capsule. In this example, the lytic reagent permeated into the gel capsule is also included in the contaminants.
- a sufficient washing effect can be obtained by sequentially adding lysozyme, achromopeptidase and protease K, adding sodium dodecyl sulfate to lyse the cells, and then performing centrifugation only before adding Buffer D2. ..
- centrifugation may be performed after lysing the cells with each lytic reagent.
- the target genomic DNA can be collected by lysing the cells with a plurality of types of lytic reagents, and the lytic reagent and the poly of the lysed cells can be collected by centrifugation after immersion in the lytic reagent. Contaminants such as components other than nucleotides can be removed, and genomic DNA can be purified without inhibiting the subsequent genomic DNA amplification reaction.
- the amplification reagent was added to the tube containing the gel capsule holding the denatured genomic DNA in the potassium hydroxide solution (Buffer D2), and the gel capsule was immersed in the amplification reagent.
- MDA using phi29 DNA polymerase, which is a strand-substituted DNA synthase.
- the (Multiple Displacement Amplification) method was used.
- the whole genome amplification reaction reagent was immersed in REPLI-g Single Cell Kit (QIAGEN), and the whole genome amplification reaction was carried out for 3 hours (S1000 thermal cycler, Bio-Rad).
- the amplification reagent (REPLI-g Single Cell Kit) contains a component that neutralizes the potassium hydroxide solution (Buffer D2).
- a fluorescent DNA intercalator SYBR Green I nucleic acid gel st ain 10,000 in DMSO, (S7563, Thermo Fisher Scientific)
- BD FACSMelody cell sorter BD Biosciences
- the MDA method (REPLI-g Single Cell Kit, 150345) is used in the wells of each plate. , QIAGEN) was performed to prepare a library master plate containing 10 ⁇ L of DNA amplification product for each well.
- Dispense 39 ⁇ L of nuclease-free water (UltraPure DNase / RNase-Free Distilled Water, 10977-015, Thermo Fisher Scientific) into each well of the new plate, add 1 ⁇ L of the DNA amplification product in the library master plate, and add 1 ⁇ L of the DNA amplification product in the library master plate to the library master plate.
- a 40-fold diluted solution was prepared.
- the DNA concentration was quantified by a Qubit fluorometer (Q33226, Thermo Fisher Scientific), Qubit dsDNA HS Assay Kit (Q32854, Thermo Fisher Scientific) using 1 ⁇ L of the diluent.
- PCR targeting the V3V4 region of the 16S rRNA gene was performed using 1 ⁇ L of the diluted solution as a template (6.25 ⁇ L PrimeSTAR Max DNA Polymerase (R045B, Takara Bio), 0.5 ⁇ L 10 ⁇ M Primer Forward (5'-TCGTCGGCAGCGTCAGGTGTATAAGGCAGCGCAGCGTACAGGTGTATAAGGCAGGCAGGCAGCGAGTGAGCAGCGAGCAGCGAGCGCAGGCAGCGATGTGTATAAGCAGGCAGGCAGCGAGCAGGCAGCGAGCAGCGAGCAGCGAGCAGCGAGCAGCGAGCAGCGAGCAGCGAGCAGCGAGCAGCGAGCAGCGAGCAGCGAGCAGCGAGCAGCGAGCAGCGAGCAGCGAGCAGCGAGCAGCGAGCAGGC '(SEQ ID NO: 1)), 0.5 ⁇ L 10 ⁇ M Primer Reverse (5'-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATCC-3' (SEQ ID NO
- PCR reaction conditions are 95 ° C, 5 minutes for initial thermal degeneration, 9 8 ° C, 10 seconds for thermal degeneration, 51 ° C, 15 seconds for annealing, and 72 for elongation reaction. Performed 27 cycles at °C for 5 seconds, reacted at 72 °C for 5 minutes, and then stored at 4 °C.
- Agalose gel electrophoresis (translocation tank: Mupid-exU, EXU-1, Mupid, marker: GeneRulerTM 1kb DNA Ladder, # After confirming the presence or absence of PCR products by SM0318, Primeras, staining: Midori Green Direct, NE-MG06, Nippon Genetics, loading buffer: 6 ⁇ Loading Buffer, 9157, Takara Bio) (migration conditions: 100V, 15 min), amplification is performed. Sequence analysis was performed on the found samples using the Sanger method (DNA sequence outsourced service of Fasmac Co., Ltd.).
- the evolutionary phylogenetic classification analysis of bacteria was performed from the genomic data of each sample. As a result, it was shown that many data are derived from the phylum Firmicutes, Actinobacteria, Bacteroidetes, and Proteob acteria, which are the preferred species of gut flora. Bacterial species can be identified and counted, and the composition ratio can be calculated by referring to the index related to such phylogenetic classification and the identity of the 16S rRNA gene.
- analyzing the digital sequence information of the bacterium it is possible to analyze the metabolic function of the bacterium, possess a drug resistance gene, analyze a gene mutation, compare with a known bacterium, and compare with another sample.
- This process includes, for example, search engines such as blast, analysis websites such as Ensembl, assembly evaluation tools such as QUAST and CheckM, annotation tools such as Prokka, InterProScan, and DFAST, and metabolism / physiology such as MetaCyc and MAPLE. It can be carried out using a functional potential evaluation system.
- search engines such as blast
- analysis websites such as Ensembl
- assembly evaluation tools such as QUAST and CheckM
- annotation tools such as Prokka, InterProScan, and DFAST
- metabolism / physiology such as MetaCyc and MAPLE.
- the genes in the genome are identified, and the conservativeness as a metabolic pathway is evaluated by MAPLE.
- the conservativeness and identity of each gene will be evaluated, and comparative genome analysis with related species will be performed.
