WO2020210724A1 - Htra1 modulation for treatment of amd - Google Patents

Htra1 modulation for treatment of amd Download PDF

Info

Publication number
WO2020210724A1
WO2020210724A1 PCT/US2020/027802 US2020027802W WO2020210724A1 WO 2020210724 A1 WO2020210724 A1 WO 2020210724A1 US 2020027802 W US2020027802 W US 2020027802W WO 2020210724 A1 WO2020210724 A1 WO 2020210724A1
Authority
WO
WIPO (PCT)
Prior art keywords
htra1
sequence
risk
protein
amd
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2020/027802
Other languages
English (en)
French (fr)
Inventor
Brandi WILLIAMS
Gregory Hageman
Burt Timothy Richards
Osama YOUSSEF
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of Utah Research Foundation Inc
Original Assignee
University of Utah Research Foundation Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University of Utah Research Foundation Inc filed Critical University of Utah Research Foundation Inc
Priority to US17/599,979 priority Critical patent/US20230165976A1/en
Priority to EP20787458.7A priority patent/EP3953485A4/en
Priority to CN202080042929.4A priority patent/CN113966401A/zh
Priority to CA3136119A priority patent/CA3136119A1/en
Priority to JP2021559892A priority patent/JP2022526429A/ja
Publication of WO2020210724A1 publication Critical patent/WO2020210724A1/en
Anticipated expiration legal-status Critical
Priority to JP2025093119A priority patent/JP2025175283A/ja
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • A61K48/0066Manipulation of the nucleic acid to modify its expression pattern, e.g. enhance its duration of expression, achieved by the presence of particular introns in the delivered nucleic acid
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P27/00Drugs for disorders of the senses
    • A61P27/02Ophthalmic agents
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1137Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86Viral vectors
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/87Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/90Stable introduction of foreign DNA into chromosome
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/16Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22Ribonucleases [RNase]; Deoxyribonucleases [DNase]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/48Hydrolases (3) acting on peptide bonds (3.4)
    • C12N9/50Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
    • C12N9/64Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue
    • C12N9/6421Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue from mammals
    • C12N9/6424Serine endopeptidases (3.4.21)
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/80Fusion polypeptide containing a DNA binding domain, e.g. Lacl or Tet-repressor
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/20Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPR]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00Applications; Uses
    • C12N2320/30Special therapeutic applications
    • C12N2320/34Allele or polymorphism specific uses
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00Reverse transcribing RNA viruses
    • C12N2740/00011Details
    • C12N2740/10011Retroviridae
    • C12N2740/16011Human Immunodeficiency Virus, HIV
    • C12N2740/16041Use of virus, viral particle or viral elements as a vector
    • C12N2740/16043Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011Details
    • C12N2750/14011Parvoviridae
    • C12N2750/14111Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14141Use of virus, viral particle or viral elements as a vector
    • C12N2750/14143Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00Nucleic acids vectors
    • C12N2800/40Systems of functionally co-operating vectors
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00Vector systems having a special element relevant for transcription
    • C12N2830/008Vector systems having a special element relevant for transcription cell type or tissue specific enhancer/promoter combination
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y304/00Hydrolases acting on peptide bonds, i.e. peptidases (3.4)
    • C12Y304/21Serine endopeptidases (3.4.21)

