WO2020178738A1 - T cell receptors and methods of use thereof - Google Patents

T cell receptors and methods of use thereof Download PDF

Info

Publication number
WO2020178738A1
WO2020178738A1 PCT/IB2020/051807 IB2020051807W WO2020178738A1 WO 2020178738 A1 WO2020178738 A1 WO 2020178738A1 IB 2020051807 W IB2020051807 W IB 2020051807W WO 2020178738 A1 WO2020178738 A1 WO 2020178738A1
Authority
WO
WIPO (PCT)
Prior art keywords
hla
tcr
eso
amino acid
acid sequence
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/IB2020/051807
Other languages
English (en)
French (fr)
Inventor
Naoto Hirano
Kenji Murata
Kayoko SASO
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University Health Network
Original Assignee
University Health Network
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to KR1020217031582A priority Critical patent/KR20210149051A/ko
Priority to BR112021017486A priority patent/BR112021017486A2/pt
Priority to CA3132252A priority patent/CA3132252A1/en
Priority to JP2021552598A priority patent/JP7748874B2/ja
Priority to SG11202109588R priority patent/SG11202109588RA/en
Priority to AU2020231106A priority patent/AU2020231106A1/en
Priority to US17/436,929 priority patent/US20220169695A1/en
Priority to MX2021010533A priority patent/MX2021010533A/es
Application filed by University Health Network filed Critical University Health Network
Priority to CN202080028558.4A priority patent/CN113853434B/zh
Priority to EP20765782.6A priority patent/EP3935173A4/en
Publication of WO2020178738A1 publication Critical patent/WO2020178738A1/en
Priority to IL286032A priority patent/IL286032A/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4748Tumour specific antigens; Tumour rejection antigen precursors [TRAP], e.g. MAGE
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70503Immunoglobulin superfamily
    • C07K14/7051T-cell receptor (TcR)-CD3 complex
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/66Phosphorus compounds
    • A61K31/675Phosphorus compounds having nitrogen as a ring hetero atom, e.g. pyridoxal phosphate
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7042Compounds having saccharide radicals and heterocyclic rings
    • A61K31/7052Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides
    • A61K31/706Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom
    • A61K31/7064Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom containing condensed or non-condensed pyrimidines
    • A61K31/7076Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom containing condensed or non-condensed pyrimidines containing purines, e.g. adenosine, adenylic acid
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/0005Vertebrate antigens
    • A61K39/0011Cancer antigens
    • A61K39/00119Melanoma antigens
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/10Cellular immunotherapy characterised by the cell type used
    • A61K40/11T-cells, e.g. tumour infiltrating lymphocytes [TIL] or regulatory T [Treg] cells; Lymphokine-activated killer [LAK] cells
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/30Cellular immunotherapy characterised by the recombinant expression of specific molecules in the cells of the immune system
    • A61K40/32T-cell receptors [TCR]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/40Cellular immunotherapy characterised by antigens that are targeted or presented by cells of the immune system
    • A61K40/41Vertebrate antigens
    • A61K40/42Cancer antigens
    • A61K40/4267Cancer testis antigens, e.g. SSX, BAGE, GAGE or SAGE
    • A61K40/4269NY-ESO
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/40Cellular immunotherapy characterised by antigens that are targeted or presented by cells of the immune system
    • A61K40/41Vertebrate antigens
    • A61K40/42Cancer antigens
    • A61K40/4271Melanoma antigens
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70503Immunoglobulin superfamily
    • C07K14/70539MHC-molecules, e.g. HLA-molecules
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70578NGF-receptor/TNF-receptor superfamily, e.g. CD27, CD30, CD40, CD95
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2803Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
    • C07K16/2809Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily against the T-cell receptor (TcR)-CD3 complex
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/30Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants from tumour cells
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/111General methods applicable to biologically active non-coding nucleic acids
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1138Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against receptors or cell surface proteins
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06Animal cells or tissues; Human cells or tissues
    • C12N5/0602Vertebrate cells
    • C12N5/0634Cells from the blood or the immune system
    • C12N5/0636T lymphocytes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/16Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22Ribonucleases [RNase]; Deoxyribonucleases [DNase]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/80Vaccine for a specifically defined cancer