- genomes derived from allogeneic microorganisms based on the single copy marker gene sequences detected by Average Nucleotide Identity, CheckM, and GTDB-tk. Create a genome set containing genetic information derived from a single organism that is presumed to be and genetic information of known microorganisms. Subsequently, differences between genomes such as the presence or absence of a specific gene, a locus, and a mutation in a common gene sequence are identified and extracted by a homology search tool such as BLAST or hmmer. By performing clustering based on characteristic intergenomic differences, classification of allogeneic microorganisms at the strain level or substrain level of homologous microorganisms is performed.
- the disclosure is a device for sorting genetic information or other biomolecular information by cell or cell-like structure, A) derived from two or more cells or cell-like structures.
- a provider that provides information on genetic information or other biomolecules to be used as a set of genetic information or other biomolecule information for each cell or cell-like structure, and B) the genetic information or other biomolecules.
- a sorting unit that sorts the genetic information or other biomolecule information for each cell or cell-like structure based on all or part of the information, and C) the sorted genetic information or, if necessary.
- an apparatus including an analysis unit for analyzing information on other biomolecules.
- genetic information or other biomolecule information is selected from the group consisting of nucleic acid information, protein information, lipid information and sugar chain information. In certain embodiments, the genetic information or other biomolecule information is nucleic acid information. In some embodiments, the donor sequences nucleic acids from cells or cell-like structures to obtain nucleic acid information. In some embodiments, the sorter assesses the presence or absence of a particular gene sequence and / or identity with a particular gene sequence.
- the present disclosure is a program that implements on a computer a method of sorting genetic information or other biomolecular information for each cell or cell-like structure, the method of which is A) two or more cell or cell-like structures.
- a program including a step of analyzing information on other biomolecules is provided.
- genetic information or other biomolecule information is selected from the group consisting of nucleic acid information, protein information, lipid information and sugar chain information. In certain embodiments, the genetic information or other biomolecule information is nucleic acid information. In some embodiments, A) comprises sequencing nucleic acid from a cell or cell-like structure to obtain nucleic acid information. In some embodiments, B) comprises assessing the presence or absence of a particular gene sequence and / or identity with a particular gene sequence.
- the present disclosure is a recording medium containing a program that implements a method for sorting genetic information or other biomolecular information for each cell or cell-like structure on a computer, and the method is A) two or more.
- a recording medium including a step of analyzing selected genetic information or information of other biomolecules.
- genetic information or other biomolecule information is selected from the group consisting of nucleic acid information, protein information, lipid information and sugar chain information.
- the genetic information or other biomolecule information is nucleic acid information.
- A) comprises sequencing nucleic acid from a cell or cell-like structure to obtain nucleic acid information.
- B) comprises assessing the presence or absence of a particular gene sequence and / or identity with a particular gene sequence.
- the disclosure makes use of methods for amplifying polynucleotides in cells.
- This amplification method uses a sample containing two or more single biomolecules (eg, including cells or cell-like structures (including viruses, organs (Mt, Nuc), etc.)) and said the single biounit (eg, including Mt, Nuc).
- Cells or cell-like structures are encapsulated in droplets one by one (eg, cells or cell-like structures), and the droplets are gelled to form gel capsules.
- the polynucleotide or other biomolecule of interest in the structure) is eluted into the gel capsule and retained in the gel capsule with the polynucleotide or other biomolecule of interest removed.
- the step of contacting the polynucleotide with an amplification reagent to amplify the polynucleotide in a gel capsule can also amplify the polynucleotide while maintaining a gel state in the gel capsule.
- the amplification method used in the present disclosure is capable of individually amplifying a genome at the so-called single biological unit (eg, single cell) level or a similar gene assembly or other biomolecular assembly.
- these nucleic acids or other biomolecules can be individually amplified or analyzed, and the amplification or analysis can be achieved in a very simple manner. Therefore, genomic information or other biomolecular information can be obtained at one time for cells in units of 100, 1000, 10,000, 100,000 or more, and therefore, it is used as a library. It can also be done.
- any embodiment detailed in the following (droplet generation) section or other sections can be adopted.
- the cells or cell-like structures that can be of interest in the amplification methods used in the present disclosure are any number of two or more, eg, 10 or more, 50 or more, 100 or more. It can be 500 or more, 1000 or more, 5000 or more, 10,000 or more, 50,000 or more, 100,000 or more, 500,000 or more, 1 million or more, 5 million or more, 10 million or more.
- the cell or cell-like structure which is a single biological unit that can be of interest in the amplification methods utilized in the present disclosure, is any of those described in the section (Single Biological Unit, Cell and Cell-like Structure). Can be adopted.
- cells can be targeted.
- cell-like structures are targeted, among which viruses or organelles such as mitochondria and nuclei can be targeted.
- the sample containing the provided cell or single biological unit may be provided in any form.
- the medium contained in the sample is a suitable medium (buffer, salt) for any single biological unit (eg, cell or cell-like structure) selected from the section (Unit Biological Unit, Cell and Cell-like Structure). , Including nutrients and other ingredients) can be selected.
- a suitable medium buffer, salt
- any component may be used as long as it is a component suitable for droplet generation. It is preferable that the component is also suitable for gelation. Examples of such components include, but are not limited to, buffer solutions such as PBS, Tris-HCl, TE, and HEPES, as well as sterilized water, seawater, and artificial seawater.
- encapsulation of a single biological unit for example, a cell or a cell-like structure
- a droplet of one single biological unit for example, a cell or a cell-like structure
- droplet preparation Any embodiment described in the section may be adopted.