Definitions

  • the invention relates to methods and compositions for treatment of age-related macular degeneration, and finds application in the fields of biology and medicine.
  • Age-related macular degeneration is the leading cause of irreversible vision loss in the developed world (for reviews see Zarbin, fur. Ophthalmol. 8:199-206, (1998) affecting approximately 15% of individuals over the age of 60. An estimated 600 million individuals are in this age demographic. The prevalence of AMD increases with age; mild, or early forms occur in nearly 30%, and advanced forms in about 7%, of the population that is 75 years and older (Vingerling et al., Epidemiol. Rev. 17(2):347-360, 1995).
  • a therapeutic agent e.g., an anti-VEGF agent
  • these therapies require repeated, invasive surgery, which has caused significant discomfort and inconvenience to patients.
  • the procedures involved in these therapies may also increase the risk of side effects.
  • the therapeutic agents are administered only after the choroidal neovascularization (CNV) has developed and when there is significant damage to the macula.
  • CNV choroidal neovascularization
  • AMD includes two distinct biological diseases: Chromosome 1-directed AMD (or “Chr 1 AMD”), which results from dysregulation of the complement system, including complement factor H dysregulation, and chromosome 10-directed AMD (or “Chr 10 AMD”), which is associated with genetic variants in chromosomal region 10q26, which harbors the ARMS2 and HTRA1 genes.
  • chromosomes 1 and 10 together account for 95% of all AM D risk in Caucasian population and that chromosomal region 10q26 is strongly associated with increased risk of AM D (Fisher et al., 2005; Rivera et. al. 2005).
  • the disclosure provides a method of treating, preventing the development of, slowing progression of, reversing or ameliorating the symptoms and signs of Chr 10 AM D in a subject, by administering an agent that increases HTRA1 expression in cells of the subject (e.g., RPE cells, horizontal cells, or photoreceptor cells).
  • an agent that increases HTRA1 expression in cells of the subject e.g., RPE cells, horizontal cells, or photoreceptor cells.
  • the subject has a single chromosome 10 risk allele.
  • the subject is homozygous for the chromosome 10 risk allele.
  • the subject exhibits a Chr 10 AMD clinical phenotype.
  • the subject does not carry a chromosome 1 risk allele(s).
  • the agent causes upregulation of transcription of an endogenous HTRA1 gene sequence.
  • the agent may be a transcriptional activator that binds a target sequence within an HTRA1 transcriptional regulatory region or an HTRA1 promoter.
  • the agent is a fusion protein of i) a DNA targeting protein capable of recognizing a target sequence within the HTRA1 transcriptional regulatory region, and ii) the transcriptional activator.
  • the DNA targeting protein recognizes the target sequence through a guide RNA that is complementary to a sequence within the HTRA1 transcriptional regulation region or the HTRA1 promoter region.
  • the DNA targeting protein is an enzymatically inactive Cas9 protein (dCas9).
  • the transcriptional activator is VP16.
  • the method further comprises administering a sgRNA that is complementary to a sequence within the HTRA1 transcriptional regulation region.
  • administering results in expression of an exogenous HTRA1 protein in cells of the subject (including, e.g., RPE cells, horizontal cells, or photoreceptor cells).
  • the agent may be a vector, such as a viral vector (e.g ., AAV or lentivirus), that delivers an exogenous HTRA1 protein or a nucleic acid sequence encoding HTRA1 protein, preferably operably linked to a promoter.
  • the promoter is a RPE-specific promoter.
  • treating a subject using the agent results in modification of genomic DNA in RPE cells of the subject.
  • genome editing methods may be used to change a sequence in the HTRA1 gene or transcription regulatory regions and convert one or more risk alleles to corresponding non-risk allele(s).
  • the agent is a DNA endonuclease-based system.
  • the DNA endonuclease is a Cas9 endonuclease, a Zinc-finger nuclease, a transcription activator-like effector nuclease, a Homing endonuclease, a Meganuclease or a Cre recombinase.
  • the agent modifies the genomic DNA and results in a genomic DNA sequence comprising SEQ ID NO: 34. In some cases, the agent modifies the genomic DNA and results in a genomic DNA sequence comprising SEQ. ID NO: 14. In some cases, a risk allele sequence (c) at rs36212733 is changed to a non-risk allele sequence (t). In some cases, the agent is administered by subretinal injection. In some cases the agent is delivered by suprachoroidal injection. In some cases the agent is delivered by intravitreal injection. In some cases the agent is delivered by other routes.
  • the one or more agents comprise Cas9 and one or more sgRNAs, wherein the one or more sgRNAs direct the cas9 to a genomic region comprising the one or more risk alleles, thereby modifying the genomic region, which results in the one or more risk alleles being replaced with corresponding non-risk alleles.
  • the agent is a small molecule compound, a peptide, or a nucleic acid that increases HTRA1 expression or activity in RPE cells.
  • the disclosure provides a pharmaceutical composition for treating Chr 10 AM D, comprising (i) an agent that increases HTRA1 expression in RPE cells of the subject, and (ii) a pharmaceutically acceptable carrier.
  • compositions of the invention in one form include a guide RNA (gRNA) comprising a guide sequence of at least 10 contiguous nucleotides corresponding to a target sequence in the HTRA1 promoter or in the HTRA1 2 kb regulatory region.
  • gRNA guide RNA
  • HTRA1 promoter has the sequence set forth in SEQ ID NO: 5, 7, 8, or 13 and the 2 kb regulatory region has the sequence set forth in SEQ ID NO: 14.
  • the invention includes a ribonucleoprotein (RNP) complex comprising: (a) guide RNA (gRNA) comprising a guide sequence of at least 10 contiguous nucleotides corresponding to a target sequence in the HTRA1 promoter or in the HTRA1 2 kb regulatory region; and (b) a fusion protein comprising a CRISPR-associated protein (Cas) domain fused to a transcriptional activator domain, wherein the Cas protein domain lacks nuclease activity and the HTRA1 promoter has the sequence set forth in SEQ ID NO: 5, 7, 8, or 13, and the 2 kb regulatory region has the sequence set forth in SEQ ID NO: 14.
  • gRNA guide RNA
  • Cas CRISPR-associated protein
  • the Cas of the RNP complex is dCas9 or dCasl2a.
  • the target sequence of the RNP complex is in the promoter and the transcriptional activator is selected from VP16, VP64, VP160, MLL, E2A, HSF1, NF-IL6, NFAT1 and NF-kB.
  • the target sequence of the RNP complex is in the 2kb regulatory region and the transcriptional activator is LHX2.
  • the invention includes a ribonucleoprotein (RNP) complex comprising: (a) guide RNA (gRNA) comprising a guide sequence of at least 10 contiguous nucleotides corresponding to a target sequence in the FITRA1 2 kb regulatory region; and (b) a CRISPR-associated (Cas) protein, wherein the 2 kb regulatory region has the sequence set forth in SEQ ID NO: 14.
  • the Cas of the RNP complex is Cas is Cas9, Casl2a, or Cas3.
  • the guide sequence of the gRNA or RNP complex comprises at least 15 contiguous nucleotides corresponding to the target sequence. In another aspect the guide sequence of the gRNA or RNP complex comprises at least 20 contiguous nucleotides corresponding to the target sequence. In yet another aspect, the guide sequence of the gRNA or RNP complex comprises 15-25 contiguous nucleotides corresponding to the target sequence. In one embodiment, target sequence of the gRNA or RNP complex is contiguous with a protospacer adjacent motif (PAM) is NGG.
  • PAM protospacer adjacent motif
  • the guide sequence of the gRNA or the RNP complex comprises any of SEQ ID NOS: 15-33, or a subsequence comprising at least 15 contiguous bases of any of SEQ ID NOS: 15-33.
  • the invention includes gRNA or the RNP complex, wherein (i) the guide sequence comprises any of SEQ ID NOS: 36-49; and/or (ii) target sequence comprises or is adjacent to a risk allele selected from risk at rsl0490924, rsl44224550, rs36212731, rs36212732, rs36212733, rs3750848, rs3750847, and rs3750846.
  • the invention includes a polynucleotide encoding the gRNA, wherein the polynucleotide is DNA.
  • the polynucleotide comprises a promoter operably linked to a sequence encoding the gRNA.
  • the invention includes a viral vector comprising the polynucleotide.
  • the invention provides a viral vector comprising a polynucleotide that encodes an FITRA1 polypeptide, wherein the polynucleotide comprises is a human codon optimized sequence encoding HTRA1 operably linked to a promoter.
  • the viral vector is a retrovirus, a lentivirus, a herpes virus, or an adeno-associated virus (AAV).
  • the promoter of the polynucleotide or the viral vector is an RPE specific promoter.
  • the invention includes a FITRA1 activating system comprising: (a) a vector comprising a DNA sequence encoding a gRNA; and (b) a vector comprising a DNA sequence encoding a fusion protein comprising a Cas protein domain fused to a transcriptional activator domain, wherein the Cas protein domain lacks nuclease activity.
  • the vector in (a) and the vector in (b) are different vectors.
  • the invention includes a HTRA1 targeting system comprising: (a) a vector comprising a nucleic acid encoding a gRNA disclosed herein; and (b) a vector comprising a nucleic acid encoding a Cas protein.
  • the HTRA1 targeting system further comprises: (c) a vector comprising nucleic acid encoding a template repair sequence, said template repair sequence optionally comprising at least one of SEQ ID NOs: 87-94 or the complement of at least one of SEQ ID NOs: 87-94.
  • (a) and (b) are the same vector, or (a), (b) and (c) are the same vector.
  • the invention includes an isolated cell comprising a gRNA, an RNP, polynucleotide, the viral vector, the activating system, or the targeting system.
  • invention provides the use of the gRNA, the isolated polynucleotide, the vector, the activating system, the targeting system, or the isolated cell for the preparation of a medicament for treating age-related macular degeneration (AMD).
  • the guide RNA, the isolated polynucleotide, the vector, the activating system, the targeting system, or the isolated cell are used for the preparation of a medicament for treating age-related macular degeneration (AMD).
  • the subject being treated (a) exhibits a Chr 10 AMD clinical phenotype; (b) has a chromosome 10 risk allele; (c) is homozygous for the chromosome 10 risk allele; or (d) does not have a chromosome 1 risk allele.
  • the invention further includes, a method for increasing HTRA1 expression in a cell comprising expressing the activating system or the targeting system, in the cell.
  • the invention includes a method of treating, preventing development of, slowing progression of, reversing or ameliorating symptoms and signs of Chr 10 AMD in a subject, comprising administering an agent(s) that increases HTRA1 expression in RPE cells or horizontal cells or photoreceptor cells of the subject.
  • the subject exhibits a Chr 10 AM D clinical phenotype.
  • the subject has a chromosome 10 risk allele.
  • the subject is homozygous for the chromosome 10 risk allele.
  • the subject does not have a chromosome 1 risk allele.
  • the transcription of an endogenous HTRA1 gene sequence is increased.
  • the agent is a ribonucleoprotein complex comprising: (a) a fusion protein of an enzymatically inactive Cas protein domain and a transcriptional activator domain and (b) a guide RNA.
  • the enzymatically inactive Cas protein is dCas9.
  • the ribonucleoprotein complex binds in the HTRA1 promoter region.
  • the ribonucleoprotein complex binds in the HTRA1 enhancer region.
  • the transcriptional activator domain binds an LHX2 binding motif.
  • the agent is a ribonucleic acid complex comprising a guide RNA and a Cas protein.
  • the subject carries a risk allele in the HTRA1 gene enhancer
  • the agent is a combination comprising (a) ribonucleic acid complex comprising a guide RNA and a Cas protein and (ii) a template repair polynucleotide comprising sequence of a non-risk allele corresponding to the risk allele.
  • FIG. 1 shows in situ hybridization of HTRA1 mRNA in human retina.
  • FIG. 2 shows microarray analysis of HTRA1 mRNA expression in the Newman data sets.
  • FIG. 3A and 3B show qRT-PCR analysis of HTRA1 mRNA expression in the DiaxonHit (A) and Newman (B) data sets (human ocular tissues).
  • FIG. 4A and 4B show allele-specific expression of HTRA1 in human ocular tissues (RPE- choroid and neural retina) and RPE scrapes, respectively.
  • the amount of HTRA1 mRNA containing the risk allele at rsl049331 relative to the amount of HTRA1 mRNA with the non-risk allele was determined.
  • FIG. 5A and 5B show polarized expression of HTRA1 protein in hTERT-RPEl and differentiated human fetal RPE cells.
  • FIG. 6 shows the amounts of HTRA1 protein detected in various tissue extracts from human eye.
  • FIG. 7. shows the predicted and observed isoforms of long non-coding RNA IncSCTMl (LOC105378525).
  • FIG. 8 shows allele-specific expression of human HTRA1 mRNA and IncSCTMl RNA in RPE- choroid and retina.
  • FIG. 9 shows the consensus binding motif for LHX2 protein and disruption of the motif by the risk allele at the rs36212733 polymorphic site.
  • FIG. 10A and 10B show the binding of LHX2 to ChrlO probes containing the non-risk (WT) sequence at rs36212733 but weaker binding to the risk sequence and no binding to a scrambled sequence.
  • FIG. 11 shows the result of preferential binding affinity of LHX2 for the non-risk ChrlO probe sequence relative to the risk sequence.
  • FIG. 12A and 12B shows HTRA1 protein and mRNA levels in the human retina by ChrlO genotype group
  • FIG. 13A and 13B shows HTRA1 protein and mRNA levels in RPE-choroid by ChrlO genotype group.
  • FIG. 14 shows the sgRNA sequences used to target the HTRA1 promoter.
  • FIG. 15 shows the HTRA1 and IL1B mRNA levels (quantitative RT-PCR) using total RNA isolated from hlRPE7 cells treated with CRISPR-based SAM components for 72 hours.
  • FIG. 16 shows HTRA1 mRNA levels (quantitative RT-PCR) in total RNA of hlRPE7 cells mock transfected or transfected with LentiMPFI plasmid (MPH), LentiSAM plasmid (SAM) or both (MPH + SAM) for 72 hours.
  • MPH LentiMPFI plasmid
  • SAM LentiSAM plasmid
  • FIG. 17A and 17B show levels of HTRA1 (FIG. 17A) and IL1B (FIG. 17B).
  • mRNAs quantitative RT-PCR
  • P7 sgRNA-LentiSAM P7
  • P18 P18
  • ILlB-targeted P2 sgRNA-LentiSAM with and without LentiMPH plasmid (MPH) for 72 hours.
  • FIG. 18A and 18B show levels of HTRA1 mRNA (quantitative RT-PCR) in total RNA of hlRPE7 cells transfected with different amounts of P7 sgRNA-LentiSAM plasmid (SAM) for 72 hours.
  • FIG. 19A and 19B show the results of HTRA1 ELISA, (A) Standard curve of HTRA1 protein; (B) HTRA1 protein levels in cell culture supernatant of hlRPE7 transfected with different amounts (2.5, 5.0 and 7.5 pg) of Ctrl sgRNA- or P18 sgRNA-LentiSAM for 3, 4 and 5 days.
  • FIG. 20A and 20B show the results of normalized HTRA1 protein levels (A) and HTRA1 mRNA levels (B) in hlRPE7 cells transfected with different amounts (2.5, 5.0 and 7.5 pg) of Ctrl sgRNA- LentiSAM or P18 sgRNA for 3, 4 and 5 days.
  • FIG. 23A and 23B show the results of normalized HTRA1 protein levels (A) and HTRA1 mRNA levels (B) in hlRPE7 cells transduced with MOI 20 of Ctrl sgRNA- or P18 sgRNA-LentiSAM for 3, 6 and 9 days.
  • FIG. 24 shows HTRA1 mRNA levels in HTRA1 knockdown RPE1 cells transfected with promoterless (None), BEST1, RPE65 or CMV-HTRA1 plasmids using lipofectamine 3000 for 72 hours relative to the control pCTM259 vector.
  • FIG. 25 shows HTRA1 mRNA levels in RPE1 cells transfected with promoterless (None), BEST1, RPE65 or CMV-HTRA1 plasmids using lipofectamine 3000 for 72 hours relative to the control pCTM259 vector.
  • FIG. 26 shows a time course kinetics of HTRA1 mRNA expression in RPE1 (HTRA1 KD) cells transfected with AAV2-HTRA1 plasmids driven by the BEST1-, RPE65- or CMV-derived promoters
  • FIG. 27A-27C show a time course kinetics of HtrAl protein expression in RPE1 (HTRA1 KD) cells transfected with AAV2-HTRA1 plasmids driven by the BEST1-, RPE65- or CMV-derived promoters.
  • FIG. 28 shows an example of allele-specific deletion of a region within the ChrlO risk locus encompassing the ARMS2 gene.
  • FIG. 29 shows the 'causal' (regulatory) region and IncSCTMl on AMD Chromosome 10 Locus.
  • the ChrlO regulatory region is approximately 2-4 kb.
  • a novel IncRNA (designated IncSCTMl) was identified that overlaps this regulatory region.
  • the novel IncRNA contains ARMS2 rsl0490924.
  • the arrows show that IncSCTMl is transcribed in the anti-sense orientation from the HTRA1 promoter and may share a divergent promoter with HTRA1.
  • FIG. 30 shows microarray analysis of HTRA1 mRNA expression with exon targeted probes in human extramacular RPE-choroid (FIG. 30A), extramacular retina (FIG. 30B), macula RPE-Choroid (FIG. 30C) and macula retina (FIG. 30D) comparing ChrlO non-risk (GG) donors to heterozygous (GT) and homozygous risk (TT) donors.
  • GG ChrlO non-risk
  • GT heterozygous
  • TT homozygous risk
  • HTRA1 mRNA and/or protein levels in the eye provides benefit to subjects with, or at risk of developing, age- related macular degeneration (AMD).
  • AMD age-related macular degeneration
  • increasing HTRA1 mRNA and/or protein levels provide benefit to patients having manifestations of chromosomelO- directed AMD (or "Chr 10 AMD") or genetically predisposed to developing chromosome-10 directed AMD.
  • the disclosure provides methods and reagents for treating, preventing development of, slowing progression of, reversing, or ameliorating the symptoms and signs of age-related macular degeneration (AMD) by increasing HTRA1 expression or levels in the eyes of a subject in need of treatment.
  • AMD age-related macular degeneration
  • Exemplary methods of treating, preventing the development, slowing the progression of, reversing or ameliorating symptoms and signs of Chr 10 AMD are described.
  • the methods comprise administering an agent to a subject, wherein the agent increases HTRA1 mRNA and/or protein levels in RPE cells of the subject, or alternatively horizontal cells or photoreceptor cell.
  • Exemplary methods for increasing HTRA1 mRNA and/or protein levels in cells are described below.
  • HTRA1 expression is increased in retinal pigmented epithelial (RPE) cells of the subject.
  • HTRA1 mRNA and/or protein levels in the eye include transcriptional regulation of HTRA1, including upregulation of expression of endogenous HTRA1 using CRISPRa, CRISPR-mediated repair in risk region, gene therapy to introduce HTRA1 protein coding sequences into a cell, reducing degradation of HTRA1 within the cell, and cell therapy.
  • the invention is not limited to specific methods and any therapeutically effective approach may be used.
  • the "increasing expression of HTRA1" refers to increasing the level of HTRA1 protein by increasing transcription from an endogenous or exogenous gene and the production of a gene product (mRNA or protein).
  • HTRA1 expression may refer to production of HTRA1 mRNA or HTRA1 protein.
  • Increasing expression may also refer to methods of increasing the amount of HTRA1 protein through mechanisms other than transcription, such as increasing the stability of HTRA1 protein or mRNA in a cell, increasing the rate of translation of HTRA1 mRNA, mRNA recruitment, and direct introduction of exogenous HTRA1 protein into a cell. It will be recognized by the reader that “increasing HTRA1 expression” may refer to increasing the amount of a desired species of HTRA1 protein.
  • increasing HTRA1 expression may refer to increasing the amount of HTRA1 protein with a sequence not associated with the risk genotype.
  • HTRA1 serine protease activity is increased.
  • upregulate may be used to refer to an increase in the transcription (e.g. amount of mRNA production) by at least 10%, or at least 20%, or at least 30%, or at least 50% relative to a control cell not treated with an agent.
  • HTRA1 levels provide benefit to patients was unexpected.
  • the consensus in the AMD field has been that overexpression, not under-expression, of HTRA1 is associated with increased risk of developing AMD and that HTRA1 levels or activity should be reduced or inhibited to treat AMD.
  • Dewan et al (2006) reported the risk allele (A) of an HTRA1 promoter SNP at rsll200638 is associated with enhanced HTRA1 transcription in cultured RPE cells.
  • Yang et al (2006) also reported that circulating lymphocytes from individuals homozygous for the risk allele (AA) express higher levels of HTRA1 mRNA as compared to lymphocytes from individuals homozygous for the non-risk allele (GG). Chan et al.
  • HTRA1 expression is up- regulated at the mRNA level in archived eyes of patients with AMD and concluded that the enhanced expression of HTRA1 was the cause of active neovascularization in the macular lesions of wet AMD.
  • HTRA1 protein and mRNA levels in human extramacular retina and RPE-choroid as function of age in donors with or without risk at the ChrlO locus demonstrated that in the retina HtrAl levels are relatively unchanged with age, independent of a subject's ChrlO risk status, but in the RPE-choroid there is a significant increase with age in HtrAl mRNA and protein levels of donors without ChrlO risk, as compared to donors with risk alleles.
  • HTRA1 allele-specific expression assay was used to narrow the region of chromosome 10 that is causal for AMD.
  • the assay used mRNA derived from human donors eyes with rare recombination events within the AMD-associated ARMS2/HTRA1 LD block.
  • We mapped the region associated with decreased HTRA1 mRNA to an approximately 4 kb regulatory region (between and including rsll200632 and rs3750846) upstream from the HTRA1 coding sequence.
  • the 4 kb region includes rsl0490924 ( ARMS2 A69S).
  • the same genetic region was found to be associated with elevated risk of AMD disease by Grassmann et al.
  • the “2 kb AMD risk region,” (SEQ ID NO: 14) is equivalently referred to as the “2 kb risk region,” “2 kb regulatory region,” “2kb causal region” or “2 kb region.”
  • the 2 kb AMD risk region is also referred to as the "HTRA1 enhancer region.”
  • the HTRA1 "promoter sequence” comprises CRISPRa (CRISPR activation) target sequences and other features.
  • the promoter region sequence is provided in the following sequences. Unless indicated otherwise or clear from context, references to “promoter” herein is intended to refer to each of these ranges of sequence.
  • SEQ. ID NO: 8 (300 bp) shows the HTRA1 primary promoter sequence including 300 bp 5' from the putative transcription start site.
  • SEQ. ID NO: 5 (469 bp) shows the extended promoter sequence with additional upstream sequence.
  • SEQ. ID NO: 7 (400 bp) shows the primary promoter sequence plus 100 bp of 5' UTR sequence.
  • the "native promoter region” is SEQ ID NO:13 (853 bp) with both promoter and UTR sequence.
  • gene therapy is used to enhance expression of endogenous HTRA1 in RPE cells.
  • gene therapy involves delivering a transcriptional activator that can bind to a transcriptional regulatory region of HTRA1 and promote the transcription of HTRA1.
  • a targeting moiety e.g., a Cas protein-guide RNA complex
  • binds the HTRA1 promoter region and positions a transcriptional activator in proximity to the HTRA1 promoter region is used.
  • a targeting moiety binds the HTRA1 enhancer region and positions the transcriptional activator in proximity to a transcription activator binding motif.
  • the transcriptional activator activity is provided by a fusion protein of a transcriptional activator and a DNA targeting protein.
  • a DNA targeting protein disclosed herein can be a DNA targeting protein that binds to the HTRA1 transcriptional regulatory region.
  • Various platforms using DNA targeting proteins may be used, as discussed below.
  • CRISPRa CRISPR activation
  • a transcriptional activator is provided as fusion protein in which a nuclease-deficient type-ll CRISPR-associated protein (Cas) is the DNA targeting protein.
  • the Cas is modified so that it lacks endonuclease activity (i.e., a "nuclease- dead Cas" or "dCas").
  • the Cas is dCas9.
  • the Cas is dCasl2a.
  • the Cas is any Cas protein with modifications that render it nuclease deficient.
  • the invention is not limited to this method of activation and non- Cas proteins or moieties that direct a transcriptional activator to a promoter or enhancer region can be used.
  • dCas9 is used to mediate upregulation of HTRA1 expression in a CRISPR activation ("CRISPRa") system.
  • CRISPRa CRISPR activation
  • Cas9 which is widely used in the type II CRISPR/Cas system and generates double stranded breaks in genomic DNA when directed to a target sequence
  • dCas9 lacks nuclease activity and does not generate double stranded breaks in DNA.
  • dCas9 may be connected to a transcriptional activator and complexed with a guide RNA (e.g., sgRNA) that specifically hybridizes to a sequence in the HTRA1 promoter region to achieve precise and robust RNA-guided transcription regulation.
  • a guide RNA e.g., sgRNA
  • dCas9-mediated gene activation systems are well known and are described in, e.g., Dominquez et al., 2016, "Beyond editing: repurposing CRISPR-Cas9 for precision genome regulation and interrogation,” Nat. Rev. Mol. Cell. Biol. 17:5-15.
  • nuclease deficient Cas proteins may also be used to recruit a transcriptional activator to a promoter or enhancer site.
  • a dCasl2a domain may be fused to a transcriptional activator domain for use in the methods of the invention (see Sarstedt, "Spotlight on Casl2 A search for more type V Casl2 family members turns up unexpected functionality", Nature Methods, 2019, 16:213-219; Pickar-Oliver et al., "The next generation of CRISPR-Cas technologies and applications", Nature Reviews Molecular Cell Biology, 2019, 20:490-507; Kleinstiver et al., "Engineered CRISPR- Casl2a Variants with Increased Activities and Improved Targeting Ranges for Gene, Epigenetic And Base Editing", Nature Biotechnology, 2019, 37:276-282; Xu et al., 2018, “A CRISPR-dCas Toolbox for Genetic Engineering and Synthetic Biology", J. Mol. Biol. doi.org/10.
  • the method disclosed herein comprises administering an agent to the patient, where the administration results in delivery of the dCas-transcriptional activator fusion protein and one or more sgRNAs to the eye (e.g., RPE) of a patient in need of treatment.
  • the fusion protein binds to the HTRA1 regulatory region under the guidance of one or more single guide RNAs (sgRNAs) thereby upregulating HTRA1 transcription.
  • sgRNAs single guide RNAs
  • the dCas9 is derived from Staphylococcus aureus ("Sa-dCas9").
  • the dCas9 is derived from Staphylococcus pyogenes ("Sp-dCas9").
  • the dCas9-transcriptional activator fusion protein can take different configurations, such as those disclosed in Dominguez et al., Nat Rev Mol Cell Biol. Jan; 17(1): 5-15 (2016).
  • the fusion protein can consist of multiple copies of a transcriptional activator and one copy of dCas9.
  • transcription factor useful for increasing HTRA1 mRNA or protein expression bind in the HTRA1 promoter or enhancer regions, and the binding results in increased transcription in cells of a subject, e.g., RPE cells, horizontal cells, or photoreceptor cells.
  • transcription factor encompasses factors that bind in a promoter region, including factors that activate transcription via a transactivation domain ("TAD") and factors that bind in an enhancer region, including factors that activate transcription via a scaffold, such as a LIM element, that can recruit and assemble additional transcription factors and chromatin remodeling proteins to initiate transcription, or through other mechanisms.
  • TAD transactivation domain
  • an enhancer region including factors that activate transcription via a scaffold, such as a LIM element, that can recruit and assemble additional transcription factors and chromatin remodeling proteins to initiate transcription, or through other mechanisms.
  • transcription factor Members of both classes of transcription factor include a DNA-binding domain, which directs the transcription factor to the target promoter or enhancer element, and an effector domain (e.g., TAD or scaffold or the like).
  • the invention makes use of fusion proteins that combine the DNA binding and recognition properties of a nuclease deficient Cas/guide RNA system with the transcription effector properties of a transcription factor.
  • Transcription factor effector domains used in the present invention may be from any source but are generally derived from human or viral transcriptional factors or engineered derivatives thereof.
  • Exemplary transcription factors useful for upregulation of HTRA1 transcription include VP16, VP64, VP160 (VP64 consisting of two or more copies of VP16, and VP160 consists of ten tandem copies of VP16); MLL (UniProt ID Q00613), E2A (UniProt ID P15923), HSF1 (UniProt ID Q.00613), NF-IL6 (UniProt ID P17676), NFAT1 (UniProt ID Q13469), NFIX (UniProt ID Q14938), NF-kB (UniProt ID Q04206); MEF2A (Potthoff & Olson (2007), "MEF2: a central regulator of diverse developmental programs," Development 2007;134(23):4131-4140; UniProt ID Q02078); and YY1 (Weintraub et al.
  • TFs Fluman transcription factors
  • Lambert et al. describe over 1,600 likely human transcription factors (Lambert et al., 2018, “The Human Transcription Factors” Cell 172:650-665). Also see Fulton et al. (2009), “TFCat: the curated catalog of mouse and human transcription factors", Genome Biol 2009; 10: R29, Vaquerizas et al. (2009), “A census of human transcription factors: function, expression and evolution”, Nat. Rev. Genet. 2009; 10: 252-263, Wingender et al. (2015), "TFCIass: a classification of human transcription factors and their rodent orthologs", Nucleic Acids Res.
  • Transcription factor binding motifs are known and are described in collections such as TRANSFAC (Matys et al. (2006), “TRANSFAC and its module TRANSCompel: transcriptional gene regulation in eukaryotes", Nucleic Acids Res. 2006; 34: D108-D110), JASPAR (Mathelier et al. (2016), “JASPAR 2016: a major expansion and update of the open-access database of transcription factor binding profiles", Nucleic Acids Res. 2016; 44: D110-D115), HT-SELEX (Jolma et al. (2013), "DNA-binding specificities of human transcription factors", Cell 2013; 152: 327-339; Jolma et al.
  • Fusion proteins in which a transcription factor effector domain is combined with a nuclease deficient DNA binding domain can also be made using programmable nucleases other than Cas proteins, including, for example, with TALENs and ZFNs.
  • a targeting moiety includes an RNA with a region of complementarity to the DNA target.
  • the RNA can be referred to as a guide RNA (gRNA) and the region of complementarity can be referred to as the guide sequence.
  • the "guide sequence" of a gRNA is the sequence that confers target specificity. It hybridizes with (i.e., it is the reverse complement of) the opposite strand of a target sequence.
  • CRISPR systems include two RNA molecules: tracrRNA, which binds the Cas endonuclease, and crRNA, which binds to the DNA target sequence.
  • sgRNA chimeric single guide RNA
  • crRNA-tracrRNA fusion that obviates the need for RNase III and crRNA processing in general, and which binds both the Cas and target.
