WO2020188570A1 - T cell expressing an fc gamma receptor and methods of use thereof - Google Patents
T cell expressing an fc gamma receptor and methods of use thereof Download PDFInfo
- Publication number
- WO2020188570A1 WO2020188570A1 PCT/IL2020/050327 IL2020050327W WO2020188570A1 WO 2020188570 A1 WO2020188570 A1 WO 2020188570A1 IL 2020050327 W IL2020050327 W IL 2020050327W WO 2020188570 A1 WO2020188570 A1 WO 2020188570A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- cell
- cells
- population
- polypeptide
- domain
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
- C07K14/70503—Immunoglobulin superfamily
- C07K14/70535—Fc-receptors, e.g. CD16, CD32, CD64 (CD2314/705F)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
- A61K39/39533—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals
- A61K39/3955—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals against proteinaceous materials, e.g. enzymes, hormones, lymphokines
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K40/00—Cellular immunotherapy
- A61K40/10—Cellular immunotherapy characterised by the cell type used
- A61K40/11—T-cells, e.g. tumour infiltrating lymphocytes [TIL] or regulatory T [Treg] cells; Lymphokine-activated killer [LAK] cells
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K40/00—Cellular immunotherapy
- A61K40/30—Cellular immunotherapy characterised by the recombinant expression of specific molecules in the cells of the immune system
- A61K40/32—T-cell receptors [TCR]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K40/00—Cellular immunotherapy
- A61K40/40—Cellular immunotherapy characterised by antigens that are targeted or presented by cells of the immune system
- A61K40/41—Vertebrate antigens
- A61K40/42—Cancer antigens
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K40/00—Cellular immunotherapy
- A61K40/40—Cellular immunotherapy characterised by antigens that are targeted or presented by cells of the immune system
- A61K40/41—Vertebrate antigens
- A61K40/42—Cancer antigens
- A61K40/4244—Enzymes
- A61K40/4245—Tyrosinase or tyrosinase related proteinases [TRP-1 or TRP-2]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
- C07K14/70503—Immunoglobulin superfamily
- C07K14/7051—T-cell receptor (TcR)-CD3 complex
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0634—Cells from the blood or the immune system
- C12N5/0636—T lymphocytes
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K2239/00—Indexing codes associated with cellular immunotherapy of group A61K40/00
- A61K2239/31—Indexing codes associated with cellular immunotherapy of group A61K40/00 characterized by the route of administration
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K2239/00—Indexing codes associated with cellular immunotherapy of group A61K40/00
- A61K2239/38—Indexing codes associated with cellular immunotherapy of group A61K40/00 characterised by the dose, timing or administration schedule
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K2239/00—Indexing codes associated with cellular immunotherapy of group A61K40/00
- A61K2239/46—Indexing codes associated with cellular immunotherapy of group A61K40/00 characterised by the cancer treated
- A61K2239/57—Skin; melanoma
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
- C07K2319/03—Fusion polypeptide containing a localisation/targetting motif containing a transmembrane segment
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/50—Cell markers; Cell surface determinants
- C12N2501/599—Cell markers; Cell surface determinants with CD designations not provided for elsewhere
Definitions
- the present invention in some embodiments thereof, relates to a T cell expressing an Fey receptor and methods of use thereof.
- Cancer immunotherapy including cell-based therapy, antibody therapy and cytokine therapy, has emerged in the last couple of years as a promising strategy for treating various types of cancer owing to its potential to evade genetic and cellular mechanisms of drug resistance and to target tumor cells while sparing healthy tissues.
- Antibody-based cancer immunotherapies such as monoclonal antibodies, antibody-fusion proteins, and antibody drug conjugates (ADCs) depend on recognition of cell surface molecules that are differentially expressed on cancer cells relative to non-cancerous cells and/or immune- checkpoint blockade. Binding of an antibody-based immunotherapy to a cancer cell can lead to cancer cell death via various mechanisms, e.g., antibody-dependent cell-mediated cytotoxicity (ADCC), complement-dependent cytotoxicity (CDC), direct cytotoxic activity of the payload from an antibody-drug conjugate (ADC) or suppressive checkpoint blockade. Many of these mechanisms initiate through the binding of the Fc domain of cell-bound antibodies to specialized cell surface receptors (Fc receptors) on hematopoietic cells.
- ADCC antibody-dependent cell-mediated cytotoxicity
- CDC complement-dependent cytotoxicity
- ADC antibody-drug conjugate
- suppressive checkpoint blockade Many of these mechanisms initiate through the binding of the Fc domain of cell-bound antibodies to specialized cell surface
- T cells having a T cell receptor (TCR) specific for an antigen differentially expressed in association with an MHC class I molecule on cancer cells relative to non-cancerous cells were shown to exert anti-tumor effects in several types of cancers, e.g. hematologic malignancies.
- TCR T cell receptor
- antigen-specific effector lymphocytes are very rare, individual-specific, limited in their recognition spectrum and difficult to obtain against most malignancies.
- FcRy Fc receptor common g chain
- the first polypeptide comprises an amino acid sequence of a O ⁇ 3z chain capable of transmitting an activating signal.
- the FcRy is located N-terminally to the O ⁇ 3z chain.
- the second polypeptide comprises an amino acid sequence of a O ⁇ 3z chain capable of transmitting an activating signal.
- the amino acid sequence capable of recruiting the first polypeptide comprises the transmembrane domain of an Fc receptor.
- the amino acid sequence capable of recruiting the first polypeptide comprises the cytoplasmic domain of an Fc receptor.
- the Fc receptor is Fey receptor.
- the Fey receptor is CD64.
- the first polypeptide is less than 25 kDa in molecular weight.
- the first polypeptide does not comprise a target-binding moiety.
- the first polypeptide does not comprise a scFv.
- the second polypeptide does not comprise a scFv.
- the T cell does not express a chimeric antigen receptor (CAR).
- CAR chimeric antigen receptor
- a T cell clone expressing CD64 comprises an extracellular domain, a transmembrane domain and a cytoplasmic domain.
- an isolated population of T cells comprising at least 80 % T cells expressing endogenous CD64, the CD64 comprising an extracellular domain, a transmembrane domain and a cytoplasmic domain.
- a T cell genetically engineered to express CD64 comprising an extracellular domain, a transmembrane domain and a cytoplasmic domain.
- the T cell or the population of T cells being genetically engineered to express a polypeptide comprising an amino acid sequence of an Fc receptor common g chain (FcRy), the amino acid sequence is capable of transmitting an activating signal.
- FcRy Fc receptor common g chain
- the polypeptide further comprises an amino acid sequence of a € ⁇ 3z chain, the amino acid sequence is capable of transmitting an activating signal.
- the T cell or the population of T cells being endogenously expressing a T cell receptor specific for a pathologic cell.
- the T cell or the population of T cells being genetically engineered to express a T cell receptor (TCR).
- TCR T cell receptor
- the T cell or the population of T cells being genetically engineered to express a chimeric antigen receptor (CAR).
- CAR chimeric antigen receptor
- a method of treating a disease associated with a pathologic cell in a subject treated with a therapeutic composition comprising an Fc domain, the therapeutic composition being specific for the pathologic cell comprising administering to the subject a therapeutically effective amount of the T cells or the population of T cells, thereby treating the disease in the subject.
- the T cells or the population of T cells for use in treating a disease associated with a pathologic cell in a subject treated with a therapeutic composition comprising an Fc domain, the therapeutic composition being specific for the pathologic cell.
- a method of treating a disease associated with a pathologic cell in a subject in need thereof comprising administering to the subject a therapeutically effective amount of the T cells or the population of T cells; and a therapeutic composition comprising an Fc domain, the therapeutic composition being specific for the pathologic cell, thereby treating the disease in the subject.
- the T cells or the population of T cells and a therapeutic composition comprising an Fc domain, for use in treating a disease associated with a pathologic cell in a subject in need thereof, wherein the therapeutic composition is specific for the pathologic cell.
- an article of manufacture comprising a packaging material packaging the T cells or the population of T cells and a therapeutic composition comprising an Fc domain.
- the therapeutic composition is specific for a pathologic cell.
- the therapeutic composition is an Fc- fusion protein.
- the therapeutic composition is an antibody.
- the antibody is an IgG.
- the disease is cancer and wherein the pathologic cell is a cancerous cell.
- the cancer is selected from the group consisting of melanoma, adenocarcinoma, mammary carcinoma, colon cancer, ovarian cancer, lung cancer and B-cell lymphoma.
- the cancer is selected from the group consisting of melanoma, adenocarcinoma and mammary carcinoma.
- the antibody is selected from the group consisting of Atezolizumab, Cetuximab, Retuximab, Gatipotuzumab and IVIG.
- the cancerous cell expresses a marker selected from the group consisting of PDL-1, CD19, E-cadherin, MUC1, TRP-1 and TRP-2.
- the cancerous cell expresses PDL-1.
- the antibody is an anti-PDL- 1.
- the antibody is Atezolizumab.
- a method of isolating a T cell comprising isolating a CD64+ T cell from a biological sample of a subject using an agent that binds CD64 polypeptide or a polynucleotide encoding the CD64 polypeptide.
- the method comprising at least one of culturing, cloning, activating and genetically engineering the CD64+ T cell following the isolating.
- the method comprising administering a plurality of the CD64+ T cell to a subject in need thereof.
- the T cell is a CD4+ T cell.
- the T cell is a CD8+ T cell.
- the T cell is a proliferating cell.
- the T cells are autologous to the subject.
- all technical and/or scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention pertains.
- methods and materials similar or equivalent to those described herein can be used in the practice or testing of embodiments of the invention, exemplary methods and/or materials are described below. In case of conflict, the patent specification, including definitions, will control.
- the materials, methods, and examples are illustrative only and are not intended to be necessarily limiting.
- FIGs. 1A-E demonstrate that adoptive transfer of CD4 + T cells along with tumor-binding antibodies induces direct killing of tumor cells.
- Figure 1A is a schematic illustration of the experimental outline.
- PB peripheral blood
- LDN tumor draining lymph node
- n melanoma antigen TRP1
- Figure 1C shows photomicrographs of B 16F10 tumor-bearing WT mice, 14 days following injection of CD4 + T cells obtained from peripheral blood (PB), tumor draining lymph node (DLN) or tumor in combination with anti-TRPl antibodies, as compared to untreated control mice (PBS).
- FIGs. 2A-C demonstrate that a subset of CD4 + T cells in tumor-bearing mice expresses Fey receptors.
- FIGs. 3A-E demonstrate that a subset of CD4 + T cells in lymphoid organs of naive mice expresses Fey receptors.
- Figure 3A is a graph demonstrating the percentages CD4 + T cells from naive mice that express the indicated Fey receptors in various organs.
- Figure 3E shows confocal microscopy images of histological sections of naive mouse spleen stained with the indicated markers.
- FIGs. 4A-D demonstrate that expression of FcyRI and its signaling chain in tumor specific CD4 + T cells induces effective lysis of tumor cells coated with antibodies.
- Figure 4B is a graph demonstrating Biotek HIM fluorescence reads of GFP-labeled B 16 cells cultured overnight with splenic FcyRI + /CD4 + (FcRI) or FcyRI neg /CD4 + [FcRI(neg)] T cells isolated from WT mice, with or without the indicated antibodies. The graph shows results pooled from 3 experiments.
- Figure 4D shows the in-vivo anti tumor effect of splenic CD4 + T cells infected with anti-tumor TCR, FcyRI and FcRy in an adoptive transfer model, with or without an anti-TRPl antibody.
- FIGs. 5A-C demonstrate that expression of FcyRI and its signaling chain in naive C57BL WT CD4 + or CD8 + T cells induces effective lysis of tumor cells coated with antibodies.
- Figure 5 A shows schematic illustrations of the constructs used: a construct encoding FcyRI T2A FcRy (SEQ ID NOs: 21-22), a construct encoding FcyRI T2A FcRy-CD3zeta (SEQ ID NOs: 23-24), a construct encoding FcyRI-CD3zeta T2A FcRy (SEQ ID NOs: 27-28, see Figure 6A), a construct encoding FcyRI-CD3zeta (SEQ ID NOs: 25-26) and a construct encoding and FcyRIa extracellular domain- TCRP constant region (SEQ ID NO: 41-42).
- Figure 5B shows images of B 16 target cells co cultured with CD4 + and CD8 + T cells infected with the constructs shown in Figure 5A.
- the cells where co-cultured in 96 wells plate, with or without an anti-TRPl antibody for 48 hours; and images where taken under X100 magnitude in inverted light microscope.
- Figure 5C is a graph demonstrating flow cytometry analysis of annexin-V/PI staining for apoptotic B 16 cells co cultured with anti-TRPl antibody and CD8 + T cells transduced with the different constructs described above.
- FIGs. 6A-C are schematic illustrations of the designed constructs and the resultant receptors expressed.
- Figure 6A shows schemes of two optional constructs: in the first (left panel) the O ⁇ 3z (zeta) chain is connected to the FcyRIa chain and the Fc receptor y chain (FcRy) is separated by T2A; in the second (right panel), the € ⁇ 3z (zeta) chain is connected to the FcRy signaling chain and both are separated by T2A from FcyRIa chain,
- Figure 6B shows illustrations of the transduced cells and the receptors which are expressed: in the left panel, the € ⁇ 3z chain is fused to FcyRIa,; and in the right panel, the FcyRIa is expressed in parallel to the FcRg-CD3z fusion protein.
- FIG. 6C shows a scheme of the therapeutic procedure. Namely, T cells are isolated from peripheral blood of a tumor-bearing patient and infected with e.g. one of the constructs shown in Figures 6A- B. Following, several millions of transduced T cells are infused back to the patient along with clinically-approved tumor-binding antibodies.