- microchannels are used to flow a suspension of single biological units (eg, cells or cell-like structures) into the microchannel and shear the suspensions one by one. It is possible to prepare droplets encapsulating a single biological unit (for example, a cell or a cell-like structure) of Those skilled in the art can appropriately prepare and carry out the components and parameters.
- any embodiment described in the following (gelling) section can be adopted as the step of gelling the droplet to form a gel capsule.
- gelation cools a droplet made so that the material of the droplet or droplet (eg, a sample containing a cell or cell-like structure) contains the material of a gel capsule.
- the material of the droplet or droplet eg, a sample containing a cell or cell-like structure
- gelation can be gelled by giving a stimulus such as light.
- any material described in the following (gelation) section can be used.
- the step of lysing a single biological unit can be realized by immersing the gel capsule in one or more lysing reagents, and the following (dissolution) items. Any embodiment described in the above can be adopted.
- the polynucleotide in the cell is eluted into the gel capsule and the substance binding to the polynucleotide is removed. It is important that the treatment is carried out so that it is retained within the gel capsule.
- the step of contacting the polynucleotide with an amplification reagent to amplify the polynucleotide in a gel capsule can also amplify the polynucleotide while maintaining a gel state in the gel capsule. ..
- various solubilizers are added stepwise or simultaneously.
- a protein contained within a single biological unit eg, cell or cell-like structure
- a single biological unit eg, cell or cell-like structure
- Lysis is achieved by adding reagents step by step from the destruction of the extracellular layer.
- the lysate remaining in the gel capsule and the lysis reagent after the dissolution operation are passed through the gel capsule using an appropriate washing solution, and the inhibitor is transferred to the outside of the gel capsule. Need to be released to.
- the residual reagent can be diluted while retaining the genetic material. This step can be repeated. By diluting the reagent to a level that does not cause inhibition, downstream operations, such as amplification reactions, can be performed smoothly.
- the step of amplifying a polynucleotide in a gel capsule can be realized by contacting the polynucleotide with an amplification reagent, and any embodiment defined in the following (amplification) can be adopted. it can.
- the present disclosure uses a sample containing two or more single biological units (eg, cells or cell-like structures) and one single biological unit (eg, cells or cell-like structures). , Cells or cell-like structures) can be included in the droplets.
- the apparatus is a droplet preparation unit that encapsulates a single biological unit (for example, a cell or a cell-like structure) in a droplet one by one (for example, a cell or a cell-like structure). Can be equipped.
- Droplet production can be performed using, for example, a microchannel.
- the droplet making section may include a microchannel.
- a suspension of a single biological unit eg, a cell or cell-like structure
- the suspension is sheared so that each single biological unit (eg, a cell or cell).
- a droplet containing a similar structure) can be produced.
- Shearing can be done at regular intervals.
- Shearing of the suspension can be done with oil.
- oil for example, mineral oil (for example, light mineral oil), vegetable oil, silicone oil, and fluorinated oil can be used.
- the diameter of the droplet may be about 1 to 250 ⁇ m.
- the diameter of the droplet may be about 20 ⁇ m, about 50 ⁇ m, about 80 ⁇ m, about 100 ⁇ m, about 150 ⁇ m, or about 200 ⁇ m.
- the present disclosure may include the step of gelling a droplet to form a gel capsule.
- the device may include a gel capsule generating unit that gels droplets to form gel capsules.
- Gelation of the droplets can be performed by configuring the droplets to contain the material of the gel capsule and cooling the prepared droplets. Alternatively, gelation can be performed by giving a stimulus such as light to the droplet.
- gelation can be performed by giving a stimulus such as light to the droplet.
- a single biological unit eg, a cell or cell-like structure. it can.
- the diameter of the gel capsule may be about 1 to 250 ⁇ m.
- the diameter of the gel capsule may be about 1 ⁇ m, about 10 ⁇ m, about 20 ⁇ m, about 50 ⁇ m, about 80 ⁇ m, about 100 ⁇ m, about 150 ⁇ m, about 200 ⁇ m or about 250 ⁇ m.
- the diameter of the gel capsule may be the same as that of the droplet to be produced, but the diameter may change during gelation.
- the gel capsule may be a hydrogel capsule.
- the material of the gel capsule may include agarose, acrylamide, a photocurable resin (for example, PEG-DA), PEG, gelatin, sodium alginate, matrigel, collagen and the like.
- a photocurable resin for example, PEG-DA
- the gel capsule may be a hydrogel capsule.
- hydrogel refers to one in which the solvent or dispersion medium held by the network structure of the polymer substance or colloidal particles is water.
- DNA can be purified by phenol / chloroform extraction and ethanol precipitation.
- the amount of the genetic substance per cell is very small, and it is necessary to individually convert the genetic substance into a nucleic acid-only state without loss.
- nucleic acid purification is attempted by a general bulk scale procedure, the result is that no nucleic acid can be extracted or only nucleic acid derived from impurities can be extracted.
- Contamination is a major problem in single-cell experiments, but by using gel capsules containing a single cell or cell-like structure, purified genetic material (eg, DNA) can be retained in the gel capsule.
- the possibility of contamination of molecules from the outside can be eliminated.
- a large amount of one cell can be processed in parallel with a very simple operation.
- the steps of centrifuging the test tube containing the gelled droplets, removing the supernatant and replacing it with a cleaning solution can be performed.
- the residual reagent can be diluted while retaining the genetic material. This step can be repeated.
- downstream operations, such as amplification reactions can be performed smoothly.
- a composition comprising a gel capsule or a material thereof may be provided. From the points described above or below, such compositions amplify or analyze nucleic acids or other biomolecules in a single biological unit (eg, cell or cell-like structure) at the single biological unit (eg, single cell) level. Can be useful for Also, such compositions can be useful for making genomic libraries.