  • sgRNA chimeric single guide RNA
  • reference to a "sgRNA” encompasses any targeting method using any suitable guide RNA with appropriate binding specificity [e.g., a sgRNA, crRNA, or other RNA comprising the guide sequence).
  • the most commonly used sgRNA's are approximately 100 base pairs in length.
  • the programmable targeting sequence comprises approximately 20 bases at or near the 5' end of the sgRNA. By programming this sequence the CRISPR Cas9 system or other Cas system can be targeted towards any genomic region complementary to that sequence.
  • sgRNAs are also commercially available, for example, from Dharmacon, Inc., as published in websites, such as dharmacon. horizondiscovery.com/ applications/ crispra-transcriptional -activation-for-gene-overexpression or benchling.com/academic; and Broad institute .org/gpp/public/ analysis-tools/sgrna-design-help-crisprai.
  • the invention provides a guide RNA (gRNA) comprising guide sequence with at least 10 contiguous nucleotides corresponding to a target sequence in the HTRA1 promoter.
  • the guide RNA is an sgRNA.
  • the guide sequence comprises at least 10, at least 15, at least 20, or at least 25 nucleotides.
  • the guide sequence is 20 nucleotides in length.
  • the invention provides a guide RNA comprising a guide sequence, where the guide RNA is complexed with a Cas (such as Cas9) lacking nuclease activity (e.g ., dCas9).
  • the invention provides a guide RNA, such as a sgRNA, complexed with a Cas fusion protein including a Cas DNA binding domain and a transcription activator.
  • a guide RNA such as a sgRNA
  • a Cas fusion protein including a Cas DNA binding domain and a transcription activator.
  • the Cas is a nuclease deficient dCas (such as dCas9).
  • the DNA target sequence (e.g., in the HTRA1 promoter or enhancer) is contiguous with a protospacer adjacent motif (PAM) recognized by the Cas protein.
  • PAM protospacer adjacent motif
  • Cas9 generally requires the PAM motif NGG for activity.
  • certain target sequences (and accordingly certain guide sequences) will be preferred based on the proximity of the target sequence to a PAM.
  • some Cas proteins, including variants of Cas9 have flexible PAM requirements (see Karvekis et al., 2019, "PAM recognition by miniature CRISPR-Casl4 triggers programmable double-stranded DNA cleavage.” bioRxiv. https://doi.org/10.1101/654897; Legut et al., 2020, "High-Throughput Screens of PAM-Flexible Cas9", Cell Reports 30:2859-2868; Jakimo et al.,
  • Exemplary PAMs include SpCas9 from Streptococcus pyogenes NGG; SpCas9 from Streptococcus pyogenes NRG; StCas9 from Streptococcus thermophilus N NAGAAW; NmCas9 from Neisseria meningitidis NNN NGATT; SaCas9 from Staphylococcus aureus NNGRRT; SaCas9 variant (KKH SaCas9) NNNRRT; SpCas9 D1135E variant NGG; SpCas9 VRER variant NGCG; SpCas9 EQR variant NGAG; SpCas9 VQR variant NGAN or NGNG 3'; AsCpfl from Acidaminococcus, LbCpfl from Lachnospiraceae TTTN; FnCpfl from Francisella novicida strain U112 TTN and/or CTA; C2cl from four major taxa: Bacilli, Verruco
  • an HTRA1 promoter target is found in SEQ ID NO:13.
  • the HTRA1 promoter target is found in SEQ ID NO:5.
  • the HTRA1 promoter target is found in SEQ ID NO:8.
  • the HTRA1 promoter target is found in SEQ ID NO:13. In some approaches the HTRA1 promoter target is found in SEQ I D NO:7. In one approach an HTRA1 enhancer target is found in SEQ ID NO:14 (2 kb region). In some approaches the HTRA1 target is found in SEQ ID NO: 14 (2 kb region) or SEQ ID NO:34 (4 kb region).
  • a guide sequence hybridizes to a target sequence that includes at least 10, at least 15, at least 20, or about 20 contiguous nucleotides of an HTRA1 promoter sequence (SEQ ID NO:5, SEQ I D NO: 7, SEQ ID NO: 8, or SEQ I D NO: 13) or of the reverse complement of SEQ I D NO:5, SEQ ID NO: 7, SEQ ID NO: 8, or SEQ ID NO: 13 or an HTRA1 enhancer sequence (SEQ I D NO:14 or 34) or of the reverse complement of SEQ ID NO: 14 or 34.
  • HTRA1 promoter sequence SEQ ID NO:5, SEQ I D NO: 7, SEQ ID NO: 8, or SEQ I D NO: 13
  • SEQ ID NO: 13 an HTRA1 enhancer sequence
  • the guide sequence comprises 10 or more contiguous bases of a promoter sequence given above.
  • sequences that comprise 10 contiguous bases of SEQ NO: 13 include GTCCCAACGG; TCCCAACGGA; CCCAACGGAT; CCAACGGATG; CAACGGATGC, etc., or the reverse complement thereof.
  • Sequences that comprise 10 or more contiguous bases of SEQ NO: 13 include a sequence encoding bases 1 to 10 of SEQ I D NO: 13, encoding bases 2-11 of SEQ I D NO:13, encoding bases 3-12 of SEQ NO: 13, etc.
  • Sequences that comprise 10 or more contiguous bases of SEQ NO: 13 include a sequence in which a nucleotide is base X of SEQ ID NO: 13, where X is 1 to 300, and the 10 contiguous bases extend to X + Y of SEQ I D NO: 13 where Y is 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more with the proviso that the guide sequence is often less than 50 bases in length.
  • a sequence of 15 contiguous nucleotides, or at least 20 can be described in the same way.
  • the guide sequence comprises 15 or more contiguous bases of SEQ NO: 13 (GTCCCAACGGATGCA; TCCCAACGGATGCAC; CCCAACGGATGCACC; CCAACGGATGCACCA; CAACGGATGCACCAA) or the reverse complement thereof.
  • each of the 10, 15 or 20 nucleotide sequences, and complements thereof can be listed in tables and individual sequences, or combinations of sequences, could be independently selected from such tables for inclusion into a set, or for exclusion from a set. That is, such tables would describe and provide basis for selecting or excluding individual sequence and combinations. It will be understood that the description above is intended to that the place of, and have the same content of, such tables.
  • Example 9 As described in Example 9 ( ⁇ 14.9), we designed sgRNAs with guide sequences that correspond to target regions in SEQ ID NO:13, denoted SEQ ID NO: 15-33, and tested their ability to activate transcription from the HTRA1 promoter.
  • the gRNA used in the present methods target a sequence comprising one SEQ. ID NO: 15-33.
  • the target sequence in the gene of interest may be complementary to the guide region of the sgRNA.
  • there is exact complementarity or identity between a guide sequence of a gRNA and its corresponding target sequence may be less than 100%
  • the degree of complementarity or identity between a guide region of a sgRNA and its corresponding target sequence may be less than 100% although 100% identity is desired to avoid off-target effects.
  • the guide region of a sgRNA and the target region of a gene of interest may be at least 95% identical (e.g., one mismatch out of 20), at least 90% identical or at least 85% identical.
  • Methods of delivery to cells of a Cas protein e.g., Cas9 and dCas9 fused to a transcriptional activator protein and gRNA are known.
  • the fusion protein can be delivered in protein form (e.g., via microinjection). More often, the fusion protein is delivered in DNA form, e.g., in a suitable vector that can be introduced into RPE or choroid cells.
  • DNA encoding the gRNA is cloned into a vector downstream of a promoter (e.g., U6 promoter) for expression.
  • the delivery is by a virus e.g., lentivirus, adeno-associated virus (AAV), as described in Byrne et al., Methods Enzymol. 546, 119-38 (2014); Cong et al., Science (80). 339, 819-823; Hirsch et al., Mol. Ther. 18, 6-8 (2010).
  • the delivery is by cell-derived nanovesicles or other methods. Also see ⁇ 7 below.
  • a CRISPRa system known as a synergistic activation mediator (SAM) is used to increase the expression of HTRA1 in Chr 10 AMD patients.
  • SAM synergistic activation mediator
  • the SAM system uses multiple transcription factors, which can further improve the potency of Cas9-mediated gene activation. See, Konermann et al., Nature, January 29; 517(7536) 2015), the relevant disclosure is herein incorporated by reference.
  • this system uses two plasmids, one encoding both the sgRNA and a dCas9- transcriptional activator, e.g., dCas9-VP64 molecule, and the other encoding a MS2-TAD fusion protein.
  • the MS2-TAD comprises an MS2 polypeptide and at least one transcription activation domain.
  • the MS2-TAD fusion protein comprises an MS2 polypeptide (SEQ ID NO:56) and the transactivation domains of p65 and HSF1 (MS2-p65-HSFl).
  • the sgRNAs used in the SAM system comprise one or more MS2 binding sequences [e.g., SEQ. ID NO.: 55), which can bind to the MS2-TAD fusion protein.
  • two MS2 binding sequences are included in the gRNA: one in the tetraloop and one on the stem loop of the gRNA.
  • Plasmids encoding MS2-TAD are commercially available, e.g., the LentiMPFI plasmid (Addgene, Watertown, MA, USA). Plasmids that encode the sgRNAs and the dCas9-VP64 fusion proteins can be constructed by cloning the suitable sgRNA coding sequences into a plasmid that carries the dCas9-VP64 coding sequence. Plasmids that carry the dCas9-VP64 coding sequence are also commercially available, e.g., the LentiSAM plasmid from Addgene (Watertown, MA, USA). The sgRNA coding sequences can be clone cloned into the LentiSAM plasmid.
  • transcription from an endogenous FITRA1 gene is increased by binding a transcription activator to a site in the HTRA1 2 kb (enhancer) region.
  • HTRA1 2 kb enhancer
  • the inventors have identified a binding motif for the transcription activator LFIX2 which overlaps the risk allele of rs36212733.
  • LFIX2 binding to the risk allele is absent or is diminished relative to binding to the non-risk allele, and that this results in reduced expression of HTRA1.
  • an LHX2 LIM domain fused to a Cas-protein is combined with an appropriate guide RNA and recruited to the LFIX2 risk binding site in a patient carrying the risk allele.
  • LHX2 delivery of LHX2 to the vicinity of the risk allele binding site is believed to result in increased gene expression because the tethering of the transcription activator effectively increases the local concentration of LHX2, eliminating or mitigating the negative effect of the risk variation on binding, and resulting in increased expression of FITRA1.
  • the LFIX2 transcription activator is modified to efficiently bind the risk allele sequence, thereby resulting in increased transcription.
  • a risk allele coincident with a transcription activator binding site may reduce or otherwise affect binding of a transcription activator and result in lower FITRA1 expression, and that recruiting a corresponding transcription activator to the site can increase FITRA1 expression
  • a review of the 2 kb region was conducted to identify other risk associated sequence variations that are coincident with a transcription activator binding motif.
  • Analysis of the risk alleles (i.e., risk-associated supplementary variant) at rsl44224550, rsl0490924, rs3750848 and rs6212733 identified several binding motifs (in addition to the LXH2 motif) coincident with the risk-associated SNP.
  • rsl44224550 (10:122455084-122455085): Nkx2-5(var2); NFIX; [0088] rs36212733 (10:122455695); MEF2A; HOXB4; ALX3; HOXD3; LBX1; HOXD4; VAX1; LBX1;
  • rsl0490924 (10:122454932) RHOXF; Myog; TCF12; ASCL1; Ascl2; NHLH1; BHLHA15 var2
  • rs3750848 (10:122455799); YY1; BARX2;
  • effector domains from a transcriptional activator listed above such as LIM domains from LXH2 are positioned (e.g., using CRISPRa) to the corresponding binding motif to increase HTRA1 expression.
  • NFIX, M EF2A and YY1 are expressed in the RPE at FPKM greater than 1, based on RNA-Seq data.
  • FITRA1 expression is increased by binding of any one of NFIX, MEF2A and YY1 to its corresponding binding motif.
  • the guide sequence for an appropriate guide RNA will bind a target sequence with a terminus within 20 bases of the risk associated nucleotide, sometimes within 50 bases, and sometimes within 100 bases.
  • CRISPR/Cas systems Other systems for (a) sequence-specific ("programmable") modification of nucleic acids and (b) sequence-specific recruitment of transcription activators to promoter and enhancer regions may also be used. Examples of such systems include a zinc-finger nuclease systems, transcription activator like effector nuclease (TALEN) systems, Homing endonuclease systems, meganuclease systems or a Cre recombinase systems (e.g., Cre-induced recombination between cryptic loxP sites).
  • TALEN transcription activator like effector nuclease
  • Cre recombinase systems e.g., Cre-induced recombination between cryptic loxP sites.
  • each genome modification method a specific nucleic acid sequence is targeted, and a subsequent modification is made.
  • modifications include the target sequence being edited by homologous recombination, non-homologous end joining, homology- directed repair, histone modification, transcriptional activation, RNA editing, transcriptional repression.
  • examples of engineering without cleavage are described by Thakore et al. 2018 in "RNA-guided transcriptional silencing in vivo with S. aureus CRISPR-Cas9 repressors" Nat Commun. 9(1):1674 and by Amabile et al.
  • the DNA- targeting molecule comprises one or more zinc-finger proteins (ZFPs) or domains thereof that bind to DNA in a sequence-specific manner and that are fused to a nuclease.
  • ZFPs zinc-finger proteins
  • a ZFP or domain thereof is a protein or domain within a larger protein that binds DNA in a sequence-specific manner through one or more zinc fingers, regions of amino acid sequence within the binding domain whose structure is stabilized through coordination of a zinc ion.
  • the term zinc finger DNA binding protein is often abbreviated as zinc finger protein or ZFP.
  • ZFPs are artificial ZFP domains targeting specific DNA sequences, typically 9-18 nucleotides long, generated by assembly of individual fingers.
  • ZFPs include those in which a single finger domain is approximately 30 amino acids in length and contains an alpha helix containing two invariant histidine residues coordinated through zinc with two cysteines of a single beta turn, and having two, three, four, five, or six fingers.
  • sequence-specificity of a ZFP may be altered by making amino acid substitutions at the four helix positions (-1, 2, 3 and 6) on a zinc finger recognition helix.
  • the ZFP or ZFP-containing molecule is non-naturally occurring, e.g., is engineered to bind to a target site of choice.
  • a target site of choice See, for example, Beerli et al. (2002) Nature Biotechnol. 20:135-141; Pabo et al. (2001) Ann. Rev. Biochem. 70:313-340; Isalan et al. (2001) Nature Biotechnol. 19:656-660; Segal et al. (2001) Curr. Opin. Biotechnol. 12:632-637; Choo et al. (2000) Curr. Opin. Struct. Biol. 10:411-416; U.S. Pat. Nos.
  • the DNA-targeting molecule is or comprises a zinc-finger DNA binding domain, TALEN, or other DNA-targeting protein fused to a DNA cleavage domain to form a targeted nuclease.
  • fusion proteins comprise the cleavage domain (or cleavage half-domain) from at least one Type IIS restriction enzyme and one or more DNA-targeting protein.
  • the cleavage domain is from the Type IIS restriction endonuclease Fok I. Fok I generally catalyzes double-stranded cleavage of DNA, at 9 nucleotides from its recognition site on one strand and 13 nucleotides from its recognition site on the other.
  • programable nuclease can refer to CRISPR family Cas nuclease or derivative thereof, a transcription activator-like effector nuclease (TALEN) or derivative thereof, a zinc-finger nuclease (ZFN) or derivative thereof, and a homing endonuclease (HE) or derivative thereof.
  • TALEN transcription activator-like effector nuclease
  • ZFN zinc-finger nuclease
  • HE homing endonuclease
  • the method of treating, preventing development, slowing progression of, reversing or ameliorating symptoms and signs of Chr 10 AMD comprises administering an agent to modify the genomic DNA of the patient's RPE cells by converting or substituting one or more of the risk alleles with corresponding non-risk alleles.
  • the alleles are in the 2.0 kb risk region (see, e.g., Example 5 and Fig, 13).
  • gRNAs that target one or more of the risk alleles in the 2 kb region are used. These risk alleles include but not limited to, rsl0490924 (the risk allele is T), rsl44224550 (risk allele is GT insertion), rs36212731 (the risk allele is T), rs36212733 (the risk allele is C), rs3750848 (the risk allele is G), rs3750847 (the risk allele is T), and rs3750846 (the risk allele is C). Exemplary sgRNAs/guide sequences that can be used to target these risk alleles are shown in Table 1, below. The nucleotides in bold are found in the risk alleles.
  • An sgRNA, Cas protein and a template repair polynucleotide comprising sequence of a non risk allele can be introduced to RPE cells in one or more viral vectors.
  • the template repair sequence generally requires a certain amount of overlap (homology) on each side of the cut site.
  • the "homology arms" of the donor template should be approximately 200-500 nucleotides.
  • each homology arm should be approximately 500-800 nucleotides. This results in the risk allele being replaced with the wild type allele, thus restoring HTRA1 expression in the RPE cells in ChrlO AMD patients to normal levels.
  • Exemplary repair sequences are shown in Table 2.
  • the guide sequence does not have to directly overlap the target SNP. If the sgRNA is near or adjacent to the SNP , that will suffice to allow homology-directed repair of the defective SNP.
  • adjacent to means the closest nucleotide hybridized to a guide sequence nucleotide is within 25 nucleotides from the SNP or other repair site, preferably withing 20 nucleotides, and sometimes within 15 or 10 nucleotides.
  • a pair of gRNAs are used in the CRISPR/Cas9 system to remove the entire 2kb risk region in the RPE cells from ChrlO AMD patients.
  • the pair of sgRNAs are designed to target the two nucleotide positions, the region defined by the two positions encompasses the 2 kb risk region.
  • the sgRNAs are SEQ ID NO: 50 and SEQ ID NO: 52.
  • the sgRNA pair are SEQ. ID NO: 51 and SEQ ID NO: 52.
  • a plasmid encoding a non-risk sequence corresponding to the deleted region and containing 500-800 nt of additional genomic sequence upstream of the 5' cut site and downstream of the 3' cut site is introduced to RPE cells such that the non-risk sequence are inserted into the deleted region by homology-directed repair, resulting in the 2kb risk region being replaced with non-risk sequence.
  • the sgRNA pairs, Cas9, and the plasmid encoding the non-risk template sequence may be introduced in the same or different viral vectors and may be introduced simultaneously or sequentially to increase the HTRA1 expression in the RPE cells of the ChrlO AMD patients.
  • CRISPR technology is used to introduce one or more nucleotide substitutions to the genomic DNA of the RPE or choroid cells in an individual carrying the Chr 10 risk alleles, thereby substituting one or more of the risk alleles with the corresponding non-risk alleles.
  • the "CRISPR/Cas" system refers to a widespread class of bacterial systems for defense against foreign nucleic acid.
  • CRISPR/Cas systems include type I, II, and III sub-types. Wild-type type II CRISPR/Cas systems use the RNA-mediated nuclease, for example, Cas9, in complex with guide and activating RNA to recognize and cleave foreign nucleic acid.
  • Cas proteins include Casl, CaslB, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csnl and Csxl2), CaslO, Csyl, Csy2, Csy3, Csel, Cse2, Cscl, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl7, Csxl4, CsxlO, Csxl6, CsaX, Csx3, Csxl, Csxl5, Csfl, Csf2, Csf3, Csf4, homologs thereof, or modified versions thereof.
  • S. pyogenes Cas9 protein may be found in the SwissProt database under accession number Q99ZW2.
  • Non-limiting examples of mutations in a Cas9 protein are known in the art (see e.g., WO2015/161276), any of which can be included in a CRISPR/Cas9 system in accord with the provided methods.
  • Cas9 homologs are found in a wide variety of eubacteria, including, but not limited to bacteria of the following taxonomic groups: Actinobacteria, Aquificae, Bacteroidetes- Chlorobi, Chlamydiae-Verrucomicrobia, Chlroflexi, Cyanobacteria, Firmicutes, Proteobacteria, Spirochaetes, and Thermotogae.
  • An exemplary Cas9 protein is the Streptococcus pyogenes Cas9 protein. Additional Cas9 proteins and homologs thereof are described in, e.g., Chylinksi, et ai, RNA Biol.
  • Cas9 and its homologs can be used with sgRNAs to introduce specific modifications to the genomic regions of interest, e.g., the genomic region comprising one or more Chr 10 risk alleles.
  • RNA-mediated nucleases that can also be used in a CRISPR/Cas system to convert the risk alleles in the 2kb risk region include, for example, Cas 12a and Cascade/Cas3. See Pickar-Oliver and Gersbach, Nature, vol. 20, August 2019, the relevant portion of which is herein incorporated by reference.
  • Cas 12a recognizes a target sequence with complementarity to the spacer in the crRNA (sgRNA) positioned next to a 3' PAM.
  • sgRNA crRNA
  • Target recognition results in generation of a staggered DNA double-strand break.
  • Cascade/Cas3 is a multimeric complex that targets a DNA that has complementarity to the spacer portion of a crRNA and that is positioned next to a 3'PAM and generates a single strand nick.
  • the method comprises introducing into the RPE cells of an individual a CRISPR system, where the system may comprise a Cas9 protein and a guide RNA (e.g., an sgRNA) that hybridizes with the target sequence.
  • the sgRNA and Cas9 can be expressed from the same or different vectors of the system.
  • a donor vector encoding the non-risk nucleotide sequence that overlaps the cut site is co-delivered with the CRISPR-Cas9 plasmids.
  • the guide RNA targets a sequence comprising or near the risk allele, and the Cas9 protein cleaves the genomic DNA molecule.
  • the cut genomic DNA is repaired by homologous recombination using the donor sequence plasmid, resulting in a change in the genomic sequence from the risk allele to the non-risk allele.
  • Any of the risk alleles described above can be converted into non-risk alleles.
  • the entire 2.0 kb region (see Example 5) or the entire 4 kb AMD risk region (see Example 3) is converted such that it comprises no Chr 10 risk alleles, which restores HTRA1 expression in RPE cells.
  • a Cas9 nickase based CRISPR/Cas system may be used to correct the individual risk alleles.
  • a cas9 nickase protein contains a mutation in one of its nuclease domains.
  • the Cas9 nickase protein thus would "nick" target DNA, i.e., cause a single-strand DNA cut at a target site rather than a double-strand cut as with unmodified Cas9.
  • dCas9 contains a mutation in each of its two nuclease domains, while a Cas9 nickase contains a mutation in only one of its nuclease domains.
  • the guide RNA is able to target the Cas9 nickase to a specific genomic location.
  • the cas9 nickase protein is introduced with base editing proteins, such as cytidine deaminases (e.g., APOBEC1, AID, APOBEC3G, or CDA1), which convert cytosine bases to uracil bases (which have the base-pairing properties of thymine bases), and adenine deaminases, which convert adenosine bases to inosine bases (which have the base-pairing properties of guanosine).
  • cytidine deaminases e.g., APOBEC1, AID, APOBEC3G, or CDA1
  • adenine deaminases which convert adenosine bases to inosine bases (which have the base-pairing properties of guanosine).
  • the Cas9 nickase based on CRISPR/Cas system also include an inhibitor of cellular DNA repair response to promote base editing efficiency.
  • uracil DNA glycosylase inhibitor can be used to prevent uracil DNA glycosylase enzyme in cells from catalysing removal of uracil bases from DNA. Removal of uracil can lead to reversion of an edited uracil back to cytosine.
  • Cas9 nickase based gene editing systems are well-known and are described in, e.g., Komor et al., Nature, 533(7603): 420-424 (2016).
  • the system comprises a cytidine deaminase (APOBEC1) fused to the N-terminus of Cas9 nickase with a 16 amino acid residue XTEN linker, and uracil DNA glycosylase inhibitor (UGI) fused to the C-terminus of Cas9 nickase [e.g., editor BE3 in Komor Et al., Nature, 533(7603): 420-424 (2016)).
  • APOBEC1 cytidine deaminase
  • UFI uracil DNA glycosylase inhibitor
  • Such systems are able to efficiently edit C-G base pairs to T-A base pairs in vivo with low rates of indel (i.e., small deletions or insertions) formation and off-target activity (i.e., editing or indel formation at genomic locations other than the locus targeted by the guide RNA).
  • indel i.e., small deletions or insertions
  • off-target activity i.e., editing or indel formation at genomic locations other than the locus targeted by the guide RNA.
  • an editing protein linked to Cas9 nickase can target multiple bases, depending on the length of the linker sequence.
  • APOBEC1 fused to dCas9 with a 16 residue XTEN linker can deaminate cytosine bases within a window of approximately five nucleotides, typically from positions 4 to 8 within the protospacer sequence, counting the end distal to the protospacer-adjacent motif as position 1 (see, e.g., Komor et al., Nature, 533(7603): 420-424 (2016)).
  • guide RNA sequences can be designed to target one or multiple bases within such a window.
  • vector sequences expressing the Cas9 nickase and guide RNAs are integrated into host cell DNA as transgenes.
  • gene sequences encoding the APOBEC1- XTEN-Cas9 nickase-UGI fusion described above, along with guide RNAs may be integrated in a plasmid and transfected into cells in a population.
  • delivery of the CRISPR base editing system components is by a virus, e.g., lentivirus or adeno-associated virus (AAV).
  • the DNA sequences encoding the CRISPR base editing system components are too large for packaging in AAV, which has a genome packaging size limit of less than 5 kilobases.
  • the CRISPR base editing system components can be delivered using a dual-AAV strategy employing intein sequences.
  • Inteins are segments of a protein that are able to excise themselves and splice together the remaining protein portions.
  • Inteins of the precursor protein can come from two genes, in which case they are called split inteins.
  • split inteins In one example of such a dual-AAV strategy, as described in Levy et al., Nat. Biomed. Eng., 4(1): 97-110 (2020), cytosine base editors such as BE3 described above can be divided in half, with each half fused to half of a fast-splicing split intein.
  • Sequences encoding these products can be incorporated into two separate AAV genomes, along with sequences expressing guide RNAs, and co-transduced into cells. When both products are expressed in a cell, they can be spliced together, leading to reconstitution of a full-length base editor such as BE3.
  • treating AMD involves gene therapy to enhance HTRA1 expression in RPE cells.
  • Gene therapy is a well-known technology and described in e.g., Moore et al., 2017, “GENE THERAPY FOR AGE-RELATED MACULAR DEGENERATION” Expert Opinion on Biological Therapy 17:10: 1235-1244; Aponte-Ubillus et al., 2018, “MOLECULAR DESIGN FOR RECOMBINANT ADENO-ASSOCIATED VIRUS (RAAV) VECTOR PRODUCTION” Applied microbiology and biotechnology 102.3:1045-1054; Ochakovski et al., 2017, “RETINAL GENE THERAPY: SURGICAL VECTOR DELIVERY IN THE TRANSLATION TO CLINICAL TRIALS” Frontiers in Neuroscience 11; Schon et al., 2015, “RETINAL GENE DELIVERY BY ADENO-ASSOCIATED VIRUS (AAV) VECTORS: STRATEGIES AND APPLICATIONS
  • gene therapy is performed to introduce an exogenous HTRA1 protein in RPE cells.
  • the introduced exogenous HTRA1 has the same amino acid sequence as the native HTRA1 protein (SEQ ID NO: 2).
  • the exogenous HTRA1 protein has an amino acid sequence that differs from SEQ ID NO: 2 but shares at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% amino acid sequence identity with the amino acid sequence of SEQ ID NO: 2.
  • the exogenous HTRA1 protein differs from SEQ ID NO:2 (i.e., HTRA1 variants) but maintains the serine protease activity of HTRA1.
  • Serine protease activity of HTRA1 can be measured using methods well known in the art, for example, as described in Grau et al., Proc. Natl. Acad. Sci. U. S. A. April 26, 102 (17) 6021-6026 (2005).
  • maintaining the serine protease activity refers to that an exogenous HTRA1 protein with at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 95% serine protease activity of the native HTRA1 protein (SEQ ID NO: 2).
  • the gene therapy incudes administering a vector comprising a nucleic acid sequence ("cargo") that encodes an exogenous HTRA1 protein of SEQ ID NO:2 or variants as described above such as variants with serine protease activity of HTRA1.
  • the nucleic acid sequence includes SEQ ID NO: 1.
  • the nucleic acid sequence shares a significant sequence identity, e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% nucleic acid sequence identity with SEQ ID NO: 1.
  • the nucleic acid sequence encoding the exogenous HTRA1 protein has significant sequence identity with SEQ ID NO:2, e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, with SEQ ID NO: 2.
  • nucleic acids encoding the HTRA1 proteins include sequences that comprise deletions, insertions, or substitutions relative to the native HTRA1 nucleic acid sequence, which still result in a polynucleotide encoding a polypeptide with serine protease activity.
  • HTRA1 nucleic acids and polypeptides can also be modified through chemical or enzymatic alterations using methods well known to those of skill in the art. For example, sequences can be modified by the addition of lipids, sugars, peptides, organic or inorganic compounds, by the inclusion of modified nucleotides or amino acids, or the like. Accordingly, the FITRA1 nucleic acids and proteins can also be conjugated to another moiety (e.g., a reporter protein), the presence of which may facilitate the detection or serve other purposes.
  • a reporter protein e.g., a reporter protein
  • Viral vectors suitable for introducing an FITRAl-encoding sequence include, for illustration and not limitation, adenovirus, AAV2 virus, lentivirus, bovine papilloma virus (BPV-I), or Epstein-Barr virus (pHEBo, pREP-derived and p205).
  • Non-viral systems such as naked DNA formulated as a microparticle, may be used. See ⁇ 7, below.
  • the transgene (e.g., the exogenous HTRA1 gene, or the recombinant nucleic acid the expression of which in the RPE cells can increase the expression of the endogenous FITRA1 gene) that is delivered comprises a protein coding sequence operably linked to a promoter sequence.
  • the promoter is heterogeneous to the FITRA1 polynucleotide.
  • the promoter is a native FITRA1 promoter (e.g., SEQ ID NO: 13).
  • the promoter is an inducible promoter.
  • the promoter is a constitutive promoter.
  • the promoters may be naturally occurring promoters or hybrid promoters that combine elements of more than one promoter.
  • the promoter is a tissue-specific promoter.
  • the promoters are shortened versions of the human endogenous RPE-specific promoter sequences (e.g. RPE65-5022 nucleotides and BEST1-5479 nucleotides).
  • RPE-specific promoters include BEST1-EP-454; RPE65-EP-415; smCBA; CBA; RPE65-EP-419; sctmCBA; or VMD2, as described in International Patent Publication W02020019002.
  • promoters or modified promoters - including natural and synthetic - may also be used for controlling expression of the therapeutic products disclosed herein include, but are not limited to UBC, GUSB, NSE, synapsin, MeCP2, GFAP, PAI1, ICAM, flt-1, and CFTR (see Papadakis et al 2004; PROMOTERS AND CONTROL ELEMENTS: DESIGNING EXPRESSION CASSETTES FOR GENE THERAPY in Current Gene Therapy, 2004, 4, 89-113; Gray & Samulski 2011; VECTOR DESIGN AND CONSIDERATIONS FOR CNS APPLICATIONS in Gene Vector Design and Application to Treat Nervous System Disorders, ed. J.