- FIG. 7 shows schematic illustrations of a construct encoding FcyRIa and FcRy as a single polypeptide (SEQ ID NOs: 29-30) and a construct encoding FcyRIa, FcRy and CD3zeta as a single polypeptide (SEQ ID NOs: 31-32).
- FIG. 8 shows confocal microscopy images of cells expressing the FcyRIa-2A-FcRy construct and stained for TCR , FcyRI and GFP. X200 magnitude.
- FIG. 9 is a graph demonstrating the correlation between the number of cells counted by incuCyte imager in a field and the number of B 16-H2B-tdTomato cells cultured in a well of 96 wells plate.
- FIGs. 10A-B demonstrate killing of B 16 target cells by FcyRIa-2A-FcRy infected cells in different ratios.
- Figure 10A shows representative images taken by incuCyte imager following 2 days of co-culturing CD8+ T cells infected with FcyRIa-2A-FcRy and B 16-H2B-tdTomato in different effector : target ratios ranging from 0.5:1 to 16: 1, in the presence of an anti-TRP-1 antibody. xlOO magnitude.
- Figure 10B is a graph demonstrating the number of target cells counted by the incuCyte imager, following 2 days of co-culturing CD4+ or CD8+ T cells infected with FcyRIa-2A-FcRy and B 16-H2B-tdTomato in different effector : target ratios with or without an anti-TRP-1 antibody.
- FIGs. 11A-C demonstrate the superiority of expressing two distinct polypeptides, one comprising the ligand binding domain of FcyRIa and the other comprising FcRy, as compared to a single polypeptide expressing both.
- Figure 11A shows schematic illustrations of a construct encoding a single polypeptide comprising FcyRIa extracellular domain-CD8a hinge and transmembrane domain-FcRy intracellular domain (SEQ ID NOs: 43-44).
- Figure 11B shows representative images of B 16-H2B-tdTomato target cells treated with anti-TRP-1 antibody either alone or in combination with co-culturing with uninfected CD8+ T cells (Sham) or CD8+ T cells infected with the FcyRIa extracellular domain-CD8a hinge and transmembrane domain- FcRy intracellular domain construct. Images were taken with bright light, red and green filters, xlOO magnitude, following 48 hours of co-culture.
- Figure 17C is a graph demonstrating the number of target cells counted by the incuCyte imager, following 48 hours of co-culturing as described in Figure 11B hereinabove.
- the present invention in some embodiments thereof, relates to a T cell expressing an Fey receptor and methods of use thereof.
- Antibody-based cancer immunotherapies depend on recognition of cell surface molecules that are differentially expressed on cancer cells relative to non-cancerous cells and/or immune- checkpoint blockade. Binding of an antibody-based immunotherapy to a cancer cell can lead to cancer cell death via various mechanisms, many of them initiate through the binding of the Fc domain of cell-bound antibodies to specialized cell surface receptors (Fc receptors) on hematopoietic cells.
- Fc receptors cell surface receptors
- T cells having a T cell receptor (TCR) specific for an antigen differentially expressed in association with an MHC class I molecule on cancer cells relative to non-cancerous cells were shown to exert anti-tumor effects in several types of cancers, e.g. hematologic malignancies.
- TCR T cell receptor
- CD4 + T which express the high affinity Fey receptor FcyRI (CD64).
- FcyRI + CD4 + T cells were able to bind tumor cells coated with anti-tumor antibodies and secrete lytic granules resulting in a remarkable tumor lysis (Example 1, Figures 1A-4B).
- the present inventors were able to recapitulate the cytotoxic capacities of this unique CD4 + T cell population in conventional CD4 + and CD8 + T cells by exogenously expressing an FcyRI polypeptide and an Fey chain polypeptide (Examples 2-3, Figures 4C-11C). Indeed, these engineered T cells exerted remarkable killing capabilities of tumors in combination with anti-tumor antibodies.
- T cells genetically engineered to express two distinct polypeptides, one comprising a ligand binding domain of an Fey receptor and the other comprising an Fc receptor common y chain; and methods of using these T cells to treat diseases associated with pathologic cells (e.g. cancer).
- pathologic cells e.g. cancer
- FcRy Fc receptor common g chain
- T cell refers to a differentiated lymphocyte with a CD3+, T cell receptor (TCR)+ having either CD4+ or CD8+ phenotype.
- the T cell is an effector cell.
- effector T cell refers to a T cell that activates or directs other immune cells e.g. by producing cytokines or has a cytotoxic activity e.g., CD4+, Thl/Th2, CD8+ cytotoxic T lymphocyte.
- the T cell is a CD4+ T cell.
- the T cell is a CD8+ T cell.
- the T cell is a naive T cell.
- the T cell is a memory T cell.
- memory T cells include effector memory CD4+ T cells with a CD3+/CD4+/CD45RA-/CCR7- phenotype, central memory CD4+ T cells with a CD3+/CD4+/CD45RA-/CCR7+ phenotype, effector memory CD8+ T cells with a CD3+/CD8+ CD45RA-/CCR7 -phenotype and central memory CD8+ T cells with a CD3+/CD8+ CD45RA-/CCR7+ phenotype.
- the T cell is a proliferating cell.
- proliferating cell refers to a T cell that proliferated upon stimulation as defined by a cell proliferation assay, such as, but not limited to, CFSE staining, MTS, Alamar blue, BRDU, thymidine incorporation, and the like.
- the T cell is a proliferating CD4+ T cell.
- the T cell is a proliferating CD8+ T cell.
- the T cell is a human T cell.
- T cells from a subject are well known in the art, such as drawing whole blood from a subject and collection in a container containing an anti-coagulant (e.g. heparin or citrate); and apheresis followed by a purification process.
- an anti-coagulant e.g. heparin or citrate
- purification process There are several methods and reagents known to those skilled in the art for purifying T cells from whole blood such as leukapheresis, sedimentation, density gradient centrifugation (e.g. ficoll), centrifugal elutriation, fractionation, chemical lysis of e.g. red blood cells (e.g. by ACK), selection using cell surface markers (using e.g. FACS sorter or magnetic cell separation techniques such as are commercially available e.g.
- the T cell is obtained from a healthy subject.
- the T cell is obtained from a subject suffering from a pathology (e.g. cancer).
- a pathology e.g. cancer
- the T cell is expressing a T cell receptor specific for a pathologic (diseased, e.g. cancerous) cell, i.e. recognizes an antigen presented in the context of MHC which is overexpressed or solely expressed by a pathologic cell as compared to a non- pathologic cell.
- a pathologic diseased, e.g. cancerous
- the antigen is a cancer antigen, i.e. an antigen overexpressed or solely expressed by a cancerous cell as compared to a non-cancerous cell.
- a cancer antigen may be a known cancer antigen or a new specific antigen that develops in a cancer cell (i.e. neoantigens).
- Non-limiting examples for known cancer antigens include MAGE-AI, MAGE-A2, MAGE- A3, MAGE-A4, MAGE-AS, MAGE-A6, MAGE-A7, MAGE-AS, MAGE-A9, MAGE- AIO, MAGE-A11, MAGE-A12, GAGE-I, GAGE-2, GAGE-3, GAGE-4, GAGE-5, GAGE-6, GAGE-7, GAGE-8, B AGE-1, RAGE- 1, LB33/MUM-1, PRAME, NAG, MAGE-Xp2 (MAGE- B2), MAGE-Xp3 (MAGE-B3), MAGE-Xp4 (MAGE-B4), MAGE- C1/CT7, MAGE-C2, NY- ESO-1, LAGE-1, SSX-1, SSX-2(HOM-MEL-40), SSX-3, SSX-4, SSX-5, SCP-1 and XAGE, melanocyte differentiation antigens, p53, ras, CEA,
- -fetoprotein 13HCG, BCA225, BTAA, CA 125, CA 15-3 (CA 27.29 ⁇ BCAA), CA 195, CA 242, CA-50, CAM43, CD68 ⁇ KP1, CO-029, FGF-5, 0250, Ga733 (EpCAM), HTgp-175, M344, MA-50, MG7- Ag, MOV18, NBM70K, NYCO-I, RCASI, SDCCAG16, TA-90 (Mac-2 binding protehAcyclophilin C-associated protein), TAAL6, TAG72, TLP, TPS, tyrosinase related proteins, TRP-1, or TRP-2.
- the T cell is endogenously expressing a T cell receptor specific for a pathologic cell (e.g. cancerous cell).
- a pathologic cell e.g. cancerous cell
- the T cell is an engineered T cells transduced with a T cell receptor (TCR).
- TCR T cell receptor
- the phrase "transduced with a TCR” or“genetically engineered to express a TCR” refers to cloning of variable a- and //-chains from T cells with specificity against a desired antigen presented in the context of MHC.
- Methods of transducing with a TCR are known in the art and are disclosed e.g. in Nicholson et al. Adv Hematol. 2012; 2012:404081; Wang and Riviere Cancer Gene Ther. 2015 Mar;22(2):85-94); and Lamers et al, Cancer Gene Therapy (2002) 9, 613— 623.
- the TCR is specific for a pathologic cell.
- the T cell is an engineered T cells transduced with a chimeric antigen receptor (CAR).
- CAR chimeric antigen receptor
- the phrase "transduced with a CAR” or“genetically engineered to express a CAR” refers to cloning of a nucleic acid sequence encoding a chimeric antigen receptor (CAR), wherein the CAR comprises an antigen recognition moiety and a T-cell activation moiety.
- a chimeric antigen receptor (CAR) is an artificially constructed hybrid protein or polypeptide containing an antigen binding domain of an antibody (e.g., a single chain variable fragment (scFv)) linked to T-cell signaling or T-cell activation domains.
- scFv single chain variable fragment
- the antigen recognition moiety is specific for a pathologic cell.
- the T cell is not transduced (i.e. does not express) a CAR.
- the T cell of some embodiments of the invention is genetically engineered to express a first polypeptide comprising an amino acid sequence of an Fc receptor common g chain (FcRy) which is capable of transmitting an activating signal.
- FcRy Fc receptor common g chain
- Fc receptor common g chain refers to the polypeptide expression product of the FCER1G gene (Gene ID 2207).
- FcRy is human FcRy.
- the FcRy protein refers to the human protein, such as provided in the following GenBank Number NP_004097.
- the polypeptide of some embodiments of the invention comprises a full length FcRy polypeptide.
- the polypeptide of some embodiments of the invention comprises a functional fragment of FcRy polypeptide.
- the phrase“functional fragment of FcRy polypeptide” refers to a portion of the polypeptide which comprises a transmembrane domain and an intracellular domain and maintains at least the capability of transmitting an activating signal in a cell expressing an Fey receptor upon binding of the Fey receptor to a Fc ligand.
- the functional fragment of FcRy polypeptide is capable of forming a homodimer.
- the functional fragment of the FcRy polypeptide comprises an IT AM motif.
- activating refers to the process of stimulating a T cell that results in cellular proliferation, maturation, cytokine production and/or induction of effector functions.
- Methods of determining signaling of an activating signal include, but are not limited to, enzymatic activity assays such as kinase activity assays, and expression of molecules involved in the signaling cascade using e.g. PCR, Western blot, immunoprecipitation and immunohistochemistry. Additionally or alternatively, determining transmission of an activating signal can be effected by evaluating T cell activation or function.
- Methods of evaluating T cell activation or function include, but are not limited to, proliferation assays such as CFSE staining, MTT, Alamar blue, BRDU and thymidine incorporation, cytotoxicity assays such as CFSE staining, chromium release, Calcin AM, cytokine secretion assays such as intracellular cytokine staining, ELISPOT and ELISA, expression of activation markers such as CD25, CD69, CD137, CD107a, PD1, and CD62L using flow cytometry.
- proliferation assays such as CFSE staining, MTT, Alamar blue, BRDU and thymidine incorporation
- cytotoxicity assays such as CFSE staining, chromium release, Calcin AM
- cytokine secretion assays such as intracellular cytokine staining, ELISPOT and ELISA
- expression of activation markers such as CD25, CD69, CD137, CD
- polypeptide of some embodiments of the invention comprises an FcRy polypeptide amino acid sequence comprising SEQ ID NO: 13.
- the polypeptide of some embodiments of the invention comprises an FcRy polypeptide amino acid sequence consisting of SEQ ID NO: 13.
- polypeptide of some embodiments of the invention comprises an amino acid sequence as set forth in SEQ ID NO: 15.
- the polypeptide of some embodiments of the invention comprises an FcRy polypeptide amino acid sequence consisting of SEQ ID NO: 15.
- FcRy also encompasses functional homologues (naturally occurring or synthetically/recombinantly produced), which exhibit the desired activity as defined hereinabove (i.e., capability of transmitting an activating signal, forming a homodimer).
- Such homologues can be, for example, at least 70 %, at least 75 %, at least 80 %, at least 81 %, at least 82 %, at least 83 %, at least 84 %, at least 85 %, at least 86 %, at least 87 %, at least 88 %, at least 89 %, at least 90 %, at least 91 %, at least 92 %, at least 93 %, at least 94 %, at least 95 %, at least 96 %, at least 97 %, at least 98 %, at least 99 % or 100 % identical or homologous to the polypeptide SEQ ID Nos: 13 or 15; or at least 70 %, at least 75 %, at least 80 %, at least 81 %, at least 82 %, at least 83 %, at least 84 %, at least 85 %, at least 86 %, at least 87 %, at least 88 %,
- Sequence identity or homology can be determined using any protein or nucleic acid sequence alignment algorithm such as Blast, ClustalW, and MUSCLE.
- the homolog may also refer to an ortholog, a deletion, insertion, or substitution variant, including an amino acid substitution, as further described hereinbelow.
