WO2020184764A1 - Use of oryza sativa-derived ak102606 gene as controller for antioxidative activity, environmental stress, and crop yield - Google Patents

Abstract

The present invention relates to a use of Oryza sativa-derived AK102606 gene as a controller for antioxidative activity, environmental stress, and crop yield. A plant transformed with the AK102606 gene of the present invention exhibits high antioxidative activity, excellent tolerance to environmental stresses, notable initial growth, and high crop yield. Thus, the introduction of AK102606 gene into valuable crops can be advantageously used to develop plants superb in terms of antioxidative activity, abiotic stress, and crop yield.

Description

The use of rice-derived AK102606 gene as a regulator of antioxidant activity, environmental stress and yield

The present invention investigated the use of the AK102606 gene derived from rice ( Oryza sativa ) as a regulator of antioxidant activity, environmental stress, and crop yield.

The critical task that humanity faces is how to stably supply and supply food amid the crisis of a rapidly changing climate and declining cropland. In fact, it is said that crop productivity has declined in the past decades amid harsh conditions. Even more serious, it is predicted that floods, droughts, high temperatures and low temperatures will become more frequent in the future. Due to these factors, the productivity of major crops such as corn, wheat and rice is expected to decrease further in the future.

Since the 1960s, efforts have been made to increase the productivity of major crops through the development of various genetic resources (germplasm), but dense cultivation conditions lead to competition for nutrients and moisture within limited arable land, further damaging the climate. Is increasing. Therefore, it is necessary to develop crops that are resistant to this environment and can maintain productivity.

Plants live by adapting to various environments through various regulatory mechanisms from cell metabolism to physiology and development. In particular, the mechanism for abiotic stress is an important adaptation factor. Abiotic stress refers to climate or soil conditions that interfere with plant cell homeostasis and eventually inhibit plant growth. Water excess or lack of, toxic ions ^{(Al 3+, Cl -, Cd} 2+, Fe 2+, Na + and the like), food shortage (Fe ^3+, N, P, S, Zn ^2+, etc), high temperature, low temperature , Atmospheric ozone (O ₃ ), etc. are examples. These stresses are divided into transient stress (high temperature during the day, etc.) and continuous stress (chronic stress; Na ^{+ in} high salinity soil, etc.), and the effect on crops depends on when stressed during the day or during the development process. It changes. The stress experienced during the young vegetative growth period slows plant growth by inhibiting cell division and cell growth, but does not significantly affect the crop yield. On the other hand, stress during reproductive growth has a serious impact on crop yields. Since abiotic stress comes in a complex way, it is necessary to improve various adaptation mechanisms to maintain crop productivity. Minimizing the damage caused by abiotic stress is ultimately the way to increase agricultural productivity.

Accordingly, the present inventors transformed rice with a recombinant vector containing the AK102606 gene represented by the nucleotide sequence of SEQ ID NO: 1 derived from rice ( Oryza sativa ), resulting in high antioxidant activity , excellent resistance to environmental stress, and excellent initial growth. The present invention was completed by confirming that the crop yield was large.

Therefore, an object of the present invention is to increase the environmental stress tolerance and antioxidant activity of plants, including the step of overexpressing the AK102606 gene by transforming a recombinant vector containing the AK102606 gene represented by the nucleotide sequence of SEQ ID NO: 1 derived from rice into rice. To provide a way.

Another object of the present invention is to provide rice ( Oryza sativa L. japonica ) AK102606 (KCTC 13810BP) with increased environmental stress resistance and antioxidant activity including the AK102606 gene represented by the nucleotide sequence of SEQ ID NO: 1.

Another object of the present invention is a plant biomass and yield comprising the step of overexpressing the AK102606 gene by transforming a recombinant vector containing the AK102606 gene represented by the nucleotide sequence of SEQ ID NO: 1 derived from rice into rice. ) To provide a way to increase.

Another object of the present invention is to provide a biomass containing the AK102606 gene represented by the nucleotide sequence of SEQ ID NO: 1 and rice ( Oryza sativa L. japonica ) AK102606 (KCTC 13810BP) with increased yield.

In order to solve the above object, increasing the environmental stress tolerance and antioxidant activity of plants comprising the step of overexpressing the AK102606 gene by transforming a recombinant vector containing the AK102606 gene represented by the nucleotide sequence of SEQ ID NO: 1 derived from rice into rice. Provides a way to do it.