    • A61K2039/876Skin, melanoma
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2239/00Indexing codes associated with cellular immunotherapy of group A61K40/00
    • A61K2239/46Indexing codes associated with cellular immunotherapy of group A61K40/00 characterised by the cancer treated
    • A61K2239/57Skin; melanoma
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2300/00Mixtures or combinations of active ingredients, wherein at least one active ingredient is fully defined in groups A61K31/00 - A61K41/00
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/30Immunoglobulins specific features characterized by aspects of specificity or valency
    • C07K2317/31Immunoglobulins specific features characterized by aspects of specificity or valency multispecific
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/60Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments
    • C07K2317/62Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments comprising only variable region components
    • C07K2317/622Single chain antibody (scFv)
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/01Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/03Fusion polypeptide containing a localisation/targetting motif containing a transmembrane segment
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/20Fusion polypeptide containing a tag with affinity for a non-protein ligand
    • C07K2319/21Fusion polypeptide containing a tag with affinity for a non-protein ligand containing a His-tag
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/33Fusion polypeptide fusions for targeting to specific cell types, e.g. tissue specific targeting, targeting of a bacterial subspecies
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/70Fusion polypeptide containing domain for protein-protein interaction
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/70Fusion polypeptide containing domain for protein-protein interaction
    • C07K2319/74Fusion polypeptide containing domain for protein-protein interaction containing a fusion for binding to a cell surface receptor
    • C07K2319/75Fusion polypeptide containing domain for protein-protein interaction containing a fusion for binding to a cell surface receptor containing a fusion for activation of a cell surface receptor, e.g. thrombopoeitin, NPY and other peptide hormones
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/14Type of nucleic acid interfering nucleic acids [NA]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00Applications; Uses
    • C12N2320/30Special therapeutic applications
    • C12N2320/31Combination therapy
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2510/00Genetically modified cells
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00Reverse transcribing RNA viruses
    • C12N2740/00011Details
    • C12N2740/10011Retroviridae
    • C12N2740/13011Gammaretrovirus, e.g. murine leukeamia virus
    • C12N2740/13041Use of virus, viral particle or viral elements as a vector
    • C12N2740/13043Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector

Definitions

  • TCRs T cell receptors
  • T cell therapies are at the forefront of immunotherapeutic development, and adoptive transfer of antitumor T cells has been shown induce clinical responses in cancer patients. Though many T cell therapies target mutated tumor antigens, the vast majority of neoantigens are not shared and are unique to each patient.
  • non-mutated antigens out number mutated antigens by multiple orders of magnitude.
  • the elucidation of T cell epitopes derived from shared antigens may facilitate the robust development of efficacious and safe adoptive T cell therapies that are readily available to a larger cohort of cancer patients.
  • the sheer number of non- mutated antigens and the high polymorphism of HLA genes may have hampered comprehensive analyses of the specificity of antitumor T cell responses toward non- mutated antigens.
  • the present disclosure provides novel epitopes for the non-mutated antigen
  • NY-ESO-1 and TCRs capable of specifically binding the epitopes. These novel epitopes are associated with associated with particular HLA alleles.
  • the use of these tumor- reactive HLA-restricted NY-ESO-1 TCRs stand to widen the applicability of anti-NY- ESO-1 TCR gene therapy, particularly in immuno-oncology.
  • Certain aspects of the present disclosure are directed to a nucleic acid molecule comprising (i) a first nucleotide sequence encoding a recombinant T cell receptor (TCR) or an antigen binding portion thereof that specifically binds human NY- ESO-1 ("anti -NY-ESO-1 TCR"); and (ii) a second nucleotide sequence, wherein the second nucleotide sequence or the polypeptide encoded by the second nucleotide sequence inhibits the expression of an endogenous TCR, wherein the anti-NY-ESO-1 TCR cross competes for binding to human NY-ESO-1 with a reference TCR, which comprises an alpha chain and a beta chain, and wherein the alpha chain comprises an amino acid sequence as set forth in SEQ ID NO: 1 and the beta chain comprises an amino acid sequence as set forth in SEQ ID NO: 2.