- the FcRy polypeptide may comprise conservative and non-conservative amino acid substitutions.
- the polypeptide comprising an amino acid sequence of an FcRy is less than 100 kDa, less than 50 kDa, less than 25 kDa or less than 20 kDa in molecular weight, each possibility represents a separate embodiment of the present invention.
- the polypeptide comprising an amino acid sequence of an FcRy is less than 25 kDa in molecular weight. According to specific embodiments, the polypeptide comprising an amino acid sequence of an FcRy does not comprise a target-binding moiety.
- the“target binding moiety” is an antigen binding moiety such as an antibody e.g. single chain antibody (e.g., scFv).
- the polypeptide comprising an amino acid sequence of an FcRy does not comprise a scFv.
- the T cell of some embodiments of the invention is genetically engineered to express a second polypeptide comprising an extracellular ligand-binding domain of an Fey receptor capable of binding an Fc ligand and an amino acid sequence capable of recruiting the first polypeptide (which comprises an amino acid sequence of an FcRy).
- extracellular ligand-binding domain of Fey receptor refers to at least a fragment of an Fey receptor which comprises an extracellular domain capable of binding an Fc ligand.
- the term“Fc ligand” refers to an Fc domain such as of an antibody. According to specific embodiments, the Fc ligand is an IgG Fc domain.
- Assays for testing binding are well known in the art and include, but not limited to flow cytometry, BiaCore, bio-layer interferometry Blitz® assay, HPLC, surface plasmon resonance.
- the extracellular ligand-binding domain of Fey receptor binds the Fc ligand with a Kd >10 6 M, >10 7 M, >10 8 M or >10 9 M, each possibility represents a separate embodiment of the present invention.
- the extracellular ligand-binding domain of Fey receptor binds the Fc ligand with a Kd >10 9 M.
- Fey receptor refers to a cell surface receptor which exhibits binding specificity to the Fc domain of an IgG antibody.
- Fey receptors include, without limitation, CD64A, CD64B, CD64C, CD32A, CD32B, CD16A, and CD16B.
- the term “Fey receptor” also encompasses functional homologues (naturally occurring or synthetically/recombinantly produced) and/or Fc receptors comprising conservative and non conservative amino acid substitutions, which exhibit the desired activity (i.e., capability of binding an IgG Fc binding domain).
- the Fey receptor is CD64.
- CD64 also known as FcyRI
- FcyRI refers to the polypeptide expression product of the FCGR1A, FCGR1B or FCGR1C gene (Gene ID 2209, 2210, 2211, respectively), and includes CD64A, CD64B and CD64C.
- Full length CD64 comprises an extracellular, transmembrane and an intracellular domain and is capable of at least binding an IgG (IgGl and IgG3) Fc domain and recruiting an FcRy. Methods of determining binding and recruitment of an FcRy are well known in the art and are also described hereinabove and below.
- CD64 is human CD64.
- the CD64 protein refers to the human CD64A protein, such as provided in the following UniProt Number P12314.
- the CD64 protein refers to the human CD64B protein, such as provided in the following UniProt Number Q92637.
- the CD64 protein refers to the human CD64C protein, such as provided in the following GenBank Number XM_001133198.
- CD64 amino acid sequence comprises SEQ ID NO: 5.
- CD64 comprises a functional fragment of a CD64 polypeptide.
- the phrase“functional fragment of a CD64 polypeptide” refers to a portion of the polypeptide which maintains at least the capability of binding an IgG (IgGl and IgG3) Fc domain and/or recruiting an FcRy, as further described hereinbelow.
- CD64 also encompasses functional homologues (naturally occurring or synthetically/recombinantly produced), which exhibit the desired activity ( . ⁇ ?., binding an IgG (IgGl and IgG3) Fc domain and/or recruiting an FcRy,).
- Such homologues can be, for example, at least 70 %, at least 75 %, at least 80 %, at least 81 %, at least 82 %, at least 83 %, at least 84 %, at least 85 %, at least 86 %, at least 87 %, at least 88 %, at least 89 %, at least 90 %, at least 91 %, at least 92 %, at least 93 %, at least 94 %, at least 95 %, at least 96 %, at least 97 %, at least 98 %, at least 99 % or 100 % identical or homologous to the polypeptide SEQ ID No: 5; or at least 70
- the CD64 polypeptide may comprise conservative and non-conservative amino acid substitutions.
- polypeptide of some embodiments of the invention comprises an extracellular ligand-binding domain of CD64.
- polypeptide comprises an extracellular ligand binding domain of CD64 comprising SEQ ID NO: 7.
- the polypeptide comprises an extracellular ligand binding domain of CD64 consisting of SEQ ID NO: 7.
- the second polypeptide of some embodiments of the invention comprises an amino acid sequence capable of recruiting the first polypeptide (i.e. which comprises an amino acid sequence of an FcRy), such that upon binding of an Fc ligand to the extracellular ligand-binding domain of the Fey receptor an activating signal is transmitted by the first polypeptide.
- the amino acid sequence capable of recruiting the first polypeptide directly recruits the first polypeptide (i.e. without an intermediate polypeptide).
- Such amino acid sequences are well known to the skilled in the art and include for example the transmembrane and/or the cytoplasmic domains of several Fc receptors such as, but not limited to CD64, CD16A, CD16B, FceRip, FcaRI (CD89).
- the amino acid sequence capable of recruiting the first polypeptide is not of an Fee receptor (FceR).
- Methods of determining recruitment of the first polypeptide are well known in the art, and include, but are not limited to, enzymatic activity assays such as kinase activity assays, and expression of molecules involved in the signaling cascade using e.g. PCR, Western blot, immunoprecipitation and immunohistochemistry. Additionally or alternatively, determining recruitment of the first polypeptide can be effected by evaluating cell activation or function by methods well known in the art such as, but not limited to proliferation assays such as CFSE staining, MTT, Alamar blue, BRDU and thymidine incorporation, cytotoxicity assays such as CFSE staining, chromium release, Calcin AM, and the like.
- proliferation assays such as CFSE staining, MTT, Alamar blue, BRDU and thymidine incorporation
- cytotoxicity assays such as CFSE staining, chromium release, Calcin AM, and the like.
- the amino acid sequence capable of recruiting the first polypeptide comprises the transmembrane domain of an Fc receptor.
- the amino acid sequence capable of recruiting the first polypeptide comprises the cytoplasmic domain of an Fc receptor.
- the amino acid sequence capable of recruiting the first polypeptide comprises the transmembrane domain of an Fey receptor. According to specific embodiments, the amino acid sequence capable of recruiting the first polypeptide comprises the cytoplasmic domain of an Fey receptor.
- the amino acid sequence capable of recruiting the first polypeptide comprises an amino acid sequence of CD64 capable of recruiting said first polypeptide.
- the amino acid sequence capable of recruiting the first polypeptide comprises the transmembrane domain of CD64.
- the amino acid sequence capable of recruiting the first polypeptide consists of the transmembrane domain of CD64.
- the amino acid sequence capable of recruiting the first polypeptide comprises SEQ ID NO: 9.
- the amino acid sequence capable of recruiting the first polypeptide consists of SEQ ID NO: 9.
- the amino acid sequence capable of recruiting the first polypeptide comprises the intracellular domain of CD64.
- the amino acid sequence capable of recruiting the first polypeptide comprises SEQ ID NO: 11.
- the amino acid sequence capable of recruiting the first polypeptide comprises the transmembrane domain and the intracellular domain of CD64.
- the amino acid sequence capable of recruiting the first polypeptide comprises SEQ ID NO: 33.
- the amino acid sequence capable of recruiting the first polypeptide consists of SEQ ID NO: 33.
- both the extracellular ligand -binding domain and the amino acid sequence capable of recruiting the first polypeptide, in the second polypeptide are of CD64.
- the second polypeptide comprises the extracellular domain and the transmembrane domain of CD64.
- the second polypeptide comprises SEQ ID NO: 34.
- the second polypeptide comprises an extracellular domain, a transmembrane domain and a cytoplasmic domain of CD64.
- the second polypeptide comprises SEQ ID NO: 5.
- the second polypeptide comprises an amino acid sequence of an extracellular ligand-binding domain of CD64 and an amino acid sequence capable of recruiting the first polypeptide consisting of SEQ ID NO: 5.
- the second polypeptide consists of SEQ ID NO: 5.
- the second polypeptide does not comprise an antibody.
- the second polypeptide does not comprise a scFv.
- any of the first and second polypeptides comprises an amino acid sequence of a O ⁇ 3z chain capable of transmitting an activating signal.
- the first polypeptide comprises an amino acid sequence of a O ⁇ 3z chain.
- the FcRy is located N-terminally to the O ⁇ 3z chain.
- the second polypeptide comprises an amino acid sequence of a O ⁇ 3z chain.
- the O ⁇ 3z chain is located C-terminally to the amino acid sequence capable of recruiting the first polypeptide.
- O ⁇ 3z chain also known as TCR ⁇ or CD247 refers to the polypeptide expression product of the CD247 gene (Gene ID 919).
- O ⁇ 3z chain is human O ⁇ 3z chain.
- the O ⁇ 3z chain protein refers to the human protein, such as provided in the following GenBank Numbers NP_000725 and/or NP_932170.
- the polypeptide of some embodiments of the invention comprises a full length O ⁇ 3z chain polypeptide.
- the polypeptide of some embodiments of the invention comprises a functional fragment of O ⁇ 3z chain polypeptide.
- the phrase“functional fragment of a CD3z” refers to a portion of the polypeptide which comprises at least an intracellular domain and maintains at least the capability of transmitting an activating signal in a T cell.
- an amino acid sequence comprises an IT AM motif.
- the amino acid sequence of a O ⁇ 3z chain comprises SEQ ID NO: 17.
- the amino acid sequence of a O ⁇ 3z chain consists of SEQ ID NO: 17.
- the amino acid sequence of a € ⁇ 3z chain comprises SEQ ID NO: 19.
- the amino acid sequence of a O ⁇ 3z chain consists of SEQ ID NO: 19.
- the term“O ⁇ 3z chain” also encompasses functional homologues (naturally occurring or synthetically/recombinantly produced), which exhibit the desired activity (7. e. , capability of transmitting an activating signal).
- Such homologues can be, for example, at least 70 %, at least 75 %, at least 80 %, at least 81 %, at least 82 %, at least 83 %, at least 84 %, at least 85 %, at least
- the O ⁇ 3z chain polypeptide may comprise conservative and non-conservative amino acid substitutions.
- any of the polypeptides disclosed herein can comprise a co-stimulatory signaling domain.
- polypeptides disclosed herein do not comprise a co-stimulatory signaling domain.
- any of the first and second polypeptides comprises a co-stimulatory signaling domain.
- the first polypeptide does not comprise a co stimulatory signaling domain.
- the second polypeptide does not comprise a co stimulatory signaling domain.
- co- stimulatory signaling domain refers to an amino acid sequence of a co-stimulatory molecule capable of transmitting a secondary stimulatory signal resulting in activation of the T cell.
- a co-stimulatory signaling domain does not comprise an IT AM domain.
- Any known co- stimulatory signaling domain can be used with specific embodiments of the present invention.
- Non-limiting examples of co- stimulatory signaling domains include 4-1BB, CD28, 0X40, ICOS, CD27, GITR, HVEM, TIM1, LFAl(CDl la), CD2.
- the co-stimulatory signaling domain is of 4- IBB and/or 0X40.
- Non-limiting examples of specific sequences of co-stimulatory signaling domains are provided in SEQ ID Nos: 45-46 (0X40), SEQ ID NO: 47-48 (4-1BB).
- any of the polypeptides disclosed herein can comprise a cytokine receptor signaling domain.
- polypeptides disclosed herein do not comprise a cytokine receptor signaling domain.
- any of the first and second polypeptides comprises a cytokine receptor signaling domain.
- the first polypeptide does not comprise a cytokine receptor signaling domain.
- the second polypeptide does not comprise a cytokine receptor signaling domain.
- cytokine receptor signaling domain refers to an amino acid sequence of a cytokine receptor capable of transmitting a stimulatory signal resulting in activation of the T cell.
- cytokine receptor signaling domains include IL2rg that is the IL2 receptor common gamma chain (e.g. such as provided e.g. in SEQ ID NOs: 63-64), the Toll/ILl receptor homology domain (TIR) that is the signaling domain of the myd88 receptor, TNF receptor intracellular domain (e.g. such as provided in SEQ ID NOs: 49-50), IL12- Rbl intracellular domain (e.g. such as provided in SEQ ID NOs: 51-52), IL12-Rbl intracellular domain (e.g.
- IL23 receptor intracellular domain e.g. such as provided in SEQ ID NOs: 55-56
- IFNy receptor 1 intracellular domain e.g. such as provided in SEQ ID NOs: 57-58
- IFNy receptor 2 intracellular domain e.g. such as provided in SEQ ID NOs: 59-60
- IL2Rb intracellular domain e.g. such as provided in SEQ ID NOs: 61-62
- IL1 receptor intracellular domain e.g. such as provided in SEQ ID NOs: 65-66
- ILlAcP receptor intracellular domain e.g. such as provided in SEQ ID NOs: 67-68.
- the second polypeptide does not comprise a linker between the extracellular ligand-binding domain of the Fc receptor and the amino acid sequence capable of recruiting the first polypeptide.
- the second polypeptide comprises a linker between the extracellular ligand-binding domain of an Fc receptor and the amino acid sequence capable of recruiting the first polypeptide.