In addition, the present invention is a step of transforming the plant cells of rice with a recombinant vector containing the AK102606 gene represented by the nucleotide sequence of SEQ ID NO: 1 derived from rice; And

It provides a method for producing a plant having increased environmental stress tolerance and antioxidant activity, comprising the step of re-differentiating the rice plant from the transformed rice plant cells.

In addition, the present invention provides a transgenic plant with increased environmental stress tolerance and antioxidant activity and seeds thereof.

In addition, the present invention provides a composition for increasing environmental stress tolerance and antioxidant activity of plants, containing the AK102606 gene derived from rice consisting of the nucleotide sequence of SEQ ID NO: 1.

In addition, the present invention provides rice ( Oryza sativa L. japonica ) AK102606 (KCTC 13810BP) with increased environmental stress tolerance and antioxidant activity including the AK102606 gene represented by the nucleotide sequence of SEQ ID NO: 1.

In addition, the present invention is a plant biomass (biomass) and yield (yield) comprising the step of overexpressing the AK102606 gene by transforming the recombinant vector containing the AK102606 gene represented by the nucleotide sequence of SEQ ID NO: 1 derived from rice in rice Provides a way to increase

In addition, the present invention is a step of transforming the plant cells of rice with a recombinant vector containing the AK102606 gene represented by the nucleotide sequence of SEQ ID NO: 1 derived from rice; And

It provides a method for producing a biomass and a plant having an increased yield, comprising the step of re-differentiating the rice plant from the transformed rice plant cells.

In addition, the present invention provides a transgenic plant with increased biomass and yield and seeds thereof.

In addition, the present invention provides a composition for increasing the biomass and yield of plants containing the AK102606 gene derived from rice consisting of the nucleotide sequence of SEQ ID NO: 1.

In addition, the present invention provides a biomass containing the AK102606 gene represented by the nucleotide sequence of SEQ ID NO: 1 and rice ( Oryza sativa L. japonica ) AK102606 (KCTC 13810BP) with increased yield.

Transgenic plants into which the AK102606 gene of the present invention has been introduced has high antioxidant capacity, excellent resistance to environmental stress, excellent initial growth, and a large crop yield. Therefore, the AK102606 gene was introduced into useful crops to provide antioxidant activity, environmental stress and crops. It will be useful to develop plants with increased yield.

1 is a photograph and graph showing the results of abiotic resistance analysis and antioxidant capacity measurement of transgenic rice into which the AK102606 gene was introduced:

(A) Phenotypes of control, Ilmi rice and transformants after treatment with salt (200 mMNaCl), low temperature (15°C), heat (42°C), and drought stress for 14, 7, 28, and 3 days

(B), (C) Expression analysis of AK10206 gene and peroxidase gene through qPT -PCR analysis when exposed to salt and cold stress for 12 hours and heat and drought stress for 24 hours

(D), (E) Relative H ₂ O ₂ and MDA analysis when exposed for salt stress 7 days, low temperature stress 4 days, heat stress 10 days and drought stress 2 days.

Figure 2 is a photograph and a graph confirming the phenotype in the initial growth stage of the transgenic rice into which the AK102606 gene was introduced:

(A) Phenotype of rice plant 4 weeks after transplantation in natural growing state

(B) 6 weeks old rice plant phenotype after transplantation

(C) Measure root length at intervals of 4 days from the 4th day after transplanting

(D) The yield and dry weight of the four-week-old plant.

Figure 3 is a photograph and graph showing the results of analyzing the natural growth state and antioxidant capacity of the transformed rice plant in the Gunwi experimental package:

(A) 6-week-old rice plant phenotype after transplantation in natural growing state

(B) Changed rice plant powder count after transplantation

(C) Photograph after NBT and DAB staining of rice leaves 6 weeks after transplanting

(D) The amount of ion leakage according to MV (methyl viologen) treatment of 6 weeks old plant after transplantation and NBT staining at 72 hours.