- a composition comprising a gel capsule or a material thereof and a single biological unit in a single cell state (eg, a cell or cell-like structure) may be provided.
- compositions may be useful for amplifying nucleic acids in a single biological unit (eg, a cell or cell-like structure) at the single cell level.
- compositions can be useful for making genomic libraries.
- compositions can be useful for sequencing nucleic acids in a single biological unit (eg, a cell or cell-like structure) at the single biological unit (eg, single cell) level.
- the present disclosure may include immersing a gel capsule in one or more lysis reagents to lyse the single biological unit (eg, a cell or cell-like structure). Further, in the present disclosure, the device may include a dissolution reagent immersion portion for immersing the gel capsule in the dissolution reagent.
- a polynucleotide or other biomolecule in a single biological unit eg, cell or cell-like structure
- Dissolving reagents include, for example, enzymes, surfactants and pH regulators, and combinations thereof can also be used.
- a composition comprising a lysis reagent for amplifying nucleic acids in a single biological unit (eg, a cell or cell-like structure) at the single biological unit (single cell) level.
- a single biological unit eg, a cell or cell-like structure
- the step of contacting the polynucleotide with an amplification reagent to amplify the polynucleotide in a gel capsule can also amplify the polynucleotide while maintaining a gel state in the gel capsule. ..
- Reagents for lysis include lysoteam, labiase, yatarase, achromopeptidase, protease, nuclease, zymolyase, chitinase, lysostaphin, mutanolaicin, sodium dodecyl sulfate, sodium lauryl sulfate, potassium hydroxide, sodium hydroxide, phenol, chloroform, guanidine hydrochloride.
- the lysis reagent may be selected from at least one group consisting of lysozyme, achromopeptidase, protease, sodium dodecyl sulfate and potassium hydroxide.
- an aggressive single biological unit eg, a cell or cell-like structure
- detection can be based on leakage of nucleic acid from a single biological unit (eg, cell or cell-like structure) by physical or thermal stimulation. is there.
- a single biological unit for example, a cell or a cell-like structure
- the genetic material in the single cell is completely destroyed. It is preferably isolated from cells.
- thermal / mechanical irritation may lead to disintegration of the gel capsule, and it may be preferable to use a dissolving reagent.
- screening can be performed by a technique such as FISH in which a nucleic acid probe for detection is reacted.
- a lytic reagent or a combination of lytic reagents that is strong to some extent.
- Gram-positive bacteria have a cell wall with a thick peptidoglycan layer, so mild ones alone may not be sufficient to lyse cells.
- screening can be performed by a method such as FISH in which a nucleic acid probe for detection is reacted.
- a strong lysing reagent may inhibit a reaction such as DNA amplification, and is preferably sufficiently removed before the downstream reaction.
- the gel capsules hold the genetic material to be analyzed or amplified, so that in a single biological unit (eg, a cell or cell-like structure) with a small amount of genetic material.
- the lysis reagent can also be removed in the analysis, so that a strong solubilizer or combination of solubilizers can be used.
- potent lysing reagents or combinations of lysing reagents allows for comprehensive nucleic acid amplification or genome analysis, regardless of the type of cell (including those with cell walls and other types of microorganisms). Can be.
- the method may include removing the lysing reagent and / or contaminants from the gel capsule.
- the dissolution reagent immersion portion includes means for removing the dissolution reagent and / or contaminants from the gel capsule.
- screening can be performed by a method such as FISH in which a nucleic acid probe for detection is reacted after lysis.
- the target molecule is part of a cell surface marker or nucleic acid and the goal is to detect its presence itself, the goal may be achieved even if the lysis operation is partial or undissolved. There is.
- the genomic DNA when attempting to amplify the full length of genomic DNA, the genomic DNA usually has only one molecule in the cell, so that the cell or cell-like structure is completely dissolved and bound from the DNA. It is necessary to sufficiently remove proteins. As a result, even when a sample consisting of hundreds or more kinds of microorganisms such as intestinal microorganisms is targeted, all of them can be uniformly dissolved and whole genome amplification can be performed from all of them. It also makes it possible to prepare the library and finally obtain whole genome sequence information.
- the present disclosure may include contacting the polynucleotide with an amplification reagent to amplify the polynucleotide within a gel capsule.
- the device may include an amplification reagent immersion portion for immersing the gel capsule in the amplification reagent.
- the amplification reagent immersion portion may be provided with means for adjusting the temperature of the gel capsule, if necessary, after immersion in the amplification reagent.
- screening can be performed by a method such as FISH that reacts a nucleic acid probe for detection, a DNA-binding fluorescent dye for detecting an amplified polynucleotide, or a Taqman probe.
- Reactions involving heat treatment can lead to redissolve of gels (eg, agarose gels), thus disrupting the individualized forms and single biological units (eg, cells or cell-like). It may invalidate the isolation in the structure).
- gels eg, agarose gels
- single biological units eg, cells or cell-like
- an enzymatic reaction of about 60 degrees or less is desirable to maintain the gel droplet shape.
- Homeothermic chain substitution amplification reaction (multiple) Displacement amplification) is preferable in that it can be performed within this temperature range and amplification of the entire genomic DNA is possible.
- the enzyme used include phi29 polymerase, Bst polymerase, Aac polymerase, and recombinase polymerase.
- RNA Ribonucleic acid
- the purpose is to determine the type and expression level of a gene in an absolute (relative) manner. It is possible to quantify whether it is expressed only.
- Treatment in gel capsules is advantageous for such amplification.
- the single biological unit (eg, cell or cell-like structure) of interest in the present disclosure is not particularly limited, but is, for example, a cell of a microorganism (eg, a bacterium, a fungus, a single cell animal), or a cell of a multicellular organism.