- the linker may be derived from naturally-occurring multi-domain proteins or is an empirical linker as described, for example, in Chichili et ah, (2013), Protein Sci. 22(2): 153-167, Chen et al, (2013), Adv Drug Deliv Rev. 65(10): 1357-1369, the entire contents of which are hereby incorporated by reference.
- the linker may be designed using linker designing databases and computer programs such as those described in Chen et al., (2013), Adv Drug Deliv Rev. 65(10): 1357-1369 and Crasto et al., (2000), Protein Eng. 13(5):309-312, the entire contents of which are hereby incorporated by reference.
- the linker is a synthetic linker.
- the linker is a polypeptide.
- an isolated population of T cells comprising at least 80 % T cells expressing endogenous CD64, said CD64 comprising an extracellular domain, a transmembrane domain and a cytoplasmic domain.
- the isolated population of T cells comprises at least 81 %, at least 82 %, at least 83 %, at least 84 %, at least 85 %, at least 86 %, at least 87 %, at least 88 %, at least 89 %, at least 90 %, at least 91 %, at least 92 %, at least 93 %, at least 94 %, at least 95 %, at least 96 %, at least 97 %, at least 98 %, at least 99 % T cells expressing the endogenous CD64.
- a method of isolating a T cell comprising isolating a CD64+ T cell from a biological sample of a subject using an agent that binds a CD64 polypeptide or a polynucleotide encoding said CD64 polypeptide.
- the CD64+ T cells can be obtained from any biological sample, such as peripheral blood, bone marrow, tissues such as spleen, lymph node, thymus, or tumor tissue. Selection of the biological sample would be evident to one of skill in the art.
- the biological sample is a peripheral blood sample.
- the biological sample is contacted with an agent that binds a CD64 polypeptide (e.g. an antibody) or a polynucleotide encoding said CD64 polypeptide (e.g. e.g. oligonucleotide probe or primer) and the cells are further selected using e.g. FACS sorter or magnetic cell separation techniques.
- an agent that binds a CD64 polypeptide e.g. an antibody
- a polynucleotide encoding said CD64 polypeptide e.g. e.g. oligonucleotide probe or primer
- the agent is an anti-CD64 antibody.
- the cells are cultured, cloned, activated and/or genetically engineered.
- a plurality of the cells is administered to a subject in need thereof.
- a T cell clone expressing CD64 comprises an extracellular domain, a transmembrane domain and a cytoplasmic domain.
- a T cell genetically engineered to express CD64 comprising an extracellular domain, a transmembrane domain and a cytoplasmic domain.
- the T cell is genetically engineered to express full length CD64.
- the T cell is genetically engineered to express a functional fragment of CD64.
- the T cell is genetically engineered to express a functional homolog of CD64.
- the T cell expressing CD64 either endogenously or exogenously, can be genetically engineered to express a polypeptide of interest.
- the T cell expressing CD64 is genetically engineered to express a polypeptide comprising an amino acid sequence of an FcRy capable of transmitting an activating signal.
- the polypeptide comprising an amino acid sequence of FcRy further comprises an amino acid sequence of a € ⁇ 3z chain capable of transmitting an activating signal.
- a polynucleotide sequence encoding the polypeptide is preferably ligated into a nucleic acid construct suitable for T cell expression.
- a nucleic acid construct includes a promoter sequence for directing transcription of the polynucleotide sequence in the cell in a constitutive or inducible manner.
- the nucleic acid construct (also referred to herein as an "expression vector") of some embodiments of the invention includes additional sequences which render this vector suitable for replication and integration (e.g., shuttle vectors).
- a typical cloning vectors may also contain a transcription and translation initiation sequence, transcription and translation terminator and a polyadenylation signal.
- such constructs will typically include a 5' LTR, a tRNA binding site, a packaging signal, an origin of second-strand DNA synthesis, and a 3' LTR or a portion thereof.
- the nucleic acid construct of some embodiments of the invention typically includes or encodes a signal sequence for targeting the polypeptide to the cell surface.
- the signal sequence for this purpose is a mammalian signal sequence or the signal sequence of the polypeptide variants of some embodiments of the invention.
- Eukaryotic promoters typically contain two types of recognition sequences, the TATA box and upstream promoter elements.
- the TATA box located 25-30 base pairs upstream of the transcription initiation site, is thought to be involved in directing RNA polymerase to begin RNA synthesis.
- the other upstream promoter elements determine the rate at which transcription is initiated.
- the promoter utilized by the nucleic acid construct of some embodiments of the invention is active in the specific cell population transformed, i.e. T cells.
- T cell specific promoters include lymphoid specific promoters [Calame et ah, (1988) Adv. Immunol. 43:235-275]; in particular promoters of T-cell receptors [Winoto et ah, (1989) EMBO J. 8:729- 733]
- Enhancer elements can stimulate transcription up to 1,000 fold from linked homologous or heterologous promoters. Enhancers are active when placed downstream or upstream from the transcription initiation site. Many enhancer elements derived from viruses have a broad host range and are active in a variety of tissues.
- the SV40 early gene enhancer is suitable for many cell types.
- Other enhancer/promoter combinations that are suitable for some embodiments of the invention include those derived from polyoma vims, human or murine cytomegalovirus (CMV), the long term repeat from various retroviruses such as murine leukemia vims, murine or Rous sarcoma vims and HIV. See, Enhancers and Eukaryotic Expression, Cold Spring Harbor Press, Cold Spring Harbor, N.Y. 1983, which is incorporated herein by reference.
- CMV cytomegalovirus
- the promoter is preferably positioned approximately the same distance from the heterologous transcription start site as it is from the transcription start site in its natural setting. As is known in the art, however, some variation in this distance can be accommodated without loss of promoter function.
- Polyadenylation sequences can also be added to the expression vector in order to increase the efficiency of mRNA translation.
- Two distinct sequence elements are required for accurate and efficient polyadenylation: GU or U rich sequences located downstream from the polyadenylation site and a highly conserved sequence of six nucleotides, AAUAAA, located 11-30 nucleotides upstream.
- Termination and polyadenylation signals that are suitable for some embodiments of the invention include those derived from SV40.
- the expression vector of some embodiments of the invention may typically contain other specialized elements intended to increase the level of expression of cloned nucleic acids or to facilitate the identification of cells that carry the recombinant DNA.
- a number of animal viruses contain DNA sequences that promote the extra chromosomal replication of the viral genome in permissive cell types. Plasmids bearing these viral replicons are replicated episomally as long as the appropriate factors are provided by genes either carried on the plasmid or with the genome of the host cell.
- the vector may or may not include a eukaryotic replicon. If a eukaryotic replicon is present, then the vector is amplifiable in eukaryotic cells using the appropriate selectable marker. If the vector does not comprise a eukaryotic replicon, no episomal amplification is possible. Instead, the recombinant DNA integrates into the genome of the engineered cell, where the promoter directs expression of the desired nucleic acid.
- the expression vector of some embodiments of the invention can further include additional polynucleotide sequences that allow, for example, the translation of several proteins from a single mRNA such as an internal ribosome entry site (IRES) or a self-cleavable peptide; and sequences for genomic integration of the promoter-chimeric polypeptide.
- IRS internal ribosome entry site
- a self-cleavable peptide sequences for genomic integration of the promoter-chimeric polypeptide.
- the first and second polypeptides described herein are expressed from distinct constructs.
- the first and second polypeptides described herein are expressed from a single construct in a bicistronic manner.
- Such an expression can be achieved by method well known in the art such as, but not limited to, using internal ribosome entry site (IRES) sequence and/or a nucleic acid sequence encoding a self-cleavable peptide e.g. a 2A peptide (e.g. P2A, T2A, E2A).
- IRS internal ribosome entry site
- the individual elements comprised in the expression vector can be arranged in a variety of configurations.
- enhancer elements, promoters and the like, and even the polynucleotide sequence(s) encoding the polypeptide can be arranged in a "head- to-tail" configuration, may be present as an inverted complement, or in a complementary configuration, as an anti-parallel strand. While such variety of configuration is more likely to occur with non-coding elements of the expression vector, alternative configurations of the coding sequence within the expression vector are also envisioned.
- mammalian expression vectors include, but are not limited to, pcDNA3, pcDNA3.1(+/-), pGL3, pZeoSV2(+/-), pSecTag2, pDisplay, pEF/myc/cyto, pCMV/myc/cyto, pCR3.1, pSinRep5, DH26S, DHBB, pNMTl, pNMT41, pNMT81, which are available from Invitrogen, pCI which is available from Promega, pMbac, pPbac, pBK-RSV and pBK-CMV which are available from Strategene, pTRES which is available from Clontech, and their derivatives.
- Expression vectors containing regulatory elements from eukaryotic viruses such as retroviruses can be also used.
- SV40 vectors include pSVT7 and pMT2.
- Vectors derived from bovine papilloma virus include pBV-lMTHA, and vectors derived from Epstein Bar virus include pHEBO, and p205.
- exemplary vectors include pMSG, pAV009/A + , pMTO10/A + , pMAMneo-5, baculovirus pDSVE, and any other vector allowing expression of proteins under the direction of the SV-40 early promoter, SV-40 later promoter, metallothionein promoter, murine mammary tumor virus promoter, Rous sarcoma virus promoter, polyhedrin promoter, or other promoters shown effective for expression in eukaryotic cells.
- viruses are very specialized infectious agents that have evolved, in many cases, to elude host defense mechanisms. Typically, viruses infect and propagate in specific cell types.
- the targeting specificity of viral vectors utilizes its natural specificity to specifically target predetermined cell types and thereby introduce a recombinant gene into the infected cell.
- the ability to select suitable vectors for transforming T cells is well within the capabilities of the ordinary skilled artisan and as such no general description of selection consideration is provided herein.
- Recombinant viral vectors are useful for in vivo expression of the polypeptides since they offer advantages such as lateral infection and targeting specificity.
- Lateral infection is inherent in the life cycle of, for example, retrovirus and is the process by which a single infected cell produces many progeny virions that bud off and infect neighboring cells. The result is that a large area becomes rapidly infected, most of which was not initially infected by the original viral particles. This is in contrast to vertical-type of infection in which the infectious agent spreads only through daughter progeny.
- Viral vectors can also be produced that are unable to spread laterally. This characteristic can be useful if the desired purpose is to introduce a specified gene into only a localized number of targeted cells.
- nucleic acids by viral infection offers several advantages over other methods such as lipofection and electroporation, since higher transfection efficiency can be obtained due to the infectious nature of viruses.
- nucleic acid transfer techniques include transfection with viral or non- viral constructs, such as adenovirus, lentivirus, Herpes simplex I virus, or adeno-associated virus (AAV) and lipid-based systems.
- viral or non- viral constructs such as adenovirus, lentivirus, Herpes simplex I virus, or adeno-associated virus (AAV) and lipid-based systems.
- Useful lipids for lipid-mediated transfer of the gene are, for example, DOTMA, DOPE, and DC-Chol [Tonkinson et al., Cancer Investigation, 14(1): 54-65 (1996)].
- the most preferred constructs for use in gene therapy are viruses, most preferably adenoviruses, AAV, lentiviruses, or retroviruses.
- a viral construct such as a retroviral construct includes at least one transcriptional promoter/enhancer or locus -defining element(s), or other elements that control gene expression by other means such as alternate splicing, nuclear RNA export, or post-translational modification of messenger.
- Such vector constructs also include a packaging signal, long terminal repeats (LTRs) or portions thereof, and positive and negative strand primer binding sites appropriate to the virus used, unless it is already present in the viral construct.
- LTRs long terminal repeats
- such a construct typically includes a signal sequence for targeting the polypeptide to the desired site in a cell.
- the construct may also include a signal that directs polyadenylation, as well as one or more restriction sites and a translation termination sequence.
- such constructs will typically include a 5' LTR, a tRNA binding site, a packaging signal, an origin of second-strand DNA synthesis, and a 3' LTR or a portion thereof.
- Other vectors can be used that are non-viral, such as cationic lipids, polylysine, and dendrimers.
- the T cells can be freshly isolated, stored e.g., cryopreserved (i.e. frozen) at e.g. liquid nitrogen temperature at any stage for long periods of time (e.g., months, years) for future use; and cell lines.
- cryopreserved i.e. frozen
- liquid nitrogen temperature e.g. liquid nitrogen temperature at any stage for long periods of time (e.g., months, years) for future use; and cell lines.
- the T cells can be stored in a cell bank or a depository or storage facility.
- the present teachings further suggest the use of the T cells and the methods disclosed herein as, but not limited to, a source for adoptive T cells therapies for diseases that can benefit from activating immune cells against pathologic cells e.g. a hyper-proliferative disease; a disease associated with immune suppression and infections.
- pathologic cells e.g. a hyper-proliferative disease; a disease associated with immune suppression and infections.
- the T cells disclosed herein are for use in adoptive T cell therapy.
- the T cells used according to specific embodiments of the present invention may be autologous or non- autologous; they can be syngeneic or non- syngeneic: allogeneic or xenogeneic to the subject; each possibility represents a separate embodiment of the present invention.
- the cells are autologous to said subject.
- the cells are non-autologous to said subject.
- the T cells described herein are cultured, expanded and/or activated ex-vivo prior to administration to the subject.
- T cells may be activated ex vivo in the presence of one or more molecule such as, but not limited to, an anti-CD3 antibody, an anti-CD28 antibody, anti-CD3 and anti-CD28 coated beads (such as the CD3CD28 MACSiBeads obtained from Miltenyi Biotec), IL-2, phytohemagglutinin, an antigen-loaded antigen presenting cell [APC, e.g. dendritic cell], a peptide loaded recombinant MHC.
