CN103290023A - Gene 03g induced to express by tissue culture and preparation method and application - Google Patents
Gene 03g induced to express by tissue culture and preparation method and application Download PDFInfo
- Publication number
- CN103290023A CN103290023A CN2012100513130A CN201210051313A CN103290023A CN 103290023 A CN103290023 A CN 103290023A CN 2012100513130 A CN2012100513130 A CN 2012100513130A CN 201210051313 A CN201210051313 A CN 201210051313A CN 103290023 A CN103290023 A CN 103290023A
- Authority
- CN
- China
- Prior art keywords
- expression
- gene
- dna
- tissue culture
- callus
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a gene 03g induced to express by tissue culture in rice and an application. Through a known public database, genes specifically expressed by callus are sieved and the gene 03g after callus induction is expressed continuously, that is, after callus differentiation, 03g is still expressed in high quantity when other genes lose expression activity. Through hybridization of 0.3g expressed plant with wild plant, expression of the 03g is not affected by the other parent. Therefore, expression or no expression of 03g or not can be used to detect whether the rice plant is transgenetic or not. Molecular biological experiments show that expression of 03g is regulated by DNA (Deoxyribonucleic Acid) methylation and histone methylation. Expression of 03g provided by the invention is epigenetically regulated, and the expression mode can be applied to detecting transgenetic rice.
Description
Technical field
The invention belongs to the plant gene engineering technology field.Be specifically related to a gene 03g who is subjected to the tissue culture abduction delivering, also relate to a regulation and control model that is subjected to the gene 03g of tissue culture abduction delivering simultaneously, also relate to a kind of purposes that is subjected to the gene 03g of tissue culture abduction delivering, spend during described gene can be used for 11 with the detection of bright extensive 63 transgenic paddy rices.
Technical background
The epigenetic regulation and control refer under the prerequisite that does not change dna sequence dna, are basic substance with chromatin, the spatial and temporal expression of regulatory gene, thereby regulating cell activity and ontogeny and environmental response.Dna methylation and histone modification are the chief components of apparent regulation and control.Dna methylation generally refers to the modification that methylates of the cytosine(Cyt) base of DNA.The end (tail) that histone modification refers to constitute the histone of nucleosome skeleton can take place as methylate, covalent modification such as acetylize; the genetic expression that these modifications are regulated and control respective regions by structure and the identification of chromatinic albumen of change nucleosome (Kouzarides.Chromatin modifications and their function.Cell.2008,128:693-705).In the process of regulate gene expression, the expression that the dna methylation of methylate the especially promotor and transcription initiation site of DNA can suppressor gene is one of item key of genetic expression silence; Methylating of histone can be because the difference in the site of modifying produces different effects to genetic expression, for example the trimethylammoniumization (H3K4me3) of the 4th Methionin of histone H 3 is the active sign of expressing of gene, the dimethylization (H3K9me2) of the 9th Methionin then is heterochromatic sign, the expression of suppressor gene.
Whether expression of gene is by the coefficient synthesis result of a lot of regulatory pathways with expression pattern, and epigenetic is regulated and control as one of its main control methods, and also multiple mode is carried out jointly when regulate gene expression.For example, DNA methylate and the modification of histone H 3 K9 is mutually promoted and is interdepended, the expression of suppressor gene then (Jackson et al.Control of CpNpG DNA methylation by the KRYPTONITE histone H3 methyltransferase.Nature.2002,416:556-560.).Interaction between the mode of the especially apparent regulation and control of various control measures is becoming focus in the research of the epigenetic memory of gene expression regulation.
Grain security has been a global difficult problem.Paddy rice to alleviating food shortage, ensures especially that the grain security of China has great significance as one of the staple food crop in the whole world, how to improve rice yield and quality and has become a significant problem in science.Simultaneously, as the model animals of grass research, the research of related fields also has suitable theory significance.The research of transgenic paddy rice may be created in the kind of having outstanding performance in aspects such as output, quality and environmental adaptation, provides a new selection for alleviating the grain security problem.Yet still there is certain uncertainty in the genetically modified research of present stage, need carry out strict management for transgenic plant, field planting will be treated with a certain discrimination, monitors the flow direction of transfer-gen plant in real time, so the research of the detection means of transfer-gen plant seems extremely important.
Summary of the invention
One object of the present invention has been to provide a kind of gene 03g that is subjected to the tissue culture abduction delivering, and this gene is subjected to dna methylation and the methylated regulation and control of histone H 3 K4.This gene is not expressed owing to dna methylation under the wild-type status, group training dedifferentiation becomes callus that the DNA demethylation takes place later on to begin active the expression, because the DNA demethylation causes that histone H 3 K4me3 is remembered this expression of gene pattern, express thereby still continue a large amount after differentiation and among the offspring simultaneously.Because the Study of Interaction of this apparent regulation and control is just risen, the research in paddy rice even whole plants field is very few especially, so this invention has important innovative significance in the theoretical investigation field of gene expression regulation.