- a microorganism eg, a bacterium, a fungus, a single cell animal
- a cell of a multicellular organism e.g, somatic cells, germ cells, cultured cells, tumor cells), intracellular organs (mitochonium, nucleus, chloroplast), viruses.
- a single biological unit also includes artificial objects such as artificial cells.
- RNA For cells of organisms with known genome sequences, which genes are expressed in them RNA In the case of analysis of an organism whose genome sequence and / or gene information is unknown, it is necessary to obtain information on the genome itself before RNA analysis. In that case, amplification or analysis of genomic sequences or other biomolecules at the single biological unit (eg, single cell) level by the methods of the present disclosure using gel capsules is advantageous.
- samples containing two or more single biological units can be used.
- the two or more cells may be derived from a plurality of organisms.
- examples of the sample include a microbial sample, a tissue sample, a mixed sample of a symbiotic microorganism and a host organism, and a sample containing microorganisms and cells taken from an animal / human sample.
- the microorganisms that can be targeted are not limited, but are eubacteria, Escherichia coli, bacilli, indigo bacteria, cocci, bacilli, spiral bacteria, gram-negative bacteria, gram-positive bacteria, archaea, fungi, etc. Can be mentioned.
- Bacteria that can be targeted by the present disclosure for example, Negibacteria, Eobacteria, Deinococci, Deinococci, Deinococcales, Thermales, Chloroflexi, Anaerolineae, Anaerolineales, Caldilineae, Chloroflexales, Herpetosiphonales, Thermomicrobia, Thermomicrobiales, Sphaerobacterales, Ktedonobacteria, Ktedonobacterales, Thermogemmatisporales, Glycobacteria, Cyanobacteria , Gloeobacterophyceae, Gloeobacterales, Nostocophyceae, Synechococcophycidae, Synechococcales, Nostocophycidae, Chroococcales, Oscillatoriales, Nostocales, Pseudanabaenales, Spirochaetes, Spirochaetes, Spirochaetales, Fibrobacteres
- gel capsules are sorted and collected in a microplate or the like for each single biological unit (for example, cell or cell-like structure). Further, the polynucleotide in each gel capsule is re-amplified in the plate as a template, and this is used as a library master plate. Then, a part of the reaction solution in the library master plate is separated to prepare a replica plate. Amplification is performed with a primer set specific to the target gene using this replica as a template. Method (1) The sequence of the amplified product is specified by a Sanger sequence or the like, and the well containing the target cell or gene is specified from the replica plate. A sample corresponding to the identified well is selected from the master plate and used for whole genome sequencing.
- the above primer set contains a barcode sequence
- each sample is subjected to an amplification reaction in which a different barcode is added, and PCR products derived from multiple replica plates are pooled to perform a next-generation sequence. Then, by specifying the plate well number by the barcode sequence and specifying the sequence of the PCR product, it is possible to screen hundreds to thousands of samples at once.
- the primer set may be a mixture of primer sets targeting a plurality of gene regions. More specifically, from a primer set that targets the v3-v4, v1-v2 regions of the 16S rRNA gene, and a primer set that distinguishes bacteria, archaea, fungi, etc.
- 18S rRNA, ITS, etc. specific enzymes and two It may be a gene group involved in the production of next metabolites, or a primer set for detecting these in order to remove host-derived DNA, mitochondria, etc. in non-microbial organisms.
- Example 1 Examination of microbial flora in mouse feces
- DPBS buffered saline
- microdroplets 3 were prepared and mouse intestinal microorganisms 1 cell 4 were encapsulated in the microdroplets 3. ..
- the micro flow path is composed of a first flow path 5, a second flow path 6, a third flow path 7, and a fourth flow path 8, and adjacent flow paths are arranged at right angles.
- 2 is used, it is also possible to use a microchannel 2 connected in a substantially T shape.
- the microchannel 2 of this example used had a width of 34 ⁇ m and a height of 50 ⁇ m, but the size of the microchannel 2 was appropriately changed depending on the size of the microdroplets 3 to be produced and the size of 1 cell 4 to be encapsulated. It is possible.
- the intestinal microbial suspension 1 was introduced from the first flow path 5 (aqueous phase inlet), and Pico-Surf1 (2% in Novec7500) was introduced from the second flow path 6 and the fourth flow path 8 (oil phase inlet).
- Sphere Fluids (hereinafter referred to as "oil 10") is introduced and the intestinal microbial suspension 1 is sheared to prepare fine droplets 3 having a diameter of 50 ⁇ m, and the third flow path 7 is allowed to flow.
- the mixture was collected in a tube 9 having a capacity of 0.2 mL.
- Approximately 450,000 microdroplets 3 were prepared at a rate of 500 droplets / second.
- the cell concentration in the microdroplets 3 is 0.1 cells / droplet.
- the diameter of the microdroplet 3 may be, for example, about 1 to 250 ⁇ m, more preferably about 10 to 200 ⁇ m, for example, about 1 ⁇ m, about 5 ⁇ m, about 10 ⁇ m, about 15 ⁇ m, It may be about 20 ⁇ m, about 25 ⁇ m, about 30 ⁇ m, about 40 ⁇ m, about 50 ⁇ m, about 80 ⁇ m, about 100 ⁇ m, about 150 ⁇ m, about 200 ⁇ m, or about 250 ⁇ m.
- a plurality of microdroplets 3 and oil 10 are housed in the tube 9, but the microdroplets 3 have a lighter specific gravity than the oil 10 and therefore accumulate in the upper layer.
- the tube 9 was cooled on ice for 15 minutes, and the fine droplet 3 was gelled with an ultra-low melting point agarose.