Figure 4 is a photograph and graph showing the results of analysis of the reproductive growth stage phenotype and agricultural trait between control Ilmi rice and transformants over 2016 (T ₅ ), 2017 (T ₆ ), and 2018 (T ₇ ):

(A) Comparative analysis of 2016 agricultural traits (T ₅ )

(B) Comparative analysis of agricultural traits in 2017 (T ₆ )

(C) Comparative analysis of agricultural traits in 2018 (T ₇ )

Total plant fresh weight (TPW), stem weight (CW), number of tillers (NT), number of panicles per hill (NP), total grain weight (total) Grain weight, TGW), number of total grains (NTG), number of spikelets per panicle (NSP), and 1,000 grain weight (1000 GW) were shown relatively. The control, Ilmi rice, is set at 100%.

Figure 5 is a graph showing the temperature and precipitation analysis of the experimental pavement at Kyungpook National University located in Hyoryeong-myeon, Gunwi-gun, Gyeongbuk for 3 years in 2016 (T ₅ ), 2017 (T ₆ ), and 2018 (T ₇ ):

(A) Average minimum temperature

(B) Average maximum temperature

(C) precipitation.

Figure 6 is a photograph of the transgenic rice introduced with the AK102606 gene, which was recovered after exposing it to a drought environment of 10% PEG400 for 5 days.

The present invention confirmed that resistance to environmental stress, antioxidant activity, and yield were increased by transforming rice into rice using the AK102606 gene represented by the nucleotide sequence of SEQ ID NO: 1 derived from rice ( Oryza sativa ).

In the present invention, rice ( Oryza sativa L. japonica ) AK102606 with increased environmental stress tolerance and antioxidant activity including the AK102606 gene represented by the nucleotide sequence of SEQ ID NO: 1 was entrusted to the Korea Research Institute of Bioscience and Biotechnology under the accession number KCTC 13810BP (2019.02. 13).

In addition, the biomass containing the AK102606 gene represented by the nucleotide sequence of SEQ ID NO: 1 of the present invention and rice ( Oryza sativa L. japonica ) AK102606 with increased yield were entrusted to the Korea Research Institute of Bioscience and Biotechnology as accession number KCTC 13810BP (2019.02. .13).

The AK102606 gene represented by the nucleotide sequence of SEQ ID NO: 1 may be an amino acid sequence represented by SEQ ID NO: 2.

The present invention includes the step of overexpressing the AK102606 gene by transforming a recombinant vector containing the AK102606 gene represented by the nucleotide sequence of SEQ ID NO: 1 derived from rice into rice, increasing the resistance to environmental stress, antioxidant activity, and yield. It is characterized in that it increases, but is not limited thereto.

In the present invention, "environmental stress" refers to an external factor that decreases the growth or productivity of a plant, and is largely classified into biological stress and abiotic stress. Biological stress includes pathogens, and non-biological stress includes high concentration of salt, drought (dry), low temperature, high temperature and oxidative stress. "Environmental stress tolerance" refers to a trait in which a decrease in growth or a decrease in productivity of a plant due to the above environmental stress is suppressed or delayed.

In the method according to the embodiment of the present invention, the environmental stress may be salt, low temperature, high temperature, or drought stress, but is not limited thereto.

In addition, variants of the base sequence are included within the scope of the present invention. Specifically, the gene includes a nucleotide sequence having sequence homology of at least 70%, more preferably at least 80%, even more preferably at least 90%, and most preferably at least 95% of the nucleotide sequence of SEQ ID NO: 1 can do. The% of sequence homology for a polynucleotide is identified by comparing two optimally aligned sequences with a comparison region, and some of the polynucleotide sequences in the comparison region are reference sequences (including additions or deletions) for the optimal alignment of the two sequences. May include additions or deletions compared to).

The term recombination refers to a cell in which a cell replicates or expresses a heterologous nucleic acid, or a cell expressing a protein encoded by a peptide, a heterologous peptide or a heterologous nucleic acid, wherein the recombinant cell is not in the natural form of the cell. The modified gene was reintroduced into the cell by artificial means. The gene may be in sense or antisense form.

In the present invention, the AK102606 gene sequence may be inserted into a recombinant expression vector.

The term "recombinant expression vector" of the present invention means a bacterial plasmid, phage, yeast plasmid, plant cell virus, mammalian cell virus or other vector. In general, any plasmid and vector can be used as long as they can replicate and stabilize in the host. An important characteristic of the expression vector is that it includes an origin of replication, a promoter, a marker gene, and a translational regulatory element.