Another object of the present invention has been to provide the application of a kind of separated DNA fragment in the transgenic paddy rice context of detection.Present transgenic paddy rice substantially all is that the method by agriculture bacillus mediated tissue culture obtains, because gene 03g of the present invention is through namely express after the tissue culture and can be remembered by heredity always, so gene provided by the invention can be used for the detection of transgenic paddy rice, enrich the detection means of transgenic paddy rice.
In order to realize above-mentioned purpose, the present invention is achieved through the following technical solutions:
The foundation of the expression pattern of a gene 03g sequence that is subjected to the tissue culture abduction delivering: the applicant is by retrieval rice at whole growth periods express spectra database (http://crep.ncpgr.cn), and the gene of screening callus specifically expressing also designs primer.By detecting these genes before callus of induce, behind the callus of induce and the expression pattern after the callus differentiation finds that one of them gene 03g does not express before callus of induce, begin behind the callus of induce to express, and after differentiation same the expression.The number of landing of this gene is LOC_Os03g02470, and cDNA total length number is AK102606, and gene I number is 32987815.Pcr amplification obtains a kind of separated DNA fragment, and its sequence is the nucleotide sequence shown in the SEQ ID NO:1.This section sequence encoding position albumen under normal circumstances is in not expression status, the expression but the process of process tissue culture will be activated, and in case just be in expression status after activating always and then pass to the offspring.
Foundation of being disposed the regulation and control model of cultivating abduction delivering gene 03g: compare the material that 03g does not express and expresses by the dna methylation order-checking, find that 03g is subjected to the regulation and control of dna methylation, the transcription initiation site dna methylation of 03g is serious in the material of not expressing, and should demethylation take place the zone in the material of expressing; (H3K4me3 of the transcription initiation site of the 03g that discovery is expressed raises for Chromatin Immunoprecipitation, the histone modification in method detection 03g site ChIP), and this is a kind of sign of transcriptional activation to utilize the chromatin immunoprecipitation.Above result shows that 03g is subjected to the acting in conjunction of multiple apparent control methods.
One is subjected to tissue culture abduction delivering gene 03g to detect application in (in spend 11 with bright extensive 63 transgenic paddy rices) at transgenic paddy rice: the offspring who detects the material that 03g expresses finds that the DNA of transcription initiation site of 03g and the modification of histone can entail the offspring.With the 03g material of expressing and the wild-type material hybridization of not expressing, detect the expression of 03g in for the offspring at F2, the ratio of the material of expressing and the material of not expressing of finding was near 3: 1, it is stable when the expression of 03g is described, be not subjected to the influence of other genome backgrounds, therefore the expression pattern of 03g can be used for the detection of transgenic paddy rice, even the father and mother of hybrid rice have only one through transgenosis.Among the present invention, spend 11 (ZH11 in the process tissue culture of expressing with 03g, see genetic resources table 1) the bright extensive 63 (MH63 of the wild-type do not expressed with 03g, see genetic resources table 2) hybridization after, F2 for material in the expression of 03g present Mendelian inheritance and separate (see figure 5), illustrate that the expression of 03g is very stable.
Advantage and the effect of invention
Compared with prior art, the present invention has the following advantages and effect:
1) epigenetic is focus and the forward position of gene expression regulation research, comprise the research of multiple control methods such as the modification of DNA and histone and identification thereof, there is mutual effect in up-to-date these control methods of discovering, but the research of this respect has just been opened one jiao of the iceberg at present.The present invention has obtained expression pattern and control methods that are subjected to the gene 03g of dna methylation and histone methylated regulation and control in paddy rice, and has studied the interaction of these two kinds of modifications, the abundant and perfect theoretical basis of apparent regulation and control.
2) transgenic technology might produce the transgenic paddy rice of high yield, high-quality and good stress resistance, but because still there are a lot of uncertain factors in present genetically modified research, so the plantation of transgenic paddy rice needs strict monitoring and management.Mostly present detection means is to detect the existence whether exogenous dna fragment is arranged by the method for PCR, but because the diversity of the external source fragment that changes over to need be selected special primer targetedly.The 03g of the present invention's preparation is as long as will express through tissue culture, and in hybridization and offspring's reproductive process, express stable, therefore can be used for detecting transgenic paddy rice, simultaneously because 03g is the intrinsic gene of paddy rice, there is not the restriction of the external source fragment that changes over to, the detection means of abundant transgenic paddy rice has application prospect.
Description of drawings
Fig. 1 is a kind of express spectra synoptic diagram that is subjected to the gene 03g of tissue culture abduction delivering.