- an anti-CD3 antibody an anti-CD28 antibody, anti-CD3 and anti-CD28 coated beads (such as the CD3CD28 MACSiBeads obtained from Miltenyi Biotec), IL-2, phytohemagglutinin, an antigen-loaded antigen presenting cell [APC, e.g. dendritic cell], a peptide loaded recombinant MHC.
- APC antigen-loaded antigen presenting cell
- T cells of specific embodiments of the present invention are activated upon binding of the extracellular ligand-binding domain of the FCy receptor to an Fc ligand, they may be used for, but not limited to, treating diseases associated with pathologic cells in combination with a therapeutic composition comprising an Fc domain (e.g. antibody) which is directed for binding the pathologic cells.
- Fc domain e.g. antibody
- a method of treating a disease associated with a pathologic cell in a subject treated with a therapeutic composition comprising an Fc domain, said therapeutic composition being specific for said pathologic cell comprising administering to the subject a therapeutically effective amount of the T cells or the population of T cells disclosed herein, thereby treating the disease in the subject.
- the T cells or the population of T cells disclosed herein for use in treating a disease associated with a pathologic cell in a subject treated with a therapeutic composition comprising an Fc domain, said therapeutic composition being specific for said pathologic cell.
- a method of treating a disease associated with a pathologic cell in a subject in need thereof comprising administering to the subject a therapeutically effective amount of the T cells or the population of T cells disclosed herein; and a therapeutic composition comprising an Fc domain, said therapeutic composition being specific for said pathologic cell, thereby treating the disease in the subject.
- the T cells or the population of T cells disclosed herein and a therapeutic composition comprising an Fc domain, for use in treating a disease associated with a pathologic cell in a subject in need thereof, wherein said therapeutic composition is specific for said pathologic cell.
- the term“subject” or“subject in need thereof’ includes mammals, preferably human beings at any age or gender.
- the subject may be healthy or showing preliminary signs of a pathology, e.g. cancer.
- This term also encompasses individuals who are at risk to develop the pathology.
- the term“treating” refers to curing, reversing, attenuating, alleviating, minimizing, suppressing or halting the deleterious effects of a disease or disorder (e.g. cancer).
- a pathology e.g. a malignancy
- the term“preventing” refers to keeping a disease, disorder or condition from occurring in a subject who may be at risk for the disease, but has not yet been diagnosed as having the disease.
- disease associated with a pathologic cell means that pathologic cells drive onset and/or progression of the disease.
- the disease can benefit from activating the immune cells of the subject.
- a disease that can benefit from activating immune cells refers to diseases in which the subject’s immune response activity may be sufficient to at least ameliorate symptoms of the disease or delay onset of symptoms, however for any reason the activity of the subject’s immune response in doing so is less than optimal.
- Non-limiting examples of diseases treated by some embodiments of the invention include hyper-proliferative diseases, diseases associated with immune suppression, immunosuppression caused by medication (e.g. mTOR inhibitors, calcineurin inhibitor, steroids) and infections.
- medication e.g. mTOR inhibitors, calcineurin inhibitor, steroids
- the disease comprises an infection.
- infectious disease refers to a disease induced by a pathogen.
- pathogens include, viral pathogens, bacterial pathogens e.g., intracellular mycobacterial pathogens (such as, for example, Mycobacterium tuberculosis), intracellular bacterial pathogens (such as, for example, Listeria monocytogenes), or intracellular protozoan pathogens (such as, for example, Leishmania and Trypanosoma).
- viral pathogens causing infectious diseases include, but are not limited to, retroviruses, circoviruses, parvoviruses, papovaviruses, adenoviruses, herpesviruses, iridoviruses, poxviruses, hepadnaviruses, picomaviruses, caliciviruses, togaviruses, flaviviruses, reoviruses, orthomyxoviruses, paramyxoviruses, rhabdoviruses, bunyaviruses, coronaviruses, arenaviruses, and filoviruses.
- viral infections which may be treated according to specific embodiments of the present invention include, but are not limited to, human immunodeficiency virus (HlV)-induced acquired immunodeficiency syndrome (AIDS), influenza, rhinoviral infection, viral meningitis, Epstein-Barr virus (EBV) infection, hepatitis A, B or C virus infection, measles, papilloma virus infection/warts, cytomegalovirus (CMV) infection, Herpes simplex virus infection, yellow fever, Ebola virus infection, rabies, etc.
- HlV human immunodeficiency virus
- AIDS human immunodeficiency virus
- EBV Epstein-Barr virus
- CMV cytomegalovirus
- Herpes simplex virus infection Herpes simplex virus infection
- yellow fever Ebola virus infection
- Ebola virus infection rabies, etc.
- the disease comprises a hyper-proliferative disease.
- the hyper-proliferative disease comprises sclerosis, fibrosis, Idiopathic pulmonary fibrosis, psoriasis, systemic sclerosis/scleroderma, primary biliary cholangitis, primary sclerosing cholangitis, liver fibrosis, prevention of radiation-induced pulmonary fibrosis, myelofibrosis or retroperitoneal fibrosis.
- the hyper-proliferative disease comprises cancer.
- the pathologic cell is a cancerous cell.
- Cancers which may be treated by some embodiments of the invention can be any solid or non-solid tumor, cancer metastasis and/or a pre-cancer.
- the cancer is a malignant cancer.
- cancer examples include but are not limited to, carcinoma, blastoma, sarcoma and lymphoma. More particular examples of such cancers include, but are not limited to, tumors of the gastrointestinal tract (colon carcinoma, rectal carcinoma, colorectal carcinoma, colorectal cancer, colorectal adenoma, hereditary nonpolyposis type 1, hereditary nonpolyposis type 2, hereditary nonpolyposis type 3, hereditary nonpolyposis type 6; colorectal cancer, hereditary nonpolyposis type 7, small and/or large bowel carcinoma, esophageal carcinoma, tylosis with esophageal cancer, stomach carcinoma, pancreatic carcinoma, pancreatic endocrine tumors), endometrial carcinoma, dermatofibrosarcoma protuberans, gallbladder carcinoma, Biliary tract tumors, prostate cancer, prostate adenocarcinoma, renal cancer (e.g., Wilms’ tumor type 2 or type 1), liver cancer (e
- the cancer is a pre-malignant cancer.
- Pre-cancers are well characterized and known in the art (refer, for example, to Berman JJ. and Henson DE., 2003. Classifying the pre-cancers: a metadata approach. BMC Med Inform Decis Mak. 3:8). Examples of pre-cancers include, but are not limited to, acquired small pre-cancers, acquired large lesions with nuclear atypia, precursor lesions occurring with inherited hyperplastic syndromes that progress to cancer, and acquired diffuse hyperplasias and diffuse metaplasias.
- Non-limiting examples of small pre-cancers include HGSIL (High grade squamous intraepithelial lesion of uterine cervix), AIN (anal intraepithelial neoplasia), dysplasia of vocal cord, aberrant crypts (of colon), PIN (prostatic intraepithelial neoplasia).
- Non-limiting examples of acquired large lesions with nuclear atypia include tubular adenoma, AILD (angioimmunoblastic lymphadenopathy with dysproteinemia), atypical meningioma, gastric polyp, large plaque parapsoriasis, myelodysplasia, papillary transitional cell carcinoma in-situ, refractory anemia with excess blasts, and Schneiderian papilloma.
- Non-limiting examples of precursor lesions occurring with inherited hyperplastic syndromes that progress to cancer include atypical mole syndrome, C cell adenomatosis and MEA.
- Non-limiting examples of acquired diffuse hyperplasias and diffuse metaplasias include Paget's disease of bone and ulcerative colitis.
- the cancer is selected from the group consisting of melanoma, adenocarcinoma, mammary carcinoma, colon cancer, ovarian cancer, lung cancer and B-cell lymphoma.
- the cancer is selected from the group consisting of melanoma, adenocarcinoma and mammary carcinoma.
- the cancer is selected from the group consisting of melanoma, adenocarcinoma and mammary carcinoma.
- the cancer or the cancerous cell expresses a marker selected from the group consisting of PDL-1, E-Cadherin, CD19, MUC1, TRP-1 and TRP-2.
- the cancer or the cancerous cell expresses PDL-1.
- the T cells are administered to the subject in combination with a therapeutic composition comprising an Fc domain (e.g. an antibody).
- a therapeutic composition comprising an Fc domain (e.g. an antibody).
- the administration of the T cells and the administration of the therapeutic composition comprising the Fc domain can be effected in the same route or in separate routes.
- the administration of the T cells may be following or concomitant with the therapeutic composition comprising the Fc domain.
- the T cells disclosed herein are administered to the subject following treatment with the therapeutic composition comprising the Fc domain.
- the T cells disclosed herein are administered to the subject concomitantly with the therapeutic composition comprising the Fc domain. Multiple rounds of administration of the T cells and multiple doses of the therapeutic composition comprising the Fc domain can be administered. Thus, according to specific embodiments, administering the T cells disclosed herein is effected following at least one administration of the therapeutic composition comprising the Fc domain. According to specific embodiments, administering the cells disclosed herein is effected in a sequential order with the treatment with the therapeutic composition comprising the Fc domain.
- the therapeutic composition comprising the Fc domain is specific for a pathologic cell, i.e. binds an antigen overexpressed or solely expressed by a pathologic (e.g. cancerous) cell as compared to a non-pathologic cell.
- compositions comprising Fc domains specific for pathologic cells are well known in the art and include, but not limited to, Fc-fusion proteins and antibodies.
- the Fc domain is of an IgG antibody.
- Fc-fusion protein refers to a molecule comprising an amino acid sequence capable of binding a pathologic cell (e.g. a ligand of a receptor expressed on a pathologic cell) combined with an Fc domain of an antibody.
- Fc-fusion protein used is well within the capability of those skilled in the art, and depends on the type of the disease and e.g. the receptors expressed by the pathologic cells associated with the pathology.
- Fc-fusion proteins that can be used with specific embodiments are disclosed in Weidle et al. Cancer Genomics and Proteomics (2012) 9(6): 357-372; and Sioud et al. Molecular Therapy - Methods & Clinical Development (2015) 2, 15043, the contents of which is fully incorporated herein by reference.
- antibody as used in this invention includes intact molecules as well as functional fragments thereof (that are capable of binding to an epitope of an antigen). According to specific embodiments, the antibody comprises an Fc domain.
- the antibody is an IgG antibody (e.g. IgGl, IgG2, IgG3, IgG4).
- the antibody isotype is IgGl or IgG3.
- the antibody binds an antigen overexpressed or solely expressed by tumor cells.
- the antibody is selected from the group consisting of Atezolizumab, Avelumab, Alemtuzumab, Cetuximab, Panitumumab, Nimotuzumab, Rituximab, Gatipotuzumab (previously known as PankoMab-GEX®), Trastuzumab, Alemtuzumab, Bevacizumab, Ofatumumab, Pertuzumab, ofatumumab, obinutuzumab and IVIG.
- the antibody is selected from the group consisting of Atezolizumab, Rituximab, Cetuximab, Gatipotuzumab and IVIG.
- the antibody is an anti-PDL- 1.
- the cancerous cell expresses PDL- 1 and the antibody is an anti-PDL-1.
- the antibody is Atezolizumab.
- the T cells and the therapeutic compositions disclosed herein can be administered to a subject in combination with other established or experimental therapeutic regimen to treat a disease associated with pathologic cells (e.g. cancer) including, but not limited to analgesics, chemotherapeutic agents, radiotherapeutic agents, cytotoxic therapies (conditioning), hormonal therapy and other treatment regimens (e.g., surgery) which are well known in the art.
- pathologic cells e.g. cancer
- analgesics chemotherapeutic agents
- radiotherapeutic agents e.g., cytotoxic therapies (conditioning), hormonal therapy and other treatment regimens (e.g., surgery) which are well known in the art.
- T cells disclosed herein and/or the therapeutic compositions disclosed herein can be administered to the subject per se, or in a pharmaceutical composition where it is mixed with suitable carriers or excipients.
- a "pharmaceutical composition” refers to a preparation of one or more of the active ingredients described herein with other chemical components such as physiologically suitable carriers and excipients.
- the purpose of a pharmaceutical composition is to facilitate administration of a compound to an organism.
- active ingredient refers to the T cells and/or the antibodies accountable for the biological effect.
- the T cells are the active ingredient in the formulation.
- physiologically acceptable carrier and “pharmaceutically acceptable carrier” which may be interchangeably used refer to a carrier or a diluent that does not cause significant irritation to an organism and does not abrogate the biological activity and properties of the administered compound.
- An adjuvant is included under these phrases.
- excipient refers to an inert substance added to a pharmaceutical composition to further facilitate administration of an active ingredient.
- excipients include calcium carbonate, calcium phosphate, various sugars and types of starch, cellulose derivatives, gelatin, vegetable oils and polyethylene glycols.
- Suitable routes of administration may, for example, include oral, rectal, transmucosal, especially transnasal, intestinal or parenteral delivery, including intramuscular, intradermal, subcutaneous and intramedullary injections as well as intrathecal, direct intraventricular, intracardiac, e.g., into the right or left ventricular cavity, into the common coronary artery, intravenous, intraperitoneal, intranasal, or intraocular injections.
- neurosurgical strategies e.g., intracerebral injection or intracerebroventricular infusion
- molecular manipulation of the agent e.g., production of a chimeric fusion protein that comprises a transport peptide that has an affinity for an endothelial cell surface molecule in combination with an agent that is itself incapable of crossing the BBB
- pharmacological strategies designed to increase the lipid solubility of an agent (e.g., conjugation of water-soluble agents to lipid or cholesterol carriers)
- the transitory disruption of the integrity of the BBB by hyperosmotic disruption resulting from the infusion of a mannitol solution into the carotid artery or the use of a biologically active agent such as an angiotensin peptide).
