WO2020197330A1 - 혈액응고인자 viii 유전자 역위 보정에 의한 혈우병 치료용 조성물 - Google Patents

혈액응고인자 viii 유전자 역위 보정에 의한 혈우병 치료용 조성물 Download PDF

Info

Publication number
WO2020197330A1
WO2020197330A1 PCT/KR2020/004232 KR2020004232W WO2020197330A1 WO 2020197330 A1 WO2020197330 A1 WO 2020197330A1 KR 2020004232 W KR2020004232 W KR 2020004232W WO 2020197330 A1 WO2020197330 A1 WO 2020197330A1
Authority
WO
WIPO (PCT)
Prior art keywords
guide rna
gene
composition
sequence
target
Prior art date
Application number
PCT/KR2020/004232
Other languages
English (en)
French (fr)
Inventor
송동우
이규준
김운기
최범석
이강인
Original Assignee
주식회사 툴젠
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 툴젠 filed Critical 주식회사 툴젠
Priority to KR1020217026772A priority Critical patent/KR20210113393A/ko
Publication of WO2020197330A1 publication Critical patent/WO2020197330A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/7105—Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00—Drugs for disorders of the blood or the extracellular fluid
    • A61P7/04—Antihaemorrhagics; Procoagulants; Haemostatic agents; Antifibrinolytic agents
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/102—Mutagenizing nucleic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/90—Stable introduction of foreign DNA into chromosome
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/90—Stable introduction of foreign DNA into chromosome
    • C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
    • C12N15/907—Stable introduction of foreign DNA into chromosome using homologous recombination in mammalian cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22—Ribonucleases RNAses, DNAses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPRs]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/35—Nature of the modification
    • C12N2310/351—Conjugate
    • C12N2310/3519—Fusion with another nucleic acid