  • Certain aspects of the present disclosure are directed to a nucleic acid molecule comprising (i) a first nucleotide sequence encoding a recombinant T cell receptor (TCR) or an antigen binding portion thereof that specifically binds human NY- ESO-1 ("anti-NY-ESO-1 TCR"); and (ii) a second nucleotide sequence, wherein the second nucleotide sequence or the polypeptide encoded by the second nucleotide sequence inhibits the expression of an endogenous TCR, wherein the anti-NY-ESO-1 TCR binds the same epitope or an overlapping epitope of human NY-ESO-1 as a reference TCR, which comprises an alpha chain and a beta chain, wherein the alpha chain comprises an amino acid sequence as set forth in SEQ ID NO: 1 and the beta chain comprises an amino acid sequence as set forth in SEQ ID NO: 2.
  • the anti-NY-ESO-1 TCR binds to an epitope of NY-
  • the HLA class I molecule is an HLA-C*03 allele. In some embodiments, the HLA class I molecule is selected from an HLA-C*03:02 allele, an HLA-C*03:03 allele, an HLA-C*03:04 allele, an HLA-C*03:05 allele, and an HLA-C*03:06 allele. In some embodiments, the HLA class I molecule is an HLA-C*03:03 allele.
  • the anti-NY-ESO-1 TCR comprises an alpha chain and a beta chain, wherein the alpha chain comprises a variable region comprising an alpha chain CDR1, an alpha chain CDR2, and an alpha chain CDR3; and wherein the beta chain comprises variable domain comprising a beta chain CDR1, a beta chain CDR2, and a beta chain CDR3; wherein the alpha chain CDR3 comprises an amino acid sequence as set forth in SEQ ID NO: 7.
  • the beta chain CDR3 of the anti-NY-ESO- 1 TCR comprises an amino acid sequence as set forth in SEQ ID NO: 10.
  • the anti-NY-ESO-1 TCR comprises an alpha chain and a beta chain, wherein the alpha chain comprises a variable region comprising an alpha chain CDR1, an alpha chain CDR2, and an alpha chain CDR3; and wherein the beta chain comprises variable domain comprising a beta chain CDR1, a beta chain CDR2, and a beta chain CDR3; wherein the beta chain CDR3 of the anti-NY-ESO-1 TCR comprises an amino acid sequence as set forth in SEQ ID NO: 10.
  • the alpha chain CDR3 of the anti-NY-ESO-1 TCR comprises an amino acid sequence as set forth in SEQ ID NO: 7.
  • the alpha chain CDR1 of the anti-NY-ESO-1 TCR comprises an amino acid sequence as set forth in SEQ ID NO: 5.
  • the beta chain CDR1 of the anti-NY-ESO-1 TCR comprises an amino acid sequence as set forth in SEQ ID NO: 8.
  • the alpha chain CDR2 of the anti-NY- ESO-1 TCR comprises an amino acid sequence as set forth in SEQ ID NO: 6.
  • the beta chain CDR2 of the anti-NY-ESO-1 TCR comprises an amino acid sequence as set forth in SEQ ID NO: 9.
  • the alpha chain variable domain of the anti-NY-ESO-1 is the alpha chain variable domain of the anti-NY-ESO-1
  • TCR comprises an amino acid sequence of a variable domain present in the amino acid sequence set forth SEQ ID NO: 1.
  • the beta chain variable domain of the anti-NY-ESO-1 TCR comprises an amino acid sequence of a variable domain present in the amino acid sequence set forth SEQ ID NO: 2.
  • the alpha chain of the anti-NY-ESO-1 TCR further comprises a constant region, wherein the constant region is different from endogenous constant region of the alpha chain.
  • the alpha chain of the anti-NY- ESO-1 TCR further comprises a constant region, wherein the alpha chain constant region comprises an amino acid sequence having at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to a constant region present in the amino acid sequence set forth SEQ ID NO: 1.
  • the alpha chain constant region comprises an amino acid sequence comprising at least 1, at least 2, at least 3, at least 4, or at least 5 amino acid substitutions relative to a constant region present in the amino acid sequence set forth SEQ ID NO: 1.
  • the beta chain of the anti-NY-ESO-1 TCR further comprises a constant region, wherein the constant region is different from endogenous constant regions of the beta chain.
  • the beta chain of the anti-NY-ESO-1 TCR further comprises a constant region, wherein the beta chain constant region comprises an amino acid sequence having at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to a constant region present in the amino acid sequence set forth SEQ ID NO: 2.