Callus grows back 03g and just is in expression status always.1. seed is induced the bud (callus does not also induce) that grows after 7 days; 2. seed is induced the bud that grows after 11 days; 3. seed is induced the callus that grows after 11 days; 4. through subculture callus once; 5. be in the callus (bud of existing differentiation grows) of differential period; 6. the seedling that differentiates of callus; Actin is the confidential reference items of the applied sample amount of cDNA.
Fig. 2 modifies the spectrum synoptic diagram for a kind of transcription initiation region of the gene 03g of tissue culture abduction delivering that is subjected in wild-type with through the dna methylation in the material of tissue culture.
In the material of expressing the generation of the transcription initiation site of 03g tangible DNA demethylation.
The rectangular frame of black represents the promoter region of 03g, and the rectangular frame of grey represents the transcriptional domain of 03g; The methylated degree of ordinate zou representation DNA.
Fig. 3 composes synoptic diagram for a kind of transcription initiation region of the gene 03g of tissue culture abduction delivering that is subjected in wild-type with through the histone H 3 K4 trimethylammonium modification in the material of tissue culture.
The rectangular frame of black represents the promoter region of 03g, and the rectangular frame of grey represents the transcriptional domain of 03g; The position of X-coordinate digitized representation base, transcription initiation site is decided to be 0; Ordinate zou represents the degree of the trimethylammoniumization of histone H 3 K4.
Fig. 4 A is a kind of synoptic diagram that is expressed in the heredity memory among the tissue culture material offspring that is subjected to the gene 03g of tissue culture abduction delivering.
Show after 03g expresses and in the offspring, to be remembered.Actin is the confidential reference items of the applied sample amount of cDNA.
Fig. 4 B is the synoptic diagram of the heredity memory of dna methylation level in tissue culture material offspring of a kind of gene 03g that is subjected to the tissue culture abduction delivering.
The dna methylation level of 03g is remembered in the offspring.HaeIII, HpaII and MspI are respectively to the dna methylation sensitivity of CHH, CG and three kinds of forms of CHG, if the i.e. identification of this enzyme is asked dna methylation occurred then can't finish cutting, the pcr amplification that carries out specific gene as template with this DNA just can amplify band again, otherwise can't amplify band owing to the DNA chain is cut off then.Contrast refers to not contain the gene order of this enzyme recognition site.
Fig. 4 C is the synoptic diagram of the heredity memory of histone H 3 K4 trimethylammonium level in tissue culture material offspring of a kind of gene 03g that is subjected to the tissue culture abduction delivering.
The histone H 3 K4 trimethylammoniumization of the rising of 03g is remembered in the offspring.The position of X-coordinate digitized representation base, transcription initiation site is decided to be 0; Ordinate zou represents the degree of the trimethylammoniumization of histone H 3 K4.
Fig. 5 is that a kind of gene 03g of tissue culture abduction delivering that is subjected to is at the expression synoptic diagram of the hybridization F2 of wild-type and tissue culture and inducement plant in generation.
Statistical presentation and the plant quantity of not expressing are 39: 16 (2.44: 1), near 3: 1, meet mendelian inheritance, illustrate that the expression of 03g is highly stable, are not subjected to the influence of other genome environment.Actin is the confidential reference items of the applied sample amount of cDNA.
Fig. 6 A is the expression synoptic diagram of 03g among a kind of wild-type material through the dna methylation inhibitor processing and the offspring thereof.
The expression of 03g is also arranged among the wild-type material that the process dna methylation inhibitor is handled and the offspring thereof, illustrate that the DNA demethylation of 03g can cause its expression and can entail the offspring.
Fig. 6 B is the dna methylation situation synoptic diagram of 03g among a kind of wild-type material through the dna methylation inhibitor processing and the offspring thereof.
The DNA demethylation has also taken place in 03g among the wild-type material that the process dna methylation inhibitor is handled and the offspring thereof, illustrates that the DNA demethylation state of 03g can entail the offspring.CG, CHG and the different type that methylates of CHH representative, ordinate zou represents the degree of the trimethylammoniumization of histone H 3 K4.
Fig. 6 C is a kind of histone H 3 K4 trimethylammonium modification situation synoptic diagram through 03g in the wild-type material of dna methylation inhibitor processing.