- each of these strategies has limitations, such as the inherent risks associated with an invasive surgical procedure, a size limitation imposed by a limitation inherent in the endogenous transport systems, potentially undesirable biological side effects associated with the systemic administration of a chimeric molecule comprised of a carrier motif that could be active outside of the CNS, and the possible risk of brain damage within regions of the brain where the BBB is disrupted, which renders it a suboptimal delivery method.
- the T cells of the invention or the pharmaceutical composition comprising same is administered via an IV route.
- compositions of some embodiments of the invention may be manufactured by processes well known in the art, e.g., by means of conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping or lyophilizing processes.
- Pharmaceutical compositions for use in accordance with some embodiments of the invention thus may be formulated in conventional manner using one or more physiologically acceptable carriers comprising excipients and auxiliaries, which facilitate processing of the active ingredients into preparations which, can be used pharmaceutically. Proper formulation is dependent upon the route of administration chosen.
- the active ingredients of the pharmaceutical composition may be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hank’s solution, Ringer’s solution, or physiological salt buffer.
- physiologically compatible buffers such as Hank’s solution, Ringer’s solution, or physiological salt buffer.
- penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art.
- the pharmaceutical composition can be formulated readily by combining the active compounds with pharmaceutically acceptable carriers well known in the art.
- Such carriers enable the pharmaceutical composition to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, and the like, for oral ingestion by a patient.
- Pharmacological preparations for oral use can be made using a solid excipient, optionally grinding the resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries if desired, to obtain tablets or dragee cores.
- Suitable excipients are, in particular, fillers such as sugars, including lactose, sucrose, mannitol, or sorbitol; cellulose preparations such as, for example, maize starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methyl cellulose, hydroxypropylmethyl-cellulose, sodium carbomethylcellulose; and/or physiologically acceptable polymers such as polyvinylpyrrolidone (PVP).
- disintegrating agents may be added, such as cross-linked polyvinyl pyrrolidone, agar, or alginic acid or a salt thereof such as sodium alginate.
- Dragee cores are provided with suitable coatings.
- suitable coatings For this purpose, concentrated sugar solutions may be used which may optionally contain gum arabic, talc, polyvinyl pyrrolidone, carbopol gel, polyethylene glycol, titanium dioxide, lacquer solutions and suitable organic solvents or solvent mixtures.
- Dyestuffs or pigments may be added to the tablets or dragee coatings for identification or to characterize different combinations of active compound doses.
- compositions which can be used orally include push-fit capsules made of gelatin as well as soft, sealed capsules made of gelatin and a plasticizer, such as glycerol or sorbitol.
- the push-fit capsules may contain the active ingredients in admixture with filler such as lactose, binders such as starches, lubricants such as talc or magnesium stearate and, optionally, stabilizers.
- the active ingredients may be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycols.
- stabilizers may be added. All formulations for oral administration should be in dosages suitable for the chosen route of administration.
- compositions may take the form of tablets or lozenges formulated in conventional manner.
- the active ingredients for use according to some embodiments of the invention are conveniently delivered in the form of an aerosol spray presentation from a pressurized pack or a nebulizer with the use of a suitable propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane, dichloro-tetrafluoroethane or carbon dioxide.
- a suitable propellant e.g., dichlorodifluoromethane, trichlorofluoromethane, dichloro-tetrafluoroethane or carbon dioxide.
- the dosage unit may be determined by providing a valve to deliver a metered amount.
- Capsules and cartridges of, e.g., gelatin for use in a dispenser may be formulated containing a powder mix of the compound and a suitable powder base such as lactose or starch.
- compositions described herein may be formulated for parenteral administration, e.g., by bolus injection or continuous infusion.
- Formulations for injection may be presented in unit dosage form, e.g., in ampoules or in multidose containers with optionally, an added preservative.
- the compositions may be suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.
- compositions for parenteral administration include aqueous solutions of the active preparation in water-soluble form. Additionally, suspensions of the active ingredients may be prepared as appropriate oily or water based injection suspensions. Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acids esters such as ethyl oleate, triglycerides or liposomes. Aqueous injection suspensions may contain substances, which increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol or dextran. Optionally, the suspension may also contain suitable stabilizers or agents which increase the solubility of the active ingredients to allow for the preparation of highly concentrated solutions.
- the active ingredient may be in powder form for constitution with a suitable vehicle, e.g., sterile, pyrogen-free water based solution, before use.
- a suitable vehicle e.g., sterile, pyrogen-free water based solution
- compositions of some embodiments of the invention may also be formulated in rectal compositions such as suppositories or retention enemas, using, e.g., conventional suppository bases such as cocoa butter or other glycerides.
- compositions suitable for use in context of some embodiments of the invention include compositions wherein the active ingredients are contained in an amount effective to achieve the intended purpose. More specifically, a therapeutically effective amount means an amount of active ingredients effective to prevent, alleviate or ameliorate symptoms of a disorder (e.g., cancer) or prolong the survival of the subject being treated.
- a disorder e.g., cancer
- the therapeutically effective amount or dose can be estimated initially from in vitro and cell culture assays.
- a dose can be formulated in animal models to achieve a desired concentration or titer. Such information can be used to more accurately determine useful doses in humans.
- Toxicity and therapeutic efficacy of the active ingredients described herein can be determined by standard pharmaceutical procedures in vitro, in cell cultures or experimental animals.
- the data obtained from these in vitro and cell culture assays and animal studies can be used in formulating a range of dosage for use in human.
- the dosage may vary depending upon the dosage form employed and the route of administration utilized.
- the exact formulation, route of administration and dosage can be chosen by the individual physician in view of the patient's condition. (See e.g., Fingl, et al., 1975, in "The Pharmacological Basis of Therapeutics", Ch. 1 p. l).
- Dosage amount and interval may be adjusted individually to provide levels of the active ingredient are sufficient to induce or suppress the biological effect (minimal effective concentration, MEC).
- MEC minimum effective concentration
- the MEC will vary for each preparation, but can be estimated from in vitro data. Dosages necessary to achieve the MEC will depend on individual characteristics and route of administration. Detection assays can be used to determine plasma concentrations.
- dosing can be of a single or a plurality of administrations, with course of treatment lasting from several days to several weeks or until cure is effected or diminution of the disease state is achieved.
- compositions to be administered will, of course, be dependent on the subject being treated, the severity of the affliction, the manner of administration, the judgment of the prescribing physician, etc.
- compositions of some embodiments of the invention may, if desired, be presented in a pack or dispenser device, such as an FDA approved kit, which may contain one or more unit dosage forms containing the active ingredient.
- the pack may, for example, comprise metal or plastic foil, such as a blister pack.
- the pack or dispenser device may be accompanied by instructions for administration.
- the pack or dispenser may also be accommodated by a notice associated with the container in a form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals, which notice is reflective of approval by the agency of the form of the compositions or human or veterinary administration. Such notice, for example, may be of labeling approved by the U.S. Food and Drug Administration for prescription drugs or of an approved product insert.
- Compositions comprising a preparation of the invention formulated in a compatible pharmaceutical carrier may also be prepared, placed in an appropriate container, and labeled for treatment of an indicated condition, as is further detailed above.
- an article of manufacture comprising a packaging material packaging the T cells or the population of T cells disclosed herein and a therapeutic composition comprising an Fc domain.
- the article of manufacture is identified for the treatment of a disease associated with a pathologic cell (e.g. cancer).
- a pathologic cell e.g. cancer
- the T cells or the population of T cells disclosed herein; and the therapeutic composition comprising the Fc domain are packaged in separate containers.
- the T cells or the population of T cells disclosed herein; and the therapeutic composition comprising an Fc domain are packaged in a co-formulation.
- compositions, method or structure may include additional ingredients, steps and/or parts, but only if the additional ingredients, steps and/or parts do not materially alter the basic and novel characteristics of the claimed composition, method or structure.
- a compound or “at least one compound” may include a plurality of compounds, including mixtures thereof.
- range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 3, 4, 5, and 6. This applies regardless of the breadth of the range.
- method refers to manners, means, techniques and procedures for accomplishing a given task including, but not limited to, those manners, means, techniques and procedures either known to, or readily developed from known manners, means, techniques and procedures by practitioners of the chemical, pharmacological, biological, biochemical and medical arts.
- sequences that substantially correspond to its complementary sequence as including minor sequence variations, resulting from, e.g., sequencing errors, cloning errors, or other alterations resulting in base substitution, base deletion or base addition, provided that the frequency of such variations is less than 1 in 50 nucleotides, alternatively, less than 1 in 100 nucleotides, alternatively, less than 1 in 200 nucleotides, alternatively, less than 1 in 500 nucleotides, alternatively, less than 1 in 1000 nucleotides, alternatively, less than 1 in 5,000 nucleotides, alternatively, less than 1 in 10,000 nucleotides.
- mice - Wild-type (WT) C57BL/6 and Balb/cOlaHsd mice were obtained from Envigo (Jerusalem, Israel), and from Jackson Laboratories (Bar-Harbor, ME, USA).
- T cell deficient mice B6.Cg-Ragl tmlMom and TCR transgenic mice TyrplB-w Tg(Tcra,TcrP)9Rest/J were purchased from Jackson Laboratory.
- B6.Cg-Tg(Tcra,TcrP)425Cbn/J were purchased from Jackson Laboratory, or kindly provided by Professor Ronen Alon at the Weizmann Institute.
- mice were housed in an American Association for the Accreditation of Laboratory Animal Care- accredited animal facility and maintained in specific pathogen-free conditions. Male and female 8-12 weeks old mice were used in all experiments. All animal experiments were approved by the Tel- Aviv University or the Stanford University Institutional Animal Care and Use Committees.
- Cell lines - B16L10 cells (CRL-6475) and 4T1 (CRL-2539) cells were purchased from the ATCC, and HEK-293LT were purchased from ThermoLisher Scientific (Waltham, MA).
- Cells were cultured in DMEM (GIBCO) supplemented with 10 % heat-inactivated LBS (Biological Industries, Israel), 2 mM L-glutamine, and 100 pg / mL penicillin / streptomycin (GIBCO) under standard conditions. Cells were routinely tested for mycoplasma using EZ-PCR Mycoplasma Test Kit (Biological Industries, Israel) according to manufacturer’s instructions.
- T cell isolation All tissue preparations were performed simultaneously from each individual mouse following euthanasia by CO2 inhalation.
- Lor isolation of T cells from lymphoid organs spleen, lymph nodes and thymus were removed from euthanized mice and mashed through 70 pM cell strainer (Gibco, Thermo Pisher Scientific, Waltham, MA). hollowing, cells were washed by centrifugation in 2,000 rpm 5 min 4-8 °C.
- Tumors were enzymatically digested with 2,000 U / ml of DNase I and 2 mg / mL collagenase IV (both from Sigma Aldrich, Merck, Israel) in HBSS for 30 minutes 37 ° C with magnetic stirrer (400 rpm). hollowing, cells were washed by centrifugation in 2,000 rpm 5 minutes 4-8 °C.
- peripheral blood was collected via the posterior vena cava prior to perfusion of the animal and transferred into sodium heparin-coated vacuum tubes prior to 1 : 1 dilution in LACS buffer (Hanks' Balanced Salt solution, 2 % PSC, 0.05 mM EDTA). Lymphocytes were enriched on Picoll®-Paque Premium (Sigma-Aldrich) gradient and collected PBMC were washed twice with LACS buffer.
- T cell culture and expansion - T cells were cultured in RPMI-1640 supplemented with 1 % Pen-Strep, 10 % heat inactivated FBS, 1 % Sodium pyruvate, 1 % MEM-Eagle non- essential amino acids, 1 % Insulin-Transferrin-Selenium, and 50 mM b-mercaptoethanol.
- culture dishes were pre-coated with 0.5pg / ml anti-CD3 (17A2) and 0.5pg / ml anti- CD28 (3751) LEAF antibodies (both purchased from BioLegend) in PBS, and were supplemented with 1,000 IU / mL recombinant murine IL-2 (PeproTech, Rocky Hill, NJ).
- Flow cytometry - Purified T cells were analyzed using flow cytometry (CytoFLEX, Beckman Coulter, Lakeview Indianapolis, IA) and sorted by FACS (BD FACSAriaTM III, BD Biosciences, Franklin Lakes, NJ). Datasets were analyzed using FlowJo software (Tree Star).
- mAbs for anti-TRPl conjugated to FITC or specific for the following mice antigen were used: (Alexa Fluor 647 or Brilliant Violet 421) CD3 (clone 17A2), (Phycoerythrin) CD4 (clone RM 4- 4), (Brilliant Violet 605) CD8 (clone 53-6.7), (Alexa Fluor 488) CDl lb (clone Ml/70), (APC/Cy7) CD44 (IM7), (Phycoerythrin /Cy7) CD62L (MEL- 14), (Alexa Fluor 647) FcRIV (clone 9E9), (Brilliant Violet 421) TCRb (H57-597), (Allophycocyanin) MHCII(M5/114.15.2), (Fluorescein) FcRI (clone X54-5/7.1), (Phycoerythrin /Cy7) FcRTT/TTT (93).
- PCR amplification of CD3 and FcyRI - Total RNA was purified from CDl lb + , FcyRL and FcyRI" 08 CD4 + sorted cells using RNeasy Micro Kit (Qiagen, Valencia, CA), and was quantified using NanoDrop One (Thermo Fisher Scientific, Pittsburgh, PA). Reverse-transcription was performed using qScript cDNA Synthesis Kit (Quanta biosciences, Beverly, MA) according to manufacturer’s protocol. cDNA samples were analyzed by PCR for the detection of FcyRI sequence using AGACACCGCTACACATCTGC (SEQ ID NO: 1) and
- GGGAAGTTTGTGCCCCAGTA (SEQ ID NO: 2) primers, and CD3 epsilon polypeptide sequence using GC ATT CT G AG AGG AT GCGGT (SEQ ID NO: 3) and
- TGGCCTTGGCCTTCCTATTC SEQ ID NO: 4 primers, and were analyzed by agarose gel electrophoresis.