In addition, the present invention is a step of transforming the plant cells of rice with a recombinant vector containing the AK102606 gene represented by the nucleotide sequence of SEQ ID NO: 1 derived from rice; And

It provides a method for producing a plant having increased environmental stress tolerance and antioxidant activity of the plant comprising the step of re-differentiating the rice plant from the transformed rice plant cells.

An expression vector comprising the AK102606 gene sequence of the present invention and an appropriate transcription/translational control signal can be constructed by methods well known to those skilled in the art. The method includes in vitro recombinant DNA technology, DNA synthesis technology, and in vivo recombinant technology. The DNA sequence can be effectively linked to an appropriate promoter in the expression vector to guide mRNA synthesis. In addition, the expression vector may include a ribosome binding site and a transcription terminator as a translation initiation site.

A preferred example of the recombinant vector of the present invention is a Ti-plasmid vector capable of transferring a part of itself, a so-called T-region, to plant cells when present in a suitable host such as Agrobacterium tumerfaciens. Another type of Ti-plasmid vector (see EP 0 116 718 B1) is currently being used to transfer hybrid DNA sequences into protoplasts from which new plants can be produced that properly insert plant cells or hybrid DNA into the plant's genome. . A particularly preferred form of Ti-plasmid vector is a so-called binary vector as claimed in EP 0 120 516 B1 and in US Pat. No. 4,940,838. Other suitable vectors that can be used to introduce the DNA according to the invention into a plant host are viral vectors such as those that can be derived from double-stranded plant viruses (e.g., CaMV) and single-stranded viruses, Gemini viruses, etc. For example, it can be selected from incomplete plant viral vectors. The use of such vectors can be advantageous especially when it is difficult to properly transform a plant host.

The method of the present invention includes transforming a plant cell with the recombinant vector according to the present invention, the transformation may be mediated by, for example, Agrobacterium tumefiaciens . In addition, the method of the present invention includes the step of regenerating a transformed plant from the transformed plant cell. Any method known in the art may be used as a method of regenerating a transformed plant from a transformed plant cell.

Transformed plant cells must be regenerated into whole plants. Techniques for the regeneration of mature plants from callus or protoplast cultures are well known in the art for a number of different species.

In addition, the present invention provides a transgenic plant and a seed thereof in which the content of biomass and yield is increased by controlling the tolerance to environmental stress produced by the above method.

The plants are Arabidopsis, potato, eggplant, tobacco, pepper, tomato, burdock, garland chrysanthemum, lettuce, bellflower, spinach, beetroot, sweet potato, celery, carrot, parsley, parsley, cabbage, cabbage, radish, watermelon, melon, cucumber, It may be a dicotyledonous plant such as pumpkin, gourd, strawberry, soybean, mung bean, kidney bean, and pea, or a monocotyledonous plant such as rice, barley, wheat, rye, corn, sugarcane, oats, onions, preferably monocotyledons, and more It may preferably be a rice plant, but is not limited thereto.

Hereinafter, the present invention will be described in more detail by examples. These examples are only

For the purpose of describing the present invention in more detail, it will be apparent to those of ordinary skill in the art that the scope of the present invention is not limited to these examples.

<Example 1> Experimental materials and methods

<1-1> Plasmid structure and transformation of rice

The full-length cDNA (GenBank accession no: AK102606) encoding the AK102606 gene was inserted into the binary vector p600-Rab21 (GenBank accession no: AB027256 Myeongji). The resulting gene structure was named AK102606 and transformed into a rice seedling ( O. sativa L. japonica cv. Japan and the United States) with Agrobacterium tumefaciens LBA4404. Agrobacterium tumefaciens LBA4404 was used to transform rice calli derived from scutellum of mature seeds of Japanese rice according to the conventional Agrobacterium tumefaciens mediated transformation method (Hiei et al. 1994). According to resistance to bialaphos and DNA genotyping, the AK102606 transformation line (T ₀ ) was selected, and a genetically modified organism (GMO) was transferred to the farmland of Kyungpook National University and T ₁ seed Were harvested, and the following year, T ₁ plants were transplanted to farmland to harvest T ₂ seeds. And T ₂ plants were evaluated for four independent AK102606 transgenic lines ( TG 1, 2, 3, 4) according to DNA genotyping.