Definitions

  • the present invention is a composition for correcting inversion and a composition for treating hemophilia that targets and restores uninverted genes and distal inverted genes, and is a gene scissors system having a resilience against inversion mutations occurring in blood coagulation factor VIII (F8). (CRISPR/Cas system) and a hemophilia A treatment technology using the same.
  • Hemophilia is a congenital hemorrhagic disease caused by a congenital deficiency of a blood coagulation factor
  • hemophilia A is a factor VIII deficiency
  • hemophilia B is a factor IX deficiency (christmas disease)
  • C Hemophilia is known to be caused by FXI deficiency.
  • Hemophilia A and B which account for 95% of the related symptoms, are inherited by recessive X chromosome.In particular, the incidence of hemophilia A is 1 per 5,000 to 10,000 surviving males, and 20 to 30% of patients have no family history. It is caused by mutation, and in Korea, hemophilia A is about 6 times higher than that of B type.
  • Hemophilia A is classified into mild (5 to 30% activity), moderate (1 to 5% activity) and severe ( ⁇ 1% activity), depending on the activity of blood coagulation factor FVIII. , Tooth extraction, continuous bleeding after surgery, and diagnosis within 1 year of life (J Graw et al ., 2005). Depending on the condition of the symptoms, severe type A develops spontaneous bleeding symptoms within 2 to 5 months when not receiving treatment, but mild type A does not have spontaneous bleeding unless surgical damage occurs. There are cases where this doesn't work.
  • hemophilia A joint hemorrhage is the most common, accounting for about 60%. In severe cases, it usually begins at 12 to 18 months of walking, and occurs around 2 to 5 years of age in moderate cases. If joint bleeding is repeated, chronic bursa thickening is caused, which eventually damages cartilage, and due to bone cyst formation and bone erosion, joints become stiff, limit movement, and deformities.
  • intramuscular bleeding due to physical injury or intramuscular injection accounts for about 30% of the bleeding, and when hematoma is formed by bleeding into a limited space, sensory and motor impairments and arterial circulation disorders may occur due to pressure on important organs, and not immediately treated.
  • Submucosal hemorrhage can be life-threatening by blocking the tongue and throat; Gastrointestinal bleeding usually results from lesions in the upper gastrointestinal tract; And intracranial bleeding is a common cause of death, and occurs after injury in about 10% of patients, and is characterized by death in 30%.
  • Hemophilia treatment method was possible only with plasma and whole blood until the 1960s, and since it was discovered that a large amount of FVIII factor was contained in cryoprecipitate in 1965, the concentrate was developed as a treatment, and in 1987, recombinant FVIII was used as a treatment. However, since there is no fundamental cure, treatment for hemophilia is a combination of treatment for bleeding and complications.
  • FVIII a hemophilia-related blood coagulation factor
  • Xq28 X chromosome
  • Xq28 X chromosome
  • int22 inversion mutation of intron 22
  • point mutation is the cause of moderate and mild hemophilia A.
  • the inversion of FVIII occurs due to recombination by homologs present on intron 1 and intron 22, the inversion at intron 1 is about 5%, and the inversion at intron 22 Is about 40%, and the inversion by intron 22 occurs 8 times more frequently.
  • intron 22 about 500-600 kb by homologous recombination of int22h-1 homolog present on the intron and int22h-2 (type 2) or int22h-3 (type 1) present at a distance of approximately 500 kb toward the telomeric It is known that inverted mutations occur in nucleic acid fragments of the length of (Naylor J et al ., 1995).
  • the CRISPR/Cas system is originally an adaptive immune system against the influx of foreign genes such as viruses and phages from bacteria or archaea (Pendades et al ., 2014).
  • the genetic scissors system is divided into Type I, II and III according to the composition of the protein complex including the Cas protein constituting it, and is classified in detail according to the composition and number of Cas genes (Makarova, A et al ., 2011) .
  • the type II CRISPR/Cas system derived from Streptococcus pyogenes which is being studied most actively, consists of Cas9, and is composed of Cas9, 2 of crRNA and tracrRNA, because the size of the operon is small and suitable for use as a gene editing technology. It forms a complex with species RNA and recognizes the PAM sequence present on the target gene to distinguish the target and has the activity of generating a double strand break for it (Jinek et al ., 2012).
  • the gene editing mechanism using the genetic scissors system is Cas9 and (a) crRNA and tracrRNA containing a guide sequence that recognizes a target gene of 30 bp or less, or (b) a single RNA fusion of the two strands. It proceeds by a complex of chain guide RNA: When Cas9 forming the complex recognizes a protospacer adjacent motif (PAM) present on the target gene and locates on the double-stranded DNA, 5'of the protospacer adjacent motif (PAM) The crRNA guide sequence is bound to a sequence complementary to the target sequence present on the upper side, and a double strand break (DSB) is generated by Cas9.
  • PAM protospacer adjacent motif
  • DSB double strand break
  • the cut DNA is subjected to gene mutation or gene modification by non-homologous end joining (NHEJ) or homology-directed repair, which is a DNA repair system existing in cells.
  • NHEJ non-homologous end joining
  • homology-directed repair which is a DNA repair system existing in cells.
  • Non-homologous end-linking is efficient, but there is an inefficient but accurate mechanism of homologous recombination that can occur when a DNA donor containing a sequence homologous to a sequence near the truncated DNA is present due to random gene rearrangement and insertion/deletion mutation.
  • PAM protospacer adjacent motif
  • Cas9 derived from S. pyogenes is 5'-NGG-3' (N is for A, T, G, C one); Cas9 from S. thermophilus is 5'-NNAGAAW-3'; Cas9 derived from C jejuni is known as 5'-NNNNRYAC-3', and since the sequences are arranged at regular intervals on the human genome, the genetic scissors system can be utilized for gene editing.
  • the ex vivo type of gene editing method is efficient in terms of target delivery ability, but this cell therapy method has the disadvantage that it is difficult to obtain a fundamental gene therapy effect, so the disease that can be treated is limited. Therefore, in order to treat various diseases In vivo gene editing is essential.
  • Technologies that can be used as in vivo delivery systems include methods of using viral vectors such as AAV (adeno-associated virus) and methods of using non-viral vectors in which Cas9 mRNA and sgRNA are packaged in lipid nanoparticles.
  • RNA and intron 22 of the distal region that specifically recognizes intron 22 that is not inverted in the gene.
  • a genetic scissors system was applied that targets guide RNA that specifically recognizes inversion.
  • An object of the present invention includes a guide RNA that specifically recognizes the uninverted hemocoagulation factor VIII (F8) gene and the distal inversion in order to apply the inversion correction gene scissor system (CRISPR/Cas system) including the Cas protein. It is to provide a composition for correcting the inversion of the blood coagulation factor VIII (F8) gene.
  • CRISPR/Cas system inversion correction gene scissor system
  • Another object of the present invention is to provide a guide RNA that specifically recognizes the uninverted coagulation factor VIII (F8) gene and the distal inversion in order to apply an inversion correction gene scissor system (CRISPR/Cas system) including a Cas protein. It is to provide a composition for preventing or treating hemophilia, including.
  • the present invention provides (i) a guide RNA specifically recognizing an inverted no. 22 intron in the blood coagulation factor VIII (F8) gene; (ii) a guide RNA that specifically recognizes intron inversion 22 of the distal region; And (iii) it provides a composition for correcting the inversion of the coagulation factor VIII (F8) gene comprising a target-specific nuclease or a nucleotide encoding the same.
  • the present invention also includes: (i) a guide RNA specifically recognizing intron #22 in the unreversed coagulation factor VIII(F8) gene; (ii) a guide RNA that specifically recognizes intron inversion 22 of the distal region; And (iii) it provides a composition for the prevention or treatment of hemophilia comprising a target-specific nuclease or a nucleotide encoding the same.
  • the present invention also includes (i) a guide RNA specifically recognizing intron 22 in the unreversed coagulation factor VIII(F8) gene; And (ii) a genetic scissors system (CRISPR/Cas system) for correcting coagulation factor VIII (FVIII) gene inversion using a guide RNA and Cas protein that specifically recognizes the inverse 22 intron of the distal region.
  • a guide RNA specifically recognizing intron 22 in the unreversed coagulation factor VIII(F8) gene
  • CRISPR/Cas system genetic scissors system for correcting coagulation factor VIII (FVIII) gene inversion using a guide RNA and Cas protein that specifically recognizes the inverse 22 intron of the distal region.
  • the present invention also includes (i) a guide RNA specifically recognizing intron 22 in the unreversed coagulation factor VIII(F8) gene; And (ii) hemocoagulation factor VIII (FVIII) gene using a guide RNA and Cas protein that specifically recognizes the inversion of intron 22 of the distal region (CRISPR/Cas system) for the prevention or treatment of hemophilia.
  • a guide RNA specifically recognizing intron 22 in the unreversed coagulation factor VIII(F8) gene and
  • hemocoagulation factor VIII (FVIII) gene using a guide RNA and Cas protein that specifically recognizes the inversion of intron 22 of the distal region (CRISPR/Cas system) for the prevention or treatment of hemophilia.
  • the present invention also provides a guide RNA that specifically recognizes one or more of the sequences represented by SEQ ID NOs: 1 to 32.
  • the present invention relates to a composition for correcting the inversion of the coagulation factor VIII (F8) gene, comprising: (i) specifically recognizing intron no. 22 that is not inverted in the coagulation factor VIII (F8) gene Guide RNA; (ii) a guide RNA that specifically recognizes intron inversion 22 of the distal region; And (iii) a target specific nuclease or a nucleotide encoding the same.
  • the term'intron' is a nucleic acid site present on the genome of eukaryotic cells, which is present in pre-mRNA during transcription, but is removed during the production of matured mRNA by splicing, Therefore, it is a DNA sequence on the genome that is not involved in making the protein.
  • the term inversion is one of structural abnormalities of a chromosome caused by rearrangement of a sequence caused by homologous recombination between different homologs on a chromosome. Most of the mutations caused by inversion have a normal phenotype, but when they occur in the meiosis stage of germ cells, a deletion of a chromosome or the formation of a recombined chromosome of duplicates may be formed, resulting in an abnormal phenotype.
  • hemophilia A is caused by an inversion at 28q of the X chromosome.Otherwise, Wolf-Hirschhorn syndrome in which 4p is deleted due to a structural abnormality in chromosome 4, and the inversion of the IDS gene in the Xq chromosome. Hunter's disease is known as a disease caused by inversion.
  • the term'cleavage' refers to separating the covalent bond backbone of a DNA molecule and may be initiated by various methods including enzymatic or chemical hydrolysis of phosphate group bonds. Both single-strand cut and double-strand cut are possible, and double-strand cut can occur as a result of two separate single-strand cut events. DNA cleavage may result in the creation of a blunt end or a staggered end, and cleavage in the present invention is characterized by a blunt end.
  • a guide RNA should be designed to restore the FVIII gene in an inverted state by using the CRISPR/Cas system.
  • a guide sequence of 30 bp or less present at the 5'end side of the guide RNA binds to the target site, and the 3'end side is involved in forming a complex with the Cas protein, which is a nucleic acid cleavage enzyme. Since the Cas protein binding site on the terminal side has a unique sequence due to biological properties, designing a guide RNA refers to a process of selecting a guide sequence that binds to a target site.
  • target' or'target' of the guide RNA in the present invention refers to a sequence to which a guide sequence on the genome where modification, such as deletion, insertion or substitution, occurs in the process of being cut or restored after being cut by a genetic scissors system. it means.
  • the guide RNA of (i) is based on the non-reversed genome of int22h-1.
  • the upper sequence at the 5'end side is determined as a guide sequence, and the guide sequence may be designed to be located at the 5'end side of the guide RNA.
  • the guide RNA since the guide RNA hybridizes to the complementary strand of the DNA strand where the PAM exists, the sequence of the guide RNA has the same characteristics as the upper sequence of the 5'end of the PAM (protospacer-adjacent motif).
  • the sequence of the guide RNA hybridizable with the target site of the target gene is 90% or more, 95% or more, 96% or more of the nucleotide sequence of the complementary strand of the DNA strand where the target sequence is located (i.e., the DNA strand where the PAM sequence is located) , 97% or more, 98% or more, 99% or more, or 100% to mean a nucleotide sequence having sequence complementarity, it is possible to bind to the nucleotide sequence of the complementary strand.
  • the target sequence is represented by the nucleic acid sequence of the strand where the PAM sequence is located among the two DNA strands of the target or target gene.
  • the sequence included in the guide RNA is a target located in the target gene, except for changing T to U due to RNA characteristics. It has the same nucleic acid sequence as the sequence.
  • the guide RNA sequence and the target sequence are represented by the same nucleic acid sequence except that T and U are mutually altered.
  • the target sequence has very good gene editing efficiency (eg, indel frequency (%)) at the on target site, and the number of mismatching nucleotides is 3 or less, 2 or less, 1 As dogs or zeros, there is almost no off-target site, so the probability of genetic correction occurring in parts other than on target is very low or absent, so safety is excellent.
  • gene editing efficiency eg, indel frequency (%)
  • the guide RNA comprises a PAM (Proto-Spacer-Adjacent Motif) sequence 5'-NGG-3', for example, a 1 bp or 2 bp mismatch comprising a sequence that does not exist on the human genome. May be hybridizable with the target.
  • PAM Proto-Spacer-Adjacent Motif
  • the guide RNA specifically recognizing an inverted intron 22 in the blood coagulation factor VIII (F8) gene is, for example, a sequence selected from SEQ ID NOs: 1 to 16. Can be recognized as.
  • a guide RNA that specifically recognizes the inverse 22 intron of the distal region may specifically recognize a sequence selected from, for example, SEQ ID NOs: 17 to 32.
  • the guide RNA may include one or more of the sequences represented by SEQ ID NOs: 1 to 32 (however, T in the sequence is changed to U).
  • the specificity of the scissor system is determined by the guide sequence of the guide RNA, it must undergo an activity verification process before applying it to the gene editing process: based on the protospacer-adjacent motif (PAM) present in the target gene.
  • Guide sequences are selected through published programs such as ATUM Scoring Algorithms, GenScript, and mismatch-sensitive T7 endonucleases are additionally used to verify on-target and off-target effects for guide RNAs containing the selected guide sequences.
  • I(T7E1) analysis and Targeted Deep-sequencing finally, a guide RNA with high target specificity and no off-target effect is determined.
  • the sequence targeted by the guide RNA in the normal cell is the same sequence as the target for restoring the inverted FVIII gene, it is obvious to those skilled in the art to predict the gene restoration ability by the frequency of inversion induction in the normal cell, not the disease model.
  • the CRISPR/Cas system consists of a Cas protein, a tracrRNA (trans-activating RNA), and a crRNA
  • the crRNA is a spacer that binds to a target site and an RNA sequence that can hybridize with the tracrRNA. Since it contains, it has the characteristic of forming an RNA-RNA conjugate through a step of preferentially hybridizing with tracrRNA before forming a complex with the Cas protein.
  • crRNA and tracrRNA can be artificially fused to form a complex with Cas protein in a single-stranded state.
  • 'guide RNA' generally includes tracrRNA and crRNA, and specifically, RNA and Cas protein including a spacer or guide sequence that binds to a target site (sequence). It is characterized in that it is an RNA composed of a single stranded RNA and a double stranded, or the two RNAs are fused together. Therefore, the term'guide RNA' refers to'single strand guide RNA','chimeric RNA','chimeric guide RNA', and'syntheic guide RNA. RNA)' may be used interchangeably.
  • the'guide RNA' is a Cas protein (or endonuclease) and binds to a target site, or binds to and cleaves the target site. It can be interpreted as corresponding to.
  • The'fusion' is a molecule in which two or more subunit molecules are preferably covalently bonded.
  • Subunit molecules may be molecules of the same chemical type or may be molecules of different chemical types.
  • the fusion of crRNA and tracrRNA is characterized in that the backbone is linked by phosphorylation rather than hydrogen bonds, and is composed of a single strand.
  • the term'guide sequence' is an RNA sequence having a length of less than 30 bp at the 5'end of the guide RNA and complementary to a target site, and a spacer or a spacer sequence ( spacer sequence).
  • RNA sequence having a length of less than 30 bp at the 5'end of the guide RNA and complementary to a target site, and a spacer or a spacer sequence ( spacer sequence).
  • spacer sequence spacer sequence
  • the guide sequence is CRISPR RGEN Tools (http://www.rgenome.net; Park et al, Bioinformatics , 31:4014-4016, 2015); sgRNA Designer (Doench et al., Nature Biotechnology 34(2):184-191, 2016); E-CRISP (http://www.e-crisp.org/E-CRISP/Heigwar et al., Nature Methods 11(2):122-123, 2014); Benchling (https://benchling.com); sgRNA scorer 2.0 (https://crispr.med.harvard.edu/sgRNAScorerV2; Chari et al., ACS Synthetic Biology , 2017.
  • the guide RNA is (a) crRNA and tracrRNA comprising a guide sequence, (b) a fusion of crRNA and tracrRNA comprising a guide sequence, or (c) a crRNA comprising a guide sequence. It may be configured, but is not limited thereto.
  • the guide RNA of the present invention may be subjected to modification to the nucleic acid backbone or base: in the backbone modification, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, 3'-alkylene phosphonates, 5'-alkylene phosphonates, chiral phosphonates, phosphinates, phosphoramidates including 3'-amino phosphoramidate aminoalkylphosphoramidates, phosphorodiamidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, selenophosphates, boranophosphate, etc.
  • 2′-methoxyethoxy, 2′-MOE, 2′-dimethylaminooxyethoxy, 2′ -dimethylaminoethoxyethoxy, methoxy, aminopropoxy, fluoro, ally, -O-allyl, and the like may be used, but are not limited thereto.
  • 5-methylcytosine (5meC), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 7-deaza-adenine, 7-deazaguanosine, and not conventional purine and pyrimidine, 2-aminopyridine, 2-pyridone, 2-thiouracil, 2-thiothymine 2-thiocytosine, 5-halouracil, 5-propynyl uracil, 6-azo uracil, pseudouracil, 7-methylguanine, 7-methyladenine, 2-F-adenine, 2 -aminoadenine, 8-azaguanine, 8-azaadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, 3-deazaadenine, phenoxazine cytidine, phenothiazine cytidine, carbazole cytidine, pyridoindole cy
  • the present invention includes (iii) a target specific nuclease or a nucleotide encoding the same.
  • the target-specific nuclease is a Cas protein (eg, Cas9 protein (CRISPR (Clustered regularly interspaced short palindromic repeats) associated protein 9)), Cpf1 protein (CRISPR from Prevotella and Francisella 1), etc. And/or it may be one or more selected from the group consisting of nucleases (eg, endonucleases) involved in the type V CRISPR system.
  • the target-specific nuclease may further include a target DNA-specific guide RNA for guiding to a target site of genomic DNA.
  • the guide RNA may be transcribed in vitro , for example, may be transcribed from an oligonucleotide double strand or a plasmid template, but is not limited thereto.
  • the target-specific nuclease may act in the form of a ribonucleic acid protein (RNP) by forming a ribonucleic acid-protein complex bound to a guide RNA (RNA-Guided Engineered Nuclease).