- In vivo tumor models 2xl0 5 B16F10 cells suspended in 50 pL DMEM were injected s.c. to C57BL/6 mice above the right flank and the size of growing tumors was measured twice a week using calipers. When tumors reached 120 mm 2 , mice were sacrificed for ethical considerations. Treatment was applied at day 8 and day 12 post injection, or when tumors reached 20 mm 2 (day 0 and day 4).
- mice were sacrificed and CD4 + T cells from DLN, tumors, and non-DLN were analyzed.
- Tumor immunotherapy - Animals were injected intratumorally with 80 pg anti-CD40 (clone FGK4.5; BioXCell) and 10 pg TNFa (BioLegend) and with or without 100 pg / mouse anti human / mouse TRP1 IgG antibodies (clone TA99; BioXCell). 100 pg / mouse of anti-Chicken Ovalbumin (clone TOSGAA1; BioLegend) were used as control.
- mice Adoptive T Cell Transfer - C57B1/6 mice were injected s.c. with 2xl0 5 B16F10 tumor cells. On days 12 and 14, mice were injected intratumorally with 80 pg anti-CD40 (clone FGK4.5; BioXCell), 1 pg IFNy (Biolegend) and/or 200 pg anti-TRPl. On day seven, mice were euthanized and the tumors and draining lymph nodes were removed and dissociated to obtain single cell suspensions.
- anti-CD40 clone FGK4.5; BioXCell
- IFNy Biolegend
- mice were euthanized and the tumors and draining lymph nodes were removed and dissociated to obtain single cell suspensions.
- T cells were enriched using magnetic beads (EasySep, StemCell technologies) and further sorted by FACSAriall as FCS 11 VS S C 1 °/TC R b + /M H C 11 " cg cells.
- T cells were cultured in T cell medium containing 1,000 IU / mL IL-2 (Peprotech) on culture plates coated with 0.5 pg / mL of anti-CD3. Following 9-12 days, T cells were gently collected and a total of lxlO 6 cells were injected intravenously into mice bearing tumors with an average size of 30-50 mm 2 .
- Fab2’ fragments - Anti-TRPl Ab (clone TA99; BioXCell) was dialyzed against 20 mM sodium acetate pH 4.5 and digested with agarose-pepsin beads (Goldbio, St. Louis, MO) for 16 hours in 37 °C incubator with rotation. Next, the sample was centrifuged and supernatant was collected, dialyzed against PBS pH 7.4 and incubated with protein-A agarose beads (Santa Cruz Biotechnology, Dallas, TX) for 2 hours with rotation. Fab2’ fraction was collected after centrifugation and was analyzed by PAGE.
- Kilting assay - CD4 + T cells were co-cultured with B 16 target cells (30,000 cells per well) at a ratio of 1:2 (T:E) in a round bottom 96-wells plate with or without the following antibodies: anti-Chicken Ovalbumin (clone TOSGAA1; BioLegend), anti-TRP-1 (clone TA99; BioXCell), or anti-TRP-1 Fab2’. Following 24 hours and 48 hours of incubation medium was replaced with PBS, and fluorescence intensity of wasabi (excitation 485nm emission 528nm) was measured by Synergy HIM plate reader (BioTek, Winooski, VT). Following 48 hours, cells were stained with Annexin V (Biolegend) for 15 minutes and propidium iodide for 2 minutes on ice and staining levels were analyzed by flow cytometry.
- Annexin V Biolegend
- effector CD4 + T cells were isolated from the blood, draining lymph node (DLN) and B 16 melanoma tumors of wild type (WT) C57BL/6 mice, and transferred by i.v. injection to WT C57BL/6 mice bearing B 16 melanoma cells, in combination with antibodies against the melanoma antigen TRP1 (gp75, Figure 1A). While injection of effector CD4 + T cells from blood had only a minor effect on tumor regression, injection of CD4 + T cells from the tumor and DLN induced a significant, long-lasting tumor regression ( Figures 1B-C).
- the present inventors assessed whether transferred CD4 + T cells directly kill tumor cells, or rather mediate their killing by activating other effector T cells.
- RAG-deficient mice RAG 7
- B 16 cells RAG-deficient mice
- tumors were allowed to grow for ten days.
- RAG 7 mice were injected with lxlO 6 effector CD4 + derived from WT C57BL/6 tumor-bearing mice with or without anti-TRPl antibodies.
- the efficacy of this treatment in RAG 7 mice was comparable to that of immune- competent mice, suggesting that tumor lysis is induced directly by the transferred antibodies and CD4 + T cells (Figure ID).
- TCRs T-cell receptors
- CD4 + T cells bearing a single TCR were isolated from OT-II, which recognize the irrelevant Ovalbumin (Ova) epitope, or from RAG1 B W TRP-1 TCR mice, which recognize a peptide derived from TRP1.
- the effector T cells were injected to WT C57BL/6 mice bearing B 16 melanoma cells in combination with an antibody against Ova, which is not expressed on B 16, or with an antibody against the tumor antigen TRP1.
- Adoptive transfer of effector T cells alone were almost inert and tumor growth in these groups was comparable to that of untreated mice.
- FcyRI gene transcript is expressed in Fc y R I + /C D 3 + / M H C 11 " cg/d Ll 11 CD4 + T cells, but not conventional FcyRI negative CD4 + T cells (Figure 3D).
- histological sections staining of narve spleen and tumors further indicated that these cells are exclusively located at the margins of the T cell zone ( Figure 3E).
- Tumor specific CD4 + T cells expressing FcyRI induce effective tumor cell lysis -
- whether the expression of FcyR on T cells is functional, or merely a surface marker was tested.
- splenic CD4 + T cells that either express or do not express FcyRI were isolated from wild type (WT) C57BL/6 control mice and incubated overnight with B 16 tumor cells. Incubation of FcyRI + /CD4 + T cells, but not FcyRI neg /CD4 + T cells, with B 16 in combination with anti-TRPl antibodies induced a remarkable tumor cell lysis.
- tdTomato B16F10 cells were obtained by infecting B 16F10 cells by lentivims containing pLVX-H2B- tdTomato, followed by sorting by FACS (BD FACSAriaTM III, BD Biosciences, Franklin Lakes, NJ) for the high-expressing tdTomato population.
- T cell isolation - Spleens were removed from WT C57BL/6 mice and mashed through 70 mM cell strainer. Following, splenocytes were collected and incubated with anti-CD4, or anti- CD8 magnetic beads (MojoSortTM Nanobeads, BioLegend, Carlsbad, CA) according to manufacturer’s instructions.
- TRP1 -reactive TCR SEQ ID NOs: 35-36
- FcyRI SEQ ID NOs: 5-6
- FcRy Fc receptor signaling gamma chain
- FcRy Fc receptor signaling gamma chain
- constructs were generated to express FcyRI, FcRy and/or TCR CD3zeta chain; FcyRI extracellular domain and TCRP constant region; and FcyRI extracellular domain, CD8 hinge + transmembrane domains and FcRy in single plasmids (see Figures 5A, 6A, 7 and 11A), SEQ ID Nos: 21-28 and 41-44).
- inserts of the fusion sequences were synthesized by GeneART (Thermo Fisher Scientific) into pMK vectors and were further cloned into pMIGII using EcoRI/XhoI sites upstream to IRES-GFP sequences. Clones were verified by pBABE5’ and IRES-Rev primers sequencing (HyLabs Israel). Histone H2B sequence was amplified with
- AATAACACTAGTGCCACCATGCCTGAACCGGCAAAAT SEQ ID NO: 45
- a AC A ACCCC GGG ACTTGTCGT C ATCGT CTTT GT SEQ ID NO: 46
- Retroviral infection Mouse CD4 + and CD8 + T cells were isolated from mouse blood and infected with the above constructs as follows: Platinum E cells were plated on 10 cm culture plates and co-transfected with 2: 1 molar ratio of pMIGII 45 and PCL-Eco plasmids using Polyplus jetPRIME® reagent (Polyplus transfections). Following 24 hours, media was replaced with complete DMEM supplemented with 0.075 % Sodium Bicarbonate. Media-containing viruses were collected after 24 hours and 48 hours and centrifuged for 1 hour at 100,000g. Pellet was resuspended gently in 1 mL media and let to recover overnight at 4 °C.
- splenic CD4 + T cells or splenic CD8 + T cells were incubated on plate pre-coated with anti-CD3 (0.5 pg / mL) in T cell media containing high-dose IL-2 (1,000 IU / ml).
- 0.3 mL of concentrated retroviruses were added to every 2xl0 6 CD4 + or CD8 + T cells with 10 pg/mL polybrene. Cells were incubated for 30 minutes in 37 °C, 5 % CO2 and centrifuged at 37 °C 1,200 rpm for 1 hour. Following, 80 % of medium was replaced and T cells were cultured for additional three days in T cell media containing high-dose IL-2.
- HEK-293FT cells were transfected with pLVX plasmids containing H2B-tdTomato under EF1 promoter together with psPAX2 (Addgene plasmid # 12260) and pCMV-VSV-G (Addgene plasmid # 8454). Media-containing viruses were collected following 24 and 48 hours. For infection, B16F10 cells were incubated with viruses and 100 pg / mL polybrene (Sigma Aldrich, Merck, Israel) for 30 minutes followed by 30 minutes centrifugation before medium was replaced. Following three days, cells that expressed tdTomato were sorted by FACSAriall.
- Adoptive T Cell Transfer - C57B1/6 mice were injected s.c. with 2xl0 5 B16F10 tumor cells. Following 9-12 days, a total of lxlO 6 transduced T cells were injected intravenously into mice bearing tumors with an average size of 30-50 mm 2 with or without 200 pg anti-TRPl.
- Killing assay - CD4 + or CD8 + T cells were co-cultured with B16 target cells (30,000 cells per well) at a ratio of 1 : 2 (T : E) in a round bottom 96-wells plate with or without anti-TRP-1 (clone TA99; BioXCell). Following 48 hours of incubation images where taken under X100 magnitude in inverted light microscope. In addition, following 48 hours, cells were stained with Annexin V (Biolegend) for 15 minutes and propidium iodide for 2 minutes on ice and staining levels were analyzed by flow cytometry. IncuCyte imager killing assay were conducted by culturing 10 4 H2B-tdTomato B16F10 target cells in 96 wells plate.
- 2xl0 4 T cells were added with or without 15 pg anti-TRP-1 antibodies in 200 pi medium and were imaged by incuCyte S3 imager (Sartorius) for at least 24 hours. Images were then used to calculate numbers of target cells by incuCyte software.
- Example 1 the inventors tested whether the killing mechanism described in Example 1 hereinabove can be mimicked in FcyRI neg /CD4 + T cells.
- splenic CD4 + T cells were infected with three retrovirus packed plasmids: TRP 1-reactive TCR, FcyRI and/or Fc receptor signaling gamma chain (FcRy), and plated with B 16 tumor cells (Figure 4C).
- CD4 + T cells infected with tumor- specific TCR, FcyRI and the gamma chain induced the most substantial killing response, as can be seen by CD 107a on the T cell membrane and cell death of tumor cells coated with antibodies.
- FIG. 4C Representative microscope images of antibody mediated B 16 killing by TCR-FcyRI-TcRy infected CD4 + are shown on the right panel ( Figure 4C). Following the infected CD4 + T cells were tested in an adoptive transfer model, with or without an anti-TRPl antibody, to evaluate the killing activity of the cells in vivo. As shown in Figure 4D, same as in-vitro, in the in-vivo model, expression of TCR of TRP1 together with FcyRI and the signaling gamma chain, in combination with an anti-TRPl antibody, mediated tumor eradication.
- the transduced T cells were further co-cultured and tested for B 16 killing activity with an anti-TRPl antibody (Figure 5B).
- Figure 5C To compare the levels of killing mediated by the different setting of receptors, the B16 cells that were co-cultured with the transduced CD8 + T cells were stained with annexin-V/PI and analyzed by flow cytometry ( Figure 5C).
- the graph in Figure 9 shows a direct correlation between the amount of cell cultured and numbers of cell counted in a field. Consequently, the incuCyte imaging system was used to evaluate killing of B 16-H2B-tdTomato by anti-TRP-1 antibody and T cells expressing FcyRIa-2A-FcRy cultured in different effector : target ratios, ranging from 0.5: 1 to 16: 1.
- Representative images ( Figure 10A) and target cells numbers ( Figure 10B) after 48 hours show that both CD8 + and CD4 + T cells killed the tumor cells when the effector : target ratio is 8 to 1, or higher.
- Figure 11A FcyRIa extracellular domain-CD8 hinge and transmembrane domain- FcRy (SEQ ID NO: 43-44).
- the construct was expressed in CD8+ T cells and their killing ability was evaluated using B 16 cells expressing the histone H2B-tdTomato ( Figures 11B-C).
- the results show the advantage of expressing two distinct polypeptides, one comprising the ligand binding domain of FcyRIa and the other comprising FcRy, as compared to a single polypeptide expressing both.
- T cell transduction Several constructs are generated as described in Example 2 hereinabove. In addition, additional constructs for expressing FcyRI, FcRy and TCR CD3zeta chain as a single polypeptide are generated (see Figure 7, SEQ ID Nos: 29-32).
- Mouse CD4 + and CD8 + T cells are isolated from mouse blood and infected with the above constructs as described in Example 2 hereinabove.