<1-2> Plant material, growth condition, stress condition

Rice ( O. sativa L. var. japonica ) cv. Ilmi (WT) was used for transformation. Rice seeds were sterilized with 0.05% insecticide (SPOOTAC: prochloraz 25%) for 24 hours, rinsed thoroughly, and immersed in distilled water for 7 days in a growth chamber at 28°C. After seed germination, seedlings are transplanted into soil and grown in a greenhouse at 28°C to 32°C for 4 weeks (repeated cycle of 16 hours light condition and 8 hours dark condition), and then a genetically modified organism (GMO) at Kyungpook National University. It was used for stress test and cultivation in farmland. Four-week-old seedlings after sowing in a greenhouse were treated with salt (200 mM NaCl), low temperature (15℃), heat (42℃), and drought stress for 14, 7, 28, and 3 days, followed by control, Ilmi rice (WT) and transformants. The phenotype of (TG) was observed. T ₇ generations of 4 independent lines were used for further analysis.

<1-3> RNA extraction and RT-PCR (quantitative real-time PCR)

Total RNA was extracted from the leaves of TG and WT rice plants 4 weeks after transplantation according to the manufacturer's instructions using TRIzol reagent (Invitrogen, Waltham, MA, USA). The reverse transcription reaction was performed using 2 μg of total RNA using SuperScript III First-Strand Synthesis System (Invitrogen). In order to confirm AK102606 (accession number AK102606) expression, AK102606-F1 (5'-ATAGTTTGCGGTGGATCTGG-3' (SEQ ID NO: 3)) and AK102606-R1 (5'-CTTGGAGGTGCAGAGTTAGC-3' (SEQ ID NO: 4)) primer sets were used. Used. Tub-F (5'-GAGTACCCTGACCGCATGAT-3' (SEQ ID NO: 5)) and Tub-R (5'-GTGGTCAGCTTGAGAGTCCT-3' (SEQ ID NO: 6)) rice tubulin gene (accession number AK072502) with primer sets ) Was used as a positive housekeeping control under the same PCR conditions. To confirm the expression of three types of peroxidase genes PrxA2 (accession number AK104730), Prx11 (accession number AK060295), and Prx (accession number AF014467), PrxA2-F CCCAGCTGCCTAGCTAAATG (SEQ ID NO: 7), PrxA2-R TCCACGAGCTAACACAC number 8 ), Prx11-F TTGCTCTCTGCCTGGCTTGT (SEQ ID NO: 9), Prx11-R TTCGGGCAGGTCTTTGAGTAG (SEQ ID NO: 10), Prx-F CGTACGCTTGTATGCCAATG (SEQ ID NO: 11), Prx-R AGCATGCCACTCTTGTAGGG (SEQ ID NO: 12) primers were used.

For quantitative real-time PCR analysis, 2 μL of diluted (1:10) primary stand cDNA template and 18 μL of SYBR Green PCR master mix (Applied Biosystems, Foster, CA, USA) were used. The reaction was repeated 40 times at 95° C. for 10 minutes at an initial denaturation step, 95° C. for 15 seconds, and 60° C. for 10 minutes. Data was collected and analyzed using StepOne Software v2.1 (Applied Biosystems). Normalization and relative quantification were performed using the 2 ^-ΔΔCt method.

<1-4> H ₂ O ₂ analysis and lipid peroxidation

It was measured with leaves of rice plants exposed for 7 days of salt stress, 4 days of low temperature stress, 10 days of heat stress, and 2 days of drought stress.

Ferrous ammonium sulfate/xylenolorange (FOX) was used to measure the H ₂ O ₂ content of rice leaves. The composition of the FOX assay reagent is as follows: 250 μM of ferrous ammonium sulfate, 100 μM of sorbitol, 100 μM of xylenol orange and 25 mM of H ₂ SO ₄ . For each sample, 50 μL of a crude extract was added to 950 μL FOX assay reagent at room temperature, thoroughly mixed, and incubated in a dark room at 25° C. for 30 minutes. The absorbance was measured to be 560 nm. The concentration of hydroperoxide was determined by the standard curve using H ₂ O ₂ reported previously (Gay et al., 1999). The amount of malondialdehyde (MDA) derived from the oxidation of unsaturated fatty acids in membrane lipids was measured using total thiobarbituric acid reactant analysis. Specifically, -0.1 g of leaf samples were homogenized with liquid nitrogen and mixed with a solution containing 20% (w/v) trichloroacetate and 0.65% (w/v) thiobarbitusic acid. Then, it was heated in a water bath at 95° C. for 25 minutes, and then centrifuged at 12,000 rpm at 4° C. for 10 minutes (Hodges et al., 1999). Finally, the MDA concentration of the resulting supernatant was measured at 532 nm based on 600 nm, and was calculated using a molar extinction coefficient of 1.56 x 10 ⁵ cm ^-1 M ^-1 for MDA (Gueta -Dahan Y et al., 1997). The results of hydroperoxide and MDA are shown based on WT rice (100%).