  • Cas protein is a major protein component of the CRISPR/Cas system, and is a protein capable of forming an activated endonuclease or nickase.
  • Cas protein or gene information can be obtained from a known database such as GenBank of NCBI (National Center for Biotechnology Information).
  • the Cas protein is Streptococcus sp. ( Streptococcus sp.), such as a Cas protein derived from Streptococcus pyogenes , such as a Cas9 protein (eg, SwissProt Accession number Q99ZW2 (NP_269215.1)); Cas proteins from the genus Campylobacter, such as Campylobacter jejuni , such as the Cas9 protein; Cas proteins from the genus Streptococcus, such as Streptococcus thermophiles or Streptocuccus aureus , such as Cas9 protein; Cas proteins from Neisseria meningitidis , such as the Cas9 protein; Cas proteins from the genus Pasteurella , such as Pasteurella multocida , such as the Cas9 protein; Fran when cellar (Francisella) in, for example, when Francisco Cellar Novi Let (Francisella novicida)
  • Cpf1 protein is a novel CRISPR system endonuclease that is distinct from the CRISPR/Cas system, and is relatively small in size compared to Cas9 and does not require tracrRNA, and can act by a single guide RNA. In addition, it recognizes a thymine-rich PAM (protospacer-adjacent motif) sequence and cuts a double chain of DNA to create a cohesive end (cohesive double-strand break).
  • PAM protospacer-adjacent motif
  • the Cpf1 protein is Candidatus genus, Lachnospira genus, Butyrivibrio genus, Peregrinibacteria , Acidominococcus genus, Porphyromonas ( Porphyromonas ) genus, Prevotella ( Prevotella ) genus, Francisella ( Francisella ) genus, Candidatus Methanoplasma ( Candidatus Methanoplasma ), or Eubacterium ( Eubacterium ) may be derived from, for example, Parcubacteria bacterium (GWC2011_GWC2_44_17 ), Lachnospiraceae bacterium (MC2017), Butyrivibrio proteoclasiicus, Peregrinibacteria bacterium (GW2011_GWA_33_10), Acidaminococcus sp.
  • BV3L6 Porphyromonas macacae, Lachnospiraceae bacterium (ND2006), Porphyromonas crevioricanis, Prevotella disiens, Moraxella bovoculi (237), Smiihella sp. (SC_KO8D17), Leptospira inadai, Lachnospiraceae bacterium (MA2020), Francisella novicida (U112), Candidatus Methanoplasma termitum, Candidatus Paceibacter, Eubacterium eligens, etc. may be derived from microorganisms, but are not limited thereto.
  • the target-specific nuclease may be isolated from a microorganism or artificially or non-naturally produced, such as a recombinant method or a synthetic method.
  • the target-specific nuclease eg, Cas9, Cpf1, etc.
  • Recombinant DNA refers to a DNA molecule that has been artificially made by a gene recombination method such as molecular cloning to contain heterogeneous or allogeneic genetic material obtained from various organisms.
  • the recombinant DNA when expressed in an appropriate organism to produce a target-specific nuclease ( in vivo or in vitro ), the recombinant DNA is a codon optimized for expression in the organism among the codons encoding the protein to be produced. It may be to have a nucleotide sequence reconstructed by selecting.
  • the target-specific nuclease may be a mutant target-specific nuclease in a mutated form.
  • the mutant target-specific nuclease may mean that it has been mutated to lose the endonuclease activity that cuts the DNA double strand, for example, a mutant target that has lost endonuclease activity and has nickase activity. It may be at least one selected from the mutated target specific nucleases that have been mutated to lose both specific nuclease and endonuclease activity and nickase activity.
  • the base conversion is performed simultaneously with the base conversion by the deaminase (e.g., cytidine to uradine conversion) or sequentially regardless of the sequence.
  • a nick can be introduced in the resulting strand or the opposite strand (e.g., the opposite strand of the strand where base transformation has occurred) (e.g., in the opposite strand of the strand where the PAM is located, the third nucleotide in the direction of the 5'end of the PAM sequence)
  • a nick is introduced at the corresponding position between the 4th nucleotide).
  • target-specific nuclease mutation may occur at least in the catalytically active domain of the nuclease (eg, RuvC catalytic domain in the case of Cas9).
  • the target-specific nuclease is a Cas9 protein derived from Streptococcus pyogenes (SwissProt Accession number Q99ZW2 (NP_269215.1)
  • the mutation is a catalytic aspartate residue; 10th position Aspartic acid (D10), etc.), glutamic acid at position 762 (E762), histidine at position 840 (H840), asparagine at position 854 (N854), asparagine at position 863 (N863), aspartic acid at position 986
  • It may include a mutation substituted with one or more optional other amino acids selected from the group consisting of acids (D986) and the like. In this case, any other amino acid to be substituted may be alanine, but is not
  • the mutant target-specific nuclease may be mutated to recognize a PAM sequence different from that of the wild-type Cas9 protein.
  • the mutation target-specific nuclease is at least one of aspartic acid at position 1135 (D1135), arginine at position 1335 (R1335), and threonine at position 1337 (T1337) of the Cas9 protein derived from Streptococcus pyogenes. , For example, all three are substituted with other amino acids, and may be mutated to recognize an NGA different from the PAM sequence (NGG) of wild-type Cas9 (N is any base selected from A, T, G, and C).
  • the mutant target-specific nuclease is among the amino acid sequence of the Cas9 protein derived from Streptococcus pyogenes,
  • the'other amino acids' are alanine, isoleucine, leucine, methionine, phenylalanine, proline, tryptophan, valine, aspartic acid, cysteine, glutamine, glycine, serine, threonine, tyrosine, aspartic acid, glutamic acid, Arginine, histidine, lysine, among all known variants of the above amino acids, refers to an amino acid selected from amino acids except for amino acids that the wild-type protein has at its original mutation position.
  • the'other amino acid' may be alanine, valine, glutamine, or arginine.
  • the mutant target-specific nuclease is a modified Cas9 protein that has lost endonuclease activity (e.g., has nickase activity, loses both endonuclease activity and nickase activity), or wild-type It may be to recognize a PAM sequence different from Cas9.
  • the modified Cas9 protein in the Cas9 protein derived from Streptococcus pyogenes ,
  • a mutation e.g., substitution with another amino acid
  • a mutation is introduced at the D10 or H840 position, resulting in loss of endonuclease activity and a modified Cas9 having nickase activity, or a Cas9 protein derived from Streptococcus pyogenes Modified Cas9 protein in which mutations (eg, substitutions with other amino acids) are introduced at both D10 and H840 positions to lose both endonuclease activity and nickase activity;
  • the mutations of (1) and (2) are all introduced to have nickase activity and recognize a PAM sequence different from the wild type, or lose both endonuclease activity and nickase activity and recognize a PAM sequence different from the wild type. It may be a modified Cas9 protein.
  • the mutation at the D10 position of the CAs9 protein is a D10A mutation (means a mutation in which D, which is the 10th amino acid of the Cas9 protein, is substituted with A; hereinafter, the mutation introduced into Cas9 is indicated in the same manner).
  • the mutation at the H840 position may be an H840A mutation, and the mutation at the D1135, R1335, and T1337 positions may be D1135V, R1335Q, and T1337R, respectively.
  • the target-specific nuclease used herein is a Cas9 protein derived from Streptococcus pyogenes (eg, SwissProt Accession number Q99ZW2 (NP_269215.1)) (1) a mutation at the D10 position (E.g., substitution with another amino acid) is introduced, resulting in loss of endonuclease activity and a modified Cas9 having Nikase activity, (2) a mutation at the H840 position (e.g., substitution with another amino acid) is introduced and endonuclease Modified Cas9 with loss of clease activity and Nikase activity, (3) mutation at position D10 (eg, substitution with another amino acid) and mutation at position H840 (eg substitution with another amino acid), resulting in endo It may be one or more selected from the group consisting of a modified Cas9 protein that has lost both nuclease activity and nikase activity.
  • a mutation at the D10 position (E.g., substitution with another
  • the mutation at the D10 position of the CAs9 protein is a D10A mutation (means a mutation in which D, which is the 10th amino acid of the Cas9 protein, is substituted with A; hereinafter, the mutation introduced into Cas9 is indicated in the same manner).
  • the mutation at the H840 position may be an H840A mutation.
  • the Cas protein may be a nucleic acid cleaving enzyme selected from Cas3, Cas9, Cpf1, Cas6, or C2c2, specifically, a Cas protein of CRISPR/Cas type II, and more specifically derived from Streptococcus pyogens. It is characterized by being a Cas9 protein.
  • the Cas protein may be a nucleic acid cleavage enzyme simply isolated from a microorganism, but (a) a variant in which some amino acid sequences are substituted, (b) an affinity tag, a recombinase, and a trans It can be transformed into a fusion protein such as a transposon, and (c) a variant to which nuclear localization sequences (NLS) are added.
  • NLS nuclear localization sequences
  • the normal gene expression rate may be 1 to 100%, specifically 1 to 80%, and more specifically 30 to 50%, but is not limited thereto.
  • At least one guide RNA and Cas protein which is a detailed configuration of the genetic scissors system of the present invention, is composed of (a) a vector comprising a nucleic acid sequence expressing at least one guide RNA and a Cas protein, (b) at least one guide RNA and a Cas protein.
  • Ribonucleoprotein (RNP) or RNA-guided engineered nuclease (RGEN), or (c) mRNA encoded by one or more guide RNAs and Cas protein may be delivered into cells, but is not limited thereto.
  • the vector may contain at least one guide RNA and a Cas protein at the same time, or consist of two or more vectors each expressing a guide RNA and a Cas protein. I can.
  • the vector may be one or more, and may be a plasmid vector or a viral vector, and the viral vector is specifically adenovirus, adeno-associated virus, lentivirus ), may be a retrovirus vector, but is not limited thereto.
  • the vector of the present invention can be delivered to cells by microvehicles, liposomes, exosomes, nanoparticles, gene-genes, etc., but is not limited thereto. It is obvious to those skilled in the art to select a delivery method suitable for the constitutive characteristics and the characteristics of the cells to be delivered.
  • a guide RNA specifically recognizing intron #22 in the non-inverted coagulation factor VIII(F8) gene It relates to a composition for the prevention or treatment of hemophilia comprising (ii) a guide RNA specifically recognizing the inversion of intron 22 of the distal region, and (iii) a target-specific nuclease or a nucleotide encoding the same.
  • the present invention includes (i) a guide RNA that specifically recognizes intron #22 in the unreversed coagulation factor VIII(F8) gene; (ii) a guide RNA that specifically recognizes the inversion of intron 22 of the distal region, and (iii) a target-specific nuclease or a nucleotide encoding the same, to an individual.
  • F8 It relates to a method for correcting gene inversion or a method for preventing or treating hemophilia.
  • the present invention targets one or more of the sequences represented by SEQ ID NOs: 1 to 32 and uses a guide RNA and Cas protein that specifically recognizes the sequence for correcting the inversion of the coagulation factor VIII (FVIII) gene It relates to a genetic scissors system (CRISPR/Cas system).
  • CRISPR/Cas system a genetic scissors system
  • the present invention targets one or more of the sequences represented by SEQ ID NOs: 1 to 32, and uses a guide RNA and Cas protein that specifically recognizes the sequence of hemophilia of the blood coagulation factor VIII (FVIII) gene. It relates to a genetic scissors system (CRISPR/Cas system) for prevention or treatment.
  • CRISPR/Cas system genetic scissors system
  • composition for correcting the inversion position can induce a semi-permanent therapeutic effect on hemophilia A because normal FVIII is expressed by gene correction using a gene scissors system.
  • the target disease to be treated using the composition of the present invention is severe type A hemophilia, and this corresponds to symptoms when the activity of FVIII is less than 1% of normal subjects.
  • compositions, the treatment method, and the composition included in the genetic scissors system of the present invention is the same as above, and the same can be applied.
  • compositions, methods and uses of the present invention can be administered to a subject in need thereof in a sufficient or effective amount.
  • 'Effective amount' or'sufficient amount' is a single or multiple doses alone or in combination with one or more other therapeutic compositions, protocols, or treatment regimens that benefit the subject for any period of time or provide the subject with an expected or desired result. Indicates the amount.
  • the AAV vector dose to achieve a therapeutic effect can be provided as a vector genome dose/kg body weight (vg/kg), but (a) the route of administration, (b) the expression level of the therapeutic gene required to achieve the therapeutic effect. , (c) any host immune response to the AAV vector, and (d) the stability of the expressed protein.
  • a blood clotting factor concentration that is greater than 1% of the factor concentration found in a normal individual provides the necessary degree to change the severe disease phenotype to a moderate phenotype. .
  • the severe phenotype is characterized by joint damage and life-threatening bleeding.
  • high blood clotting factor concentrations above 5% of normal are required.
  • the genetic scissors system and composition of the present invention may be incorporated into a pharmaceutically acceptable carrier or excipient together with an AAV vector, an additional composition, an agent, a drug, or a biologic (protein) to prepare a pharmaceutical composition.
  • a pharmaceutical composition are useful for administration and delivery to patients or subjects in vivo or ex vivo.
  • the pharmaceutical composition When prepared as the pharmaceutical composition, it includes a pharmaceutically acceptable carrier.
  • the carrier is commonly used in the formulation, and lactose, dextrose, sucrose, sorbitol, mannitol, starch, gum acacia, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone , Cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, mineral oil, saline, PBS (phosphate buffered saline) or a medium, etc., but are limited thereto. no.
  • a lubricant in addition to the above components, a lubricant, a wetting agent, a sweetening agent, a flavoring agent, an emulsifying agent, a suspending agent, a preservative, and the like may be additionally included.
  • Suitable pharmaceutically acceptable carriers and formulations are described in detail in Remington's Pharmaceutical Sciences (19th ed., 1995).
  • a suitable dosage of the pharmaceutical composition can be prescribed in various ways depending on factors such as the method of formulation, mode of administration, age, weight, sex, pathological condition of the patient, food, time of administration, route of administration, rate of excretion and sensitivity to response. .
  • the pharmaceutical composition is prepared in a unit dosage form by formulating using a pharmaceutically acceptable carrier and/or excipient according to a method that can be easily carried out by a person having ordinary knowledge in the art. Or it can be made by incorporating it into a multi-dose container.
  • the formulation may be in the form of a solution, suspension, syrup, or emulsion in an oil or aqueous medium, or in the form of an extract, powder, powder, granule, tablet or capsule, and may additionally include a dispersant or a stabilizer.
  • compositions include delivery and administration by systemic, local or local or by any route, for example, oral or transdermal topical by infusion, fusion, ingestion or inhalation.
  • routes of delivery and administration include intravenous, intramuscular, intraperitoneal, intradermal, subcutaneous, intranasal, intracranial, transdermal or topical, transmucosal or parenteral such as rectal.
  • Exemplary routes of administration and delivery are intravenous (iv), intraperitoneal (ip), intraarterial, intramuscular, parenteral, subcutaneous, intrapleural, topical, dermal, intradermal, transdermal, intracranial, intrathecal, oral (digestive ), mucous membrane, respiration, nasal, intubation, pulmonary, intrapulmonary instillation, buccal, sublingual, intravascular, intraarterial, intracavity, iontophoresis, intraocular, ocular, eye, intravenous, intratracheal, intralymphatic. Delivery and administration doses can be based on currently existing protocols and can be determined empirically or selectively in human clinical trials or using animal disease models. The initial study dose can be based on animal studies described herein, for example in mice or dogs.
  • Subjects to be treated with the genetic scissors system or composition of the present invention are animals, typically mammals such as humans, non-human primates (apes, gibbons, gorillas, chimpanzees, orangutans, macaques), companion animals (dogs And cats), livestock (poultry such as chickens and ducks, horses, cows, goats, sheep, pigs), laboratory animals (mouse, rats, rabbits, guinea pigs), and animal disease models such as coagulation diseases and those skilled in the art.
  • mammals such as humans, non-human primates (apes, gibbons, gorillas, chimpanzees, orangutans, macaques), companion animals (dogs And cats), livestock (poultry such as chickens and ducks, horses, cows, goats, sheep, pigs), laboratory animals (mouse, rats, rabbits, guinea pigs), and animal disease models such as coagulation diseases and those skilled in the art.
  • Guide RNA was designed using CRISPR RGEN Tools ((http://www.rgenome.net; Park et al, Bioinformatics 31:4014-4016, 2015) Guide RNA corresponding to Table 1 (TS1, target site1) Is a region corresponding to approximately 18000 bp from the beginning of the int22-1 homolog of the human FVIII gene (Chr-X:154109091, Grch37) toward the centromere and from the end of the int22-3 homolog (Chr-X:154684313, Grch37) toward the centromere.
  • the guide RNA corresponding to Table 2 was designed from the end of the int22-1 homologue (Chr-X:154118603, Grch37) to about 1800bp toward the telomere. After selecting a guide RNA having 5'-NGG-3' as the PAM sequence, a guide RNA without 1 base or 2 base mismatch is additionally selected and used for the activity test, excluding the on-target site on the human genome. I did.
  • RNAs with activity were selected through insertion or deletion (Indels) confirmation at the on-target genomic location, and are shown in Tables 1 and 2.
  • FIG. 1 shows the contents of an additional activity test under optimal or suboptimal conditions with different RNP doses by selecting those with good activity among the first screened guide RNAs. From this, it was possible to repeatedly select approximately 6 guide RNAs exhibiting good activity from TS1 and TS2.
  • Example 2 Inverse confirmation of human F8 genome by selected guide RNA and Cas9 protein
  • F1 5'-TGCCAACTCTTGATACAGAAGG-3' (SEQ ID NO: 33), R1: 5'-TGGCAGATTTCCCTGACATAAA-3' (SEQ ID NO: 34), F2: 5'ACAACCAGAGCAGAAATCAATGA-3' (SEQ ID NO: 35), R2: 5'- TTTCACCACATCCACGCCAA -3' (SEQ ID NO: 36).
  • Hemophilia A is a disease that can only be replaced because there is no therapeutic agent that can be cured. Since the gene size of FVIII is very large even when gene therapy technology is applied by inserting the therapeutic gene, it is difficult to deliver it into the human body due to packaging limitations in the vector. have. Recently, in order to solve this problem, methods using minimal domain FVIII have entered clinical trials, but as a technology that is expected to have only a short-term effect, it is necessary to develop a fundamental and long-term treatment method. Gene editing using the CRISPR/Cas9 system can provide a more fundamental and long-term treatment method, and Cas9 with a large size cannot be packaged in AAV, but non- It can be delivered effectively through viral delivery.
  • the genetic scissors system (CRISPR/Cas system) according to the present invention is a technology that can induce normal gene expression by correcting inverted genes, so that large-sized gene mutations that are difficult to transfer into cells can be efficiently overcome through gene editing. Excellent as.
  • CRISPR/Cas system since it can induce normal FVIII expression by restoring the inversion of the FVIII gene, it is useful for the treatment of hemophilia A.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Epidemiology (AREA)
  • Diabetes (AREA)
  • Hematology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Mycology (AREA)
  • Cell Biology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Enzymes And Modification Thereof (AREA)