  • Additional promoters include the early and late promoters of SV40, tet promoter, adenovirus or cytomegalovirus immediate early promoter, RSV promoters, T7 promoter whose expression is directed by T7 RNA polymerase, the major operator and promoter regions of phage lambda, the control regions for fd coat protein, the promoter for 3-phosphoglycerate kinase or other glycolytic enzymes, the promoters of acid phosphatase, e.g., Pho5, the promoters of the yeast a-mating factors, the polyhedron promoter of the baculovirus system and other sequences known to control the expression of genes of prokaryotic or eukaryotic cells or their viruses, and various combinations thereof.
  • the exogenous HTRA1 gene or transgene may also be under the control of other regulatory sequences such as enhancer or activator sequences, leader or signal sequences, ribosomal binding sites, transcription start and termination sequences, and polyadenylation sequence.
  • Enhancers that may be used in approaches of the invention include but are not limited to: an SV40 enhancer, a cytomegalovirus (CMV) enhancer, an elongation factor 1 (EF1) enhancer, yeast enhancers, viral gene enhancers, and the like.
  • Termination control region may comprise or be derived from a synthetic sequence, synthetic polyadenylation signal, an SV40 late polyadenylation signal, an SV40 polyadenylation signal, a bovine growth hormone (BGH) polyadenylation signal, viral terminator sequences, or the like.
  • synthetic polyadenylation signal an SV40 late polyadenylation signal
  • SV40 polyadenylation signal an SV40 polyadenylation signal
  • BGH bovine growth hormone
  • promoter sequences are provided as SEQ ID NOs: 6, 11, 12, and 13 ("promoter sequences"). It will be understood by those of skill in the art that regulatory (promoter/enhancer) sequences can tolerate a certain degree of variation whilst retaining the regulatory property. In certain approaches described herein in which a promoter/enhancer is called out, a substantially identical sequence (e.g., a sequence with at least about 90% identity, preferably at least about 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% nucleotide identity over the entire promoter/enhancer sequence) is contemplated as a suitable substitute for the called-out sequence. 7. Delivery of CRISPR, CRISPRa, Endonucleases. Repair Templates and Other
  • Systems for delivering proteins and nucleic acids, including CRISPR elements, are well known in the art. These systems may be used to deliver Cas proteins (with or without nuclease activity), Cas nickase, sgRNA or other guide RNAs, Cas-transcriptional activator fusion proteins, HTRA1 protein-encoding sequence, template repair sequences, and the like to cells (e.g ., RPE, photoreceptor and horizontal cells).
  • the material delivered to a cell is sometimes referred to herein as a "transgene” or "cargo.”
  • the delivery is by a virus e.g., lentivirus, adeno-associated virus (AAV), as described in Byrne et al., Methods Enzymol. 546, 119- 38 (2014); Cong et al., Science (80). 339, 819-823; Hirsch et al., Mol. Ther. 18, 6-8 (2010).
  • viruses e.g., lentivirus, adeno-associated virus (AAV), as described in By
  • the cargo e.g., HTRA1 transgene
  • the transgene or other components e.g., the exogenous HTRA1 gene, or the recombinant nucleic acid the expression of which in the RPE cells can increase the expression of the endogenous HTRA1
  • the transgene or other components is delivered to the RPE using an rAAV2 system that is capable of transducing RPE cells at high efficiency.
  • other adeno-associated virus-based vectors include AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, and pseudotyped AAV.
  • Retrovirus, lentivirus, adenovirus, baculovirus and others can also be employed, as disclosed in Lau and Suh (2017) doi: 10.12688/flOOOresearch.11243.1, the relevant disclosure thereof is herein incorporated by reference.
  • the ITRs are the only AAV components required in cis in the same construct as the transgene.
  • the cap and rep genes can be supplied in trans.
  • DNA constructs can be designed so that the AAV ITRs flank the coding sequence for the anti-pathogen construct (or subunits thereof, or subunits thereof fused to a dimerizable domain which is part of a regulatable promoter), thus defining the region to be amplified and packaged-the only design constraint being the upper limit of the size of the DNA to be packaged (approximately 4.5 kb).
  • viral vectors that may be used include, but are not limited to, retroviruses, adenoviruses (AdV), lentiviruses, pox viruses, alphaviruses, and herpes viruses
  • Viral vectors e.g., rAAV2, lentiviral vectors
  • HTRA1 transgenes or other cargo may be produced, collected and purified using art-known methods (including methods described in publications cited herein).
  • AAV methods see Zolotukin et al., 2002, Production And Purification Of Serotype 1, 2, And 5 Recombinant Adeno-Associated Viral Vectors" Methods 28:158-167, incorporated by reference, and, Aponte-Ubillus et al., 2018; Naso et al., 2017; and Penaud-Budloo et al., 2018; all incorporated by reference and cited above.
  • Non-viral vectors or methods can also be used to deliver cargo. These include delivery using virus-like particles (VLPs), administration using cationic liposomes, cell-derived nanovesicles, direct nucleic acid injection, hydrodynamic injection, use of nucleic acid condensing peptides and non peptides, cationic liposomes and encapsulation in liposomes.
  • virus-like particles VLP's
  • the VLP comprises an engineered version of a viral vector, where nucleic acid or non-nucleic acid cargo are packaged into VLPs through alternative mechanisms (e.g., mRNA recruitment, protein fusions, protein-protein binding).
  • stem cells e.g., iPSCs
  • RPE Retinal Deformation
  • the method comprises treating the patient with a small molecule compound that can increase expression of FITRA1.
  • a small molecule compound disclosed herein refers to an organic compound, typically with a molecular weight less than 5,000 daltons, less than 1,000 daltons, less than 900 daltons, or less than 800 daltons.
  • the method of treating, preventing development, slowing progression of, reversing or ameliorating symptoms and signs of Chr 10 AM D may comprise administering a small molecule compound to the patient wherein the agent increases expression of the HTRA1.
  • Exemplary compounds include Trichostatin A (TSA), an inhibitor of class I and class II histone deacetylases, which was shown to increase mRNA expression of HTRA1 by about two-fold. Wang et al., Plos
  • suitable compounds can be identified by screening a library of compound using a quantitative in vitro transcription assay.
  • An in vitro transcription assay can be in a cell-free system, which includes a plasmid comprising a HTRA1 and regulatory elements.
  • identifying an agent that can increase expression of HTRA1 comprises contacting a library of agents with cells that express HTRA1, and measuring the expression level or activity of HTRA1, and selecting the agents that increase the HTRA1 expression or activity.
  • a library of compounds are screened and transcription of HTRA1 can be measured using means well known in the art.
  • transcription can be carried out in the presence of radiolabelled or fluorescently labelled nucleotides, and the labelled transcripts can be precipitated on a gel, separated by electrophoresis, and then quantified.
  • HTRA1 mRNA can be measured by quantitative RT-PCR or digital PCR. Agents that increase the transcription of HTRA1 are then selected and tested. Methods for selecting agents (including compounds or peptides) that can activate transcription are well known in the art, for example, as described in U.S. Pat. No. 6,174,722, the entire content of which is incorporated herein by reference.
  • combinatorial libraries can be produced for many types of compound that can be synthesized in a step-by-step fashion.
  • Large combinatorial libraries of compounds can be constructed by the encoded synthetic libraries (ESL) method described in WO 95/12608, WO 93/06121, WO 94/08051, WO 95/35503 and WO 95/30642.
  • Peptide libraries can also be generated by phage display methods (see, e.g., Devlin, WO 91/18980).
  • Libraries of natural compounds in the form of bacterial, fungal, plant and animal extracts can be obtained from commercial sources or collected in the field.
  • Known pharmacological agents can be subject to directed or random chemical modifications, such as acylation, alkylation, esterification, amidification to produce structural analogs.
  • the test agents can be naturally occurring proteins or their fragments.
  • the test agents can also be peptides, e.g., peptides of from about 5 to about 30 amino acids, with from about 5 to about 20 amino acids being preferred, and from about 7 to about 15 being particularly preferred.
  • the peptides can be digests of naturally occurring proteins, random peptides, or "biased" random peptides.
  • the test agents can also be nucleic acids of various length and sequences.
  • agents that can be used to treat, prevent development of, slow progression of, reverse or ameliorate symptoms and signs of Chr 10 AMD can be identified by contacting an agent with a HTRA1 promoter that is operably linked to a reporter gene, and selecting the agent based on its ability to promote the expression of the reporter gene.
  • compositions and methods of the invention find particular use for treatment of subjects with, or at risk of developing, Chromosome 10 AMD.
  • Chr 10 AMD is known to be associated with genetic lesions in chromosomal region 10q26, which harbors the ARMS2 and HTRA1 genes. See Hageman et a I, 2015, "METHODS OF PREDICTING THE DEVELOPMENT OF AMD BASED ON CHROMOSOME 1 AND CHROMOSOME 10" US Pat. Pub. 2015/0211065, incorporated herein by reference.
  • Patients with Chr 10 AMD can be identified based on disease manifestations and/or based on genotypes. In one approach, candidates for treatment exhibit a Chr 10 AMD clinical phenotype.
  • the subject receiving treatment exhibits a Chr 10 clinical phenotype.
  • the subject receiving treatment carries one or two chromosome 10 risk alleles.
  • the subject receiving treatment carries one the risk alleles on one or two copies of chromosome 10 risk alleles.
  • the subject has a Chr 10 AM D clinical phenotype or genotype and does not have any chromosome 1 risk alleles.
  • Chromosome 1 risk alleles for AMD include rs529825, rs800292, rs3766404, rsl061147, rs203674, rs0161170, rs2274700, rs375046, rs9427661, rs9427662 and rsl2097550.
  • Chr 10 AMD patients display primarily classic choroidal neovascularization (CNV), rarely occult CNV and retinal angiomatous proliferation (RAP), often resulting in severe, rapid visual loss.
  • Chr 10 AMD patients typically have fewer drusen than Chr 1 AMD patients, intra-retinal fluid (cysts), a fast geographic atrophy (GA) growth rate, and retinal/choroidal thinning.
  • Chr 10 AMD patients also have reduced retinal and choroidal (including the choriocapillaris) vascular densities.
  • enhancing HTRA1 expression is achieved by gene therapy.
  • enhancing HTRA1 is achieved by administering an agent, e.g. a small molecule compound, a peptide, or a nucleic acid, to upregulate the transcription of the endogenous HTRA1 gene.
  • Gene therapy to upregulate the transcription of HTRA1 can be performed in different ways.
  • the gene therapy upregulates the endogenous HTRA1 expression (mRNA or protein expression).
  • the gene therapy introduces an exogenous HTRA1 gene, which is expressed in RPE cells.
  • the gene therapy methods are used to convert ChlO risk alleles in the cell genome to corresponding non-risk alleles, as described below.
  • Chr 10 risk alleles individuals having Chr 10 AMD often carry one or more risk alleles associated with development of the disease (“Chr 10 risk alleles"). See Examples 1 and 3. The inventors have discovered, surprisingly, that Chr 10 AMD patients have decreased HTRA1 mRNA expression specifically in the RPE relative to healthy or lower risk controls (FIG. 2). Further, the inventors have identified a genomic region responsible for decreased HTRA1, which corresponds to the region associated with increased AMD risk.
  • HTRA1 is a serine protease and can degrade extracellular matrix (ECM) proteins that are highly enriched in the sub-RPE space. Without intending to be bound by a particular theory or mechanism, the reduction in HTRA1 expression may impair the processing, maintenance or turnover of ECM proteins, which results in accumulation of damaged, misfolded and/or aggregated proteins.
  • ECM extracellular matrix
  • BLDs basal laminar deposits
  • ECM structural proteins that result in their mis-regulation lead to AMD- like diseases including L-ORD (ClqTNF5), Sorsby Fundus Dystrophy (TIMP3), Ehlers Danlos Syndrome type VI (PLOD1) or Doyne's Honeycomb Retinal Dystrophy (EFEMP1).
  • L-ORD ClqTNF5
  • TRIP3 Sorsby Fundus Dystrophy
  • PLOD1 Ehlers Danlos Syndrome type VI
  • EFEMP1 Doyne's Honeycomb Retinal Dystrophy
  • the disclosure provides methods of increasing HTRA1 expression in RPE cells to prevent or slow Chr 10 AMD development.
  • the HTRA1 therapy can be administered after the patient has been identified as having the risk of developing Chr 10 AMD based on genetic profiles, and in some cases before manifestation of any clinical symptoms of AMD. This early intervention can avoid extensive tissue damage associated with AMD.
  • the method disclosed herein requires minimal surgery, typically only once or twice during the patient's lifetime, thus minimizing the discomfort and adverse effect associated with repeated surgeries that are required for conventional therapies.
  • patients are selected for treatment based on a clinical phenotypes or genetic factors for treatment. In some approaches, they are assessed by genotyping to determine their individual genetics ( e.g ., by assess the presence of the Chr 10 risk alleles as disclosed above) and associated risk of disease.
  • imaging and morphological assessments for example and including but not limited to, color fundus photography, SD-OCT , OCT-A, indocyanine green angiography, fluorescein angiography and confocal scanning laser ophthalmoscopy (for example Heidelberg Spectralis system), including near infrared reflectance (NIR), blue-light autofluorescence, green-light autofluorescence; and functional testing (for example and including but not limited to visual acuity, best corrected visual acuity (BCVA using ETDRS chart), Low luminance BCVA (LLVA, using neutral density filter with ETDRS chart), reading speed (monocular/binocular), microperimetry (MAIA) including fixation stability, dark- adapted microperimetry (S-MAIA), scotopic and mesopic microperimetry sensitivity, visual evoked potential (VEP) assessment and multifocal ERG.
  • imaging and morphological assessments for example and including but not limited to, color fundus photography, SD-OCT , OCT-
  • patients may be assessed based on a number of phenotypes and biomarkers.
  • Administering the therapies disclosed here increases HTRA1 expression and also provides benefit to patients when administered in particular phenotypic windows defined by changes in the anatomy of the eye and appearance or changes in levels of certain biomarkers including, without limitation: having few drusen (drusen are small and hard), intra-retinal fluid (cysts), a fast GA growth rate, and retinal/choroidal thinning.
  • administration of the therapeutic agent disclosed herein at a very early stage of progression of Chr 10 AMD may provide superior therapeutic benefit.
  • treatment of patients prior to the appearance of signs or symptoms of Chr 10 AMD e.g., no presence of any of the following symptoms: drusen, intra-retinal fluid (cysts), a fast GA growth rate, and retinal/choroidal thinning
  • patients at high genetic risk by having one or more of the Chr 10 risk alleles e.g., provided herein are methods and compositions for preventing development of Chr 10 AMD, as well as slowing progression of, reversing or ameliorating symptoms and signs of Chr 10 AMD.
  • the patient has no symptoms of AMD (i.e. asymptomatic).
  • at the time of first administration of the therapeutic agent the patient does not exhibit any of the clinical phenotypes of Chr 10 AMD.
  • the patient has a combination of both Chr 1 and Chr 10, Chrl and other minor AMD-associated genes (C3, CFB, C2, etc.), or a combination of all, and the patient is treated with the therapy of the present invention to treat, prevent or slow progression of symptoms and signs of Chr 10 AMD, and a second agent to treat, prevent or slow progression of Chr 1 AMD.
  • C3, CFB, C2, etc. minor AMD-associated genes
  • an individual may be also identified, based on genetic factors alone, as being at elevated risk for developing Chr 10 AMD.
  • the methods and compositions disclosed herein can be used to treat patients having these risk alleles with an agent that increases FITRA1 expression in the RPE cells of the subject, thereby treating, preventing the development, slowing the progression, or reversing or ameliorating symptoms and signs of Chr 10 AMD.
  • the region associated with decreased HTRA1 mRNA may be located in an upstream regulatory region of FITRA1, between and including, rsll200632 and rs3750846 (the "4 kb AM D risk region").
  • Exemplary Chr 10 risk alleles are located at rsll200632 (the risk allele is G), rsll200633 (the risk allele is T), rs61871746 (the risk allele is C), rs61871747 (the risk allele is T), rsl0490924 (the risk allele is T), rs36212731 (the risk allele is T), rs36212732 (the risk allele is G), rs36212733 (the risk allele is C), rs3750848 (the risk allele is G), rs3750847 (the risk allele is T), and rs3750846 (the risk allele is C).
  • Table 5 shows the risk alleles (top) and non-risk alleles (bottom) at these polymorphic sites.
  • the methods and compositions disclosed herein can be used to treat patients having one or more of these risk alleles.
  • individuals who can benefit from the therapy disclosed herein may carry one or more risk alleles that results in decreased binding to one or more transcriptional activators and decreased transcription of HTRA1 gene.
  • the inventors have discovered a 2 kb region located at Chrl0:122454508-Chrl0:122456564 ("the 2 kb risk region"), which is transcriptionally active in RPE cells and is believed to be responsible for binding transcriptional activators that can activate HTRA1 transcription.
  • This 2 kb region comprises epigenetic markers of an active transcription enhancer element, including H3K4 mono-methylation and H3K27 acetylation.
  • LHX2 binds to a sequence motif within this region, which has a nucleotide sequence TTGCCAT AGT AT AT AT AATT AG ACAAAT (comprising the non-risk allele T, underlined, at rs36212733). LHX2 binds poorly to TTGCCGTAGTATATATAACTAGACAAAT (comprising a risk allele C, underlined, at rs36212733). See FIG. 9 (Fig. 10 and 11). Accordingly in some approaches, the method disclosed herein comprises administering an agent to a patient, whose genomic DNA in this 2.0 kb region has reduced binding affinity to transcriptional activators for HTRA1, and administration of the agent increases HTRA1 expression in RPE cells.
  • the patient showed reduced or complete loss of binding to LHX2.
  • the patients may have a risk allele of C at rs36212733, (i.e., TT GCCAT AGT AT AT AT AACT AGACAAAT), which results in its loss of binding to LHX2.
  • the method of treatment comprises administering an agent to the patient, wherein the agent increases HTRA1 expression in the RPE cells of the patient by promoting the binding of transcriptional activators (e.g ., LHX2) to the transcriptional regulatory region of HTRA1.
  • transcriptional activators e.g ., LHX2
  • the individual who can benefit from the treatment disclosed herein showed increased allele-specific expression of a noncoding RNA, IncSCTMl (also referred to as LOC105378525), or its isoforms, as compared to controls.
  • IncSCTMl is transcribed from a DNA sequence that shares the same LD block with HTRA1.
  • HTRA1 a noncoding RNA
  • IncSCTMl shares a divergent promoter with FITRA1, and is transcribed in the anti-sense orientation from the HTRA1 promoter.
  • the allele-specific expression of IncSCTMl is inversely related to the allele-specific expression of HTRA1.
  • the mRNA levels of the risk allele of IncSCTM l (e.g., rsll200638) is higher level than the mRNA of the non-risk allele of IncSCTMl.
  • the mRNA levels of the risk allele of HTRA1 are lower than the mRNA levels of the non-risk allele (FIG. 8).
  • a patient who may benefit from the therapy disclosed herein carries one or more splice forms of IncSCTM l, which are correlated with decreased expression of HTRA1.
  • IncSCTMl exists as different splice variants (FIG. 7) and expressed in different eye tissues (FIG. 14).
  • the method and compositions disclosed herein can be used to treat Chr 10 AMD in an individual who has one or more of the clinical phenotypes of Chr 10 AMD, e.g., having few drusen, intra-retinal fluid (cysts), exhibits a fast GA growth rate, retinal/choroidal thinning
  • the patient has one or more Chr 10 risk alleles as disclosed above.
  • the patient has both the one or more clinical phenotypes of Chr 10 AMD and one or more Chr 10 risk alleles.
  • the patient in addition to having the Chr 10 AMD clinical phenotypes and/or having Chr 10 risk alleles, the patient also has Chr 1 risk alleles and/or Chr 1-driven AMD clinical phenotypes. Chr 1 risk alleles/haplotypes. See U.S. Pat. No. 7,867,727, incorporated herein by reference. In some cases, the patient has no Chr 1 risk alleles/haplotypes for AMD.
  • aspects of the invention include methods of administering agents to either increase HTRA1 expression or edit the genomic regions to convert risk alleles to non-risk alleles to a subject in need of treatment.
  • aspects of the invention include contacting the subject with one or more therapeutic agents, e.g., a viral vector, a compound, a peptide, or a combination thereof as described above, under conditions by which delivery of the agent in the subject results in a beneficial effect on one or more aspects of the subject's health.
  • the invention is not limited to a particular site or method of administration.
  • the agent may be administered by systemic administration (e.g., intravenous injection or infusion), local injection or infusion (e.g., subretinal, suprachoroidal, intravitreal, transscleral or other ocular), by use of an osmotic pump, by electroporation, by application (e.g., eye drops) and by other means.
  • systemic administration e.g., intravenous injection or infusion
  • local injection or infusion e.g., subretinal, suprachoroidal, intravitreal, transscleral or other ocular
  • electroporation e.g., eye drops
  • transgenes of the invention may be introduced into, and expressed in, a variety of cell types including neural retinal cell types, such as rods, cones, RPE, and ganglion cells, ciliary epithelial, scleral, choroidal and other ocular cells.
  • the therapeutic agent disclosed herein may be suspended in a physiologically compatible carrier for administration to a human.
  • Administration may be by an ocular or nonoccular (e.g., administered intravitreally, intravascularly, extraocularly) route.
  • Suitable carriers may be readily selected by one of skill in the art in view of the route of delivery.
  • one suitable carrier includes saline, which may be formulated with a variety of buffering solutions (e.g., phosphate buffered saline).
  • the agent is administered via subretinal injection by creating a bleb or blister under the retina to deliver the viral vector directly to the region of the retina impacted by the disease.
  • One or more blebs can be created in one quadrant or multiple quadrants of the eye to ensure sufficient distribution of the therapeutic agent. See Xue et al., "TECHNIQUE OF RETINAL GENE THERAPY: DELIVERY OF VIRAL VECTOR INTO THE SUBRETINAL SPACE" Eye 31:1308-1316, 2017. Also see Moore et al. 2017, Ochakovski et al. 2017, Schon et al. 2015, supra.
  • the agent is administered via a suprachoroidal injection, thereby accessing the basal surface of the RPE.
  • AAV8-vectored suprachoroidal gene transfer produces widespread ocular transgene expression
  • Emami- and Yiu Medical and Sugical Applications for the Suprachoroidal Space, Int Ophthalmol Clin 59(l):195-207, 2019.
  • the agent can be injected into the vitreous. This approach can be especially useful for getting agent to the RPE in Chr 10 AMD patients with geographic atrophy or CNV. This technique is well known to those skilled in the art. See Kansar et al., “Suprachoroidal Delivery of Viral and Nonviral Gene Therapy for Retinal Disease", J Ocular Pharmacol Ther DOI: 10.1089/jop.2019.0126. 2020.
  • dosage values may vary with the nature of the product and the severity of the condition. It is to be further understood that for any particular subject, specific dosage regimens can be adjusted over time according to the individual need and the professional judgment of the person administering or supervising the administration of the compositions, and that dosage ranges set forth herein are exemplary only and are not intended to limit the scope or practice of the claimed composition.
  • the amount of agent administered will be an "effective amount” or a "therapeutically effective amount,” i.e., an amount that is effective, at dosages and for periods of time necessary, to achieve a desired result.
  • a desired result would include an improvement in HTRA1 expression or activity in a target cell (e.g., an RPE cell) or a detectable improvement in a symptom associated with reduced HTRA1 expression, including without limitation an improvement in AMD symptoms or signs, preferably a statistically significant improvement.
  • a desired result would include a demonstrable prevention of one or more symptoms of Chr 10 AMD, including without limitation, a symptom or sign of AMD, preferably a statistically significant prevention.
  • a therapeutically effective amount of such a composition may vary according to factors such as the disease state, age, sex, and weight of the individual, or the ability of the viral vector to elicit a desired response in the individual. Dosage regimens may be adjusted to provide the optimum response. A therapeutically effective amount is also one in which any toxic or detrimental effects of the agent, e.g., a viral vector, are outweighed by the therapeutically beneficial effects.
  • the amount of viral vector in the composition may vary according to factors such as the disease state, age, sex, and weight of the individual.
  • Dosage regimens may be adjusted to provide the optimum therapeutic response. For example, a single bolus may be administered, several divided doses may be administered over time or the dose may be proportionally reduced or increased as indicated by the exigencies of the therapeutic situation.
  • a preferred human dosage may be 10 s to 10 12 AAV genomes per injection in a volume of 100-300 mI per subretinal bleb. More than one bleb may be created per eye. Multiple treatments may be required in any given individual over a lifetime.
  • HTRA1 gene therapy in a suitable patient can stabilize, ameliorate or reverse a symptom or sign of AMD in the patient.
  • a suitable patient including treatment of an individual at risk of developing AMD or in early stages of the disease
  • providing an exogenous HTRA1 protein introducing transcriptional activator to patients that are heterozygous or homozygous for a Chr 10 risk allele can stabilize and/or slow or even reverse the progression of the disease, as demonstrated by various ocular biomarkers.
  • the primary desired treatment outcome in a patient treated with FITRA1 related therapy is detectable improvement in one or more of the symptoms associated with Chr 10 AMD, i.e., having drusen, intra-retinal fluid (cysts), a fast GA growth rate, and retinal/choroidal thinning, reduced retinal and choroidal vascular densities, choriocapillary ghosts (no flow on OCT-A) in the macular region, choroidal fibrosis in the macular region, choroidal fibrosis in the extramacular region, Bruch's basal laminar deposits (BLD) in the macular region, BLDs in the macular region, thickened Bruch's membrane in macular region, BLDs in the extramacular region.
  • Chr 10 AMD i.e., having drusen, intra-retinal fluid (cysts), a fast GA growth rate, and retinal/choroidal thinning, reduced retinal and choroidal vascular densities,
  • the desired treatment outcome in a patient treated with HTRA1 related therapy can also be detectable improvement in one or more of the functional measures, including without limitation: visual acuity (Early Treatment Diabetic Retinopathy Study, or ETDRS); best corrected visual acuity (or BCVA); microperimetry (macular integrity assessment, or MAIA); dark adaptation; reading speed; visual evoked potential (VEP); and multifocal electroretinography (mfERG), are contemplated.
  • Other biomarkers indicative of stabilization, slowing, or reversing AMD progression including without limitation: BCVA Change; Area of GA Change (square root transformation or otherwise); Fixation; Reading Speed; % New Areas of GA; Photoreceptor Height; Individual Druse Characteristics. 12.
  • compositions of the vectors of the invention include an effective amount of the agent and a pharmaceutically acceptable carrier.
  • sterile injectable solutions can be prepared by incorporating a vector, e.g., a viral vector, in the required amount, optionally with a diluent or excipient suitable for injection into a human patient.
  • unit dosage forms such as a single use, pre-filled syringes or other injection device, with e.g., sufficient AAV particles or compounds for a single administration to a patient.
  • Any pharmaceutical preparation of this invention may be packaged with or accompanied by information about the preparation and its use for treating AMD.
  • transgene used interchangeably with “exogenous gene” refers to a recombinant polynucleotide construct that is introduced into a cell using a gene therapy vector, to result in expression.
  • the term "native promoter” refers to a promoter that is naturally and/or originally present in a cell and it is typically designated for the expression of a particular gene.
  • SEQ ID NO: 13 is a native HTRA1 promoter.
  • a non-native promoter of a gene is one that that is not naturally associated with the gene.
  • the VMD2 promoter (SEQ ID NO: 6) is not a native FITRA1 promoter.
  • the term "native transcriptional activator” refers to a transcriptional activator that is naturally and/or originally present in a cell and it is typically designated for regulating the transcription of a particular gene.
  • LHX2 is a native transcriptional activator for FITRA1 promoter
  • VP16 is not a native transcriptional activator for HTRA1.
  • gene therapy vector refers to virus-derived sequence elements used to introduce a transgene into a cell.
  • a viral vector refers to a gene therapy vector including capsid proteins, used to deliver a transgene to a cell.
  • promoter refers to a DNA sequence capable of controlling (e.g., increasing) the expression of a coding sequence or functional RNA.