<1-5> Early growth evaluation

In order to evaluate the environmental adaptation of plants in paddy fields with severe daily temperature differences, 4 rice plants per independent line were sampled 4 days after transplantation and root lengths were measured at 4 days intervals. At one month after transplanting, 4 rice plants per independent line were sampled to measure fresh weight and dry weight.

<1-6> Histochemical staining

O ^2- produced by stress in leaves was detected by staining with 1% nitro blue tetrazolium (NBT) in 10 mM sodium phosphate buffer until indigo color appeared (Lin et al., 2009), and H ₂ O ₂ was detected in plants. It was detected by incubation with 3,3-diaminobenzidine (DAB)-HCl (pH 3.8) until a reddish brown color appeared in the growth chamber (Thordal-Christensen et al., 1997). .

<1-7> Methylviologen (MV) treatment and ion leakage analysis

The leaves of TG and WT rice grown for 6 weeks in paddy fields were divided into 10 pieces each 1 cm in size. Ten leaf pieces were suspended in a 10 μM MV (methyl viologen) solution (9.0 cm diameter Petri dish), and incubated in a dark room at 20° C. for 12 hours to diffuse MV into the pieces. After pre-cultivation, the leaf pieces were left on the plant growth bed (16 hours light condition and 8 hours dark condition) at 20°C for 72 hours (Kwon et al., 2003). Ion leakage was measured at a designated time for 72 hours using an ion conductivity meter (455C, Isteck Co. Ltd., Seoul, Korea). Then, the sample was autoclaved at 121° C. for 15 minutes to release the ions of the cells. After autoclaving, ion leakage of the sample was measured again, and counter ion leakage was calculated using these values.

<1-8> Evaluation of agricultural characteristics of rice grown in paddy fields

In order to investigate the yield of TG rice in natural paddy conditions, four independent strains of WT rice and TG rice grown in a greenhouse for one month were selected in 2016 (T ₅ ), 2017 (T ₆ ) and 2018 (T ₇ ). In the rice fields located in GMO packaging (Gunwi) under Kyungpook National University, one transplant was carried out per hill at intervals of 20 x 60 cm. When the rice grown in the paddy field matured and the ear was growing, the seeds were harvested by hand. Total plant fresh weight (TPW), stem weight (CW), number of tillers (NT), number of panicles per hill (NP), total grain weight (total) Grain weight, TGW), number of total grain per panicle (NTG), number of spikelets per panicle (NSP), and 1,000 grain weight (1000 GW) I did.

<1-9> Statistical analysis

H ₂ O ₂ , MDA, and relative agronomic traits were calculated based on rice (100%) of WT (wild type), and at least 3 experiments were performed to obtain biochemical results.

<Example 2> Experimental results

<2-1> AK102606 Tolerance analysis of transgenic rice with gene introduction according to abiotic stress

Transgenic rice into which the AK102606 gene was introduced was analyzed for resistance to abiotic stresses such as salt (200 mMNaCl), low temperature (15°C), heat (42°C) and drought stress in a greenhouse.

As a result, in the transgenic rice into which the AK102606 gene was introduced, the survival rate was higher under all stress than the control, Ilmi rice (WT) (Fig. 1A).

In addition, after exposing the transgenic rice to which the AK102606 gene was introduced to salt and cold stress for 12 hours and to heat and drought stress for 24 hours, qPT-PCR was performed to confirm the expression of the AK10206 gene and the peroxidase ( Prx ) gene.

As a result, the AK102606 gene was highly expressed in the transformant compared to Japan and the United States (FIG. 1B), and thus 3 types of Prx genes were also highly expressed (FIG. 1C). In particular, it was highest in heat stress.