Abstract

본 발명은 역위되지 않은 유전자 및 원위의 역위 유전자를 표적으로 하여 이를 복원시키는 역위 보정용 조성물 및 혈우병을 치료하기 위한 조성물로, 혈액응고인자 VIII(F8)에서 발생한 역위 변이에 대한 복원능이 있는 유전자 가위 시스템(CRISPR/Cas system) 및 이를 이용한 A형 혈우병 치료 기술에 관한 것이다.

Description

혈액응고인자 VIII 유전자 역위 보정에 의한 혈우병 치료용 조성물
본 발명은 역위되지 않은 유전자 및 원위의 역위 유전자를 표적으로 하여 이를 복원시키는 역위 보정용 조성물 및 혈우병을 치료하기 위한 조성물로, 혈액응고인자 VIII(F8)에서 발생한 역위 변이에 대한 복원능이 있는 유전자 가위 시스템(CRISPR/Cas system) 및 이를 이용한 A형 혈우병 치료 기술에 관한 것이다.
혈우병(Hemophilia)는 선천적으로 혈액응고인자가 결핍되어 나타나는 선천성 출혈성 질환으로, A형 혈우병은 FVIII의 결핍(factor VIII deficiency), B형 혈우병은 FIX의 결핍(factor IX deficiency, christmas disease), 그리고 C형 혈우병은 FXI의 결핍(factor XI deficiency)에 의하여 발생하는 것으로 알려져 있다.
관련 증상의 95%를 차지하는 A형 및 B형 혈우병은 X 염색체의 열성으로 유전되고, 특히 A형 혈우병의 발생빈도는 생존 남아 5000 ~ 10000명당 1명이며, 환자의 20 ~ 30%는 가족력이 없이 돌연변이에 의하여 발생하고, 국내에서는 A형 혈우병이 B형보다 약 6배 정도 높은 특징이 있다.
A형 혈우병은 혈액응고인자 FVIII의 활성에 따라, 경증(5 ~ 30%의 활성), 중등증(1 ~ 5%의 활성) 및 중증(<1%의 활성)으로 분류하는데, 임상적으로 외상, 치아 발치, 외과적 수술 이후에 계속적인 출혈이 나타나고, 생후 1년 이내에 진단이 가능하다(J Graw et al., 2005). 증상의 상태에 따라, 중증 A형은 치료를 받지 않는 경우에는 2 ~ 5 개월 사이에 자연출혈증상이 발생하나, 경증 A형의 경우에는 외과적 손상이 발생하지 않는 한 자연출혈이 없어, 평생 진단이 안 되는 경우도 있다.
A형 혈우병의 출혈 양상은 관절출혈이 가장 흔하여 60% 정도를 차지하는데, 중증에서는 대개 걷기 시작하는 12 ~ 18개월에 발생하기 시작하며, 중등증에서는 2 ~ 5세경에 발생한다. 관절출혈이 반복되면 만성활액낭 비후를 유발하여 결국 연골을 손상시키고, 골낭종 형성 및 뼈의 침식으로 인해 관절이 경직되고 운동에 제한이 오며 기형이 생기게 된다. 대개 육체적 손상이나 근육주사 등에 의한 근육 내 출혈은 출혈의 30% 정도를 차지하며, 제한된 공간 내로 출혈하여 혈종이 형성되면 중요한 장기를 압박하여 감각 및 운동 장애, 동맥순환 장애가 생길 수 있고, 즉시 치료하지 않으면 영구적인 기형을 유발할 수도 있다; 점막하 출혈은 혀, 인후부의 출혈은 기도를 막아 생명을 위협하기도 한다; 위장관 출혈은 대개 상부위장관에 있는 병변에서 기인한다; 그리고 두개강 내 출혈은 흔한 사망의 원인이며 10% 정도의 환자에서 손상 후 발생하고 30%에서 사망에 이르는 특징이 있다.
혈우병 치료 방법은 1960년대까지는 혈장과 전혈로만 치료가 가능하였으며, 1965년 동결침전물(cryoprecipitate)에 FVIII 인자가 다량 함유되었다는 점이 발견된 이래, 상기 농축액이 치료제로 개발되었고, 1987년에는 재조합 FVIII가 치료제로 사용되기 시작했으나, 사실상 근본적인 치료제가 없기 때문에, 혈우병의 치료는 출혈에 관련된 치료와 합병증에 대한 치료를 병행처치 하고 있다.
A형 혈우병 관련 혈액응고인자인 FVIII은 X 염색체 장완의 말단(Xq28)에 존재하며, 26 개의 엑손(exon)과 25 개의 인트론(intron)으로 구성된 전장 186 kb의 유전자로서, X 염색체의 0.12%를 차지하는 거대한 유전자이다. 중증 A형 혈우병의 50%가 22번 인트론(int22)의 역위(inversion) 변이에 의하여 발생하며, 중등증 및 경증 A형 혈우병에서는 점돌연변이가 원인인 것으로 알려져 있다.
FVIII의 역위(inversion)은 1번 인트론 및 22번 인트론 상에 존재하는 상동체(homolog)에 의한 재조합 현상으로 발생하는데, 1번 인트론에서의 역위는 약 5% 정도, 그리고 22번 인트론에서의 역위는 약 40%로, 22번 인트론에 의한 역위가 8배 정도 빈번하게 일어나는 특징이 있다. 22번 인트론에 대해서는 상기 인트론 상에 존재하는 int22h-1 상동체와 telomeric 쪽으로 대략 500kb 떨어진 곳에 존재하는 int22h-2(type 2) 또는 int22h-3(type 1)의 상동 재조합에 의하여 대략 500~600 kb의 길이의 핵산 단편이 역위된 변이가 일어나는 것으로 알려져 있다(Naylor J et al., 1995).
최근에는 ZFN (zinc finger nuclease) 또는 TALEN(transcriptional activator-like effector nuclease)을 이용하여 FVIII의 int1의 역위된 변이 상태를 재역위(복원) 시키는 방법(Park et al., 2014), 및 CRISPR-Cas9을 이용하여 int22-1/3 역위를 복원하는 방법(Park et al., Cell Stem Cell, 2015)이 개발되어, FVIII 유전자 복원을 위해 유전자 편집기술이 활용되기 시작한 것으로 나타났다.
유전자 가위 시스템(CRISPR/Cas system)은 원래 박테리아나 archaea에서 바이러스, 파아지 등의 외래 유전자 유입에 대한 후천성 면역시스템(adaptive immune system)이다(Pendades et al., 2014). 유전자 가위 시스템은 이를 구성하는 Cas 단백질을 포함하는 단백질 복합체의 구성에 따라, Type I, II 및 III로 나뉘며, Cas 유전자의 구성 및 개수에 따라 세부적으로 분류된다(Makarova, A et al., 2011). 그 중에서 오페론 크기가 작아 유전자 편집기술로 활용이 적합하기 때문에, 가장 활발하게 연구되고 있는 스트렙토코커스 피오게네스(Streptococcus pyogenes) 유래의 Type II CRISPR/Cas system은 Cas9으로 구성되며, crRNA 및 tracrRNA의 2종의 RNA와 복합체(complex)를 형성하여 타겟 유전자 상에 존재하는 PAM 서열을 인지하여 타겟을 구별하고, 이에 대한 이중나선절단(double strand break)을 생성하는 활성을 가지고 있다(Jinek et al., 2012).
구체적으로 유전자 가위 시스템을 이용한 유전자 편집 기전은 Cas9과 (a) 30 bp 이하의 타겟 유전자를 인지하는 가이드 서열(guide sequence)을 포함하는 crRNA 및 tracrRNA 또는 (b) 상기 두 가닥의 RNA가 융합한 단일 사슬 가이드 RNA의 복합체에 의하여 진행된다: 상기 복합체를 형성한 Cas9이 타겟 유전자상에 존재하는 PAM(protospacer adjacent motif)을 인지하여 이중 나선 DNA 상에 자리를 잡으면, PAM(protospacer adjacent motif)의 5' 상부 측에 존재하는 타겟 서열에 대해 상보적인 서열에 crRNA의 안내 서열이 결합하고, Cas9에 의하여 이중나선절단(Double strand break, DSB)이 생성된다. 이렇게 절단된 DNA는 세포 내에 존재하는 DNA repair system인 비상동적 말단결합(Non-homologous end joining, NHEJ) 또는 상동 재조합(Homology-directed repair)에 의하여 유전자 변이 또는 유전자 교정이 이루어진다. 비상동적 말단 결합은 효율적이지만, 무작위적으로 유전자가 재배정되어 삽입/결실 돌연변이가 일어나게 되며, 절단된 DNA 부근 서열과 상동하는 서열을 포함한 DNA 공여체가 존재할 때에 일어날 수 있는 상동 재조합 기전은 있는 비효율적이나 정확한 유전자 교정이 가능한 특징이 있다.
PAM(protospacer adjacent motif)은 이를 인식하는 Cas 단백질에 따라 서열이 다른 특징이 있으며, 예를 들어, S. pyogenes 유래의 Cas9은 5'-NGG-3'(N은 A, T, G, C 중 하나); S. thermophilus 유래의 Cas9은 5'-NNAGAAW-3'; C jejuni 유래의 Cas9은 5'-NNNNRYAC-3'로 알려져 있으며, 인간의 게놈 상에 상기 서열이 일정간격으로 배열되어 있기 때문에, 유전자 가위 시스템을 유전자 편집에 활용할 수 있는 것이다.
유전자 편집기술을 활용한 치료제 개발을 위해서는 타겟 전달능과 Off-target 효과를 최소화하는 것이 중요하다: 전자의 경우에는 iv vivo로 전달하는데 효율성을 향상시키기 위한 기술개발이 지속적으로 이루어지고 있고 이와 더불어, ex vivo 등의 기술이 활용되고 있다. 후자의 경우에는 가이드 RNA를 디자인하는 과정에서 Digenome-seq, Guide-seq, Bless 등의 다양한 검증 방법을 활용하여 off-target 효과가 없거나 최소화된 타겟을 인지하는 가이드 RNA 선별이 가능하도록 검증 시스템이 구축되어 있다.
특히 타겟 전달능에 있어서 ex vivo 형태의 유전자 교정 방법은 효율적이기는 하나 이러한 세포치료제 방식은 근본적인 유전자 치료효과를 얻기 어렵기 때문에, 치료할 수 있는 질병이 제한적이라는 단점이 있으며, 따라서 다양한 질환을 치료하기 위해서는 in vivo 유전자 교정이 필수적이다. in vivo 전달체로 활용될 수 있는 기술은 대표적으로 AAV(adeno-associated virus)와 같은 바이러스 벡터를 이용하는 방법과 Cas9 mRNA와 sgRNA를 지질 나노 입자에 패키징한 비바이러스성 벡터를 이용하는 방법이 있다.
본 발명자는 A형 혈우병의 원인 유전자인 FVIII의 역위(inversion) 상태에 대해, 상기 유전자내 역위되지 않은 22번 인트론(intron)을 특이적으로 인식하는 가이드 RNA 및 원위(distal region)의 22번 인트론 역위를 특이적으로 인식하는 가이드 RNA를 표적으로 하는 유전자 가위 시스템을 적용하였다.
발명의 요약
본 발명의 목적은 Cas 단백질을 포함하는 역위 보정용 유전자 가위 시스템(CRISPR/Cas system)을 적용하기 위해 역위되지 않은 혈액응고인자 VIII(F8) 유전자 및 원위의 역위를 특이적으로 인식하는 가이드 RNA를 포함하는 혈액응고인자 VIII(F8) 유전자의 역위 보정용 조성물을 제공하는데 있다.
본 발명의 다른 목적은 Cas 단백질을 포함하는 역위 보정용 유전자 가위 시스템(CRISPR/Cas system)을 적용하기 위해 역위되지 않은 혈액응고인자 VIII(F8) 유전자 및 원위의 역위를 특이적으로 인식하는 가이드 RNA를 포함하는 혈우병의 예방 또는 치료용 조성물을 제공하는데 있다.
상기 목적을 달성하기 위하여, 본 발명은 (i) 혈액응고인자 VIII(F8) 유전자 내 역위되지 않은 22번 인트론(intron)을 특이적으로 인식하는 가이드 RNA; (ii) 원위(distal region)의 22번 인트론 역위를 특이적으로 인식하는 가이드 RNA; 및 (iii) 표적 특이적 뉴클레아제 또는 이를 코딩하는 뉴클레오타이드를 포함하는 혈액응고인자 VIII(F8) 유전자의 역위 보정용 조성물을 제공한다.
본 발명은 또한, (i) 역위되지 않은 혈액응고인자 VIII(F8) 유전자 내 22번 인트론(intron)을 특이적으로 인식하는 가이드 RNA; (ii) 원위(distal region)의 22번 인트론 역위를 특이적으로 인식하는 가이드 RNA; 및 (iii) 표적 특이적 뉴클레아제 또는 이를 코딩하는 뉴클레오타이드를 포함하는 혈우병의 예방 또는 치료용 조성물을 제공한다.
본 발명은 또한 (i) 역위되지 않은 혈액응고인자 VIII(F8) 유전자 내 22번 인트론(intron)을 특이적으로 인식하는 가이드 RNA; 및 (ii) 원위(distal region)의 22번 인트론 역위를 특이적으로 인식하는 가이드 RNA와 Cas 단백질을 이용한 혈액응고인자 VIII(FVIII) 유전자 역위 보정용 유전자 가위 시스템(CRISPR/Cas system)을 제공한다.
본 발명은 또한 (i) 역위되지 않은 혈액응고인자 VIII(F8) 유전자 내 22번 인트론(intron)을 특이적으로 인식하는 가이드 RNA; 및 (ii) 원위(distal region)의 22번 인트론 역위를 특이적으로 인식하는 가이드 RNA와 Cas 단백질을 이용한 혈액응고인자 VIII(FVIII) 유전자 혈우병의 예방 또는 치료용 유전자 가위 시스템(CRISPR/Cas system)을 제공한다.
본 발명은 또한, 서열번호 1 내지 32로 표시되는 서열 중 하나 이상의 서열을 특이적으로 인식하는 가이드 RNA를 제공한다.
도 1은 선별된 가이드 RNA에 대한 인델 빈도 분석 결과를 나타낸 것이다.
도 2는 선별된 가이드 RNA와 Cas9 단백질에 의한 human F8 genome의 역위를 확인한 결과이다.
발명의 상세한 설명 및 바람직한 구현예
다른 식으로 정의되지 않는 한, 본 명세서에서 사용된 모든 기술적 및 과학적 용어들은 본 발명이 속하는 기술분야에서 숙련된 전문가에 의해서 통상적으로 이해되는 것과 동일한 의미를 가진다. 일반적으로, 본 명세서에서 사용된 명명법은 본 기술분야에 잘 알려져 있고, 통상적으로 사용되는 것이다.
본 발명은 다음을 포함하는 혈액응고인자 VIII(F8) 유전자의 역위 보정용 조성물에 관한 것이다: (i) 혈액응고인자 VIII(F8) 유전자 내 역위되지 않은 22번 인트론(intron)을 특이적으로 인식하는 가이드 RNA; (ii) 원위(distal region)의 22번 인트론 역위를 특이적으로 인식하는 가이드 RNA; 및 (iii) 표적 특이적 뉴클레아제 또는 이를 코딩하는 뉴클레오타이드.
본 발명에서의 용어, '인트론(intron)'은 진핵세포(eukaryotic cells)의 게놈 상에 존재하는 핵산 부위로서, 전사과정에서 pre-mRNA에는 존재하지만, Splicing에 의하여 matured mRNA 생성과정에서 제거되며, 따라서 단백질을 제조하는데 관여하지 않는 게놈 상의 DNA 서열이다.