Embodiment
Embodiment 1:
The preparation method of the expressed sequence of a kind of gene 03g that is subjected to the tissue culture abduction delivering the steps include:
To the gene (AK102606 that wants required for the present invention, http://www.ncbi.nlm.nih.gov/nuccore/32987815), it is main that (referring to J. Sa nurse Brooker, EF is the Ritchie not, T Manny A Disi work by the RT-PCR method, Huang Peitang, Wang Jiaxi etc. translate, molecular cloning experiment guide (third edition), Beijing, Science Press, 2002 editions) increasing obtains one section sequence of 03g gene specific:
1) A, extracting induce the bud (callus does not also induce) that grows after 7 days from RNA[in each period in the rice tissue culturing process; B, seed are induced the bud that grows after 11 days; C, seed are induced the callus that grows after 11 days; D, process subculture callus once; E, be in the callus (existing differentiation bud grow) of differential period; The seedling that F, callus differentiate], RNA extracting reagent is the Trizol extraction agent box (the concrete operations step is seen the test kit specification sheets) of Invitrogen company;
2) step of synthetic cDNA first chain of reverse transcription is as follows among the RT-PCR: 1. join mixed solution 1: total RNA 2 μ g, DNaseI 2U, 10x DNAseI buffer 1 μ l, add DEPC (diethylpyrocarbonate, the strongly inhibited agent of RNA enzyme) handles water (0.01%DEPC) to 10 μ l, behind the mixing mixed solution 1 is placed 20 minutes to remove DNA at 37 ℃, 2. place 65 ℃ of water-bath temperature to bathe 10 minutes to remove DNAse I activity mixed solution 1 after 20 minutes, placed then 5 minutes on ice, 3. the oligo (dT) that adds 1 μ l, 500 μ g/ml in the mixed solution 1,4. will place 65 ℃ of water-bath temperature to bathe at the mixed solution 1 of cooled on ice immediately 10 minutes, thoroughly to make the RNA sex change, placed then 5 minutes on ice, 5. join mixed solution 2: mixed solution 110 μ l, 5x first strand buffer 4 μ l, 0.1M DTT (mercaptoethanol) 2 μ l, 10mM dNTP mixture 1.5 μ l, DEPC handles water 0.5 μ l, ThermoScript II 2 μ l, behind the mixing mixed solution 2 placed in 42 ℃ of water-baths temperature to bathe 1.5 hours, 6. place 90 ℃ to do bath 3 minutes mixed solution 2 after reacting end, 7.-20 final product is reacted in a ℃ preservation, and the reagent of using in the reaction is all available from Invitrogen company; The full length cDNA sequence of the 03g gene of announcing according to ncbi database (http://www.ncbi.nlm.nih.gov) then, design special primer pcr amplification specific fragment.The system that PCR uses is 20 μ l, specifically joins method to be: the cDNA first chain template 1 μ l, 10xPCR buffer 2 μ l, 2mM dNTP 2 μ l, each 0.4 μ l of forward primer and reverse primer, LATaq enzyme 0.2 μ l adds water to 20 μ l (used PCR buffer, dNTP, Mg
2+, LATaq enzyme etc. is all available from precious biotechnology Dalian company limited).The PCR reaction conditions is as follows: 1. 94 ℃ 4 minutes, 2. 94 ℃ 30 seconds, 3. 56 ℃ 30 seconds, 4. 72 ℃ 60 seconds, 5. from 2.-4. circulating 30 times, 6. 72 ℃ 7 minutes, 7. 4 ℃ of preservations.Obtain a kind of separated DNA fragment, its sequence is the nucleotide sequence shown in the SEQ ID NO:1.The primer sequence is as follows:
03gRT-F (forward primer) 5 '-GTGTGAGC TCTCTGAACCTCCTAG-3 '
03gRT-R (reverse primer) 5 '-GACCATCTTCCTGAAAGGTAATG-3 '
The result produces seedling differentiation from callus as shown in Figure 1, and 03g is in the activation expression status always.
Embodiment 2:
Express material by the method for bisulfate dna methylation order-checking at 03g and (spend 11 materials in through the tissue culture generation, see genetic resources table 1) and the material of not expressing (wild-type in spend 11, see genetic resources table 1) in its dna methylation is detected, specific implementation method is as follows:
1) genomic dna of extracting material, method for extracting are CTAB method (Zhang etc., genetic diversity and differentiation of indica an japonica rice detected by RFLP analysis, 1992, Theor Appl Genet, 83,495-499).Handle the genomic dna of each material with bisulfate, method therefor is that (EpiTect Bisulfite Kit, article No.: 59104), concrete grammar is referring to operation instruction available from the test kit of QIANGEN company.