<2-2> AK102606 Analysis of Antioxidant Activity of Transgenic Rice Introduced Genes

In order to confirm the antioxidant ability of transgenic rice with AK102606 gene introduced, H, an active oxygen produced in the leaves of rice plants exposed for 7 days of salt, salt stress, 4 days of low temperature stress, 10 days of heat stress, and 2 days of drought stress. ₂ O ₂ and the resulting fatty acid (MDA) value was measured.

As a result, the amount of active oxygen and oxidized fat of the transformant was lower than that of Japan and the United States of the control (Fig. 1D, E).

As a result, the transformant into which the AK102606 gene of rice was introduced increased the expression of the antioxidant gene than that of the control, Ilmi rice, so that the antioxidant capacity was increased and was resistant to all stresses.

When recovering after treatment with 10% PEG, it was confirmed that the AK102606 transgenic rice had a higher recovery rate than that of the control Japanese rice, and thus had resistance to drought stress (FIG. 6 ).

<2-3> AK102606 Early growth analysis of transgenic rice with gene introduction

After transplanting to the GMO test site of Kyungpook National University located in Hyoryeong-myeon, Gunwi-gun, Gyeongsangbuk-do, in order to observe the initial growth stage of each transgenic rice plant, the plant was pulled from the fourth day after transplanting, and the root length was measured. The biomass and dry weight of were measured.

As a result, in the early stage of growth, the transformant continued to have superior root length and growth status compared to the Japanese and American controls (Fig. 2C), and the phenotype and biomass of the plant at one month were also introduced with the AK102606 gene compared to the Japanese and American controls. Excellent results were shown in the converted rice (Fig. 2A, D).

As a result, the transgenic rice introduced with the AK102606 gene showed superior adaptability to nature at the early stage of growth compared to Japanese and American controls.

<2-4> AK102606 Analysis of growth status and antioxidant capacity of transgenic rice with gene introduction

The seedlings of the transgenic rice with the AK102606 gene introduced were transplanted to the experimental package of Kyungpook National University located in Hyoryeong -myeon, Gunwi-gun, Gyeongsangbuk-do, and then the increase in the number of seeds, ROS staining, and ion leakage were analyzed from 4 to 7 weeks.

As a result, between 6 and 7 weeks after transplantation, the number of powders rapidly increased, and the increase rate of transformants was higher than that of the control (FIG. 3B ). NBT (binding with superoxide) and DAB (binding with H ₂ O ₂ ) staining were performed to confirm the antioxidant ability from 6 weeks old leaves after transplantation, and ROS production was lower in the leaves of the transformant compared to the control group Ilmi rice. It was confirmed (Fig. 3C).

In addition, after treatment with 10 μM of MV (photosynthesis inhibitor and ROS inducer) on the same leaf for 72 hours, the amount of ions leaked during cell destruction was measured, and NBT staining was performed to confirm the amount of ROS generated at 72 hours. In Japanese rice, more ROS than the transformant was generated and the content of leaked ions was high (Fig. 3D). Since the antioxidant ability against these environmental stresses, photosynthesis blockers and active oxygen inducing agents was high in the transformants, as a result, the initial phenotype and growth rate were excellent in the group experimental packaging as shown in Example 2-3.

<2-5> AK102606 Analysis of the yield of transgenic rice with gene introduction

For 2016 (T ₅ ), 2017 (T ₆ ), and 2018 (T ₇ ), the seedlings of transgenic rice with the AK102606 gene introduced were transplanted into the experimental field at Kyungpook National University located in Hyoryeong -myeon, Gunwi-gun, Gyeongsangbuk-do. Total plant weight (TPW), stem fresh weight (CW), number of stalks (NT), and number of ears per ridge (NP), which are indicators that can confirm the increase in biomass of transformants compared to Japan and the US for 3 years with different climatic conditions. All increased.

In addition, compared to Japan and the US control, the total grain weight (TGW), total grain count (NTG), side index per ear (NSP) and 1,000 grain weight, which are indicators that can confirm the increase in productivity of transformants, 1000GW) all increased.

Therefore, the transformant overexpressing the AK102606 gene increased antioxidant capacity in natural paddy fields with various environmental stresses than the control, Ilmi rice, resulting in superior initial growth, resulting in increased yield (FIG. 4 ).