- the gelled microdroplets 3 are gel capsules 11. Since the diameter of the microdroplet 3 is 50 ⁇ m, the diameter of the gel capsule 11 is also 50 ⁇ m.
- the diameter of the gel capsule 11 may be, for example, about 1 to 250 ⁇ m, more preferably about 10 to 200 ⁇ m, for example, about 1 ⁇ m, about 5 ⁇ m, about 10 ⁇ m, about 15 ⁇ m, about 20 ⁇ m, about 25 ⁇ m, about 30 ⁇ m, about.
- the gel capsule 11 is sequentially immersed in the lytic reagent 13 as a lysis reagent, a portion other than the collection target such as the cell wall of the cell 4 is dissolved inside the gel capsule 11, and the genomic DNA 14 is eluted in the gel capsule 11. I let you.
- lysozyme (10 U / ⁇ L) (R1804M, Epicenter), which is one of the lytic reagents 13, was added to the tube 9 to lyse the cells 4.
- achromopeptidase (850 U / mL) (015-09951, Fujifilm Wako Pure Chemical Industries, Ltd.), which is one of the lytic reagents 13, was added to the tube 9.
- protease K (1 mg / mL) (MC5005, Promega) and sodium dodecyl sulfate (SDS) 0.5% (71736-100ML, SIGMA-ALDRICH), which is one of the lytic reagents 13, were added to the tube 9.
- the gel capsule 11 was immersed in Buffer D2 (QIAGEN), which is an aqueous solution containing potassium hydroxide, which is one of the lytic reagents 13, to dissolve the residual components and denature the genomic DNA 14.
- Buffer D2 QIAGEN
- the lytic test solution 13 used in this example is lysozyme, achromopeptidase, proteinase K, sodium dodecyl sulfate, and Buffer D2.
- potassium hydroxide is also used in a normal DNA amplification reaction step, it is used as one of the lytic reagents 13 in this example because it also has a lytic effect. Since the gel capsule 11 is immersed in the lytic reagent 13 for a short time, the eluted genomic DNA 14 is not discharged to the outside of the gel capsule 11 by the lytic reagent 13 and is retained in the gel capsule 11. In this example, the lytic reagent 13 that has permeated the gel capsule 11 is also included in the contaminants.
- lysozyme, achromopeptidase, and protease K are added in sequence, sodium dodecyl sulfate is added to dissolve cells 4, and then centrifugation is performed only before adding Buffer D2 to obtain a sufficient cleaning effect. Can be done.
- the cells 4 may be lysed with each lytic reagent 13 and then centrifuged.
- the target genomic DNA 14 can be collected by lysing the cells 4 with a plurality of types of lytic reagents 13, and the lytic reagent 13 and lysis can be obtained by performing centrifugal washing after immersion in the lytic reagent 13. Contaminants such as components other than the polynucleotide of the cell 4 can be removed, and the genomic DNA 14 can be purified without inhibiting the subsequent genomic DNA amplification reaction.
- the amplification reagent 15 was added to the tube 9 containing the gel capsule 11 holding the denatured genomic DNA 14 in the potassium hydroxide solution (Buffer D2), and the gel capsule 11 was immersed in the amplification reagent 15.
- the MDA (Multiple Replication Replication) method using phi29 DNA polymerase which is a strand-substitution type DNA synthase, was used.
- the whole genome amplification reaction reagent was immersed in REPLI-g Single Cell Kit (QIAGEN), and the whole genome amplification reaction was carried out for 3 hours (S1000 thermal cycler, Bio-Rad).
- the MDA method (REPLI-g Single Cell Kit, 150345) is used in the wells of each plate. , QIAGEN) was performed to prepare a library master plate containing 10 ⁇ L of DNA amplification product for each well.
- the production device 18 includes a droplet production unit 19 that encloses 1 cell 4 in the microdroplet 3 by the microchannel 2.
- the generated microdroplets 3 are housed in the tube 9.
- the manufacturing apparatus 18 includes a gel capsule generation unit 20 that gels the fine droplets 3 to generate the gel capsule 11.
- the gel capsule generation unit 20 has a cooling unit 21 and can cool the fine droplets 3 in a state of being housed in the tube 9.
- the gel capsule generation unit 20 has an ultraviolet irradiation unit 22 that irradiates ultraviolet rays while the fine droplets 3 are contained in the tube 9, and the gel capsule 11 can be generated using a photocurable resin. it can. It should be noted that only one of the cooling unit 21 and the ultraviolet irradiation unit 22 may be provided.
- the manufacturing apparatus 18 includes a dissolving reagent immersion unit 23 in which the lytic reagent 13 is injected into the tube 9 containing the gel capsule 11 and the gel capsule 11 is immersed in the lytic reagent 13.
- the lytic reagent 13 is injected into the tube 9 from the lysis reagent injection unit 24.
- the manufacturing apparatus 18 includes a removing unit 25 for removing contaminants including oil 10 and lytic reagent 13 from the gel capsule 11.
- the removing unit 25 has a centrifugal cleaning unit 26, and after immersing the gel capsule 11 in the lytic reagent 13 for a predetermined time, the lytic reagent 13 and contaminants are removed from the gel capsule 11 and the tube 9 by the centrifugal cleaning unit 26. ..
- the production device 18 includes an amplification reagent immersion unit 27 for immersing the amplification reagent 15 for amplifying the genomic DNA 14 held in the gel capsule 11.
- the amplification reagent 15 is injected into the tube 9 from the amplification reagent injection unit 28.
- the production apparatus 18 includes a sorting unit 29 that sorts gel capsules 11 that retain the genomic DNA 14 amplified more than a predetermined value.