본 발명에서의 용어, 역위(inversion)는 염색체 상의 서로 다른 상동체 간의 상동재조합(homologous recombination)에 의하여 발생하는 서열의 재배열에 의한 염색체의 구조적 이상 중 하나이다. 역위에 의한 변이는 대부분 정상 표현형을 나타내나, 생식세포의 감수분열 단계에서 발생할 경우, 염색체의 결실 또는 중복의 재조합 염색체를 형성하게 되어 비정상적 표현형을 나타낼 수 있다. 가장 대표적으로 X 염색체의 28q에서의 역위에 의한 A형 혈우병을 들 수 있으며, 그 외에는 4번 염색체의 구조적 이상에 의하여 4p가 결실된 울프-허쉬호른 증후군 및 Xq 염색체에서의 IDS 유전자의 역위에 의한 헌터병 등이 역위에 의한 질환으로 알려져 있다.
본 발명에서의 용어, '절단'은 DNA 분자의 공유 결합 백본을 분리시키는 것으로 인산기 결합에 대한 효소적 또는 화학적 가수분해를 포함하는 여러 가지 방법들에 의해 개시될 수 있다. 단일-가닥 절단과 이중-가닥절단이 모두 가능하며, 이중-가닥 절단은 두 별개의 단일-가닥 절단 사건의 결과로서 일어날 수 있다. DNA 절단은 블런트(blunt) 단부 또는 스태거드(staggered) 단부의 생성을 가져올 수 있으며, 본 발명에서의 절단은 블런트(blunt) 단부인 특징이 있다.
A형 혈우병의 치료제 개발과 관련하여, 유전자 가위 시스템(CRISPR/Cas system)을 이용하여 역위 상태의 FVIII 유전자를 복원시키기 위해서는 가이드 RNA(guide RNA)를 디자인해야 한다.
통상적으로 가이드 RNA는 5' 말단 측에 존재하는 30 bp 이하의 안내 서열(guide sequence)이 표적 부위에 결합하고, 3' 말단 측은 핵산절단효소인 Cas 단백질과 복합체를 형성하는데 관여하는데, 상기 3' 말단 측의 Cas 단백질 결합부위는 생물학적 특성에 의하여 고유한 서열을 가지고 있기 때문에, 가이드 RNA(guide RNA)를 디자인이라는 것은 표적 부위에 결합하는 안내 서열(guide sequence)를 선별하는 과정을 의미한다.
본 발명에서의 용어 가이드 RNA의 '표적' 또는 '타겟'은 유전자 가위 시스템에 의하여 절단되거나, 절단 후 복원되는 과정에서 결실, 삽입 또는 치환 등의 변형이 발생하는 게놈 상의 안내 서열이 결합하는 서열을 의미한다.
22번 인트론 내 존재하는 int22h-1과 telomeric 쪽으로 대략 500kb 떨어진 곳에 존재하는 int22h-3가 상동 재조합에 의해 역위가 일어난 상태에서, 상기 (i)의 가이드 RNA는 역위되지 않은 유전체 기준으로 int22h-1의 업스트림 및 int22h-3의 업스트림에 존재하고 DNA 상에 존재하는 PAM(protospacer-adjacent motif)의 5' 말단 및/또는 3' 말단에 인접하여 위치하는 연속적인 17bp, 18bp, 19bp, 20bp, 21bp, 22bp 또는 23bp 길이의 뉴클레오티드 서열을 포함할 수 있으며, 상기 (ii)의 가이드 RNA는 역위되는 부분으로, 역위되지 않는 유전체 기준으로는 int22h-1의 다운스트림에 존재하고 DNA 상에 존재하는 PAM(protospacer-adjacent motif)의 5' 말단 및/또는 3' 말단에 인접하여 위치하는 연속적인 17bp, 18bp, 19bp, 20bp, 21bp, 22bp 또는 23bp 길이의 뉴클레오티드 서열을 포함할 수 있다.
예를 들어 5' 말단 측의 상부 서열을 안내 서열로 결정하고, 상기 안내 서열은 가이드 RNA의 5' 말단 측에 위치하도록 디자인할 수 있다. 실제로 가이드 RNA는 PAM이 존재하는 DNA 가닥의 상보 가닥에 혼성화되기 때문에, 가이드 RNA의 서열은 PAM(protospacer-adjacent motif)의 5' 말단의 상부 서열과 동일한 특징이 있다.
타겟 유전자의 타겟 부위와 혼성화 가능한 가이드 RNA의 서열은 타겟 서열이 위치하는 DNA 가닥 (즉, PAM 서열이 위치하는 DNA 가닥)의 상보적인 가닥의 뉴클레오타이드 서열과 90% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 99% 이상, 또는 100%의 서열 상보성을 갖는 뉴클레오타이드 서열을 의미하는 것으로, 상기 상보적 가닥의 뉴클레오타이드 서열과 결합 가능하다.
상기 타겟 서열은 표적 또는 타겟 유전자의 두 개의 DNA 가닥 중 PAM 서열이 위치하는 가닥의 핵산 서열로 표시된다. 이 때, 실제로 가이드 RNA가 결합하는 DNA 가닥은 PAM 서열이 위치하는 가닥의 상보적 가닥이므로, 상기 가이드 RNA에 포함된 서열은 RNA 특성상 T를 U로 변경하는 것을 제외하고, 타겟 유전자에 위치하는 타겟 서열과 동일한 핵산 서열을 가진다. 따라서, 본 명세서에서, 가이드 RNA 서열과 타겟 서열은 T와 U가 상호 변경되는 것을 제외하고 동일한 핵산 서열로 표시된다.
상기 타겟 서열은 on target 부위에서의 유전자 교정 효율 (예컨대, indel 빈도(%))가 매우 우수하며, on target 이외의 부분에서는 미스매칭 뉴클레오티드 (mismatching nucleotide) 개수가 3개 이하, 2개 이하, 1개, 또는 0개로, 오프타겟 부위가 거의 존재하지 않아서, on target 이외의 부분에서 유전자 교정이 일어날 확률이 매우 낮거나 없어서 안전성이 우수하다.
상기 가이드 RNA는 PAM (Proto-Spacer-Adjacent Motif) 서열 5'-NGG-3'을 포함하고, 예를 들어 1 bp 또는 2 bp 미스매치 (mismatch)가 인간 게놈 상에 존재하지 않은 서열을 포함하는 타겟과 혼성화 가능할 수 있다.
하나의 실시예에서, 상기 혈액응고인자 VIII(F8) 유전자 내 역위되지 않은 22번 인트론(intron)을 특이적으로 인식하는 가이드 RNA는 예를 들어, 서열번호 1 내지 16 중에서 선택되는 서열을 특이적으로 인식할 수 있다.
또한, 상기 원위(distal region)의 22번 인트론 역위를 특이적으로 인식하는 가이드 RNA는 예를 들어, 서열번호 17 내지 32 중에서 선택되는 서열을 특이적으로 인식할 수 있다.
이 때, 상기 가이드 RNA는 서열번호 1 내지 32로 표시되는 서열 중 하나 이상의 서열을 포함할 수 있다 (단, 서열 중 T를 U로 변경).
유전자 가위 시스템의 특이성(Specificity)은 가이드 RNA의 안내 서열에 의해 결정되기 때문에, 유전자 편집과정에 적용하기 전에 활성 검증 과정을 반드시 거쳐야 한다: 표적 유전자에 존재하는 PAM(protospacer-adjacent motif)을 기준으로 ATUM Scoring Algorithms, GenScript 등의 공개된 프로그램을 통해 안내 서열을 선별하고, 선별된 안내 서열을 포함하는 가이드 RNA에 대해서는 추가로 On-target 및 Off-target 효과 검증을 위해 불일치-민감성 T7 엔도뉴클레아제 I(T7E1) 분석 및 Targeted Deep-sequencing의 과정을 거치며, 최종적으로 타겟 특이성이 높고, Off-target 효과가 없는 가이드 RNA를 확정하게 된다.
상기 정상세포에서 가이드 RNA가 타겟팅하는 서열은 역위된 FVIII 유전자를 복원시키기 위한 표적과 동일한 서열이기 때문에, 질환모델이 아닌 정상 세포에서의 역위 유발 빈도로 유전자 복원능을 예측하는 것은 당업자에게 자명하다.
통상적으로 유전자 가위 시스템(CRISPR/Cas system)은 Cas 단백질, tracrRNA(trans-activating RNA) 및 crRNA로 구성되며, 상기 crRNA는 표적 부위와 결합하는 스페이서(spacer) 및 tracrRNA와 혼성화될 수 있는 RNA 서열을 포함하고 있기 때문에, Cas 단백질과 복합체를 형성하기 전에 tracrRNA와 우선적으로 혼성화하는 단계를 거쳐 RNA-RNA 결합체를 형성하는 특징이 있다. 또한, crRNA와 tracrRNA를 인위적으로 융합시켜 단일 가닥으로 된 상태로 Cas 단백질과의 복합체를 형성하도록 유도할 수 있다.
본 발명에서 '가이드 RNA(guide RNA)'는 통상적으로 tracrRNA 및 crRNA를 포함하며, 구체적으로는 표적 부위(서열)에 결합하는 스페이서(spacer) 또는 안내 서열(guide sequence)을 포함하는 RNA 및 Cas 단백질과 결합하는 RNA와 이중 가닥, 또는 상기 두 RNA가 융합된 단일 가닥으로 구성된 RNA인 특징이 있다. 따라서, 상기 '가이드 RNA'라는 용어는 '단일 가닥 가이드 RNA(single strand guide RNA)', '키메라 RNA(chimeric RNA)', '키메라 가이드 RNA(chimeric guide RNA)', '합성 가이드 RNA(syntheic guide RNA)'로 혼용될 수 있다. 또한, 상기 '가이드 RNA'는 Cas 단백질(또는 엔도뉴클레이즈)과 결합하여 표적 부위에 결합하거나, 또는 결합하여 상기 표적 부위를 절단하는 특징을 가진 복합체(complex)를 구성하는 RNA는 모두 상기 용어에 해당하는 것으로 해석될 수 있다.
상기 '융합'은 둘 이상의 서브유닛 분자들이 바람직하게는 공유 결합된 분자이다. 서브유닛 분자들은 화학적 종류가 동일한 분자일 수 있거나, 또는 화학적 종류가 상이한 분자일 수 있다. 상기 가이드 RNA에서 crRNA와 tracrRNA의 융합은 수소결합이 아닌 인산화 결합에 의하여 백본이 연결되어, 단일 가닥으로 구성된 상태를 특징으로 한다.
본 발명에서의 용어, '안내 서열(guide sequence)'는 가이드 RNA의 5' 말단측에 30 bp 이내의 길이를 가지며 표적 부위에 상보적인 특징을 가지는 RNA 서열로서, 스페이서(spacer) 또는 스페이서 서열(spacer sequence)와 혼용될 수 있다. 통상적으로 Cas 단백질/가이드 RNA의 복합체에서 Cas 단백질과의 결합에 관여하지 않고, 표적 부위와 상보적으로 결합하는 작용을 하는 서열은 모두 상기 용어에 해당하는 것으로 해석될 수 있다.
상기 안내 서열(guide sequence)은 CRISPR RGEN Tools(http://www.rgenome.net; Park et al, Bioinformatics, 31:4014-4016, 2015); sgRNA Designer(Doench et al., Nature Biotechnology 34(2):184-191, 2016); E-CRISP(http://www.e-crisp.org/E-CRISP/Heigwar et al., Nature Methods 11(2):122-123, 2014); Benchling(https://benchling.com); sgRNA scorer 2.0(https://crispr.med.harvard.edu/sgRNAScorerV2; Chari et al., ACS Synthetic Biology, 2017. doi: 10.1021/acssynbio.6b00343), CRISPy-web(Blin et al., Synthetic and Systems Biotechnology, 1(2): 118-121, 2016)을 이용하여 당업자라면 용이하게 선별할 수 있다.
본 발명에 있어서, 상기 가이드 RNA는 (a) 안내 서열을 포함하는 crRNA 및 tracrRNA, (b) 안내 서열을 포함하는 crRNA 및 tracrRNA의 융합체(chimeric guide RNA) 또는 (c) 안내 서열을 포함하는 crRNA로 구성될 수 있으며, 이에 한정된 것은 아니다.
본 발명의 가이드 RNA는 핵산 백본 또는 염기에 변형(modification)이 가해질 수 있다: 백본 변형에 있어서는 phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, 3'-alkylene phosphonates, 5'-alkylene phosphonates, chiral phosphonates, phosphinates, phosphoramidates including 3'-amino phosphoramidate aminoalkylphosphoramidates, phosphorodiamidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, selenophosphates, boranophosphate 등이 사용될 수 있고, 당 분자 잔기 변형에는 2′-methoxyethoxy, 2′-MOE, 2′-dimethylaminooxyethoxy, 2′-dimethylaminoethoxyethoxy, methoxy, aminopropoxy, fluoro, ally, -O-allyl 등이 사용될 수 있으며, 이에 한정된 것은 아니다. 또한, 염기 변형에 있어서는 통상적인 퓨린(purine) 및 피리미딘(pyrimidine)이 아닌 5-methylcytosine(5meC), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine, 2-pyridone, 2-thiouracil, 2-thiothymine 2-thiocytosine, 5-halouracil, 5-propynyl uracil, 6-azo uracil, pseudouracil, 7-methylguanine, 7-methyladenine, 2-F-adenine, 2-aminoadenine, 8-azaguanine, 8-azaadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, 3-deazaadenine, phenoxazine cytidine, phenothiazine cytidine, carbazole cytidine, pyridoindole cytidine 등 일 수 있으나, 이에 한정된 것은 아니다.
추가적으로, 본 발명은 (iii) 표적 특이적 뉴클레아제 또는 이를 코딩하는 뉴클레오타이드를 포함한다.