  • a promoter may include a minimal promoter (a short DNA sequence comprised of a TATA-box and other sequences that serve to specify the site of transcription initiation).
  • An enhancer sequence e.g., an upstream enhancer sequence
  • promoter may include an enhancer sequence.
  • Promoters and other regulatory sequences are "operably linked" to a transgene when they affect to the expression or stability of the transgene or a transgene product (e.g., mRNA or protein).
  • the terms "introduce” or “introduced,” in the context of gene therapy refers to administering a composition comprising, e.g., a polynucleotide (DNA) encoding a HTRA1 polypeptide, a transcriptional activator that can increase expression of HTRA1, or a DNA endonuclease, under conditions in which polynucleotide enters cells and is expressed in the cells to produce proteins.
  • Polynucleotides may be introduced as naked DNA, using a viral (e.g., AAV2) vector, using a non-viral vector system, of by other methods.
  • AAV2 Addeno-associated virus 2
  • rAAV2 recombinant Adeno-associated virus 2
  • Exemplary AAV2 vectors are derived from the adeno-associated virus 2 genome and are described extensively in the scientific literature. See, e.g., Srivastava, et al, 1983, J. Virol. 45:555-564, incorporated herein by reference and other references cited herein below.
  • Lentivirus refers to a gene therapy vector (lentiviral vector) that may be used to transduce a transgene into a cell. See, e.g., Keeker et al., 2017, Clin Transl Sci. 10:242-248, incorporated herein by reference and other references cited herein below.
  • nucleic acids or polypeptide sequences refer to two or more sequences or subsequences that are the same (“identical") or have a specified percentage of amino acid residues or nucleotides that are the same (i.e., at least about 70% identity, at least about 75% identity, at least 80% identity, at least about 90% identity, preferably at least about 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher identity over the entire sequence of a specified region, when compared and aligned for maximum correspondence over a comparison window or designated region as measured by manual alignment and visual inspection or using a BLAST or BLAST 2.0 sequence comparison algorithms with default parameters described below (see, e.g., NCBI web site ncbi.nlm.nih.gov/BLAST/ or the like)). Such sequences are then said to be “substantially identical.”
  • subject refers to a human or an animal (particularly a mammal) and other organisms that receive either prophylactic or therapeutic treatment.
  • a subject can be a non-human primate.
  • the preferred algorithms can account for gaps and the like.
  • identity exists over a region that is at least about 25 amino acids or nucleotides in length, or more preferably over a region that is 50-100 or more amino acids or nucleotides in length.
  • one sequence acts as a reference sequence, to which test sequences are compared.
  • a percentage identity is determined in relation to the full length of a reference sequence selected from SEQ ID NO: 1 (nucleotide sequence of HTRA1) or SEQ ID NO: 2 (amino acid sequence of HTRA1).
  • test and reference sequences are entered into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. Preferably, default program parameters can be used, or alternative parameters can be designated.
  • sequence comparison algorithm then calculates the percent sequence identities for the test sequences relative to the reference sequence, based on the program parameters.
  • a "comparison window" includes reference to a segment of any one of the number of contiguous positions selected from the group consisting of from 20 to 600, usually about 50 to about 200, more usually about 100 to about 150 in which a sequence may be compared to a reference sequence of the same number of contiguous positions after the two sequences are optimally aligned.
  • Optimal alignment of sequences for comparison can be conducted, e.g., by the local homology algorithm of Smith & Waterman, Adv. Appl. Math. 2:482 (1981), by the homology alignment algorithm of Needleman & Wunsch, J. Mol. Biol. 48:443 (1970), by the search for similarity method of Pearson & Lipman, Proc. Nat'l. Acad. Sci.
  • BLAST and BLAST 2.0 are used, with the parameters described herein, to determine percent sequence identity for the nucleic acids and proteins of the invention.
  • Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information (www.ncbi.nlm.nih.gov/). This algorithm involves first identifying high scoring sequence pairs (HSPs) by identifying short words of length within the query sequence, which either match or satisfy some positive-valued threshold score T when aligned with a word of the same length in a database sequence. T is referred to as the neighborhood word score threshold (Altschul et al., supra). These initial neighborhood word hits act as seeds for initiating searches to find longer HSPs comprising them.
  • HSPs high scoring sequence pairs
  • the word hits are extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Cumulative scores are calculated using, for nucleotide sequences, the parameters M (reward score for a pair of matching residues; always >0) and N (penalty score for mismatching residues; always ⁇ 0). For amino acid sequences, a scoring matrix is used to calculate the cumulative score. Extension of the word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative-scoring residue alignments; or the end of either sequence is reached.
  • the BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment.
  • W word length
  • E expectation
  • Drusen are focal extracellular deposits comprising lipids, fluid, a variety of proteins including complement pathway-related proteins, located between the RPE basal lamina and Bruch's membrane. Drusen are visible ophthalmoscopically as white/yellow dots and can be detected using a variety of art-known methods including those described in Wu et al., 2015,
  • drusen and small hard drusen refer to distinct drusen with a diameter less than about 63 pm.
  • large drusen and “large soft drusen” refer to drusen with a diameter greater than about 125 pm, which are often clustered.
  • Drusen with a diameter between 63 and 125 pm can be referred to as "intermediate drusen.”
  • Localized detachments of the RPE typically referred to as pigment epithelial detachments (PEDs), are often called drusen.
  • haplotype refers to a DNA sequence or a combination of DNA sequences present at various loci on a chromosome that are transmitted together; a haplotype may be one locus, several loci, or an entire chromosome depending on the number of recombination events that have occurred between a given set of loci.
  • polymorphism refers to the occurrence of one or more genetically determined alternative sequences or alleles in a population.
  • a "polymorphic site” is the locus at which sequence divergence occurs. Polymorphic sites have at least one allele.
  • a diallelic polymorphism has two alleles.
  • a triallelic polymorphism has three alleles.
  • Diploid organisms may be homozygous or heterozygous for allelic forms.
  • a polymorphic site can be as small as one base pair. Examples of polymorphic sites include: restriction fragment length polymorphisms (RFLPs), variable number of tandem repeats (VNTRs), hypervariable regions, minisatellites, dinucleotide repeats, trinucleotide repeats, tetranucleotide repeats, and simple sequence repeats.
  • RFLPs restriction fragment length polymorphisms
  • VNTRs variable number of tandem repeats
  • minisatellites dinucleotide repeats
  • trinucleotide repeats trinucleotide repeats
  • tetranucleotide repeats and simple sequence repeats.
  • reference to a "polymorphism" can encompass a set of polymorphisms (i.e., a haplotype).
  • a "single nucleotide polymorphism (SNP)" can occur at a polymorphic site occupied by a single nucleotide, which is the site of variation between allelic sequences. The site can be preceded by and followed by highly conserved sequences of the allele.
  • a SNP can arise due to substitution of one nucleotide for another at the polymorphic site. Replacement of one purine by another purine or one pyrimidine by another pyrimidine is called a transition. Replacement of a purine by a pyrimidine or vice versa is called a transversion.
  • a synonymous SNP refers to a substitution of one nucleotide for another in the coding region that does not change the amino acid sequence of the encoded polypeptide.
  • a non-synonymous SNP refers to a substitution of one nucleotide for another in the coding region that changes the amino acid sequence of the encoded polypeptide.
  • a SNP may also arise from a deletion or an insertion of a nucleotide or nucleotides relative to a reference allele.
  • linkage disequilibrium is the non-random association of alleles at two or more loci, not necessarily on the same chromosome. It is not the same as linkage, which describes the association of two or more loci on a chromosome with limited recombination between them. Linkage disequilibrium describes a situation in which some combinations of alleles or genetic markers occur more or less frequently in a population than would be expected from a random formation of haplotypes from alleles based on their frequencies. Non-random associations between polymorphisms at different loci are measured by the degree of linkage disequilibrium (LD).
  • the level of linkage disequilibrium can be influenced by a number of factors including genetic linkage, the rate of recombination, the rate of mutation, random drift, non-random mating, and population structure.
  • Linkage disequilibrium or “allelic association” thus means the non-random association of a particular allele or genetic marker with another specific allele or genetic marker more frequently than expected by chance for any particular allele frequency in the population.
  • a marker in linkage disequilibrium with an informative marker, such as one of the SNPs, haplotypes, or diplotypes described herein can be useful in detecting susceptibility to Chr 10-driven AMD.
  • ARMS2 refers to the AMD susceptibility 2 gene.
  • the ARMS2 gene consists of two exons and theoretically encodes a 107 amino acid protein with no homology to known protein motifs and no known functions.
  • the expression and localization of ARMS2 protein within cells remains elusive and the use of poorly characterized antibodies has resulted in conflicting reports (Fritsche et al., 2008; Kanda et al., 2007; Kortvely et al, 2010; Wang et al., 2012).
  • RNA-Seq analyses indicates that expression of ARMS2 mRNA is exceptionally low in most tissues (TPM ⁇ 1.0) with the exception of testis (TPM is approximately 6.9) and placenta (qRT-PCR data not shown) (Lonsdale et al., 2013; The GTEx Consortium, 2015).
  • HTRA1 refers to HtrA serine peptidase 1, the mRNA and the protein of which are represented by Gene Bank Accession Nos. NMJD02775 and NPJ302766, respectively. HTRA1 is ubiquitously expressed in nearly all cells and tissues examined and it is abundantly expressed in photoreceptors and horizontal cells of the retina, retinal pigmented epithelium (RPE) and various cell types in the choroid (FIG. 1). HTRA1 is enriched in extracts derived from Bruch's membrane and choroid as compared to retina and RPE (FIG. 6). HTRA1 acts as a secreted serine protease, and exists in solution primarily as an approximately 150 kDa trimer.
  • HTRA1 is activated by an allosteric mechanism (Cabrera et al., 2017) and cleaves a variety of extracellular matrix proteins, proteoglycans, and many growth factors, such as TGFb, FGF and IGFBP.
  • TGFb extracellular matrix proteins
  • FGF FGF
  • IGFBP IGFBP
  • loss of HTRA1 resulted in an increase in many ECM proteins, including TIMP3, clusterin, elastin, vitronectin and fibulin 3 in the brain vessel proteome (Zellner et al., 2018).
  • CARASIL Cerebral autosomal recessive arteriopathy with subcortical infarcts and leukoencephalopathy
  • treatment includes but is not limited to, alleviating a symptom of a disease or condition; and/or reducing, suppressing, inhibiting, lessening, ameliorating or affecting the progression, severity, and/or scope of a disease or condition.
  • transcriptional regulatory region refers to the HTRA1 promoter and the HTRA1 enhancer.
  • the term “enhancer” refers to the HTRA1 2 kb region.
  • corresponding to in the context of a sequence refers to the compliment, the RNA sequence that is equivalent to a DNA sequence but for the substitution of U for T, and the like as apparent from context.
  • Codon optimization has its usual meaning in the art. Codon optimization can be used to increase the rate of translation or to produce recombinant RNA transcripts having desirable properties, such as a longer half-life and greater expression efficiency, as compared with transcripts produced using a non-optimized sequence.
  • the present disclosure provides HTRA1 coding sequences that have been engineered to to maximize expression efficiency. Methods for codon optimization are readily available, for example, optimizer, accessible free of charge at http://genomes.urv.es/OPTIMIZER, and GeneGPS ® Expression Optimization Technology from DNA 2.0 (Newark, California).
  • the coding sequence is codon-optimized for expression in human using the OptimumGeneTM algorithm from GenScript (Piscataway, New Jersey).
  • a Cas protein that "lacks nuclease activiity" has at least a 50% reduction in activity relative to the wild-type equivalent, sometimes at least an 80% reduction, sometimes at least an 95% reduction, and sometimes at least a 99% reduction.
  • horizontal cells have the normal meaning in the art. See, e.g., Poche et al., "Retinal horizontal cells: challenging paradigms of neural development and cancer biology", Development, 2009, 136, Pages 2141-2151. "Horizontal cells” are laterally interconnecting neurons having their cell bodies in the inner nuclear layer of the retina of vertebrate eyes. They integrate and regulate the input from multiple photoreceptor cells.
  • photoreceptor cells are specialized neuroepithelial cells found in the outermost layer of the neural retina. They are capable of visual phototransduction and there are two major types, the rods which mediate scotopic vision and the cones which mediate photopic vision.
  • a "programmable" endonuclease is a nuclease that can be specifically targeted to a particular DNA sequence by selection of an associated molecule (e.g. gRNA for Cas proteins), fused protein sequence, or other means.
  • an associated molecule e.g. gRNA for Cas proteins
  • a DNA "target sequence” [A] is contiguous with a PAM [P] on the first DNA strand.
  • the complement of the target sequence [C] is found on the complementary DNA strand.
  • the guide sequence [G] of the gRNA hybridizes to, and is complementary to, the complement of the target, and has the sequence of the target [A], except that thymidine in DNA is replaced by uracil in RNA.
  • the guide sequence of the gRNA can be produced by transcription from [C],
  • nucleotide sequences are presented 5' to 3’.
  • Microarray-based gene expression analyses were conducted using two independent sets of human donor eye tissues (comprising 80 and 200 donor samples, respectively). The results showed that HTRA1 mRNA levels were decreased in RPE-choroid tissue of human donors homozygous or heterozygous for a risk allele at rsl0490924, relative to non-risk donors homozygous for the non-risk allele (FIG. 2 and FIG. 30). The results of reduced HTRA1 mRNA levels in RPE-choriod tissue were confirmed by qRT-PCR analyses (FIG. 3A and 3B).
  • Allele-specific expression analysis using mRNA from heterozygous donor RPE tissue samples also showed a significant and reproducible decrease of risk allele mRNA relative to wild-type allele mRNA.
  • the number of copies of mRNA with the non-risk allele versus the risk allele was determined using digital PCR and a Taqman SNP assay. There were no allele specific mRNA changes detected in the choroids or retinas from the same donor samples (FIG. 4).
  • FIG. 2 The results also show that the reduction of HTRA1 mRNA is tissue specific— it was only detected in RPE, but not in retina.
  • FIG. 2 FIG. 3A, FIG. 3B and FIG 30 show that the FITRA1 mRNA levels decreased in RPE-choroid tissue of patients having one or two risk alleles at rsl0490924, relative to non-risk donors with two, wild-type, non-risk alleles, but the FITRA1 expression in retina remained unchanged.
  • This example shows that HTRA1 mRNA is secreted in a polarized manner and enriched in Bruch's membrane and choroid in human eye tissues from non-AMD samples.
  • FITRA1 protein were secreted in a polarized manner with 70% of HtrAl secreted apically and 30% secreted basally (FIG. 5A and 5B). Basal secretion of HTRA1 may be the exclusive source of sub-RPE HTRA1 in the elderly, as the HTRA1 trimer is not expected to gain access to the sub-RPE space from the choriocapillaris, due to selective permeability of Bruch's membrane and RPE basal lamina (Moore, DJ et.
  • the goal of an AAV-HTRA1 therapy is to deliver a therapeutic amount of HtrAl to the eye in order to restore function.
  • an understanding of HtrAl concentrations in human and AGM ocular tissues is necessary.
  • HtrAl protein and mRNA levels in extramacular retina and RPE-choroid as a function of age in donors with or without risk at the ChrlO locus demonstrated that HtrAl levels are relatively unchanged with age in retina independent of ChrlO risk status (FIG. 12) but significantly increases with age in the RPE-choroid of donors without ChrlO risk (FIG. 13A).
  • donors with ChrlO risk show a significant impairment in the age-dependent increase in HtrAl in RPE-choroid of non-risk donors. This is consistent with a similar age-dependent increase in HTRA1 mRNA in non-risk donors but not in donors with risk (FIG. 13B).
  • the HTRA1 allele-specific expression assay was performed using mRNA derived from donors with rare recombination events within the AMD-associated ARM52/HTRA1 LD block. Donors were heterozygous at the rsl049331 SNP in HTRA1 exon 1, but homozygous for either the risk or non-risk alleles in a portion of the upstream SNPs within the LD block.
  • HTRA1 promoter SNP and ARMS2 insertion-deletion (indel) region were excluded as causal drivers of decreased HTRA1 mRNA expression. Instead, the region associated with decreased HTRA1 mRNA was mapped to an upstream regulatory region between and including rsll200632 and rs3750846 SNPs that includes rsl0490924 ( ARMS2 A69S) (Table 8). The same genetic region was found to be associated with elevated risk of AMD disease by Grassmann et al ( Genetics 2017) in their analysis of recombinant haplotypes in case/control studies. The finding that the region associated with allele- specific expression of HTRA1 matches the same region associated with AMD risk strongly implies that risk-associated reduction in HTRA1 expression leads to an increase in AMD incidence. This region is designated as the 4 kb AMD risk region.
  • Table 7 shows nine haplotypes of the ARMS2 region, each of which accounts for greater than 2% of the population. Haplotypes HI, H2, H3 and H6 all showed increased Chr 10 AM D risk and all comprise a T allele at SNP rsl0490924. This indicates that the presence of the risk allele at rsl0490924 (A69S) is associated with development of Chr 10 AM D. [0200] Table 7: Haplotypes Within the ARMS2 Region
  • This IncRNA was transcribed in the anti-sense orientation from the HTRA1 promoter and it appears that HTRA1 and LOC105378525 may share an overlapping divergent promoter.
  • RACE rapid amplification of cDNA ends
  • PCR analysis of RNA from retina and RPE indicates that exon 3, as mapped in XR_946382 variant 1, extends approximately lkb further than reported. This is supported by RNA-seq data from the GTEx Consortium in which reads are mapped to this extended region in various tissues.
  • RACE PCR also indicates that the alternate exon 3, as mapped in variant 4 (XR_946385), begins at either hg38 Chr 10:122,455,021 (alt ex3a) or Chr 10:122,454,857 (Alt ex3b) and extends in the anti-sense direction to Chr 10:122,454,457.
  • Sequence analysis indicates that the alt ex3a variant contains the rsl0490924 SNP, the risk form of which is associated with elevated AMD risk, whereas alt ex3b does not.
  • variants comprising exon 3 instead of alternative exon 3 do not contain rsl0490924 or any other SNPs in the 4 kb AMD risk region
  • the IncSCTMl alternative exon 3 almost completely overlaps with ARMS2 exon 1.
  • HTRA1 mRNA and IncSCTM l ncRNAs were examined using allele-specific expression assays for HTRA1 (rsl049331, exon 1) and IncSCTMl (rsll200638, exon 1). mRNA from heterozygous donors was used in the assay and any deviation from the expected 50:50 ratio was indicative of allele- specific expression. Gene-specific primers were used for cDNA synthesis to ensure that transcripts come from the expected strand. It was observed that the allele-specific expression of HTRA1 inversely correlated with the allele-specific expression of IncSCTMl.
  • the results showed that mRNA derived from the risk allele of IncSCTMl was expressed at higher levels than that derived from the non-risk allele, whereas mRNA derived from the risk allele of HTRA1 was decreased relative to that of the non-risk allele (FIG. 8).
  • the risk allele analyzed in FIG. 8 was at rsll200638, which is in the LD block associated with AMD that includes rsl0490924. rsll200638 is also within exon 1 of IncSCTMl and present in all isoforms of IncSCTMl.
  • RNA-seq analyses of retina and RPE indicate that HTRA1 mRNA was expressed at >400-fold higher levels than IncSCTMl mRNA (data not shown). If IncSCTMl regulates HTRA1 expression, it seems unlikely that it could regulate HTRA1 in trans and instead, most likely IncSCTMl would regulate expression of HTRA1 via cis effects on HTRA1 transcription.
  • This example describes a newly identified 2 kb region that is responsible for regulating HTRA1 transcription and transcriptional activators associated therewith.
  • this same 2 kb region comprises epigenetic markers of active transcription, including H3K27 acetylation.
  • This 2 kb region overlaps both ARMS2 exon 1-intron 1 and the alternative exon 3 of IncSCTMl (FIG. 10) as well as other SNPs in the 4 kb AMD risk region, including rs36212731, rs36212732, rs36212733 and rs3750848.
  • ChIP-Seq analysis of retina and RPE extracts was performed with antibodies targeting histone marks associated with enhancer elements, including monomethylated histone H3 lysine 4 (H3K4mel) and acetylated histone H3 lysine 27 (H3K27Ac).
  • H3K4mel monomethylated histone H3 lysine 4
  • H3K27Ac acetylated histone H3 lysine 27
  • LHX2 is also expressed in some cell types in retina and choroid and thus, is not an RPE-specific transcription factor.
  • the rs36212733 SNP associated with risk of AMD disrupts one of the critical residues within this motif by converting the T at position 6 to a 'C'.
  • the LHX2 site is surrounded by two potential binding sites for members of the SoxE family of transcription factors but these do not overlap the ChrlO-associated SNPs.
  • ESA electrophoretic mobility shift assay
  • Microarray and qRT-PCR analysis of donor RPE tissue has demonstrated that the level of HTRA1 mRNA was downregulated by approximately 30% in donors with homozygous risk at ChrlO compared to donors with no risk.
  • the SAM CRISPRa system was selected to restore the expression of HTRA1 in RPE tissue to levels similar to non-risk donors while minimizing any off-target effects on gene expression.
  • the SAM system consists of two plasmids: LentiSAM plasmid (SAM; Addgene #92062) encoding both the sgRNA and the dCas9-VP64 fusion protein, and LentiMPH (MPH; Addgene #92065) plasmid encoding a fusion protein comprised of the MS2 affinity tag and the p65 and HSF1 transcription factors.
  • SAM LentiSAM plasmid
  • MPH Addgene #92065
  • sgRNAs were designed to cover the promoter region of HTRA1 (FIG. 14). These sequences, along with a published sgRNA sequence targeting IL1B, were cloned into BsmBI sites adjacent to the U6 promoter within the lentiSAM v2 (Puro) plasmid (Addgene). Cells were transfected with the sgRNA-LentiSAMv2 (Puro) plasmid with or without equimolar amounts of the Addgene (Neo) plasmid (5 pg total) by electroporation. After 24-96 hours, total RNA was extracted and purified using an RNeasy kit (Qjagen, Cat. #74106).
  • Complementary DNA was generated using 1 pg of total RNA and the Superscript IV VILO Master Mix kit (Invitrogen, Cat. #11756050). Quantitative PCR was performed using 50 ng of cDNA and TaqMan gene expression assays (Applied Biosystems) for HTRA1 (Hs01016151_ml), IL1B (Hs01555410_ml), and GAPDH (hs03929097_gl) following the standard protocol.
  • FIG. 15 shows that most of the sgRNAs upregulated HTRA1 to some level. P7 and P18 sgRNAs showed the highest increase in HTRA1 levels (an approximately 3.6- and 3.2-fold increase for P7 and P18 sgRNA, respectively).
  • FIG. 19 shows that HTRA1 protein levels were increased specifically in P18 sgRNA-LentiSAM transfected cells 3 and 4 days after transfection. The protein level reached its maximum with 5 pg of LentiSAM plasmid.
  • FIG. 20 shows HTRA1 protein levels after normalization to ENPP-2 protein.
  • the lentiviral particles shown in Table 11 were constructed. These particles comprise the P18-lentiSAM plasmid
  • hlRPE7 cells were transduced at an MOI of 20 with lentiviral particles encoding the P18-LentiSAM plasmid and cell culture supernatant was collected every 3 days post transduction.
  • lentiviral particles encoding the non-targeting sgRNA (Ctrl-LentiSAM).
  • Cells were also treated with polybrene-containing media without virus (Mock).
  • HTRA1 protein levels in the cell culture supernatant collected at 3, 6 and 9 days post-transduction were measured by HTRA1 ELISA assay. As shown in FIG.
  • HTRA1 protein levels increased by approximately 40% (1.4-fold increase relative to Ctrl-LentiSAM) in cells transduced with P18-LentiSAM at 6 and 9 days post-transduction compared to cells transduced with Ctrl-LentiSAM viral particles.
  • FIG. 23 shows HTRA1 protein levels after normalization to ENPP-2 protein. Levels of HtrAl still show a ⁇ 30-40% increase following transduction with P18 sgRNA-LentiSAM at 6 and 9 days post transduction. To test the correlation between HTRA1 mRNA expression and HTRA1 secreted protein levels, mRNA levels of HTRA1 were measured from total RNA extracted at 9 days post-transduction (FIG. 23).
  • HTRA1 mRNA levels were increased approximately 2-fold in cells treated with P18-LentiSAM relative to cells treated with Ctrl-LentiSAM. Thus, both HTRA1 mRNA and protein levels were increased in response to the P18-LentiSAM treatment. This indicates that viral delivery of the CRISPR-based SAM system can successfully induce HTRA1.
  • the experiments in this example were conducted to develop an AAV2-based vector carrying the HTRA1 gene under the control of a suitable RPE-specific promoter to restore the wild- type expression level of HTRA1 in the RPE of AMD patients.
  • the HTRA1 gene was subcloned from the pCTM16 plasmid into pCTM295 using Kpnl and Sphl restriction sites to generate pTR-HTRAl (pCTM289).
  • Fragments of the BEST1 and RPE65 promoter were PCR amplified using primers with Acc65l (Forward) and BamHI restriction sites (Reverse). The PCR products were digested with Acc65l and BamHI and subcloned into pCTM289 at these sites to generate HTRA1 expression plasmids under the control of BEST1- and RPE65-derived promoter fragments.
  • Table 12 shows the primers used to prepare each of the promoter fragments from the BESTl-promoter (SEQ ID NO:ll) and the RPE65 promoter fragment (SEQ ID NO: 12).
  • RPE1 cells that stably express an HTRA1 3-UTR-targeted shRNA plasmid (and thus, express low levels of endogenous HTRA1) were transfected with 5 pg of indicated plasmids by electroporation using 100 mI Neon tips or by lipid transfection in 96 well plates containing 10,000 cells per well. A total of 0.15 mI of Lipofectamine 3000, 0.2 mI P3000 and 100 ng DNA were used . Cell culture supernatant and RNA were collected 24-96 hours post-transfection.
  • FITRA1 mRNA increased in cells transfected with the BEST1- and RPE65-FITRA1 plasmids compared to the negative control plasmid (pCTM259).
  • the pattern of FITRA1 expression relative to each other is similar in both cell lines.
  • FITRA1 mRNA Relative to the control plasmid (pCTM259), levels of FITRA1 mRNA are strongly increased by several of the AAV- FITRA1 plasmids driven by the BEST1_723, BEST1_340 and RPE65_146 promoters (FIG. 26). With each of these plasmids, mRNA levels peaked at 24 hours and gradually decrease at the 48- and 72-hour time points. With the positive control CMV-driven promoter, HTRA1 levels also peaked at 24 hours but sharply decrease by the 48- and 72-hour time points.
  • This example shows experiments conducted to selectively delete a region of DNA on ChrlO encompassing the HTRA1 regulatory region in an allele-specific manner. Specifically, the CRISPR/Cas9 system and combinations of CRISPR guide RNA pairs were used to specifically remove a large section of DNA surrounding the rsl0490924 SNP from either the risk or wild-type alleles in RPE1 cells.
  • the cell-RNP mixture was electroporated using a 10 mI Neon pipette tip at 1300 volts, pulse width 20, and 2 pulses then transferred to 3 ml media in a 6-well plate. After 24 hours, the transfected cells were serially diluted to a concentration of 15 cells/ml. One hundred mI approximately 1.5 cells/well) was plated into 3x96 well plates for each sample. Table 13. CRISPR Reagents Targeting the rsl0490924 Region
  • Genomic DNA was purified from the clonal cultures using a DNeasy Blood & Tissue Kit
  • PCR was performed using 200 nM of T7E1-Reg8-F (5'CTT ACCACCCTCG CT ACAT C3' ) and INDEL-DEL-R1 (5'CCAGGGTGGTGTAATCC ATC3') primers in Q5 PCR buffer (NEB, Cat. # B9027) containing 50 ng genomic DNA, 200 mM dNTPs (Thermo Fisher, Cat. # 18427), and Q5 Hot Start High-Fidelity DNA Polymerase (NEB, Cat. # M0493). PCR products were visualized by agarose gel electrophoresis.
  • RPE1 cells are triploid for chromosome 10q26, containing two copies of the rsl0490924 wild type allele and a single copy of the risk allele. PCR amplification of this region using untreated RPE1 cells yields two PCR products corresponding to a 3.5 kb band for the wild type alleles and a 3.2 kb band for the risk allele. Agarose gel electrophoresis shows a 2:1 bias in the density of the wild type vs the mutant allele. When cells are treated with CRISPR guide pairs specific for the wild type allele, there are three possible outcomes.
  • a single wild type allele may be deleted, as indicated by a 1:1 ratio of the 3.5 kb/3.2 kb bands along with a 600-800 bp band generated from the cut allele with the fragment removed. If both of the wild type alleles are cut, the PCR will only yield a 3.2 kb band from the mutant allele and a 600-800 bp band from the cut wild type alleles. In contrast, cells treated with CRISPR guide pairs specific for the mutant allele should only show the denser 3.5 kb wild type band and a 600-800 bp band corresponding to the cut mutant allele.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Biomedical Technology (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Veterinary Medicine (AREA)
  • Epidemiology (AREA)
  • Virology (AREA)
  • Ophthalmology & Optometry (AREA)
  • Mycology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicinal Preparation (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
PCT/US2020/027802 2019-04-10 2020-04-10 Htra1 modulation for treatment of amd Ceased WO2020210724A1 (en)