  • the beta chain constant region comprises an amino acid sequence comprising at least 1, at least 2, at least 3, at least 4, or at least 5 amino acid substitutions relative to a constant region present in the amino acid sequence set forth SEQ ID NO: 2.
  • the alpha chain of the anti-NY-ESO-1 TCR comprises an amino acid sequence as set forth in SEQ ID NO: 1.
  • the beta chain of the anti-NY-ESO-1 TCR comprises an amino acid sequence as set forth in SEQ ID NO: 2.
  • the second nucleotide sequence is one or more siRNAs that reduce the expression of endogenous TCRs.
  • the one or more siRNAs are complementary to a target sequence within a nucleotide sequence encoding a constant region of the endogenous TCRs.
  • the one or more siRNAs comprise one or more nucleotide sequences selected from the group consisting of SEQ ID NOs: 53-56.
  • the second nucleotide sequence encodes Cas9.
  • the anti-NY-ESO-1 TCR comprises an alpha chain constant region, a beta chain constant region, or both; and wherein the alpha chain constant region, the beta chain constant region, or both comprises an amino acid sequence having at least 1, at least 2, at least 3, at least 4, or at least 5 substitutions within the target sequence relative to the corresponding amino acid sequence of an endogenous TCR.
  • the vector is a viral vector, a mammalian vector, or bacterial vector.
  • the vector is a retroviral vector.
  • the vector is selected from the group consisting of an adenoviral vector, a lentivirus, a Sendai virus vector, a baculoviral vector, an Epstein Barr viral vector, a papovaviral vector, a vaccinia viral vector, a herpes simplex viral vector, a hybrid vector, and an adeno associated virus (AAV) vector.
  • the vector is a lentivirus.
  • TCR T cell receptor
  • the recombinant T cell receptor (TCR) or an antigen binding portion thereof that specifically binds human NY-ESO-1 (“an anti-NY-ESO-1 TCR"), which cross competes for binding to human NY-ESO-1 with a reference TCR; wherein the reference TCR comprises an alpha chain and a beta chain, and wherein the alpha chain comprises an amino acid sequence as set forth in SEQ ID NO: 1 and the beta chain comprises an amino acid sequence as set forth in SEQ ID NO: 2; and wherein the anti-NY-ESO-1 TCR comprises an alpha chain and a beta chain, wherein the alpha chain comprises a constant region, and wherein the beta chain comprises a constant region; wherein (i) the alpha chain constant region comprises an amino acid sequence having a least 1, at least 2,
  • Certain aspects of the present disclosure are directed to a recombinant T cell receptor (TCR) or an antigen binding portion thereof that specifically binds human NY- ESO-1 ("an anti-NY-ESO-1 TCR"), which binds the same epitope or an overlapping epitope of human NY-ESO-1 as a reference TCR; wherein the reference TCR comprises an alpha chain and a beta chain, and wherein the alpha chain comprises an amino acid sequence as set forth in SEQ ID NO: 1 and the beta chain comprises an amino acid sequence as set forth in SEQ ID NO: 2; and wherein the anti-NY-ESO-1 TCR comprises an alpha chain and a beta chain, wherein the alpha chain comprises a constant region, and wherein the beta chain comprises a constant region; wherein (i) the alpha chain constant region comprises an amino acid sequence having a least 1, at least 2, at least 3, at least 4, or at least 5 amino acid substitutions relative to a constant region present in the amino acid sequence set forth in SEQ ID NO: 1 or
  • the anti-NY-ESO-1 TCR binds to an epitope of NY-ESO-1 consisting of an amino acid sequence as set forth in SEQ ID NO: 13.
  • the epitope is complexed with an HLA class I molecule.
  • the HLA class I molecule is an HLA-A, HLA-B, HLA- C, HLA-E, HLA-F, or HLA-G allele.
  • the HLA class I molecule is an HLA-C*03 allele.
  • the HLA class I molecule is selected from an HLA-C*03:02 allele, an HLA-C*03:03 allele, an HLA-C*03:04 allele, an HLA-C*03:05 allele, and an HLA-C*03:06 allele. In some embodiments, the HLA class I molecule is an HLA-C*03:03 allele.