<2-6> AK102606 Analysis of temperature and drought stress tolerance and productivity increase of transgenic rice with gene introduction

During 2016 (T ₅ ), 2017 (T ₆ ), and 2018 (T ₇ ), the temperature and precipitation were measured after transplanting the seedlings of the transgenic rice with the AK102606 gene introduced into the experimental field at Kyungpook National University located in Hyoryeong -myeon, Gunwi-gun, Gyeongsangbuk-do.

As a result, in May-June when rice is transplanted, the average temperature is 10°C or less (FIG. 5A), and in August when the rice is growing in full swing, the average temperature is 40°C (FIG. 5B). In September-October, when the rice is mature, the temperature drops below 5℃ (Fig. 5A).

Plants transplanted to the packaging are unintentionally subjected to low and high temperature stress. And there is a difference in precipitation every year for three years (Fig. 5C). Even under different climatic conditions for 3 years, the yield of the transgenic rice introduced with the AK102606 gene continued to show a similar pattern (FIG. 4).

<2-7> AK102606 Analysis of drought stress tolerance of transgenic rice with gene introduction

The transformant into which the AK102606 gene was introduced was exposed in a cold chamber at 10° C. for a certain period (about 7 days), and then moved to a normal 28° C. chamber and grown, and the change in growth of the transgenic rice according to the cold stress was observed.

Specifically, the transformant 4 plant into which the AK102606 gene was introduced was transferred to a 50 ml conical tube, treated with 10% polyethylene glycol (PEG), which interferes with the water absorption of the plant, and then visually observed the phenotypic change over time, After the stress was treated for 5 days, it was observed to recover with normal water.

As a result, when recovered after treatment with 10% PEG, it was confirmed that the transformant introduced the AK102606 gene had a higher recovery rate than that of Japanese rice in the control, and thus had resistance to drought stress (FIG. 6 ).

[Microorganism deposit certificate]

Name of deposit institution: Korea Research Institute of Bioscience and Biotechnology

Accession number: KCTC 13810BP

Consignment Date: 2019213

Claims (13)

1. Rice ( Oryza sativa ) A method for increasing the environmental stress tolerance and antioxidant activity of plants comprising the step of overexpressing the AK102606 gene by transforming a recombinant vector containing the AK102606 gene represented by the nucleotide sequence of SEQ ID NO: 1 in rice.
2. The method of claim 1, wherein the environmental stress is salt, low temperature, high temperature or drought stress.
3. Transforming the plant cells of rice with a recombinant vector containing the AK102606 gene represented by the nucleotide sequence of SEQ ID NO: 1 derived from rice ( Oryza sativa ); And

   A method for producing a plant having increased environmental stress tolerance and antioxidant activity, comprising the step of re-differentiating a rice plant from the transformed rice plant cells.
4. Transgenic plants with increased environmental stress tolerance and antioxidant activity produced by the method of claim 3.
5. The seed of the plant according to claim 4.
6. AK102606 derived from rice ( Oryza sativa ) consisting of the nucleotide sequence of SEQ ID NO: 1 A composition for increasing environmental stress tolerance and antioxidant activity of plants containing a gene.
7. Rice ( Oryza sativa L. japonica ) AK102606 (KCTC 13810BP) with increased environmental stress tolerance and antioxidant activity including the AK102606 gene represented by the nucleotide sequence of SEQ ID NO: 1.
8. Rice ( Oryza sativa ) The biomass and yield of plants including the step of overexpressing the AK102606 gene by transforming rice with a recombinant vector containing the AK102606 gene represented by the nucleotide sequence of SEQ ID NO: 1 How to increase.
9. Transforming the plant cells of rice with a recombinant vector containing the AK102606 gene represented by the nucleotide sequence of SEQ ID NO: 1 derived from rice ( Oryza sativa ); And

   A method for producing a plant with increased biomass and yield comprising the step of regenerating a rice plant from the transformed rice plant cells.
10. A transgenic rice plant with increased yield and biomass produced by the method of claim 9.
11. The seed of the plant according to claim 10.
12. Rice consisting of the nucleotide sequence of SEQ ID NO: 1 ( Oryza sativa ) containing the A102606 gene derived, a composition for increasing the biomass and yield of plants.
13. Rice ( Oryza sativa L. japonica ) AK102606 (KCTC 13810BP) with increased yield and biomass containing the AK102606 gene represented by the nucleotide sequence of SEQ ID NO: 1.

Images