Priority Applications (6)

Application Number Priority Date Filing Date Title
US17/599,979 US20230165976A1 (en) 2019-04-10 2020-04-10 Htra1 modulation for treatment of amd
EP20787458.7A EP3953485A4 (en) 2019-04-10 2020-04-10 HTRA1 MODULATION FOR THE TREATMENT OF AMD
CN202080042929.4A CN113966401A (zh) 2019-04-10 2020-04-10 用于治疗amd的htra1调节
CA3136119A CA3136119A1 (en) 2019-04-10 2020-04-10 Htra1 modulation for treatment of amd
JP2021559892A JP2022526429A (ja) 2019-04-10 2020-04-10 Amdの処置のためのhtra1調節
JP2025093119A JP2025175283A (ja) 2019-04-10 2025-06-04 Amdの処置のためのhtra1調節

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201962832182P 2019-04-10 2019-04-10
US62/832,182 2019-04-10

Publications (1)

Publication Number Publication Date
WO2020210724A1 true WO2020210724A1 (en) 2020-10-15

Family

ID=72750902

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2020/027802 Ceased WO2020210724A1 (en) 2019-04-10 2020-04-10 Htra1 modulation for treatment of amd

Country Status (6)

Country Link
US (1) US20230165976A1 (cg-RX-API-DMAC7.html)
EP (1) EP3953485A4 (cg-RX-API-DMAC7.html)
JP (2) JP2022526429A (cg-RX-API-DMAC7.html)
CN (1) CN113966401A (cg-RX-API-DMAC7.html)
CA (1) CA3136119A1 (cg-RX-API-DMAC7.html)
WO (1) WO2020210724A1 (cg-RX-API-DMAC7.html)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2023011248A1 (zh) * 2021-08-05 2023-02-09 呈诺再生医学科技(珠海横琴新区)有限公司 以iPSC来源的细胞为载体、基因治疗湿性年龄相关性黄斑变性
WO2023023278A3 (en) * 2021-08-18 2023-06-08 University Of Utah Research Foundation Multigene constructs for treatment of age-related macular degeneration and other complement dysregulation-related conditions
WO2023086663A3 (en) * 2021-11-15 2023-06-22 The Children's Medical Center Corporation Methods for tauopathy diagnosis and treatment