일 구체예에서, 상기 표적 특이적 뉴클레아제는 Cas 단백질 (예컨대, Cas9 단백질(CRISPR (Clustered regularly interspaced short palindromic repeats) associated protein 9)), Cpf1 단백질 (CRISPR from Prevotella and Francisella 1) 등과 같은 타입 Ⅱ 및/또는 타입 V의 CRISPR 시스템에 수반되는 뉴클레아제 (예컨대, 엔도뉴클레아제) 등으로 이루어진 군에서 선택된 1종 이상일 수 있다. 이 경우, 상기 표적 특이적 뉴클레아제는 유전체 DNA의 표적 부위로 안내하기 위한 표적 DNA 특이적 가이드 RNA를 추가로 포함할 수 있다. 상기 가이드 RNA는 생체 외 (in vitro)에서 전사된(transcribed) 것일 수 있고, 예컨대 올리고뉴클레오티드 이중가닥 또는 플라스미드 주형으로부터 전사된 것일 수 있으나, 이에 제한되지 않는다. 상기 표적 특이적 뉴클레아제는 가이드 RNA에 결합된 리보핵산-단백질 복합체를 형성(RNA-Guided Engineered Nuclease)하여 리보핵산 단백질 (RNP) 형태로 작용할 수 있다.
Cas 단백질은 CRISPR/Cas 시스템의 주요 단백질 구성 요소로, 활성화된 엔도뉴클레아제 또는 니케이즈를 형성할 수 있는 단백질이다.
Cas 단백질 또는 유전자 정보는 NCBI (National Center for Biotechnology Information)의 GenBank와 같은 공지의 데이터 베이스에서 얻을 수 있다.
예컨대, 상기 Cas 단백질은, 스트렙토코커스 sp. (Streptococcus sp.), 예컨대, 스트렙토코커스 피요게네스 (Streptococcus pyogenes) 유래의 Cas 단백질, 예컨대, Cas9 단백질 (예컨대, SwissProt Accession number Q99ZW2(NP_269215.1)); 캄필로박터 속, 예컨대, 캄필로박터 제주니 (Campylobacter jejuni) 유래의 Cas 단백질, 예컨대, Cas9 단백질; 스트렙토코커스 속, 예컨대, 스트렙토코커스 써모필러스 (Streptococcus thermophiles) 또는 스트렙토코커스 아우레우스 (Streptocuccus aureus) 유래의 Cas 단백질, 예컨대, Cas9 단백질; 네이세리아 메닝기디티스 (Neisseria meningitidis) 유래의 Cas 단백질, 예컨대, Cas9 단백질; 파스테우렐라 (Pasteurella) 속, 예컨대, 파스테우렐라 물토시다 (Pasteurella multocida) 유래의 Cas 단백질, 예컨대 Cas9 단백질; 프란시셀라 (Francisella) 속, 예컨대, 프란시셀라 노비시다 (Francisella novicida) 유래의 Cas 단백질, 예컨대 Cas9 단백질등으로 이루어진 군에서 선택된 하나 이상일 수 있으나, 이에 제한되는 것은 아니다.
Cpf1 단백질은 상기 CRISPR/Cas 시스템과는 구별되는 새로운 CRISPR 시스템의 엔도뉴클레아제로서, Cas9에 비해 상대적으로 크기가 작고 tracrRNA가 필요 없으며, 단일 가이드 RNA에 의해 작용할 수 있다. 또한, 티민 (thymine)이 풍부한 PAM (protospacer-adjacent motif) 서열을 인식하고 DNA의 이중 사슬을 잘라 점착종단 (cohesive end; cohesive double-strand break)을 생성한다.
예컨대, 상기 Cpf1 단백질은 캔디다투스 (Candidatus) 속, 라치노스피라 (Lachnospira) 속, 뷰티리비브리오 (Butyrivibrio) 속, 페레그리니박테리아 (Peregrinibacteria), 액시도미노코쿠스 (Acidominococcus) 속, 포르파이로모나스 (Porphyromonas) 속, 프레보텔라 (Prevotella) 속, 프란시셀라 (Francisella) 속, 캔디다투스 메타노플라스마 (Candidatus Methanoplasma), 또는 유박테리움 (Eubacterium) 속 유래의 것일 수 있고, 예컨대, Parcubacteria bacterium (GWC2011_GWC2_44_17), Lachnospiraceae bacterium (MC2017), Butyrivibrio proteoclasiicus, Peregrinibacteria bacterium (GW2011_GWA_33_10), Acidaminococcus sp. (BV3L6), Porphyromonas macacae, Lachnospiraceae bacterium (ND2006), Porphyromonas crevioricanis, Prevotella disiens, Moraxella bovoculi (237), Smiihella sp. (SC_KO8D17), Leptospira inadai, Lachnospiraceae bacterium (MA2020), Francisella novicida (U112), Candidatus Methanoplasma termitum, Candidatus Paceibacter, Eubacterium eligens 등의 미생물 유래의 것일 수 있으나, 이에 제한되는 것은 아니다.
상기 표적 특이적 뉴클레아제는 미생물에서 분리된 것 또는 재조합적 방법 또는 합성적 방법 등과 같이 인위적 또는 비자연적 생산된 것(non-naturally occurring)일 수 있다. 일 예에서, 상기 표적 특이적 뉴클레아제 (예컨대, Cas9, Cpf1, 등)은 재조합 DNA에 의하여 만들어진 재조합 단백질일 수 있다. 재조합 DAN(Recombinant DNA; rDNA)는 다양한 유기체로부터 얻어진 이종 또는 동종 유전 물질을 포함하기 위하여 분자 클로닝과 같은 유전자 재조합 방법에 의하여 인공적으로 만들어진 DNA 분자를 의미한다. 예컨대, 재조합 DNA를 적절한 유기체에서 발현시켜 표적 특이적 뉴클레아제를 생산 (in vivo 또는 in vitro)하는 경우, 재조합 DNA는 제조하고자 하는 단백질을 암호화 하는 코돈들 중에서 상기 유기체에 발현하기에 최적화된 코돈을 선택하여 재구성된 뉴클레오타이드 서열을 갖는 것일 수 있다.
상기 표적 특이적 뉴클레아제는 변이된 형태의 변이 표적 특이적 뉴클레아제일 수 있다. 상기 변이 표적 특이적 뉴클레아제는 DNA 이중 가닥을 절단하는 엔도뉴클레아제 활성을 상실하도록 변이된 것을 의미할 수 있으며, 예컨대, 엔도뉴클레아제 활성을 상실하고 니카아제 활성을 갖도록 변이된 변이 표적 특이적 뉴클레아제 및 엔도뉴클레아제 활성과 니카아제 활성을 모두 상실하도록 변이된 변이 표적 특이적 뉴클레아제 중에서 선택된 1종 이상일 수 있다. 상기 변이 표적 특이적 뉴클레아제가 니카아제 활성을 갖는 것인 경우, 상기 디아미나제에 의한 염기변환(예컨대, 시티딘이 우라딘으로 변환)과 동시 또는 순서와 무관하게 순차적으로, 상기 염기 변환이 일어난 가닥 또는 그 반대 가닥 (예컨대, 염기 변환이 일어난 가닥의 반대 가닥)에서 nick이 도입될 수 있다 (예컨대, PAM이 위치하는 가닥의 반대가닥에서, PAM 서열의 5' 말단 방향으로 3번째 뉴클레오타이드와 4번째 뉴클레오타이드 사이에 해당하는 위치에 nick이 도입됨). 이와 같은 표적 특이적 뉴클레아제의 변이 (예컨대, 아미노산 치환 등)는 적어도 뉴클레아제의 촉매 활성 도메인 (예컨대, Cas9의 경우 RuvC 촉매 도메인)에서 일어나는 것일 수 있다. 일 예에서, 상기 표적 특이적 뉴클레아제가 스트렙토코커스 피요젠스 유래 Cas9 단백질 (SwissProt Accession number Q99ZW2(NP_269215.1))인 경우, 상기 변이는 촉매 활성을 갖는 아스파르트산 잔기 (catalytic aspartate residue; 10번째 위치의 아스파르트산 (D10) 등), 762번째 위치의 글루탐산 (E762), 840번째 위치의 히스티딘 (H840), 854번째 위치의 아스파라긴 (N854), 863번째 위치의 아스파라긴 (N863), 986번째 위치의 아스파르트산 (D986) 등으로 이루어진 군에서 선택된 하나 이상 임의의 다른 아미노산으로 치환된 돌연변이를 포함할 수 있다. 이 때, 치환되는 임의의 다른 아미노산은 알라닌 (alanine)일 수 있지만, 이에 제한되지 않는다.
다른 예에서, 상기 변이 표적 특이적 뉴클레아제는 야생형 Cas9 단백질과 상이한 PAM 서열을 인식하도록 변이된 것일 수 있다. 예컨대, 상기 변이 표적 특이적 뉴클레아제는 스트렙토코커스 피요젠스 유래 Cas9 단백질의 1135번째 위치의 아스파르트산 (D1135), 1335번째 위치의 아르기닌 (R1335), 및 1337번째 위치의 트레오닌 (T1337) 중 하나 이상, 예컨대 3개 모두가 다른 아미노산으로 치환되어, 야생형 Cas9의 PAM 서열 (NGG)와 상이한 NGA (N은 A, T, G, 및 C 중에서 선택된 임의의 염기임)을 인식하도록 변이된 것일 수 있다.
일 예에서, 상기 변이 표적 특이적 뉴클레아제는 스트렙토코커스 피요젠스 유래 Cas9 단백질의 아미노산 서열 중,
(1) D10, H840, 또는 D10 + H840;
(2) D1135, R1335, T1337, 또는 D1135 + R1335 + T1337; 또는
(3) (1)과 (2) 잔기 모두에서 아미노산 치환이 일어난 것일 수 있다.
본 명세서에 사용된 바로서, 상기 '다른 아미노산'은, 알라닌, 이소류신, 류신, 메티오닌, 페닐알라닌, 프롤린, 트립토판, 발린, 아스파라긴산, 시스테인, 글루타민, 글리신, 세린, 트레오닌, 티로신, 아스파르트산, 글루탐산, 아르기닌, 히스티딘, 라이신, 상기 아미노산들의 공지된 모든 변형체 중에서, 야생형 단백질이 원래 변이 위치에 갖는 아미노산을 제외한 아미노산들 중에서 선택된 아미노산을 의미한다. 일 예에서, 상기 '다른 아미노산'은 알라닌, 발린, 글루타민, 또는 아르기닌일 수 있다.
일 예에서, 상기 변이 표적 특이적 뉴클레아제는 엔도뉴클레아제 활성을 상실(예컨대, 니카아제 활성을 갖거나, 엔도뉴클레아제 활성 및 니카아제 활성을 모두 상실)한 변형 Cas9 단백질, 또는 야생형 Cas9과 상이한 PAM 서열을 인식하는 것일 수 있다. 예컨대, 상기 변형 Cas9 단백질은, 스트렙토코커스 피요제네스 (Streptococcus pyogenes) 유래의 Cas9 단백질에 있어서,
(1) D10 또는 H840 위치에 돌연변이 (예컨대, 다른 아미노산으로의 치환)가 도입되어 엔도뉴클레아제 활성이 상실되고 니카아제 활성을 갖는 변형 Cas9, 또는 스트렙토코커스 피요젠스 (Streptococcus pyogenes) 유래의 Cas9 단백질에 D10 및 H840 위치에 모두 돌연변이 (예컨대, 다른 아미노산으로의 치환)가 도입되어 엔도뉴클레아제 활성 및 니카아제 활성을 모두 상실한 변형 Cas9 단백질;
(2) D1135, R1335 및 T1337 중에서 하나 이상 또는 이들 모두에 돌연변이(예컨대, 다른 아미노산으로의 치환)가 도입되어 야생형과 상이한 PAM 서열을 인식하는 변형 Cas9 단백질; 또는
(3) (1) 및 (2)의 돌연변이가 모두 도입되어 니카아제 활성을 갖고 야생형과 상이한 PAM 서열을 인식하거나, 엔도뉴클레아제 활성 및 니카아제 활성을 모두 상실하고 야생형과 상이한 PAM 서열을 인식하는 변형 Cas9 단백질일 수 있다.
예컨대, 상기 CAs9 단백질의 D10 위치에서의 돌연변이는 D10A 돌연변이 (Cas9 단백질의 아미노산 중 10번째 아미노산인 D가 A로 치환된 돌연변이를 의미함; 이하, Cas9에 도입된 돌연변이는 동일한 방법으로 표기됨)일 수 있고, 상기 H840 위치에서의 돌연변이는 H840A 돌연변이일 수 있으며, D1135, R1335, 및 T1337 위치에서의 돌연변이는 각각 D1135V, R1335Q, 및T1337R일 수 있다.
일 예에서, 본 명세서에서 사용되는 표적 특이적 뉴클레아제는 스트렙토코커스 피요젠스 (Streptococcus pyogenes) 유래의 Cas9 단백질(예컨대, SwissProt Accession number Q99ZW2(NP_269215.1))에 (1) D10 위치에서의 돌연변이 (예컨대, 다른 아미노산으로의 치환) 가 도입되어 엔도뉴클레아제 활성이 상실되고 니케이즈 활성을 갖는 변형 Cas9, (2) H840 위치에서의 돌연변이 (예컨대, 다른 아미노산으로의 치환) 가 도입되어 엔도뉴클레아제 활성이 상실되고 니케이즈 활성을 갖는 변형 Cas9, (3) D10 위치에서의 돌연변이(예컨대, 다른 아미노산으로의 치환)와 H840 위치에 돌연변이 (예컨대, 다른 아미노산으로의 치환)가 모두 도입되어 엔도뉴클레아제 활성 및 니케이즈 활성을 모두 상실한 변형 Cas9 단백질 등으로 이루어진 군에서 선택된 1종 이상일 수 있다. 예컨대, 상기 CAs9 단백질의 D10 위치에서의 돌연변이는 D10A 돌연변이 (Cas9 단백질의 아미노산 중 10번째 아미노산인 D가 A로 치환된 돌연변이를 의미함; 이하, Cas9에 도입된 돌연변이는 동일한 방법으로 표기됨)일 수 있고, 상기 H840 위치에서의 돌연변이는 H840A 돌연변이일 수 있다.
본 발명에 있어서, 상기 Cas 단백질은 Cas3, Cas9, Cpf1, Cas6, 또는 C2c2로 선택된 핵산절단효소일 수 있으며, 구체적으로는 CRISPR/Cas type II의 Cas 단백질이며, 보다 구체적으로는 스트렙토코커스 피요젠스 유래의 Cas9 단백질인 특징이 있다.
본 발명에 있어서, 상기 Cas 단백질은 미생물에서 단순 분리한 핵산절단효소일 수 있으나, (a) 일부 아미노산 서열이 치환된 변이체, (b) 친화성 태그(affinity tag), 재조합효소(recombinase), 트랜스포손(transposon) 등과 융합 단백질, (c) NLS(nuclear localization sequences)가 추가된 변이체 등으로 변형될 수 있다.
본 발명에 있어서, 역위된 유전자를 보정에 의하여 정상적인 유전자가 발현되도록 하기 때문에, 질환에 대한 반영구적 치료 효과를 유도할 수 있다. 정상적인 유전자가 발현되는 비율은 1 ~ 100%, 구체적으로는 1 ~ 80%, 보다 구체적으로는 30 ~ 50%일 수 있으며, 이에 한정된 것은 아니다.
본 발명의 유전자 가위 시스템의 세부 구성인 하나 이상의 가이드 RNA 및 Cas 단백질은 (a) 하나 이상의 가이드 RNA 및 Cas 단백질을 발현하는 핵산서열을 포함하는 벡터, (b) 하나 이상의 가이드 RNA 및 Cas 단백질로 구성된 리보핵산단백질(Ribonucleoprotein, RNP) 또는 RGEN(RNA-guided engineered nuclease), 또는 (c) 하나 이상의 가이드 RNA 및 Cas 단백질로 코딩되는 mRNA의 구성으로 세포 내에 전달될 수 있으며, 이에 한정된 것은 아니다.