- Human CD4 + and CD8 + T cells are isolated from the blood of healthy donors or from the blood of melanoma patients refractory to treatment with Atezolizumab and infected with the above constructs.
- cytotoxic activity of the transduced mouse T cells - Transduced T cells are co-cultured with B 16, 4T1, or MC38 tumor cells, which express high levels of PDL1, with or without anti-PDLl antibodies (BioXCell).
- tumor cell lysis is measured using a fluorescence live cells assay created by a Biotek HIM plate reader.
- Transduced T cells isolated from healthy donors are incubated with SK-Mel-5 and A375 tumor cell lines that express PDL1, with or without Atezolizumab. At several time points, tumor cell lysis is measured. Furthermore, transduced T cells isolated from the blood of melanoma patients’ refractory to treatment with Atezolizumab are co-cultured with autologous melanoma tumor cells, with or without Atezolizumab. At several time points, tumor cell lysis is measured by a fluorescence live cells assay using a Biotek HIM plate reader.
- T cells can also express PDL1, though usually at a low level, the concentration of antigens that elicit killing of target cells is tested.
- macrophages, B cells, and endothelial cells are isolated from naive mice and healthy human donors and activated with IFNy, to induce PDL1 expression. Following the cells are incubated overnight with the transduced T cells, with or without anti-PDLl antibodies, and cell mortality is determined by annexin V and propidium iodide (PI) staining.
- PI propidium iodide
- mice are injected with B 16 cells, MC38, or 4T1, all of which express high levels of PDL1, but are refractory to blocking antibodies. Once tumors are established, mice are treated by i.v. injection with the transduced mouse T cells, with or without mouse anti-mouse PDL1 antibodies and tumor burden is monitored. In addition, tumors are analyzed by flow cytometry for their T cell infiltration, expansion and IFNy secretion. Tumor cell apoptosis is determined by tunnel staining under confocal microscopy.
- Tumor cell lines SK-Mel-5 and A375 that express PDL1 are transplanted into nudc-scid-IL2RyGnicc (NSG), and left to grow to a palpable size. Following, mice are injected with transduced human T cells with or without Atezolizumab and tumor growth is monitored. In addition, tumors are analyzed by flow cytometry for their T cell infiltration, expansion and IFNy secretion. Tumor cell apoptosis is determined by tunnel staining under confocal microscopy.
- transduced tumor T cells to kill refractory human tumors -
- Fresh tumor samples and PBMC are obtained from patients, which their tumors express high levels of PDL1 and are undergoing resective surgery.
- Transduced cell lines are established from cancer patients and injected into NSG mice. Once tumors reach a palpable size, mice are injected with transduced autologous T cells with or without Atezolizumab and tumor growth is monitored.
- mice are examined routinely for their wellbeing following treatments. To this end, mice are weighed every other day and assessed for their level of activity, as well as signs of dermatitis, diarrhea, and acute pain. In addition, mice are bled twice a week from the retinal tear and tested for serum levels of CRP, MCP-1, IL-6, TNFa, IFNy and IL-1. Serum samples are also tested for metabolic abnormalities, including levels of potassium, phosphate, calcium, uric acid, glucose, creatinine, and albumin, and the liver enzymes ALT, AST, ALP.
- mice treated with the transduced T cells with or without Atezolizumab are analyzed by staining serial histological sections.
- Excessive lymphocyte proliferation in lymphoid organs is tested by Ki67 staining and liver, adrenal cortex, salivary glands, kidney, heart, skin, and colon are tested for immune infiltrates by staining for T cells, B cells, and myeloid cells.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Immunology (AREA)
- Organic Chemistry (AREA)
- Veterinary Medicine (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Engineering & Computer Science (AREA)
- Epidemiology (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Medicinal Chemistry (AREA)
- Biomedical Technology (AREA)
- Cell Biology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- Wood Science & Technology (AREA)
- Pharmacology & Pharmacy (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Gastroenterology & Hepatology (AREA)
- Toxicology (AREA)
- Microbiology (AREA)
- Hematology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Engineering & Computer Science (AREA)
- Endocrinology (AREA)
- Mycology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Developmental Biology & Embryology (AREA)
- Virology (AREA)
- Peptides Or Proteins (AREA)
Priority Applications (8)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202080037294.9A CN113853205A (zh) | 2019-03-19 | 2020-03-19 | 表达FCγ受体的T细胞及其使用方法 |
| EP20774261.0A EP3941492A4 (en) | 2019-03-19 | 2020-03-19 | T-CELL EXPRESSING A FC GAMMA RECEPTOR AND METHODS OF USE THEREOF |
| AU2020243623A AU2020243623A1 (en) | 2019-03-19 | 2020-03-19 | T cell expressing an FC gamma receptor and methods of use thereof |
| CA3133037A CA3133037A1 (en) | 2019-03-19 | 2020-03-19 | T cell expressing an fc gamma receptor and methods of use thereof |
| JP2021556491A JP2022525927A (ja) | 2019-03-19 | 2020-03-19 | Fcガンマ受容体を発現するt細胞およびその使用方法 |
| IL286477A IL286477A (en) | 2019-03-19 | 2021-09-19 | T cell expressing an fc gamma receptor and methods of use thereof |
| US17/478,930 US20210401893A1 (en) | 2019-03-19 | 2021-09-19 | T cell expressing an fc gamma receptor and methods of use thereof |
| US19/008,721 US20250163128A1 (en) | 2019-03-19 | 2025-01-03 | T cell expressing an fc gamma receptor and methods of use thereof |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201962820357P | 2019-03-19 | 2019-03-19 | |
| US62/820,357 | 2019-03-19 |
Related Child Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US17/478,930 Continuation US20210401893A1 (en) | 2019-03-19 | 2021-09-19 | T cell expressing an fc gamma receptor and methods of use thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2020188570A1 true WO2020188570A1 (en) | 2020-09-24 |
Family
ID=72519182
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/IL2020/050327 Ceased WO2020188570A1 (en) | 2019-03-19 | 2020-03-19 | T cell expressing an fc gamma receptor and methods of use thereof |
Country Status (8)
| Country | Link |
|---|---|
| US (2) | US20210401893A1 (https=) |
| EP (1) | EP3941492A4 (https=) |
| JP (1) | JP2022525927A (https=) |
| CN (1) | CN113853205A (https=) |
| AU (1) | AU2020243623A1 (https=) |
| CA (1) | CA3133037A1 (https=) |
| IL (1) | IL286477A (https=) |
| WO (1) | WO2020188570A1 (https=) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2024154122A1 (en) | 2023-01-18 | 2024-07-25 | Gilboa Therapeutics LTD | Immune cells expressing a complement receptor and uses thereof |
| US12077569B2 (en) | 2020-06-22 | 2024-09-03 | Ramot At Tel-Aviv University Ltd. | Multi subunit protein modules, cells expressing same and uses thereof |
| WO2024236557A1 (en) | 2023-05-12 | 2024-11-21 | Gilboa Therapeutics LTD | Compositions comprising an fc domain for the treatment of medical conditions |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN117660500B (zh) * | 2023-09-28 | 2025-01-28 | 上海恩凯细胞技术有限公司 | 核酸构建体、载体、转基因免疫细胞及其应用 |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2015179833A1 (en) * | 2014-05-23 | 2015-11-26 | The Trustees Of The University Of Pennsylvania | Compositions and methods for treating antibody resistance |
Family Cites Families (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5641875A (en) * | 1993-09-30 | 1997-06-24 | University Of Pennsylvania | DNA encoding chimeric IgG Fc receptor |
| AU2005277831B2 (en) * | 2004-07-10 | 2012-11-22 | The Institute For Cancer Research | Genetically modified human natural killer cell lines |
| US10144770B2 (en) * | 2013-10-17 | 2018-12-04 | National University Of Singapore | Chimeric receptors and uses thereof in immune therapy |
| CA2972714A1 (en) * | 2014-09-09 | 2016-03-17 | Unum Therapeutics | Chimeric receptors and uses thereof in immune therapy |
| JP6839074B2 (ja) * | 2014-09-17 | 2021-03-03 | ノバルティス アーゲー | 養子免疫療法のためのキメラ受容体での細胞毒性細胞のターゲティング |
| US11440946B2 (en) * | 2015-03-13 | 2022-09-13 | University Of Maryland, Baltimore | Universal antibody-mediated biosensor |
-
2020
- 2020-03-19 JP JP2021556491A patent/JP2022525927A/ja active Pending
- 2020-03-19 WO PCT/IL2020/050327 patent/WO2020188570A1/en not_active Ceased
- 2020-03-19 CA CA3133037A patent/CA3133037A1/en active Pending
- 2020-03-19 EP EP20774261.0A patent/EP3941492A4/en not_active Withdrawn
- 2020-03-19 CN CN202080037294.9A patent/CN113853205A/zh active Pending
- 2020-03-19 AU AU2020243623A patent/AU2020243623A1/en not_active Abandoned
-
2021
- 2021-09-19 US US17/478,930 patent/US20210401893A1/en not_active Abandoned
- 2021-09-19 IL IL286477A patent/IL286477A/en unknown
-
2025
- 2025-01-03 US US19/008,721 patent/US20250163128A1/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2015179833A1 (en) * | 2014-05-23 | 2015-11-26 | The Trustees Of The University Of Pennsylvania | Compositions and methods for treating antibody resistance |
Non-Patent Citations (3)
| Title |
|---|
| DIANA RASOULOUNIRIANA, NADINE SANTANA-MAGAL, AMIT GUTWILLIG, LEEN FARHAT-YOUNIS, YARIV WINE, COREY SAPERIA, LIOR TAL, HAIM GUTMAN,: "A distinct subset of FcγRI-expressing Th1 cells exert antibody-mediated cytotoxic activity", THE JOURNAL OF CLINICAL INVESTIGATION, vol. 129, no. 10, 26 August 2019 (2019-08-26), pages 4151 - 4164, XP055741350, DOI: 10.1172/JCI127590 * |
| See also references of EP3941492A4 * |
| URBANSKA, KATARZYNA ET AL.: "771. Overcoming Resistance To Antibody Targeted Therapy in Cancer Using Gene-Modified T Cells", CANCER-IMMUNOTHERAPY II, vol. 22, 1 May 2014 (2014-05-01), 75 VARICK ST, 9 TH FLR, NEW YORK , NY 10013-1917 USA, XP055741344, DOI: 10.1016/S1525-0016(16)35784-7 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US12077569B2 (en) | 2020-06-22 | 2024-09-03 | Ramot At Tel-Aviv University Ltd. | Multi subunit protein modules, cells expressing same and uses thereof |
| WO2024154122A1 (en) | 2023-01-18 | 2024-07-25 | Gilboa Therapeutics LTD | Immune cells expressing a complement receptor and uses thereof |
| WO2024236557A1 (en) | 2023-05-12 | 2024-11-21 | Gilboa Therapeutics LTD | Compositions comprising an fc domain for the treatment of medical conditions |
Also Published As
| Publication number | Publication date |
|---|---|
| JP2022525927A (ja) | 2022-05-20 |
| CN113853205A (zh) | 2021-12-28 |
| IL286477A (en) | 2021-10-31 |
| EP3941492A1 (en) | 2022-01-26 |
| US20210401893A1 (en) | 2021-12-30 |
| CA3133037A1 (en) | 2020-09-24 |
| US20250163128A1 (en) | 2025-05-22 |
| AU2020243623A1 (en) | 2021-11-04 |
| EP3941492A4 (en) | 2023-05-03 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US12350334B2 (en) | Compositions and methods for generating a persisting population of T cells useful for the treatment of cancer | |
| US20230181643A1 (en) | Use of trans-signaling approach in chimeric antigen receptors | |
| JP7289293B2 (ja) | T細胞の改変 | |
| US20250163128A1 (en) | T cell expressing an fc gamma receptor and methods of use thereof | |
| US12077569B2 (en) | Multi subunit protein modules, cells expressing same and uses thereof | |
| WO2017009843A2 (en) | Compositions, articles of manufacture and methods for treating cancer | |
| JP2014509841A (ja) | 癌を治療するための組成物および方法 | |
| WO2020236964A1 (en) | Engineered expression of cell surface and secreted sialidase by car t cells for increased efficacy in solid tumors | |
| WO2022057725A1 (zh) | 分离的能够用于表达外源基因的溶瘤腺病毒、载体、治疗剂及其用途 | |
| WO2020212986A1 (en) | Siglec-based chimeric polypeptides and uses thereof | |
| US20230048361A1 (en) | Methods of culturing t cells and uses of same | |
| JP7764035B2 (ja) | 細胞治療の方法 | |
| US20240207315A1 (en) | Chimeric receptors and uses thereof | |
| Vile et al. | Cancer immunotherapy using AIRE conditioning of the tumor epitopeome | |
| US20240325535A1 (en) | Compositions and methods comprising car t cells comprising prdm1 and/or nr4a3 knockout | |
| WO2024154122A1 (en) | Immune cells expressing a complement receptor and uses thereof | |
| WO2023015300A1 (en) | Compositions and methods for enhancing car t cell efficacy through the engineered secretion of c. perfringens neuraminidase |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 20774261 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 3133037 Country of ref document: CA |
|
| ENP | Entry into the national phase |
Ref document number: 2021556491 Country of ref document: JP Kind code of ref document: A |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 2020774261 Country of ref document: EP Effective date: 20211019 |
|
| ENP | Entry into the national phase |
Ref document number: 2020243623 Country of ref document: AU Date of ref document: 20200319 Kind code of ref document: A |
|
| WWW | Wipo information: withdrawn in national office |
Ref document number: 2020774261 Country of ref document: EP |