2) with 1) in the DNA that obtains be template, the primer of the dna methylation order-checking of design 03g carries out pcr amplification, the design of primers instrument is http://www.urogene.org/methprimer/index1.html, using method specifies referring to the website.The pcr amplification system is: 1 μ l template, and 10xPCR buffer 2 μ l, 2mM dNTP 2 μ l, each 0.4 μ l of forward primer and reverse primer, rTaq enzyme 0.2 μ l adds water to 20 μ l (used PCR buffer, dNTP, Mg
2+, LATaq enzyme etc. is all available from precious biotechnology Dalian company limited).The PCR reaction conditions is as follows: 1. 94 ℃ 4 minutes, 2. 94 ℃ 30 seconds, 3. 50 ℃ 30 seconds, 4. 72 ℃ 60 seconds, 5. from 2.-4. circulating 35 times, 6. 72 ℃ 7 minutes, 7. 4 ℃ of preservations.The PCR product cloning that obtains is gone up (available from Pu Luomaige (Beijing) Bioisystech Co., Ltd, i.e. U.S. Promega company) to T carrier pGEMT-vector.The primer sequence of using is:
BS03g-F (forward primer) 5 '-ATAGAGAGAAAAAGAAAGTTTTATTTT-3 '
BS03g-R (reverse primer) 5 '-ACTCCAACAACTCAACTAACTCTACAC-3 '
3) picking positive colony behind the transformed into escherichia coli, (it is synthetic that the worker is given birth in Shanghai with the T7 primer for the extracting plasmid, TAATACGACTCACTATAGGG) check order, each material is selected the clone more than 20, the processing tool of sequencing result is http://katahdin.mssm.edu/kismeth/revpage.pl, and concrete operation method is referring to site description (http://katahdin.mssm.edu/kismeth/revpage.pl).
The result as shown in Figure 2, the dna methylation level of the 03g that activate to express is in very low state, the activation of hint 03g is expressed may be relevant with methylating of DNA.
Embodiment 3:
Utilize the histone modification situation of the method detection 03g of chromatin immunoprecipitation, concrete operation method is as follows:
1) material that material: 03g expresses is spent 11 materials (seeing genetic resources table 1) in producing through tissue culture, the material that 03g does not express be wild-type in spend 11 materials (seeing genetic resources table 1).
2) get 14 days seedling of growth, be immersed in (0.4M sucrose, 10mM Tris-HCl pH8,10mM MgCl in the extraction buffer 1 that contains 1% (volume) formaldehyde
2The 5mM beta-mercaptoethanol, proteinase inhibitor), vacuumized 30 minutes, add the glycine 2.5ml of 2M again, continued to vacuumize 5 minutes.Take out material then and blot with after twice of the distillation washing, it is freezing rapidly to put into liquid nitrogen, grinds, and according to 1: 2 ratio of mass/volume powder is joined in the extraction buffer 1, places on ice mixing 30 minutes.Centrifugal 20 minutes of 4000rpm under the 4 degree conditions outwells supernatant liquor gently again, adds extraction buffer 2 (0.25M sucrose, 10mM Tris-HCl pH8, the 10mM MgCl of 1ml in the precipitation
21%Triton X-100,5mM beta-mercaptoethanol, proteinase inhibitor), inhale gently on ice and beat mixing, centrifugal 10 minutes of 12000rpm under the 4 degree conditions abandons supernatant again, adds 300 μ l extraction buffers, 3 (1.7M sucrose, 10mM Tris HCl pH8,0.15%Triton X-100,2mM MgCl
2, 5mM beta-mercaptoethanol, proteinase inhibitor) inhale on ice and beat mixing, adding 300 μ l extraction buffers 3 in a new centrifuge tube, the product of mixing is added in above it gently, is stratification state at this moment, 13000rpm is centrifugal 60 minutes under the 4 degree conditions, abandons supernatant.Adding 300 μ l lysis buffers (50mM Tris HCl pH8,10mM EDTA, 1%SDS, proteinase inhibitor) in the precipitation inhales on ice and leaves standstill cracking 15-20 minute (avoiding producing bubble) on ice after beating mixing.Product after the cracking takes out 20 μ l in contrast, the remaining ultrasonic wave of beating, and parameter is: 15 seconds/time * 2 times, 10 seconds/time * 2 times, the ultrasonoscope energy was set to 4.Get 20 μ l ultrasonic wave products again, the contrast together with taking out before behind moisturizing to the 500 μ l, adds the 5M NaCl of 20 μ l, places 65 degree water-baths to separate crosslinked spending the night.Remaining ultrasonic wave product places-20 degree stand-by.Second day, get and separate crosslinked product, add isopyknic chloroform: primary isoamyl alcohol=24: 1 mixtures, mixing, 12000rpm is the careful supernatant of drawing after centrifugal 5 minutes, add the 3MNaAC of 1/10 volume