- the sorting unit 29 sorts the gel capsule 11 having the flow cytometer 30 and holding the genomic DNA 14 amplified more than a predetermined value, and collects it on the plate 16.
- the gel capsule 11 that does not retain the genomic DNA 14 amplified above a predetermined level is collected in another container 31.
- Dispense 39 ⁇ L of nuclease-free water (UltraPure DNase / RNase-Free Distilled Water, 10977-015, Thermo Fisher Scientific) into each well of a new plate, add 1 ⁇ L of DNA amplification product in the library master plate, and add 1 ⁇ L of DNA amplification product to the library master.
- a 40-fold diluted solution of the plate was prepared.
- the DNA concentration was quantified by a Qubit fluorometer (Q33226, Thermo Fisher Scientific) and a Qubit dsDNA HS Assay Kit (Q32854, Thermo Fisher Scientific) using 1 ⁇ L of the diluted solution.
- PCR was performed on the V3V4 region of the 16S rRNA gene using 1 ⁇ L of the diluted solution as a template (6.25 ⁇ L PrimeSTAR Max DNA Polymerase (R045B, Takara Bio), 0.5 ⁇ L 10 ⁇ M Primer Forward (5).
- PCR reaction conditions are initial heat denaturation at 95 ° C., 5 minutes, heat denaturation at 98 ° C., 10 seconds, annealing at 51 ° C.
- extension reaction was carried out at 72 ° C. for 5 seconds for 27 cycles, and after reaction at 72 ° C. for 5 minutes, storage was performed at 4 ° C.
- Markers GeneRuler TM 1 kb DNA Ladyr, # SM0318, Primers, Staining: Midori Green Direct, NE-MG06, Nippon Genetics, Loading buffer: 6 x Loading Buffer, 9157, Takara Bio) (Migration conditions: 100V, min After confirming the presence or absence of the PCR product, the sample in which amplification was observed was subjected to sequence analysis using the Sanger method (DNA sequence outsourced service of Fasmac Co., Ltd.).
- the homology of the base sequence between each sample is 99% or more for the marker gene group detected using CheckM, and (2) between each sample for the sequence of all Contigs. Samples satisfying the two conditions that the homology in the above was 95% or more were collectively analyzed as genomic information derived from the same species. However, for the integration of genomic information, ccSAG (Kogawa et al., Sci Rep. 2018 Feb 1; 8 (1): 2059. https: // doi.org / 10.1038 / s41598-018-20384-3) It was used.
- genomic information derived from 44 types of intestinal bacteria with a completion rate of more than> 50% was obtained from 347 genomic information (Fig. 12).
- Completion rate (90% or more), contamination rate (5% or more) according to the international standard Minimum information about a single amplified genome (MISAG) (https://doi.org/10.1038/nbt.3893).
- MISAG single amplified genome
- CheckM it was clarified that 15 kinds of samples were classified into High-quality single. Of these, 7 were Lachnospiraceae bacteria and 4 were Bacteroidaceae bacteria (Table 2).
- Example 4 When it is desired to selectively acquire data of cells having specific characteristics from various cells) A gel containing a polynucleotide when the purpose is to obtain genomic data of one or more specific microorganisms of interest to those skilled in the art among animal symbiotic microorganisms such as gut flora and marine / soil microorganisms. By confirming the presence or absence of the gene fragment of the target microorganism in advance for the capsule, it is possible to reduce unnecessary gene sequence data acquisition and the cost involved.
- measurement targets include comparative analysis of microorganisms of the same strain (for example, analysis of subspecies in a group of microorganisms related to diseases, etc.) and microorganisms having a specific gene (for example, secondary metabolites and enzymes produced by microorganisms). It is assumed that the purpose is to search for or analyze bacteria, archaea, fungi, and other eukaryotic cells individually from among various species.
- Example 5 When a large amount of DNA derived from a host animal or the like is mixed, the analysis sample is feces, saliva, sputum or skin, oral cavity, nasal cavity, ears, genital lavage fluid, surgical cleaning solution, tissue extract or blood, and the microorganisms contained in the sample are analyzed. Contains cells, intracellular small organs, and nucleic acids from many host animals in the sample. Some of these can also be encapsulated inside the gel capsule to perform polynucleotide amplification.
- the polynucleotide derived from the host can be applied to the analysis combined with the analysis of the target microorganism or other cells.
- the intestinal flora and host animals present in the gastrointestinal tract have a symbiotic relationship in which the host provides an anaerobic environment for colonization of the gastrointestinal tract, while the intestinal flora affects the health of the host. It is known to have.
- the major effects on the health status of the host include the production of nutrients, the defense against infectious diseases, and the development of the immune system.
- inflammatory bowel disease is a disease caused by an abnormality of intestinal environmental factors such as intestinal bacteria in addition to a genetic predisposition.
- the function of biotransformers derived from gut flora is analyzed in a complex manner, including genetic analysis, metabolome analysis, biochemical analysis, etc. on the host side, and the gut flora
- the function can be inferred from the genome sequence information of the bacterium, and the correlation with various data such as the biotransformate and metabolome produced can be seen.
- This disclosure is useful in industries that use single cell analysis.