상기 하나 이상의 가이드 RNA 및 Cas 단백질을 발현하는 핵산서열을 포함하는 벡터에서의 상기 벡터는 하나 이상의 가이드 RNA 및 Cas 단백질을 동시에 포함하거나, 또는 가이드 RNA 및 Cas 단백질을 각각 발현하는 둘 이상의 벡터로 구성될 수 있다.
본 발명의 유전자 가위 시스템에서, 상기 벡터는 하나 이상으로서, 플라스미드 벡터 또는 바이러스 벡터일 수 있으며, 상기 바이러스 벡터는 구체적으로 아데노바이러스(Adenovirus), 아데노부속 바이러스(Adeno-associated virus), 렌티바이러스(Lentivirus), 레트로바이러스(Retrovirus) 벡터일 수 있으나, 이에 한정된 것은 아니다.
본 발명의 벡터는 마이크로 전달체(microvehicles), 리포좀(liposome), 엑소좀(exosome), 나노입자(nanoparticles), 유전자 건(gene-gene) 등에 의하여 세포로 전달할 수 있으며, 이에 한정된 것은 아니며, 벡터의 구성적 특징 및 전달하려는 세포의 특성에 적합한 전달 방법을 선택하는 것은 당업자에게 자명하다.
본 발명자는 유전자 가위 시스템을 이용하여 역위된 유전자를 복원시킬 수 있으며, 또한 정상적인 유전자 발현이 가능하여 치료효과가 유도될 수 있음을 입증하기 위하여, 서열번호 1 내지 32로 구성된 군에서 선택된 하나 이상의 가이드 RNA의 타겟 서열을 선별하였다(표 1 및 2).
본 발명은 다른 양태에서, (i) 역위되지 않은 혈액응고인자 VIII(F8) 유전자 내 22번 인트론(intron)을 특이적으로 인식하는 가이드 RNA; (ii) 원위(distal region)의 22번 인트론 역위를 특이적으로 인식하는 가이드 RNA 및 (iii) 표적 특이적 뉴클레아제 또는 이를 코딩하는 뉴클레오타이드를 포함하는 혈우병의 예방 또는 치료용 조성물에 관한 것이다.
본 발명은 (i) 역위되지 않은 혈액응고인자 VIII(F8) 유전자 내 22번 인트론(intron)을 특이적으로 인식하는 가이드 RNA; (ii) 원위(distal region)의 22번 인트론 역위를 특이적으로 인식하는 가이드 RNA 및 (iii) 표적 특이적 뉴클레아제 또는 이를 코딩하는 뉴클레오타이드를 개체에 투여하는 단계를 포함하는 혈액응고인자 VIII(F8) 유전자의 역위 보정방법 또는 혈우병의 예방 또는 치료방법에 관한 것이다.
본 발명은 또 다른 양태에서, 서열번호 1 내지 32로 표시되는 서열 중 하나 이상의 서열을 표적으로 하여 해당 서열을 특이적으로 인식하는 가이드 RNA 및 Cas 단백질을 이용한 혈액응고인자 VIII(FVIII) 유전자 역위 보정용 유전자 가위 시스템(CRISPR/Cas system)에 관한 것이다.
본 발명은 또 다른 양태에서, 서열번호 1 내지 32로 표시되는 서열 중 하나 이상의 서열을 표적으로 하여 해당 서열을 특이적으로 인식하는 가이드 RNA 및 Cas 단백질을 이용한 혈액응고인자 VIII(FVIII) 유전자 혈우병의 예방 또는 치료용 유전자 가위 시스템(CRISPR/Cas system)에 관한 것이다.
상기 역위 보정용 조성물은 유전자 가위 시스템을 이용한 유전자 보정에 의하여 정상적인 FVIII가 발현되기 때문에, A형 혈우병에 대한 반영구적 치료 효과를 유도할 수 있다.
본 발명의 조성물을 이용하여 치료하고자 하는 타겟질환은 중증 A형 혈우병로서, FVIII의 활성이 정상인의 1% 미만인 경우의 증상이 이에 해당한다.
본 발명의 조성물, 치료방법 및 유전자 가위 시스템에 포함된 구성에 대한 설명은 위와 같으며, 동일하게 적용될 수 있다.
본 발명의 조성물, 방법 및 용도는 이를 필요로 하는 대상체에 충분량 또는 유효량으로 투여될 수 있다. '유효량' 또는 '충분량'은 단일 또는 다중 용량으로 단독으로 또는 하나 이상의 다른 치료용 조성물, 프로토콜, 또는 치료 요법과 조합되어 임의의 기간 동안 대상체에 이로움을 주거나 대상체에 예상되거나 요망되는 결과를 제공하는 양을 나타낸다.
치료학적 효과를 달성하기 위한 AAV 벡터 용량은 벡터 유전체 용량/체중kg(vg/kg)로 제공될 수 있으나, (a) 투여 경로, (b) 치료학적 효과를 달성하는데 요구되는 치료 유전자의 발현 수준, (c) AAV 벡터에 대한 임의의 숙주 면역 반응, (d) 발현된 단백질의 안정도와 같은 요건에 따라 변동될 수 있다. 예시로서 혈우병을 이용하는 경우, 일반적으로 말해서, 치료학적 효과를 달성하기 위해, 정상 개체에서 발견된 인자 농도의 1% 초과인 혈액 응고 인자 농도가 중증 질환 표현형을 중등도증 표현형으로 변화시키는데 필요한 정도로 제공한다. 중증의 표현형은 관절 손상 및 생명을 위협하는 출혈을 특징으로 한다. 중등도증 질환 표현형을 경증 표현형으로 전환시키기 위해, 정상치의 5% 초과의 높은 혈액 응고 인자 농도가 요구된다.
본 발명의 유전자 가위 시스템 및 조성물은 AAV 벡터, 추가 조성, 제제, 약물, 생물제제(단백질)와 더불어 약제학적으로 허용되는 담체 또는 부형제 내로 혼입하여 약제학적 조성물로 제조할 수 있다. 특히, 이러한 약제학적 조성물은 생체 내 또는 생체 외에서 환자 또는 대상체에 투여되고 전달되기에 유용하다.
상기 약제학적 조성물로 제조되는 경우에는, 약제학적으로 허용되는 담체를 포함한다. 상기 담체는 제제 시에 통상적으로 이용되는 것으로서, 락토스, 덱스트로스, 수크로스, 솔비톨, 만니톨, 전분, 아카시아 고무, 인산 칼슘, 알기네이트, 젤라틴, 규산 칼슘, 미세결정성 셀룰로스, 폴리비닐피롤리돈, 셀룰로스, 물, 시럽, 메틸 셀룰로스, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 활석, 스테아르산 마그네슘, 미네랄 오일, 식염수, PBS(phosphate buffered saline) 또는 배지 등을 포함하나, 이에 한정되는 것은 아니다. 그리고 상기 성분들 이외에 윤활제, 습윤제, 감미제, 향미제, 유화제, 현탁제, 보존제 등을 추가로 포함할 수 있다. 적합한 약제학적으로 허용되는 담체 및 제제는 Remington's Pharmaceutical Sciences (19th ed., 1995)에 상세히 기재되어 있다. 약제학적 조성물의 적합한 투여량은 제제화 방법, 투여 방식, 환자의 연령, 체중, 성, 병적 상태, 음식, 투여 시간, 투여 경로, 배설 속도 및 반응 감응성과 같은 요인들에 의해 다양하게 처방될 수 있다.
또한, 상기 약제학적 조성물은 당해 발명이 속하는 기술분야에서 통상의 지식을 가진 자가 용이하게 실시할 수 있는 방법에 따라, 약제학적으로 허용되는 담체 및/또는 부형제를 이용하여 제제화함으로써 단위 용량 형태로 제조되거나 또는 다용량 용기 내에 내입시켜 제조될 수 있다. 이때 제형은 오일 또는 수성 매질중의 용액, 현탁액, 시럽제 또는 유화액 형태이거나 엑스제, 산제, 분말제, 과립제, 정제 또는 캅셀제 형태일 수도 있으며, 분산제 또는 안정화제를 추가적으로 포함할 수 있다.
상기 약제학적 조성물은 전신, 부위적 또는 국부적으로 또는 임의의 경로, 예를 들어, 주입, 융합, 섭취 또는 흡입에 의한 경구 또는 경피적 국소에 의한 전달 및 투여를 포함한다. 이러한 전달 및 투여 경로는 정맥 내, 근 내, 복강 내, 피 내, 피하, 강 내, 두개 내, 경피 또는 국소, 점막관통 또는 직장과 같은 비경구을 포함한다. 예시적인 투여 및 전달 경로는 정맥 내(i.v.), 복강 내(i.p.), 동맥 내, 근내, 비경구, 피하, 흉막 내, 국소, 피부, 피 내, 경피, 두개 내, 척수 내, 경구(소화), 점막, 호흡, 비 내, 삽관, 폐내, 폐내 점적, 협측, 설하, 혈관내, 동맥내, 강내, 이온영동, 안구내, 안구, 눈, 선내, 기관내, 림프내를 포함한다. 전달 및 투여 용량은 현재 존재하는 프로토콜을 기반으로 할 수 있으며, 인간 임상 시험에서 선택적으로 또는 동물 질환 모델을 사용하여 또는 실험적으로 결정될 수 있다. 초기 연구 용량은 예를 들어, 마우스 또는 개에 대한 본원에 기재된 동물 연구를 기반으로 할 수 있다.
본 발명의 유전자 가위 시스템 또는 조성물을 처치하는 대상은 동물, 전형적으로, 포유동물 예컨대, 인간, 인간 외 영장류(유인원, 긴팔원숭이, 고릴라, 침팬지, 오랑우탄, 마카크(macaque)), 반려동물(개 및 고양이), 가축(가금류 예컨대, 닭 및 오리, 말, 소, 염소, 양, 돼지), 실험용 동물(마우스, 래트, 토끼, 기니아 피그), 및 동물 질환 모델 예를 들어, 혈액응고질환 및 당업자에게 공지된 기타 질환의 마우스 및 기타 동물 모델을 포함한다.
본 발명에서 이용되는 각 조성물 및 단계에 대해서는 이미 상술하였으므로, 과도한 중복을 피하기 위해 그 기재를 생략한다.
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 예시하기 위한 것으로, 본 발명의 범위가 이들 실시예에 의해 제한되지 않는 것은 당업계에서 통상의 지식을 가진 자에게 있어서 자명할 것이다.
[실시예]
실시예 1: 가이드 RNA의 선별
1) 가이드 RNA의 선별
CRISPR RGEN Tools((http://www.rgenome.net; Park et al, Bioinformatics 31:4014-4016, 2015)을 이용하여 가이드 RNA를 디자인 하였다. 표1(TS1, target site1)에 해당하는 가이드 RNA는 인간 FVIII 유전자의 int22-1 상동체 시작부분(Chr-X:154109091, Grch37)부터 centromere쪽으로 대략 18000bp까지 해당되는 region과 int22-3 상동체 끝부분(Chr-X:154684313, Grch37)으로부터 centromere쪽으로 대략 950bp까지 해당하는 부분에서 디자인하였다. 표2(TS2, target site2)에 해당하는 가이드 RNA는 int22-1 상동체 끝부분(Chr-X:154118603, Grch37)으로부터 telomere쪽으로 대략 1800bp까지 해당하는 부분에서 디자인하였다. PAM 서열로 5'-NGG-3'를 갖는 guide RNA를 선별한 후, 인간 유전체상에서 On-target 부위를 제외하고 1 base 또는 2 base mismatch가 없는 guide RNA를 추가적으로 선별하여 활성 테스트에 사용하였다.
2) 가이드 RNA의 On-target/Off-target effect
Human cell line인 Jurkat cell에 SpCas9과 in-vitro transcription을 이용해 합성된 각각의 sgRNA를 RNP형태로 nucleofection하고, 약 2 ~ 3일 후 genomic DNA를 추출하고 PCR로 on-target위치를 증폭시킨 후, Next-Generation Sequencing을 위한 sequencing primer에 특이적인 adaptor 및 TruSeq HT 이중 지표 프라이머(TruSeq HT Dual Index primers)를 붙이는 추가적인 PCR을 진행하였다. 이후 paired sequencing을 통하여 나온 read들을 분석하여 on-target 유전체 위치에서의 insertion 또는 deletion (Indels) 확인을 통해 activity가 있는 guide RNA들을 선별하였다.
on-target 유전체 위치에서의 insertion 또는 deletion (Indels) 확인을 통해 activity가 있는 guide RNA들을 선별하였으며, 표 1 및 표 2와 같다.
Figure PCTKR2020004232-appb-T000001
Figure PCTKR2020004232-appb-T000002
도 1은 1차적으로 스크리닝한 가이드 RNA중에서 활성이 좋은 것들을 선별하여 RNP dose가 다른 optimal 또는 suboptimal condition에서 추가 활성검사를 진행한 내용이다. 이로부터 반복적으로 좋은 활성을 나타내는 가이드 RNA를 TS1 및 TS2에서 대략 6개씩 선별할 수 있었다.
실시예 2: 선별된 가이드 RNA와 Cas9 단백질에 의한 human F8 genome의 역위 확인
Human iPSC에 TS1-2-1 (서열번호 15)/TS2-4 (서열번호 19) 조합과 SpCas9을 각각 RNP형태로 necleofection하고, 3일 후 genomic DNA를 추출하여 역위-특이적인 primer를 이용한 PCR로 대략 560kb의 large chromosome의 역위를 F8-intron22 부분(F1+F2)과 distal 부분(R1+R2)에서 각각 확인하였다. 정상형-특이적인 primer를 이용한 PCR로는 역위되지 않는 population을 F8-intron22 부분(F1+R1)과 distal 부분(F2+R2)에서 각각 확인하였다 (도 2). 사용된 primer의 서열은 각각 다음과 같다. F1: 5’-TGCCAACTCTTGATACAGAAGG-3' (서열번호 33), R1: 5’-TGGCAGATTTCCCTGACATAAA-3'(서열번호 34), F2: 5’ACAACCAGAGCAGAAATCAATGA-3' (서열번호 35), R2: 5’- TTTCACCACATCCACGCCAA-3' (서열번호 36).
A형 혈우병은 근본적인 치료가 가능한 치료제가 없어 대체요법만 가능한 질환으로, 치료 유전자 삽입에 의한 유전자 치료기술을 적용하기에도 FVIII의 유전자 크기가 매우 크기 때문에, 벡터 내 패키징 한계로 인체 내로 전달하는데 어려움이 있다. 최근에는 이러한 문제를 해결하고자 minimal domain의 FVIII을 이용한 방법들이 임상시험에 들어가 있으나, 단기적인 효과만 기대되는 기술로서, 근본적이고 장기적인 치료방법의 개발이 필요하다. 유전자 가위 시스템(CRISPR/Cas9 system)을 이용한 유전자 교정은 보다 근본적이고 장기적인 치료방법을 제시해 줄 수 있고, Size가 큰 Cas9의 경우 AAV에는 packaging이 될 수 없으나, lipid nano particle이나 polymer nano particle같은 non-viral delivery를 통해 효과적으로 전달할 수 있다. 본 발명에 따른 유전자 가위 시스템(CRISPR/Cas system)은 역위 유전자 보정능에 의하여 정상적인 유전자 발현을 유도할 수 있어, 세포 내 전달이 어려운 큰 사이즈의 유전자 변이를 유전자교정을 통해 효율적으로 극복할 수 있는 기술로서의 탁월하다. 특히, FVIII 유전자의 역위를 복원시켜 정상적인 FVIII 발현을 유도할 수 있으므로, A형 혈우병의 치료에 유용하다.
전자파일 첨부하였음.