and the dehydrated alcohol of 2 times of volumes and be placed on-70 degree 30 minutes, 12000rpm is centrifugal 15 minutes again, 75% (volume ratio) ethanol is washed once, and the back super clean bench dries up, the agarose gel that adds after the 20 μ l water dissolution with 1% (mass/volume than) detects, and the fragment after the ultrasonic wave concentrates on 100bp-500bp with main brightness and is advisable.Get 40 μ l albumin A-magnetic beads, with dilution damping fluid (1%Triton, 1.2mM EDTA, 16.7mM Tris-HCl pH8,167mM NaCl) washes 3 times, add the special antibody of 4 μ l again and be diluted to 1ml with the dilution damping fluid, under 4 degree conditions, mixed 2 hours.Get and beaten hyperacoustic product, 12000rpm is centrifugal 10 minutes under the 4 degree conditions, gets 30 μ l supernatants and places-20 degree frozen as input, respectively gets 100 μ l supernatants again and joins in the centrifuge tube that antibody-magnetic bead mixes, and 4 degree mix and spend the night.Second day, centrifuge tube is placed on the magnetic force frame, rise and remove supernatant, use low salt buffer (150mM NaCl, 0.1%SDS, 1%TritonX-100 successively, 2mM EDTA, 20mM Tris-HCl pH8.0), high-salt buffer (500mM NaCl, 0.1%SDS, 1%TritonX-100,2mM EDTA, 20mM Tris-HCl pH8.0), LiCl damping fluid (0.25M LiCl, 1%NP40,1%sodium deoxycholate, 1mM EDTA, 10mM Tris-HCl pH8.1) and TE damping fluid (10mM Tris-HCl pH8.0,1mM EDTA) respectively wash (for the first time liquid flush away residual on the tube wall get final product, spend mixing, washings 4 for the second time) twice.To washing elution buffer (1%SDS, the 0.1M NaHC0 that adds 250 μ l in the good magnetic bead
3), wash-out is got supernatant in a new centrifuge tube in the 65 degree water-baths after 15 minutes, repeats once, obtains 500 μ l eluted product.Input before getting adds water to the product of 500 μ l and wash-out, each adds 20 μ l concentration is the NaCl of 5M, separate crosslinked spending the night in the 65 degree water-baths, separate the crosslinked back that finishes to wherein adding 36 μ l Proteinase K mixed solution (10ul of 0.5M EDTA, 20ul 1M Tris-HCl pH6.5,1ul of 20mg/ml Proteinase K, 5ul 10mg/ml RNA enzyme), 45 degree reactions 1 hour.Add isopyknic chloroform in the final product: primary isoamyl alcohol=24: 1 mixtures, mixing, 12000rpm is the careful supernatant of drawing after centrifugal 5 minutes, add the 3M NaAC of 1/10 volume and the dehydrated alcohol of 2 times of volumes and be placed on-70 degree 30 minutes, 12000rpm is centrifugal 15 minutes again, super clean bench dried up after 75% (volume ratio) ethanol was washed once, and molten ultrapure water 50 μ l are used for quantitative PCR detection.
2) obtain detecting with the method for real-time fluorescence quantitative PCR behind the product dna content in 03g site.Reagent is available from precious biotechnology Dalian company limited, and reaction system is referring to specification sheets.The PCR instrument is 7500 of American AB I company, and the PCR parameter is 95 ℃ of pre-sex change 10 seconds, enters the back 95 ℃ of sex change of circulation 5 seconds, and 40 circulations were extended in 60 ℃ of annealing 40 seconds.It is as follows to the results are shown in primer shown in Figure 3, used:
03gChIP-F1?5’-GTGAATAGGAGCTGCATGAAATCC-3’
03gChIP-R1?5’-GCCCAGTTGGTGAAAAACGT-3’
03gChIP-F2?5’-CGAGATTGCCACACGGTAAGA-3’
03gChIP-R2?5’-GAATCTACCGAGTCCTGGGCT-3’
03gChIP-F3?5’-CACTCGATCTCCCCTTTTGC-3’
03gChIP-R3?5’-GCTCACACCCCACGTTGTTT-3’。
The result shows that the H3K4 trimethylammonium modification of primer 3 positions is obviously risen in the material that 03g expresses, and the (see figure 3) that in the material that 03g does not express, do not rise.
Embodiment 4:
The evaluation of the genetic development of RNA, dna methylation and the histone modification of a gene 03g who is subjected to the tissue culture abduction delivering:
Remove plant and progeny material thereof through tissue culture procedures, detect expression and dna methylation and the histone methylated modification situation of 03g in these materials, concrete grammar is as follows:
1) material: the rice plant that comes out through callus induction and selfing F1 generation thereof and F2 generation.
2) detect the rna expression situation of 03g in these materials with the step among the embodiment 1, the results are shown in Figure 4A, 03g how for continuous expression in the transmittance process.