- SEQ ID NO: 1 16S rRNA gene V3V4 region Forward Primer
- SEQ ID NO: 2 16S RRNA gene V3V4 region Revere Primer
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Analytical Chemistry (AREA)
- Biotechnology (AREA)
- Immunology (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- General Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Biophysics (AREA)
- Biomedical Technology (AREA)
- General Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Medicinal Chemistry (AREA)
- Pathology (AREA)
- Sustainable Development (AREA)
- Urology & Nephrology (AREA)
- Hematology (AREA)
- Food Science & Technology (AREA)
- Cell Biology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| JP2021516281A JPWO2020218549A1 (https=) | 2019-04-26 | 2020-04-24 |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| JP2019-085819 | 2019-04-26 | ||
| JP2019085819 | 2019-04-26 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2020218549A1 true WO2020218549A1 (ja) | 2020-10-29 |
Family
ID=72942817
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/JP2020/017788 Ceased WO2020218549A1 (ja) | 2019-04-26 | 2020-04-24 | 単一生物単位の遺伝情報またはその他の生体分子の情報を使用した、サンプルのスクリーニング法 |
Country Status (2)
| Country | Link |
|---|---|
| JP (1) | JPWO2020218549A1 (https=) |
| WO (1) | WO2020218549A1 (https=) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115651971A (zh) * | 2021-12-27 | 2023-01-31 | 迈克生物股份有限公司 | 多重分时核酸检测装置及检测方法 |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20140212881A1 (en) * | 2013-01-26 | 2014-07-31 | Denovo Sciences, Inc. | System and method for capturing and analyzing cells |
| WO2017184707A1 (en) * | 2016-04-19 | 2017-10-26 | President And Fellows Of Harvard College | Immobilization-based systems and methods for genetic analysis and other applications |
| US20180216162A1 (en) * | 2017-01-30 | 2018-08-02 | 10X Genomics, Inc. | Methods and systems for droplet-based single cell barcoding |
-
2020
- 2020-04-24 WO PCT/JP2020/017788 patent/WO2020218549A1/ja not_active Ceased
- 2020-04-24 JP JP2021516281A patent/JPWO2020218549A1/ja active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20140212881A1 (en) * | 2013-01-26 | 2014-07-31 | Denovo Sciences, Inc. | System and method for capturing and analyzing cells |
| WO2017184707A1 (en) * | 2016-04-19 | 2017-10-26 | President And Fellows Of Harvard College | Immobilization-based systems and methods for genetic analysis and other applications |
| US20180216162A1 (en) * | 2017-01-30 | 2018-08-02 | 10X Genomics, Inc. | Methods and systems for droplet-based single cell barcoding |
Non-Patent Citations (1)
| Title |
|---|
| RIEKAET: "Variation analysis of intestinal microflora in inulin-fed mice using microbialsingle-cell genomics", PROCEEDINGS OF THE 2019ANNUAL MEETING OF JAPAN SOCIETY FOR BIOSCIENCE,BIOTECHNOLOGY, AND AGROCHEMISTRY, 5 March 2019 (2019-03-05) * |
Also Published As
| Publication number | Publication date |
|---|---|
| JPWO2020218549A1 (https=) | 2020-10-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US11142787B2 (en) | Method for performing single-cell analysis and device therefor | |
| Sheth et al. | Spatial metagenomic characterization of microbial biogeography in the gut | |
| McCann et al. | Viromes of one year old infants reveal the impact of birth mode on microbiome diversity | |
| CN107429290B (zh) | 使用源自细菌的纳米囊泡鉴定细菌感染性疾病的致病菌的方法 | |
| Angelakis et al. | Glycans affect DNA extraction and induce substantial differences in gut metagenomic studies | |
| JP2010524443A (ja) | 微生物集団の分析 | |
| WO2014130162A1 (en) | Methods of diagnosing and treating cancer by detecting and manipulating microbes in tumors | |
| Wang et al. | Laser capture microdissection and metagenomic analysis of intact mucosa-associated microbial communities of human colon | |
| US11525164B2 (en) | Spatial metagenomic characterization of microbial biogeography | |
| WO2020218549A1 (ja) | 単一生物単位の遺伝情報またはその他の生体分子の情報を使用した、サンプルのスクリーニング法 | |
| WO2020218551A1 (ja) | ゲルカプセル方式による1細胞ゲノムライブラリーからの配列スクリーニング法 | |
| Posteraro et al. | Profiling the gastrointestinal microbiota | |
| JP2025027472A (ja) | 単一生物単位の生菌由来核酸の選択的検出、カウント、ゲノム解析 | |
| Acharya et al. | Culture-independent identification of Mycobacterium avium subspecies paratuberculosis in ovine tissues: comparison with bacterial culture and histopathological lesions | |
| JP7584800B2 (ja) | デジタル微生物叢解析 | |
| WO2009145830A2 (en) | Signatures of radiation response | |
| JPWO2018212288A1 (ja) | パーキンソン病の判定マーカーおよび判定方法 | |
| Abernathy et al. | Gene expression profiling of a fish parasite Ichthyophthirius multifiliis: Insights into development and senescence-associated avirulence | |
| Audarya et al. | First Genotyping of Mycobacterium avium Subspecies Paratuberculosis from Large Ruminant Population at Satna District in Madhya Pradesh in India to Bison Type | |
| US20240352525A1 (en) | Microrna assay for detection of johne's infection and disease | |
| KR102926893B1 (ko) | 마이크로바이옴을 이용한 비결핵항산균 감염성 질환의 치료 반응성 예측을 위한 조성물 | |
| Takano et al. | Droplet Sequencing Reveals Virulence Gene Clusters in Oral Biofilm Extracellular Vesicles | |
| WO2025015224A2 (en) | Treatment of samples containing nucleic acids | |
| KR20250171623A (ko) | 새끼돼지의 장내 면역세포의 수준 예측 방법 | |
| CN121922207A (zh) | 一种基于口腔微生物的中-非流动人群族源鉴定的法医模型及其构建方法 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 20794141 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 2021516281 Country of ref document: JP Kind code of ref document: A |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 20794141 Country of ref document: EP Kind code of ref document: A1 |