Claims (11)

  1. 다음을 포함하는 혈액응고인자 VIII(F8) 유전자의 역위 보정용 조성물:
    (i) 혈액응고인자 VIII(F8) 유전자 내 역위되지 않은 22번 인트론(intron)을 특이적으로 인식하는 가이드 RNA;
    (ii) 원위(distal region)의 22번 인트론 역위를 특이적으로 인식하는 가이드 RNA; 및
    (iii) 표적 특이적 뉴클레아제 또는 이를 코딩하는 뉴클레오타이드.
  2. 제1항에 있어서, 상기 표적 특이적 뉴클레아제는 스트렙토코커스 피요젠스 유래 Cas9 단백질 또는 상기 Cas9 단백질 코딩 뉴클레오타이드를 추가로 포함하는 것을 특징으로 하는 조성물.
  3. 제1항에 있어서, 상기 가이드 RNA는 PAM (Proto-Spacer-Adjacent Motif) 서열 5'-NGG-3'을 포함하는 것을 특징으로 하는 조성물.
  4. 제1항에 있어서, 상기 역위되지 않은 혈액응고인자 VIII(F8) 유전자 내 22번 인트론(intron)을 특이적으로 인식하는 가이드 RNA는 서열번호 1 내지 16 중에서 선택되는 서열을 특이적으로 인식하는 것을 특징으로 하는 조성물.
  5. 제1항에 있어서, 상기 원위(distal region)의 22번 인트론 역위를 특이적으로 인식하는 가이드 RNA는 서열번호 17 내지 32 중에서 선택되는 서열을 특이적으로 인식하는 것을 특징으로 하는 조성물.
  6. 다음을 포함하는 혈우병의 예방 또는 치료용 조성물:
    (i) 역위되지 않은 혈액응고인자 VIII(F8) 유전자 내 22번 인트론(intron)을 특이적으로 인식하는 가이드 RNA;
    (ii) 원위(distal region)의 22번 인트론 역위를 특이적으로 인식하는 가이드 RNA; 및
    (iii) 표적 특이적 뉴클레아제 또는 이를 코딩하는 뉴클레오타이드.
  7. 제6항에 있어서, 상기 표적 특이적 뉴클레아제는 스트렙토코커스 피요젠스 유래 Cas9 단백질 또는 상기 Cas9 단백질 코딩 뉴클레오타이드를 추가로 포함하는 것을 특징으로 하는 조성물.
  8. 제6항에 있어서, 상기 가이드 RNA는 PAM (Proto-Spacer-Adjacent Motif) 서열 5'-NGG-3'을 포함하는 것을 특징으로 하는 조성물.
  9. 제6항에 있어서, 상기 역위되지 않은 혈액응고인자 VIII(F8) 유전자 내 22번 인트론(intron)을 특이적으로 인식하는 가이드 RNA는 서열번호 1 내지 16 중에서 선택되는 서열을 특이적으로 인식하는 것을 특징으로 하는 조성물.
  10. 제6항에 있어서, 상기 원위(distal region)의 22번 인트론 역위를 특이적으로 인식하는 가이드 RNA는 서열번호 17 내지 32 중에서 선택되는 서열을 특이적으로 인식하는 것을 특징으로 하는 조성물.
  11. 서열번호 1 내지 32로 표시되는 서열 중 하나 이상의 서열을 특이적으로 인식하는 가이드 RNA.
PCT/KR2020/004232 2019-03-28 2020-03-27 혈액응고인자 viii 유전자 역위 보정에 의한 혈우병 치료용 조성물 WO2020197330A1 (ko)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020217026772A KR20210113393A (ko) 2019-03-28 2020-03-27 혈액응고인자 viii 유전자 역위 보정에 의한 혈우병 치료용 조성물

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR20190035763 2019-03-28
KR10-2019-0035763 2019-03-28

Publications (1)

Publication Number Publication Date
WO2020197330A1 true WO2020197330A1 (ko) 2020-10-01

Family

ID=72610620

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2020/004232 WO2020197330A1 (ko) 2019-03-28 2020-03-27 혈액응고인자 viii 유전자 역위 보정에 의한 혈우병 치료용 조성물

Country Status (2)

Country Link
KR (1) KR20210113393A (ko)
WO (1) WO2020197330A1 (ko)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114058690A (zh) * 2021-10-18 2022-02-18 浙江博圣生物技术股份有限公司 检测f8基因1号内含子和22号内含子倒位的试剂盒

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20160045575A1 (en) * 2012-12-07 2016-02-18 Tom E. HOWARD FACTOR VIII MUTATION REPAIR AND TOLERANCE INDUCTION AND RELATED cDNAs, COMPOSITIONS, METHODS AND SYSTEMS
WO2016186772A2 (en) * 2015-05-16 2016-11-24 Genzyme Corporation Gene editing of deep intronic mutations
WO2017053729A1 (en) * 2015-09-25 2017-03-30 The Board Of Trustees Of The Leland Stanford Junior University Nuclease-mediated genome editing of primary cells and enrichment thereof
WO2017165859A1 (en) * 2016-03-24 2017-09-28 Research Institute At Nationwide Children's Hospital Modified viral capsid proteins
EP3243529A2 (en) * 2015-01-06 2017-11-15 Industry-Academic Cooperation Foundation Yonsei University Endonuclease targeting blood coagulation factor viii gene and composition for treating hemophilia comprising same

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20160045575A1 (en) * 2012-12-07 2016-02-18 Tom E. HOWARD FACTOR VIII MUTATION REPAIR AND TOLERANCE INDUCTION AND RELATED cDNAs, COMPOSITIONS, METHODS AND SYSTEMS
EP3243529A2 (en) * 2015-01-06 2017-11-15 Industry-Academic Cooperation Foundation Yonsei University Endonuclease targeting blood coagulation factor viii gene and composition for treating hemophilia comprising same
WO2016186772A2 (en) * 2015-05-16 2016-11-24 Genzyme Corporation Gene editing of deep intronic mutations
WO2017053729A1 (en) * 2015-09-25 2017-03-30 The Board Of Trustees Of The Leland Stanford Junior University Nuclease-mediated genome editing of primary cells and enrichment thereof
WO2017165859A1 (en) * 2016-03-24 2017-09-28 Research Institute At Nationwide Children's Hospital Modified viral capsid proteins

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114058690A (zh) * 2021-10-18 2022-02-18 浙江博圣生物技术股份有限公司 检测f8基因1号内含子和22号内含子倒位的试剂盒
CN114058690B (zh) * 2021-10-18 2022-12-13 浙江博圣生物技术股份有限公司 检测f8基因1号内含子和22号内含子倒位的试剂盒

Also Published As

Publication number Publication date
KR20210113393A (ko) 2021-09-15

Similar Documents

Publication Publication Date Title
US11834649B2 (en) CRISPR/CAS-related methods and compositions for treating herpes simplex virus
US20240132867A1 (en) Adenosine deaminase base editors and methods of using same to modify a nucleobase in a target sequence
US20220135970A1 (en) Crispr/cas-related methods and compositions for treating usher syndrome and retinitis pigmentosa
US20230159956A1 (en) Methods of editing single nucleotide polymorphism using programmable base editor systems
US20230140953A1 (en) Methods of editing a disease-associated gene using adenosine deaminase base editors, including for the treatment of genetic disease
US20230017979A1 (en) Compositions and methods for non-toxic conditioning
CA3100014A1 (en) Methods of suppressing pathogenic mutations using programmable base editor systems
CA3009727A1 (en) Compositions and methods for the treatment of hemoglobinopathies
CA2985615A1 (en) Crispr/cas-related methods and compositions for treating hiv infection and aids
US20220098593A1 (en) Splice acceptor site disruption of a disease-associated gene using adenosine deaminase base editors, including for the treatment of genetic disease
CN113512534B (zh) 用于遗传修饰和靶向的组合物和方法
TW202100748A (zh) 恢復肌縮蛋白功能之基於ｃｒｉｓｐｒ／ｃａｓ之基因組編輯組合物
US20240123088A1 (en) USE OF A SPLIT dCAS FUSION PROTEIN SYSTEM FOR EPIGENETIC EDITING
JP2021513866A (ja) アンジェルマン症候群を処置する方法および組成物
WO2023241669A1 (zh) CRISPR-Cas效应子蛋白、其基因编辑系统及应用
JP2023545132A (ja) ジストロフィン機能を修復するためのｃｒｉｓｐｒ／ｃａｓをベースにした塩基編集組成物
WO2020197330A1 (ko) 혈액응고인자 viii 유전자 역위 보정에 의한 혈우병 치료용 조성물
CA3147641A1 (en) Compositions and methods for modulating apolipoprotein b (apob) gene expression
CN112888461A (zh) 抗凝因子的基因编辑
JP2020528735A (ja) 反復伸長変異のためのゲノム編集システム
EP3690046A2 (en) Composition for treatment of hemophilia, comprising crispr/cas system having coagulation factor viii gene inversion correction potential
JP2023553422A (ja) ウイルスゲノムを切断するための組成物及び方法
JP7539136B2 (ja) ウイルスベクターによるｃａｓ９遺伝子の部位特異的導入方法
US20240336939A1 (en) Crispr induced disruption of mogs gene
EP3901262A1 (en) Compositions for use in treating autosomal dominant best1-related retinopathies

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 20776569

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 20217026772

Country of ref document: KR

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 20776569

Country of ref document: EP

Kind code of ref document: A1