Citations (36)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1991018980A1 (en) 1990-06-01 1991-12-12 Cetus Corporation Compositions and methods for identifying biologically active molecules
WO1993006121A1 (en) 1991-09-18 1993-04-01 Affymax Technologies N.V. Method of synthesizing diverse collections of oligomers
WO1994008051A1 (en) 1992-10-01 1994-04-14 The Trustees Of Columbia University In The City Of New York Complex combinatorial chemical libraries encoded with tags
US5356802A (en) 1992-04-03 1994-10-18 The Johns Hopkins University Functional domains in flavobacterium okeanokoites (FokI) restriction endonuclease
WO1995012608A1 (en) 1993-11-02 1995-05-11 Affymax Technologies N.V. Synthesizing and screening molecular diversity
US5436150A (en) 1992-04-03 1995-07-25 The Johns Hopkins University Functional domains in flavobacterium okeanokoities (foki) restriction endonuclease
WO1995030642A1 (en) 1994-05-06 1995-11-16 Pharmacopeia, Inc. Combinatorial dihydrobenzopyran library
WO1995035503A1 (en) 1994-06-22 1995-12-28 Pharmacopeia, Inc. Synthesis of combinatorial libraries
US5487994A (en) 1992-04-03 1996-01-30 The Johns Hopkins University Insertion and deletion mutants of FokI restriction endonuclease
US6174722B1 (en) 1997-03-12 2001-01-16 Aventis Pharma Deutschland Gmbh In-vitro transcription processes for screening natural products and other chemical substances
US6453242B1 (en) 1999-01-12 2002-09-17 Sangamo Biosciences, Inc. Selection of sites for targeting by zinc finger proteins and methods of designing zinc finger proteins to bind to preselected sites
US6503717B2 (en) 1999-12-06 2003-01-07 Sangamo Biosciences, Inc. Methods of using randomized libraries of zinc finger proteins for the identification of gene function
US6534261B1 (en) 1999-01-12 2003-03-18 Sangamo Biosciences, Inc. Regulation of endogenous gene expression in cells using zinc finger proteins
US6599692B1 (en) 1999-09-14 2003-07-29 Sangamo Bioscience, Inc. Functional genomics using zinc finger proteins
US6689558B2 (en) 2000-02-08 2004-02-10 Sangamo Biosciences, Inc. Cells for drug discovery
US6794136B1 (en) 2000-11-20 2004-09-21 Sangamo Biosciences, Inc. Iterative optimization in the design of binding proteins
US20050064474A1 (en) 2003-08-08 2005-03-24 Sangamo Biosciences, Inc. Methods and compositions for targeted cleavage and recombination
US20050267061A1 (en) 2004-04-08 2005-12-01 Sangamo Biosciences, Inc. Methods and compositions for treating neuropathic and neurodegenerative conditions
US7030215B2 (en) 1999-03-24 2006-04-18 Sangamo Biosciences, Inc. Position dependent recognition of GNN nucleotide triplets by zinc fingers
US7067317B2 (en) 2000-12-07 2006-06-27 Sangamo Biosciences, Inc. Regulation of angiogenesis with zinc finger proteins
US7070934B2 (en) 1999-01-12 2006-07-04 Sangamo Biosciences, Inc. Ligand-controlled regulation of endogenous gene expression
US7253273B2 (en) 2004-04-08 2007-08-07 Sangamo Biosciences, Inc. Treatment of neuropathic pain with zinc finger proteins
US7262054B2 (en) 2002-01-22 2007-08-28 Sangamo Biosciences, Inc. Zinc finger proteins for DNA binding and gene regulation in plants
US20070218528A1 (en) 2004-02-05 2007-09-20 Sangamo Biosciences, Inc. Methods and compositions for targeted cleavage and recombination
US7361635B2 (en) 2002-08-29 2008-04-22 Sangamo Biosciences, Inc. Simultaneous modulation of multiple genes
US7867727B2 (en) 2006-07-13 2011-01-11 University Of Iowa Research Foundation Methods and reagents for treatment and diagnosis of vascular disorders and age-related macular degeneration
US20110111407A1 (en) * 2008-04-08 2011-05-12 Ehrmann Michael Method for analysing the epigenetic status of the htra 1 gene in a biological sample
US20130122016A1 (en) 2007-02-16 2013-05-16 Massachusetts Eye And Ear Infirmary Methods and Compositions for Prognosing, Detecting, and Treating Age-Related Macular Degeneration
US20130129743A1 (en) 2011-10-14 2013-05-23 Genentech, Inc. ANTI-HtrA1 ANTIBODIES AND METHODS OF USE
US20150211065A1 (en) 2012-09-14 2015-07-30 University Of Utah Research Foundation Methods of predicting the development of amd based on chromosome 1 and chromosome 10
WO2015161276A2 (en) 2014-04-18 2015-10-22 Editas Medicine, Inc. Crispr-cas-related methods, compositions and components for cancer immunotherapy
WO2018107028A1 (en) 2016-12-08 2018-06-14 Intellia Therapeutics, Inc. Modified guide rnas
WO2018169983A1 (en) * 2017-03-13 2018-09-20 President And Fellows Of Harvard College Methods of modulating expression of target nucleic acid sequences in a cell
US10190137B2 (en) * 2013-11-07 2019-01-29 Editas Medicine, Inc. CRISPR-related methods and compositions with governing gRNAS
US10208317B2 (en) * 2013-12-11 2019-02-19 Regeneron Pharmaceuticals, Inc. Methods and compositions for the targeted modification of a mouse embryonic stem cell genome
WO2020019002A1 (en) 2018-07-20 2020-01-23 University Of Utah Research Foundation Gene therapy for macular degeneration

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
ES2391788T3 (es) * 2006-07-26 2012-11-29 Yale University, Inc. Diagnóstico y tratamiento de degeneración macular relacionada con la edad
TW200911290A (en) * 2007-07-02 2009-03-16 Alcon Res Ltd RNAI-mediated inhibition of HTRA1 for treatment of macular degeneration
BR112013023724A2 (pt) * 2011-03-15 2019-09-24 Univ Utah Res Found métodos para tratar doença ou sintoma, detriagem para um agente ou uma combinação de agentes, e para determinar a eficácia de um agente e de um tratamento
US20200291427A1 (en) * 2018-11-16 2020-09-17 Gemini Therapeutics Inc. Crispr-based therapeutics for targeting htra1 and methods of use
WO2020206098A1 (en) * 2019-04-03 2020-10-08 Regenxbio Inc. Gene therapy for eye pathologies

Patent Citations (36)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1991018980A1 (en) 1990-06-01 1991-12-12 Cetus Corporation Compositions and methods for identifying biologically active molecules
WO1993006121A1 (en) 1991-09-18 1993-04-01 Affymax Technologies N.V. Method of synthesizing diverse collections of oligomers
US5487994A (en) 1992-04-03 1996-01-30 The Johns Hopkins University Insertion and deletion mutants of FokI restriction endonuclease
US5356802A (en) 1992-04-03 1994-10-18 The Johns Hopkins University Functional domains in flavobacterium okeanokoites (FokI) restriction endonuclease
US5436150A (en) 1992-04-03 1995-07-25 The Johns Hopkins University Functional domains in flavobacterium okeanokoities (foki) restriction endonuclease
WO1994008051A1 (en) 1992-10-01 1994-04-14 The Trustees Of Columbia University In The City Of New York Complex combinatorial chemical libraries encoded with tags
WO1995012608A1 (en) 1993-11-02 1995-05-11 Affymax Technologies N.V. Synthesizing and screening molecular diversity
WO1995030642A1 (en) 1994-05-06 1995-11-16 Pharmacopeia, Inc. Combinatorial dihydrobenzopyran library
WO1995035503A1 (en) 1994-06-22 1995-12-28 Pharmacopeia, Inc. Synthesis of combinatorial libraries
US6174722B1 (en) 1997-03-12 2001-01-16 Aventis Pharma Deutschland Gmbh In-vitro transcription processes for screening natural products and other chemical substances
US6453242B1 (en) 1999-01-12 2002-09-17 Sangamo Biosciences, Inc. Selection of sites for targeting by zinc finger proteins and methods of designing zinc finger proteins to bind to preselected sites
US7070934B2 (en) 1999-01-12 2006-07-04 Sangamo Biosciences, Inc. Ligand-controlled regulation of endogenous gene expression
US6534261B1 (en) 1999-01-12 2003-03-18 Sangamo Biosciences, Inc. Regulation of endogenous gene expression in cells using zinc finger proteins
US7030215B2 (en) 1999-03-24 2006-04-18 Sangamo Biosciences, Inc. Position dependent recognition of GNN nucleotide triplets by zinc fingers
US6599692B1 (en) 1999-09-14 2003-07-29 Sangamo Bioscience, Inc. Functional genomics using zinc finger proteins
US6503717B2 (en) 1999-12-06 2003-01-07 Sangamo Biosciences, Inc. Methods of using randomized libraries of zinc finger proteins for the identification of gene function
US6689558B2 (en) 2000-02-08 2004-02-10 Sangamo Biosciences, Inc. Cells for drug discovery
US6794136B1 (en) 2000-11-20 2004-09-21 Sangamo Biosciences, Inc. Iterative optimization in the design of binding proteins
US7067317B2 (en) 2000-12-07 2006-06-27 Sangamo Biosciences, Inc. Regulation of angiogenesis with zinc finger proteins
US7262054B2 (en) 2002-01-22 2007-08-28 Sangamo Biosciences, Inc. Zinc finger proteins for DNA binding and gene regulation in plants
US7361635B2 (en) 2002-08-29 2008-04-22 Sangamo Biosciences, Inc. Simultaneous modulation of multiple genes
US20050064474A1 (en) 2003-08-08 2005-03-24 Sangamo Biosciences, Inc. Methods and compositions for targeted cleavage and recombination
US20070218528A1 (en) 2004-02-05 2007-09-20 Sangamo Biosciences, Inc. Methods and compositions for targeted cleavage and recombination
US7253273B2 (en) 2004-04-08 2007-08-07 Sangamo Biosciences, Inc. Treatment of neuropathic pain with zinc finger proteins
US20050267061A1 (en) 2004-04-08 2005-12-01 Sangamo Biosciences, Inc. Methods and compositions for treating neuropathic and neurodegenerative conditions
US7867727B2 (en) 2006-07-13 2011-01-11 University Of Iowa Research Foundation Methods and reagents for treatment and diagnosis of vascular disorders and age-related macular degeneration
US20130122016A1 (en) 2007-02-16 2013-05-16 Massachusetts Eye And Ear Infirmary Methods and Compositions for Prognosing, Detecting, and Treating Age-Related Macular Degeneration
US20110111407A1 (en) * 2008-04-08 2011-05-12 Ehrmann Michael Method for analysing the epigenetic status of the htra 1 gene in a biological sample
US20130129743A1 (en) 2011-10-14 2013-05-23 Genentech, Inc. ANTI-HtrA1 ANTIBODIES AND METHODS OF USE
US20150211065A1 (en) 2012-09-14 2015-07-30 University Of Utah Research Foundation Methods of predicting the development of amd based on chromosome 1 and chromosome 10
US10190137B2 (en) * 2013-11-07 2019-01-29 Editas Medicine, Inc. CRISPR-related methods and compositions with governing gRNAS
US10208317B2 (en) * 2013-12-11 2019-02-19 Regeneron Pharmaceuticals, Inc. Methods and compositions for the targeted modification of a mouse embryonic stem cell genome
WO2015161276A2 (en) 2014-04-18 2015-10-22 Editas Medicine, Inc. Crispr-cas-related methods, compositions and components for cancer immunotherapy
WO2018107028A1 (en) 2016-12-08 2018-06-14 Intellia Therapeutics, Inc. Modified guide rnas
WO2018169983A1 (en) * 2017-03-13 2018-09-20 President And Fellows Of Harvard College Methods of modulating expression of target nucleic acid sequences in a cell
WO2020019002A1 (en) 2018-07-20 2020-01-23 University Of Utah Research Foundation Gene therapy for macular degeneration

Non-Patent Citations (132)