3) genomic dna of each material of extracting carries out enzyme with HaeIII, HpaII and the genome of MspI respectively and cuts.Method is as follows: respectively get 5 μ g genomic dnas, add the enzyme of 10 units, 37 degree enzymes are cut 8 hours (used enzyme is all available from NEB company).Because HaeIII, HpaII and MspI are respectively to the dna methylation sensitivity of CHH, CG and three kinds of forms of CHG, if the i.e. identification of this enzyme is asked dna methylation occurred then can't finish cutting, the pcr amplification that carries out specific gene as template with this DNA just can amplify band again, otherwise because the DNA chain is cut off then and can't amplifies band, contrast refers to not contain the gene order of this enzyme recognition site.Result such as Fig. 4 B show, can not amplify band through in the wild-type of tissue culture, be that DNA is methylated, and 03g all is in DNA demethylation state among the material of process tissue culture and the offspring thereof, illustrates that the dna methylation decorating state genetic stability of 03g has arrived the offspring.
4) detect the histone methylated modification situation of 03g in each material with the method among the embodiment 3, the result is shown in Fig. 4 C, and the histone modification situation of 03g still genetic stability has been given the offspring.Above result shows, the expression of 03g is in case in fact, and the existence that it is expressed and the state of chromatin modification will be stable also entails the offspring, and its basis that provides as a kind of detection means of transgenic paddy rice is provided.
Embodiment 5:
An evaluation that is subjected to the expression of gene 03g in cross-fertilize seed and offspring thereof of tissue culture abduction delivering:
Detect 03g at the expression of expressing and not expressing among the material cross-fertilize seed offspring.Concrete grammar is as follows: select for use respectively process tissue culture that 03g expresses in spend 11 (ZH11, see genetic resources table 1) the bright extensive 63 (MH63 of the wild-type do not expressed with 03g, see genetic resources table 2) hybridization, obtain planting again behind the first familiar generation seed, remove the F2 carrying material, use the method extracted total RNA among the embodiment 1, carry out reverse transcription, detect the expression of 03g.Used parameter and primer are equal to embodiment 1.The results are shown in Figure 5,55 F2 have been detected altogether for material, the plant quantity of expressing and not expressing is 39: 16 (2.44: 1), near 3: 1, meet mendelian inheritance, illustrate that the expression of 03g is highly stable, be not subjected to the influence of other genome environment, even therefore transgenic line and wild-type material are hybridized, its offspring also can come out by the detection of expression of 03g.Actin is the confidential reference items of the applied sample amount of cDNA.
Embodiment 6:
The evaluation of dna methylation and histone methylated relation:
Utilize a gene 03g identification of dna that is subjected to the tissue culture abduction delivering to methylate and histone methylated between relation, specific implementation method is as follows:
Remove the seed of wild-type material, contain 50mg/L dna methylation inhibitor 5-azepine-2-Deoxyribose cytidine (5-Aza-2 '-deoxycytidine, available from SIGMA company, article No. A3656-10MG) germinates on the MS/2 substratum, take a sample after 14 days extracting RNA (method is seen embodiment 1) and DNA (method is seen embodiment 2) and chromatin (method is seen embodiment 3) of growth under the dark condition, simultaneously the part seedling is transferred under the normal condition and grows, get RNA (method is seen embodiment 1) and DNA (method is seen embodiment 2) and the chromatin (method is seen embodiment 3) of the material in its selfing F1 generation, detect the expression of 03g respectively, dna methylation and histone modification situation.The result as shown in Figure 6A, the wild-type material that 03g handles through dna methylation inhibitor also has the expression of 03g, the expression of Yan Zheng 03g is subjected to the control of dna methylation again, and as long as express produce after heredity always remember in progeny material; Shown in Fig. 6 B, in the material through the dna methylation inhibitor processing, the dna methylation degree of 03g descends, and in its offspring, the degree that methylates of DNA does not return to and can suppress the 03g expression levels, has further verified result as shown in Figure 6A; Result shown in Fig. 6 C shows, after only causing the expression of 03g with the dna methylation processing, the histone H 3 K4 trimethylammonium level in 03g site raises, hint can cause the rising of genetic expression activation tagging H3K4 trimethylammoniumization as the removal of the dna methylation of genetic expression inhibition mark, disclosed dna methylation and histone methylated between relation, enriched chromatin modify between interactional theoretical investigation.
Claims (3)
1. separated DNA fragment, its sequence is the nucleotide sequence shown in the SEQ ID NO:1.
2. the described a kind of separated DNA fragment of claim 1 is spent the application in 11 transgenic paddy rices in detection.