* Cited by examiner, † Cited by third party
Title
"Current Protocols in Molecular Biology", 1995
"The GTEx Consortium (2015) The Genotype-Tissue Expression (GTEx) pilot analysis: Multitissue gene regulation in humans", SCIENCE, vol. 348, pages 648 - 660
"UniProt", Database accession no. P50458
ALTSCHUL ET AL., J. MOL. BIOL., vol. 215, 1990, pages 403 - 410
ALTSCHUL ET AL., NUC. ACIDS RES., vol. 25, 1977, pages 3389 - 3402
AMABILE ET AL.: "Inheritable Silencing of Endogenous Genes by Hit-and-Run Targeted Epigenetic Editing", CELL, vol. 167, no. 1, 2016, pages 219 - 232, XP029748865, DOI: 10.1016/j.cell.2016.09.006
APONTE-UBILLUS ET AL.: "MOLECULAR DESIGN FOR RECOMBINANT ADENO-ASSOCIATED VIRUS (RAAV) VECTOR PRODUCTION", APPLIED MICROBIOLOGY AND BIOTECHNOLOGY, vol. 102, no. 3, 2018, pages 1045 - 1054, XP036390095, DOI: 10.1007/s00253-017-8670-1
BODNAR ET AL., SCIENCE, vol. 279, 1998, pages 349 - 52
BYRNE ET AL., METHODS ENZYMOL., vol. 546, 2014, pages 119 - 38
CHAN CSHEN DZHOU MROSS RDING XZHANG KGREEN RTUO J: "Human htral in the archived eyes with age-related macular degeneration", TRANS AM OPHTHALMOL SOC, vol. 105, 2007, pages 92 - 98
CHOO ET AL., CURR. OPIN. STRUCT. BIOL., vol. 10, 2000, pages 411 - 416
CHOWERS IMEIRTLEDERMAN MGOLDENBERG-COHEN NCOHEN YBANIN EAVERBUKH EHEMO IPOLLACK AAXER-SIEGEL R: "Sequence variants in HTRA1 and LOC387715/ARMS2 and phenotype and response to photodynamic therapy in neovascular age-related macular degeneration in populations from Israel", MOL VIS, vol. 14, 2008, pages 2263 - 71
CHYLINKSI ET AL., RNA BIOL., vol. 10, no. 5, 1 May 2013 (2013-05-01), pages 726 - 737
COLIJN JMBUITENDIJK GHSPROKOFYEVA E ET AL.: "Prevalance of age-related macular degeneration in Europe: The past and the future", OPHTHALMOLOGY, vol. 124, 2017, pages 1753 - 63, XP085266109, DOI: 10.1016/j.ophtha.2017.05.035
CUI ET AL.: "Review of CRISPR/Cas9 sgRNA Design Tools", INTERDISCIP. SCI., vol. 10, 2018, pages 455 - 465, XP036502047, DOI: 10.1007/s12539-018-0298-z
DEWAN ALIU MHARTMAN SZHANG SSLIU DTZHAO CTAM POCHAN WMLAM DSSNYDER M: "HTRA1 promoter polymorphism in wet age-related macular degeneration", SCIENCE, vol. 314, 2006, pages 989 - 92, XP002486674, DOI: 10.1126/science.1133807
DING ET AL.: "AAV8-vectored suprachoroidal gene transfer produces widespread ocular transgene expression", J CLIN INVEST, vol. 129, no. 11, 2019, pages 4901 - 4911, XP055889807, DOI: 10.1172/JCI129085
DOENCH ET AL., NATURE BIOTECHNOLOGY, vol. 34, 2016, pages 184 - 191
DOENCH ET AL., NT. BIOTECHNOL, vol. 34, no. 2, 2016, pages 184 - 191
DOMINGUEZ ET AL., NAT REV MOL CELL BIOL., vol. 17, no. 1, 2016, pages 5 - 15
DOMINQUEZ ET AL.: "Beyond editing: repurposing CRISPR-Cas9 for precision genome regulation and interrogation", NAT. REV. MOL. CELL. BIOL., vol. 17, 2016, pages 5 - 15
DUNBAR ET AL.: "Gene Therapy Comes Of Age", SCIENCE, vol. 359, 2018, pages 6372
EMAMIYIU: "Medical and Sugical Applications for the Suprachoroidal Space", INT OPHTHALMOL CLIN, vol. 59, no. 1, 2019, pages 195 - 207
ESVELT KMMALI P ET AL.: "Orthogonal Cas9 proteins for RNA-guided gene regulation and editing", NATURE METHODS, vol. 10, no. 11, 2013, pages 1116 - 1121, XP055128928, DOI: 10.1038/nmeth.2681
FISHER SAABECASIS GRYASHAR BM: "Meta-analysis of genome scans of age-related macular degeneration", HUM MOL GENET, vol. 14, 2005, pages 2257 - 64
FLAXMAN SRBOURNE RRARESNIKOFF S ET AL.: "Global causes of blindness and distance vision impairment 1990-2020: a systematic review and meta-analysis", LANCET GLOB HEALTH, vol. 5, no. 12, 2017, pages e1221 - e1234
FRITSCHE LGLOENHARDT TJANSSEN AFISHER SARIVERA AKEILHAUER CNWEBER BH.: "Age-related macular degeneration is associated with an unstable ARMS2 (LOC387715) mRNA", NATURE GENETICS, vol. 40, 2008, pages 892 - 6
FUKUTAKE, T.: "Cerebral Autosomal Recessive Arteriopathy with Subcortical Infarcts and Leukoencephalopathy (CARASIL): From Discovery to Gene Identification", J STROKE CEREBROVASC DIS, vol. 20, 2011, pages 85 - 93, XP028145916, DOI: 10.1016/j.jstrokecerebrovasdis.2010.11.008
FULTON: "TFCat: the curated catalog of mouse and human transcription factors", GENOME BIOL, vol. 10, 2009, pages R29, XP021053577, DOI: 10.1186/gb-2009-10-3-r29
GLEDITZSCH ET AL.: "PAM identification by CRISPR-Cas effector complexes: diversified mechanisms and structures", RNA BIOL, vol. 16, no. 4, April 2019 (2019-04-01), pages 504 - 517, XP055867769, DOI: 10.1080/15476286.2018.1504546
GRASSMAN FHEID IMWEBER BHINTERNATIONAL AMD GENOMICS CONSORTIUM.: "Recombinant haplotypes narrow the ARMS/HTRA1 association signal for age-related macular degeneration", GENETICS, vol. 205, 2017, pages 919 - 924
GRAU ET AL., PROC. NATL. ACAD. SCI. U. S. A., vol. 102, no. 17, 2005, pages 6021 - 6026
GRAYSAMULSKI: "Gene Vector Design and Application to Treat Nervous System Disorders", 2011, SOCIETY FOR NEUROSCIENCE, article "VECTOR DESIGN AND CONSIDERATIONS FOR CNS APPLICATIONS", pages: 1 - 9
HARA KSHIGA AFUKUTAKE T ET AL.: "Association of HTRA1 mutations and familial sschemic cerebral small-vessel disease", N ENGL J MED, vol. 360, 2009, pages 1729 - 39
HAYWARD ET AL., HUM. MOL. GENET., vol. 12, 2003, pages 2657 - 67
HENIKOFFHENIKOFF, PROC. NATL. ACAD. SCI. USA, vol. 89, 1989, pages 10915
HIRAI ET AL.: "Structure and functions of powerful transactivators: VP16, MyoD and FoxA Int", J. DEV. BIOL, vol. 54, no. 11-12, 2010, pages 1589 - 1596, XP055157454, DOI: 10.1387/ijdb.103194hh
HIRSCH ET AL., MOL. THER., vol. 18, 2010, pages 6 - 8
HOLZ FGTADAYONI RBEATTY SBERGER ACEREDA MGCORTEZ RHOYNG CBHYKIN PSTAURENGHI GHELDNER S: "Multi-country real-life experience of anti-vascular endothelial growth factor therapy for wet age-related macular degeneration", BR J OPHTHALMOL, vol. 99, no. 2, 2015, pages 220 - 6
HORLBECK ET AL., ELIFE, vol. 5, 2016, pages e19760
HOU ET AL., PROC NATL ACAD SCI USA., vol. 110, no. 39, 24 September 2013 (2013-09-24), pages 15644 - 9
HUME ET AL.: "UniPROBE, update 2015: new tools and content for the online database of protein-binding microarray data on protein-DNA interactions", NUCLEIC ACIDS RE., vol. 43, 2015, pages D117 - D122
ISALAN ET AL., NATURE BIOTECHNOL., vol. 19, 2001, pages 656 - 660
ITAKAKATAOKA: "Recent development of nonviral gene delivery systems with virus-like structures and mechanisms", EUR J PHARMA AND BIOPHARMA, vol. 71, 2009, pages 475 - 483, XP025992168, DOI: 10.1016/j.ejpb.2008.09.019
JAKIMO ET AL., CAS9 WITH COMPLETE PAM RECOGNITION FOR ADENINE DINUCLEOTIDES BIORXIV, 2018
JINEK ET AL., SCIENCE, vol. 337, no. 6096, 17 August 2012 (2012-08-17), pages 816 - 823
JOLMA ET AL.: "DNA-binding specificities of human transcription factors", CELL, vol. 152, 2013, pages 327 - 339
JOLMA ET AL.: "DNA-dependent formation of transcription factor pairs alters their binding specificity", NATURE, vol. 527, 2015, pages 384 - 388, XP055750401, DOI: 10.1038/nature15518
JONES AKUMAR SZHANG NTONG ZYANG JHWATT CANDERSON JAMRITA, FILLERUP HMCCLOSKEY MLUO L: "Increased expression of multifunctional serine protease, HTRA1, in retinal pigment epithelium induces polypoidal choroidal vasculopathy in mice", PROC. NATL. ACAD. SCI. U.S.A., vol. 108, no. 35, 2011, pages 14578 - 83, XP055124215, DOI: 10.1073/pnas.1102853108
KANDA ACHEN WOTHMAN MBRANHAM KEBROOKS MKHANNA RHE SLYONS RABECASIS GRSWAROOP A.: "A variant of mitochondrial protein LOC387715/ARMS2, not HTRA1, is strongly associated with age-related macular degeneration", PNAS, vol. 104, no. 20, 2007, pages 16227 - 32, XP002629042, DOI: 10.1073/pnas.0703933104
KANSAR ET AL.: "Suprachoroidal Delivery of Viral and Nonviral Gene Therapy for Retinal Disease", J OCULAR PHARMACOL THER
KARVEKIS ET AL.: "PAM recognition by miniature CRISPR-Casl4 triggers programmable double-stranded DNA cleavage.", BIORXIV, 2019, Retrieved from the Internet <URL:https://doi.org/10.1101/654897>
KEEKER ET AL., CLIN TRANSL SCI., vol. 10, 2017, pages 242 - 248
KEELER ET AL.: "Gene Therapy 2017: Progress and Future Directions", CLIN. TRANSL. SCI., vol. 10, 2017, pages 242 - 248
KEENAN: "ASSESSMENT OF PROTEINS ASSOCIATED WITH COMPLEMENT ACTIVATION AND INFLAMMATION IN MACULAE OF HUMAN DONORS HOMOZYGOUS RISK AT CHROMOSOME 1 CFH-TO-F13B", INVEST OPHTHALMOL VIS SCI., vol. 56, 2015, pages 487 - 79
KIM ET AL., J. BIOL. CHEM., vol. 31, no. 978-31, 1994, pages 982
KIM ET AL., PROC. NATL. ACAD. SCI. USA, vol. 91, 1994, pages 883 - 887
KLEINSTIVER ET AL.: "Engineered CRISPR-Cas12a Variants with Increased Activities and Improved Targeting Ranges for Gene, Epigenetic And Base Editing", NATURE BIOTECHNOLOGY, vol. 37, 2019, pages 276 - 282, XP037171464, DOI: 10.1038/s41587-018-0011-0
KOMOR ET AL., NATURE, vol. 533, no. 7603, 2016, pages 420 - 424
KONERMAN ET AL., NATURE, vol. 517, no. 7536, 2015
KONERMANN ET AL., NATURE, vol. 517, no. 7536, 29 January 2015 (2015-01-29)
KORTVELY EHAUCK SMDUETSCH GGLOECKNER CJKREMMER EALGE-PRIGLINGER CSDEEG CAUEFFING M.: "ARMS2 is a constituent of the extracellular matrix providing a link between familial and sporadic age-related macular degenerations", INVEST OPHTALMOL VIS SCI, vol. 51, 2010, pages 79 - 88
LAMBERT ET AL.: "The Human Transcription Factors", CELL, vol. 172, 2018, pages 650 - 665, XP085347128, DOI: 10.1016/j.cell.2018.01.029
LAMBERT SAJOLMA ACAMPITELLI LFDAS PKYIN YALBU MCHEN XTAIPALE JHUGHES TRWEIRAUCH MT, CELL, vol. 172, no. 4, 2018, pages 650 - 665
LAU CSUH Y.: "In vivo genome editing in animals using AAV-CRISPR system: applications to translational research of human disease", F1000 RES, vol. 6, 2017, pages 2153, XP055573337, DOI: 10.12688/f1000research.11243.1
LEGUT ET AL.: "High-Throughput Screens of PAM-Flexible Cas9", CELL REPORTS, vol. 30, 2020, pages 2859 - 2868
LEVY ET AL., NAT. BIOMED. ENG., vol. 4, no. 1, 2020, pages 97 - 110
LI ET AL., PROC. NATL. ACAD. SCI. USA, vol. 89, 1992, pages 4275 - 4279
LI ET AL., PROC. NATL. ACAD. SCI. USA, vol. 90, 1993, pages 2764 - 2768
LLOYD ET AL., FRONTIERS IN IMMUNOLOGY, vol. 4, no. 221, 2013, pages 1 - 7
LONSDALE JTHOMAS JSALVATORE M ET AL.: "The Genotype-Tissue Expression (GTEx) project", NAT GENET, vol. 45, 2013, pages 580 - 5
MATHELIER ET AL.: "JASPAR 2016: a major expansion and update of the open-access database of transcription factor binding profiles", NUCLEIC ACIDS RES., vol. 44, 2016, pages D110 - D115
MATYS ET AL.: "TRANSFAC and its module TRANSCompel: transcriptional gene regulation in eukaryotes", NUCLEIC ACIDS RES., vol. 34, 2006, pages D108 - D110
MOORE DJCLOVER GM.: "The effect of age on the macromolecular permeability of human Bruch's membrane", INVEST OPHTHALMOL VIS SCI, vol. 42, 2001, pages 2970 - 5
MOORE ET AL.: "GENE THERAPY FOR AGE-RELATED MACULAR DEGENERATION", EXPERT OPINION ON BIOLOGICAL THERAPY, vol. 17, no. 10, 2017, pages 1235 - 1244, XP055404429, DOI: 10.1080/14712598.2017.1356817
MURALIDHARAN ET AL., J. NEUROSCI, vol. 37, no. 46, 2017, pages 11245 - 54
NAGY: "Cre recombinase: the universal reagent for genome tailoring", GENESIS, vol. 26, no. 2, 2000, pages 99 - 109, XP008028883, DOI: 10.1002/(SICI)1526-968X(200002)26:2<99::AID-GENE1>3.0.CO;2-B
NASO ET AL.: "Adeno-Associated Virus (Aav) As A Vector For Gene Therapy", BIODRUGS, vol. 31, 2017, pages 317, XP055547503, DOI: 10.1007/s40259-017-0234-5
NAT. REV. MICROBIOL., vol. 9, no. 6, pages 467 - 477
NEEDLEMANWUNSCH, J. MOL. BIOL., vol. 48, 1970, pages 443
OCHAKOVSKI ET AL.: "RETINAL GENE THERAPY: SURGICAL VECTOR DELIVERY IN THE TRANSLATION TO CLINICAL TRIALS", FRONTIERS IN NEUROSCIENCE, vol. 11, 2017
PABO ET AL., ANN. REV. BIOCHEM., vol. 70, 2001, pages 313 - 340
PAPADAKIS ET AL.: "PROMOTERS AND CONTROL ELEMENTS: DESIGNING EXPRESSION CASSETTES FOR GENE THERAPY", CURRENT GENE THERAPY, vol. 4, 2004, pages 89 - 113, XP009159935, DOI: 10.2174/1566523044578077
PEARSONLIPMAN, PROC. NAT'L. ACAD. SCI. USA, vol. 85, 1988, pages 2444
PEDDLE ET AL.: "CRISPR Interference-Potential Application in Retinal Disease", INT. J. MOL. SCI., vol. 21, 2020, pages 1 - 14
PENAUD-BUDLOO ET AL.: "Pharmacology of Recombinant Adeno- Associated Virus Production", MOLECULAR THERAPY: METHODS & CLINICAL DEVELOPMENT, vol. 8, 2018, pages 166 - 180, XP055713307, DOI: 10.1016/j.omtm.2018.01.002
PENAUD-BUDLOO ET AL.: "PHARMACOLOGY OF RECOMBINANT ADENO-ASSOCIATED VIRUS PRODUCTION", MOLECULAR THERAPY: METHODS & CLINICAL DEVELOPMENT, vol. 8, 2018, pages 166 - 180, XP055713307, DOI: 10.1016/j.omtm.2018.01.002
PENG YSHEKHAR KYAN WHERRMANN DSAPPINGTON ABRYMAN GSVANZYL TDO MTHREGEV ASANES JR: "Molecular classification and comparative taxonomics of foveal and peripheral cells in primate retina", CELL, vol. 176, no. 5, 2019, pages 1222 - 1237
PICKAR-OLIVER ET AL.: "The next generation of CRISPR-Cas technologies and applications", NATURE REVIEWS MOLECULAR CELL BIOLOGY, vol. 20, 2019, pages 490 - 507, XP037038726, DOI: 10.1038/s41580-019-0131-5
PICKAR-OLIVERGERSBACH, NATURE, vol. 20, August 2019 (2019-08-01)
POCHE ET AL.: "Retinal horizontal cells: challenging paradigms of neural development and cancer biology", DEVELOPMENT, vol. 136, 2009, pages 2141 - 2151
POTTHOFFOLSON: "MEF2: a central regulator of diverse developmental programs", DEVELOPMENT, vol. 134, no. 23, 2007, pages 4131 - 4140, XP055070212, DOI: 10.1242/dev.008367
POWELLGRAY: "VIRAL EXPRESSION CASSETTE ELEMENTS TO ENHANCE TRANSGENE TARGET SPECIFICITY AND EXPRESSION IN GENE THERAPY", DISCOV. MED., vol. 19, no. 102, 2015, pages 49 - 57, XP055272358
REGILLO CDBUSBEE BGHO ACDING BHASKOVA Z: "Baseline predictors of 12-month treatment response to ranibizumab in patients with wet age-related macular degeneration", AM J OPHTHALMOL, vol. 160, no. 5, 2015, pages 1014 - 23
RIVERA AFISHER SAFRITSCHE LGKEILHAUER CNLICHTNER PMEITINGER TWEBER BH: "Hypothetical LOC387715 is a second major susceptibility gene for age-related macular degeneration, contributing independently of complement factor H to disease risk", HUM MOL GENET, vol. 14, 2005, pages 3227 - 36, XP002423453, DOI: 10.1093/hmg/ddi353
SAMPSON ET AL., NATURE, vol. 497, no. 7448, 9 May 2013 (2013-05-09), pages 254 - 7
SARSTEDT: "Spotlight on Cas12 A search for more type V Cas12 family members turns up unexpected functionality", NATURE METHODS, vol. 16, 2019, pages 213 - 219
SCHON ET AL.: "Retinal Gene Delivery By Adeno-Associated Virus (Aav) Vectors: Strategies And Appucations", EUROPEAN JOURNAL OF PHARMACEUTICS AND BIOPHARMACEUTICS, vol. 95, 2015, pages 343 - 352, XP055533708, DOI: 10.1016/j.ejpb.2015.01.009
SCHON ET AL.: "RETINAL GENE DELIVERY BY -ASSOCIATED VIRUS (AAV) VECTORS: STRATEGIES AND APPLICATIONS", EUROPEAN JOURNAL OF PHARMACEUTICS AND BIOPHARMACEUTICS, vol. 95, 2015, pages 343 - 352, XP055533708, DOI: 10.1016/j.ejpb.2015.01.009
See also references of EP3953485A4
SEGAL ET AL., CURR. OPIN. BIOTECHNOL., vol. 12, 2001, pages 632 - 637
SENGUPTA ET AL.: "Viral Cre-LoxP tools aid genome modification in mammalian cells", J. BIOLOGICAL ENGINEERING, vol. 11, 2017, pages 45, XP055601775, DOI: 10.1186/s13036-017-0087-y
SMITHWATERMAN, ADV. APPL. MATH., vol. 2, 1981, pages 482
SRIVASTAVA ET AL., J. VIROL., vol. 45, 1983, pages 555 - 564
SUN ET AL.: "Transcription activator-like effector nucleases (TALENs): a highly efficient and versatile tool for genome editing", BIOTECHNOL BIOENG., vol. 110, no. 7, 2013, pages 1811 - 21
TANG ET AL., EFFICIENT CLEAVAGE RESOLVES PAM PREFERENCES OF CRISPR-CAS IN HUMAN CELLS CELL REGENERATION, vol. 8, 2019, pages 44 - 50
THAKORE ET AL.: "RNA-guided transcriptional silencing in vivo with S. aureus CRISPR-Cas9 repressors", NAT COMMUN, vol. 9, no. 1, 2018, pages 1674, XP055624179, DOI: 10.1038/s41467-018-04048-4
TRAPANI ET AL.: "VECTOR PLATFORMS FOR GENE THERAPY OF INHERITED RETINOPATHIES", PROGRESS IN RETINAL AND EYE RESEARCH, vol. 43, 2014, pages 108e128
URNOV ET AL.: "Genome editing with engineered zinc finger nucleases", NAT REV GENET, vol. 11, no. 9, 2010, pages 636 - 46, XP055198280, DOI: 10.1038/nrg2842
VAQUERIZAS ET AL.: "A census of human transcription factors: function, expression and evolution", NAT. REV. GENET., vol. 10, 2009, pages 252 - 263
VIERKOTTEN SMUETHER PFAUSER S: "Overexpression of HTRA1 Leads to Ultrastructural Changes in the Elastic Layer of Bruch's Membrane via Cleavage of Extracellular Matrix Components", PLOS ONE, vol. 6, no. 8, 2011, pages e22959
VINGERLING ET AL., EPIDEMIOL. REV., vol. 17, no. 2, 1995, pages 347 - 360
WANG ET AL., PLOS I ONE, 2012, Retrieved from the Internet <URL:https://doi.org/10.1371/journal.pone.0039446>
WANG GSCOTT WKWHITEHEAD PCOURT BLKOVACH JLSCHWARTZ SGAGARWAL ADUBOVY SHAINES JLPERICAK-VANCE MA: "A novel ARMS2 splice variant is identified in human retina", EXP. EYE RES, vol. 94, 2012, pages 187 - 91
WANG NECKERT KZOMORRODI AXIN PPAN WSHEARER DWEISZ JMARANUS CCLAWSON G, PLOS LONE, 2012, Retrieved from the Internet <URL:https://doi.org/10.1371/journal.pone.0039446>
WEBER ET AL., NAT. GENET, vol. 8, no. 4, pages 352 - 6
WEINTRAUB ET AL.: "YY1 Is a Structural Regulator of Enhancer-Promoter Loops", CELL, vol. 171, 2017, pages 1573 - 88
WEIRAUCH ET AL.: "Determination and inference of eukaryotic transcription factor sequence specificity", CELL, vol. 158, 2014, pages 1431 - 1443, XP029055513, DOI: 10.1016/j.cell.2014.08.009
WINGENDER ET AL.: "TFClass: a classification of human transcription factors and their rodent orthologs", NUCLEIC ACIDS RES., vol. 43, 2015, pages D97 - D102
WONG WLSU XLI XCHEUNG CMKLEIN RCHENG CYWONG TY: "Global prevalence of age-related macular degeneration and disease burden projection for 2020 and 2040: a systematic review and meta-analysis", LANCET GLOB HEALTH, vol. 2, no. 2, 2014, pages e106 - 16
WU ET AL.: "FUNDUS AUTOFLUORESCENCE CHARACTERISTICS OF NASCENT GEOGRAPHIC ATROPHY IN AGE-RELATED MACULAR DEGENERATION", INVEST OPHTHALMOL VIS SCI., vol. 56, 2015, pages 1546 - 52
XU ET AL.: "A CRISPR-dCas Toolbox for Genetic Engineering and Synthetic Biology", J. MOL. BIOL., 2018
XUE ET AL.: "TECHNIQUE OF RETINAL GENE THERAPY: DELIVERY OF VIRAL VECTOR INTO THE SUBRETINAL SPACE", EYE, vol. 31, 2017, pages 1308 - 1316, XP055588589, DOI: 10.1038/eye.2017.158
YANG ET AL.: "A Variant of the HTRA1 Gene Increases Susceptibility to Age-Related Macular Degeneration", SCIENCE, vol. 314, no. 5801, 10 November 2006 (2006-11-10), pages 992 - 993, XP002486673, DOI: 10.1126/science.1133811 *
YANG ZCAMP NJSUN HTONG ZGIBBS DCAMERON DJCHEN HZHAO YPEARSON ELI X: "A variant of the HTRA1 gene increases susceptibility to age-related macular degeneration", SCIENCE, vol. 314, 2006, pages 992 - 3, XP002486673, DOI: 10.1126/science.1133811
YANIK ET AL.: "In vivo genome editing as a potential treatment strategy for inherited retinal dystrophies", PROGRESS IN RETINAL AND EYE RESEARCH, vol. 56, 2017, pages 1 - 18
YIN ET AL.: "Impact of cytosine methylation on DNA binding specificities of human transcription factors", SCIENCE, vol. 356, 2017, pages eaaj2239
ZARBIN, EUR. OPHTHALMOL., vol. 8, 1998, pages 199 - 206
ZELLNER ASCHARRER EARZBERGER T ET AL.: "CADASIL brain vessels show a HTRA1 loss-of-function profile", ACTA NEUROPATHOL, vol. 136, 2018, pages 111 - 125, XP036532300, DOI: 10.1007/s00401-018-1853-8
ZHAO ET AL.: "CRISPR-offinder: a CRISPR guide RNA design and off-target searching tool for user-defined protospacer adjacent motif", INT J BIOL SCI, vol. 13, no. 12, 2017, pages 1470 - 1478
ZIBETTI ET AL.: "Epigenomic profiling of retinal progenitors reveals LHX2 is required for developmental regulation of open chromatin", COMMUNICATIONS BIOLOGY, 25 April 2019 (2019-04-25), pages 1 - 13
ZOLOTUKIN ET AL.: "Production And Purification Of Serotype 1, 2, And 5 Recombinant Adeno-Associated Viral Vectors", METHODS, vol. 28, 2002, pages 158 - 167, XP002256404, DOI: 10.1016/S1046-2023(02)00220-7

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2023011248A1 (zh) * 2021-08-05 2023-02-09 呈诺再生医学科技(珠海横琴新区)有限公司 以iPSC来源的细胞为载体、基因治疗湿性年龄相关性黄斑变性
WO2023023278A3 (en) * 2021-08-18 2023-06-08 University Of Utah Research Foundation Multigene constructs for treatment of age-related macular degeneration and other complement dysregulation-related conditions
WO2023086663A3 (en) * 2021-11-15 2023-06-22 The Children's Medical Center Corporation Methods for tauopathy diagnosis and treatment

Also Published As

Publication number Publication date
JP2022526429A (ja) 2022-05-24
CA3136119A1 (en) 2020-10-15
EP3953485A4 (en) 2023-05-17
JP2025175283A (ja) 2025-12-01
EP3953485A1 (en) 2022-02-16
US20230165976A1 (en) 2023-06-01
CN113966401A (zh) 2022-01-21

Similar Documents

Publication Publication Date Title
US20250235556A1 (en) Gene therapy for autosomal dominant diseases
EP4186921A1 (en) Gene editing for autosomal dominant diseases
US12285495B2 (en) Genome editing methods and constructs
JP2025175283A (ja) Amdの処置のためのhtra1調節
US11492614B2 (en) Stem loop RNA mediated transport of mitochondria genome editing molecules (endonucleases) into the mitochondria
CN113631710A (zh) 用于治疗rho相关的常染色体显性视网膜色素变性(adrp)的crispr/rna指导的核酸酶相关方法和组合物
KR20210049833A (ko) Mma의 치료를 위한 비-붕괴적 유전자 요법
Liu et al. Allele-specific gene-editing approach for vision loss restoration in RHO-associated retinitis pigmentosa
WO2019134561A1 (en) High efficiency in vivo knock-in using crispr
US12590323B2 (en) Compositions for use in treating autosomal dominant BEST1-related retinopathies
US20240207448A1 (en) Crispr/rna-guided nuclease-related methods and compositions for treating rho-associated autosomal-dominant retinitis pigmentosa (adrp)
AU2021219795A1 (en) Haplotype-based treatment of RP1 associated retinal degenerations
WO2026025441A1 (zh) 一种用于显性遗传的视网膜色素变性基因编辑药物载体
HK40075787A (en) Gene therapy for autosomal dominant diseases
LLADO SANTAEULARIA THERAPEUTIC GENOME EDITING IN RETINA AND LIVER
WO2026088097A1 (en) Mutation-independent genome editing
EP4698663A1 (en) Genome editing methods and constructs
WO2026032020A1 (zh) Aav介导的rpgr x连锁视网膜变性的基因编辑治疗方法
HK1251615B (en) Gene therapy for autosomal dominant diseases

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 20787458

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 3136119

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2021559892

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2020787458

Country of ref document: EP

Effective date: 20211110