3. the application of the described a kind of separated DNA fragment of claim 1 in detecting bright extensive 63 transgenic paddy rices.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN2012100513130A CN103290023A (en) | 2012-03-01 | 2012-03-01 | Gene 03g induced to express by tissue culture and preparation method and application |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN2012100513130A CN103290023A (en) | 2012-03-01 | 2012-03-01 | Gene 03g induced to express by tissue culture and preparation method and application |
Publications (1)
Publication Number | Publication Date |
---|---|
CN103290023A true CN103290023A (en) | 2013-09-11 |
Family
ID=49091554
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN2012100513130A Pending CN103290023A (en) | 2012-03-01 | 2012-03-01 | Gene 03g induced to express by tissue culture and preparation method and application |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN103290023A (en) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2020184764A1 (en) * | 2019-03-11 | 2020-09-17 | 경북대학교 산학협력단 | Use of oryza sativa-derived ak102606 gene as controller for antioxidative activity, environmental stress, and crop yield |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN1557966A (en) * | 2004-01-18 | 2004-12-29 | 上海市农业科学院生物技术研究中心 | Internal standard gene suitable to exogenous gene detection such as transgene cotton and application thereof |
CN101402996A (en) * | 2008-11-06 | 2009-04-08 | 东北农业大学 | High throughput five-nest type PCR transgenic detection method for finely processed product of food crop |
-
2012
- 2012-03-01 CN CN2012100513130A patent/CN103290023A/en active Pending
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN1557966A (en) * | 2004-01-18 | 2004-12-29 | 上海市农业科学院生物技术研究中心 | Internal standard gene suitable to exogenous gene detection such as transgene cotton and application thereof |
CN101402996A (en) * | 2008-11-06 | 2009-04-08 | 东北农业大学 | High throughput five-nest type PCR transgenic detection method for finely processed product of food crop |
Non-Patent Citations (2)
Title |
---|
吴智丹等: "水稻OsN1基因5 端启动子不同区域序列分析", 《江苏农业学报》 * |
汪小福等: "转Cry1Ab基因水稻分子特征及其特异性PCR检测方法", 《遗传》 * |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2020184764A1 (en) * | 2019-03-11 | 2020-09-17 | 경북대학교 산학협력단 | Use of oryza sativa-derived ak102606 gene as controller for antioxidative activity, environmental stress, and crop yield |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Huang et al. | The development of loop-mediated isothermal amplification combined with lateral flow dipstick for detection of Karlodinium veneficum | |
CN105200160B (en) | A kind of relevant SNP marker of dissolved oxygen tolerance low to litopenaeus vannamei and its screening and application | |
CN104017891B (en) | Application of septin1 gene to detection of nosema bombycis | |
Jiang et al. | Genetic and epigenetic variation in mass selection populations of Pacific oyster Crassostrea gigas | |
CN104017890A (en) | Application of EB1 gene to detection of nosema bombycis | |
CN104419706A (en) | SNP (single nucleotide polymorphism) marker and application thereof | |
Abid et al. | Changes in DNA-methylation during zygotic embryogenesis in interspecific hybrids of beans (Phaseolus ssp.) | |
CN107400715A (en) | The exploitation and its application of the special chemoattractant molecule mark of Thinopyrum ponticum and probe | |
Li et al. | Comparative methylome analysis reveals perturbation of host epigenome in chestnut blight fungus by a hypovirus | |
Brysting et al. | Genomic origin and organization of the hybrid Poa jemtlandica (Poaceae) verified by genomic in situ hybridization and chloroplast DNA sequences | |
JP2014000078A (en) | Nondestructive method for isolating dna from plant | |
Li et al. | A SNP in the 3′-UTR of HSF1 in dairy cattle affects binding of target bta-miR-484 | |
Rosellini et al. | Sexual polyploidization in Medicago sativa L.: Impact on the phenotype, gene transcription, and genome methylation | |
CN103834647A (en) | SSR marker Xgwm537 in close linkage with wheat dwarf gene RhtDC20 and application thereof | |
Lozano et al. | RNA polymerase mapping in plants identifies enhancers enriched in causal variants | |
CN103898225B (en) | A kind of primer and discrimination method differentiating the hidden kind of Bemisia tabaci and trialeurodes vaporariorum | |
CN101597648B (en) | Method for screening allogynogenesis diploid of pseudosciaena crocea | |
CN103290023A (en) | Gene 03g induced to express by tissue culture and preparation method and application | |
WO2016090965A1 (en) | Hmg1 gene and uses thereof in microsporidium molecular detection | |
Bian et al. | Adaptational significance of variations in DNA methylation in clonal plant Hierochloe glabra (Poaceae) in heterogeneous habitats | |
Anand et al. | Development and characterization of genomic microsatellite markers in Prosopis cineraria | |
Dutta et al. | Development of a rapid RNA extraction procedure from urediniospores of the leaf rust fungus, Puccinia triticina | |
CN107760682A (en) | A kind of nucleotide sequence and its application available for molecule pest control | |
CN106048027A (en) | Grouper-growth-rate-related SNP (single-nucleotide polymorphism) marker and application thereof | |
Jiang et al. | Expression and DNA methylation pattern of reproduction-related genes in partially fertile triploid Pacific oysters Crassostrea gigas |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20130911 |