  • the alpha chain of the anti-NY-ESO-1 TCR comprises a variable domain comprising an alpha chain CDR1, an alpha chain CDR2, and an alpha chain CDR3; and wherein the beta chain of the anti-NY-ESO-1 TCR comprises variable domain comprising a beta chain CDR1, a beta chain CDR2, and a beta chain CDR3; wherein the alpha chain CDR3 of the anti-NY-ESO-1 comprises an amino acid sequence as set forth in SEQ ID NO: 7.
  • the beta chain CDR3 of the anti- NY-ESO-1 TCR comprises an amino acid sequence as set forth in SEQ ID NO: 10.
  • the alpha chain of the anti-NY-ESO-1 TCR comprises a variable domain comprising an alpha chainCDRl, an alpha chain CDR2, and an alpha chain CDR3; and wherein the beta chain of the anti-NY-ESO-1 TCR comprises a variable domain comprising a beta chain CDR1, a beta chain CDR2, and a beta chain CDR3; wherein the beta chain CDR3 of the anti-NY-ESO-1 TCR comprises an amino acid sequence as set forth in SEQ ID NO: 10.
  • the alpha chain CDR3 of the anti-NY-ESO-1 TCR comprises an amino acid sequence as set forth in SEQ ID NO: 7.
  • the alpha chain CDR1 of the anti-NY-ESO-1 TCR comprises an amino acid sequence as set forth in SEQ ID NO: 5.
  • the beta chain CDR1 of the anti-NY-ESO-1 TCR comprises an amino acid sequence as set forth in SEQ ID NO: 8.
  • the alpha chain CDR2 of the anti-NY- ESO-1 TCR comprises an amino acid sequence as set forth in SEQ ID NO: 6.
  • the beta chain CDR2 of the anti-NY-ESO-1 TCR comprises an amino acid sequence as set forth in SEQ ID NO: 9.
  • the alpha chain variable domain of the anti-NY-ESO-1 is the alpha chain variable domain of the anti-NY-ESO-1
  • TCR comprises an amino acid sequence of a variable domain present in the amino acid sequence set forth in SEQ ID NO: 1.
  • the beta chain variable domain of the anti-NY-ESO-1 TCR comprises an amino acid sequence of a variable domain present in the amino acid sequence set forth in SEQ ID NO: 2.
  • the alpha chain constant region comprises an amino acid sequence having at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to the amino acid sequence of a constant region present in the amino acid sequence set forth in SEQ ID NO: 1.
  • the beta chain constant region comprises an amino acid sequence having at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to the amino acid sequence of a constant region present in the amino acid sequence set forth in SEQ ID NO: 2.
  • the alpha chain of the anti-NY-ESO-1 TCR comprises an amino acid sequence as set forth in SEQ ID NO: 1.
  • the beta chain of the anti-NY-ESO-1 TCR comprises an amino acid sequence as set forth in SEQ ID NO: 2.
  • Certain aspects of the present disclosure are directed to a bispecific TCR comprising a first antigen-binding domain and a second antigen-binding domain, wherein the first antigen-binding domain comprises a TCR or an antigen-binding portion thereof disclosed herein or a TCR or an antigen-binding portion thereof disclosed herein.
  • the first antigen-binding domain comprises a single chain variable fragment ("scFv").
  • the second antigen-binding domain binds specifically to a protein expressed on the surface of a T cell.
  • the second antigen-binding domain binds specifically to CD3.
  • the second antigen-binding domain comprises an scFv.
  • first antigen-binding domain and the second antigen-binding domain are linked or associated by a covalent bond. In some embodiments, the first antigen-binding domain and the second antigen-binding domain are linked by a peptide bond.
  • Certain aspects of the present disclosure are directed to a cell comprising a nucleic acid molecule disclosed herein, a vector disclosed herein, a TCR disclosed herein, a recombinant TCR disclosed herein, or a bispecific TCR disclosed herein.
  • the cell further expresses CD3.
  • the cell is selected from the group consisting of a T cell, a natural killer (NK) cell, an natural killer T (NKT) cell, or an ILC cell.
  • the cancer is selected from the group consisting of melanoma, bone cancer, pancreatic cancer, skin cancer, cancer of the head or neck, uterine cancer, ovarian cancer, rectal cancer, cancer of the anal region, stomach cancer, testicular cancer, uterine cancer, carcinoma of the fallopian tubes, carcinoma of the endometrium, carcinoma of the cervix, carcinoma of the vagina, carcinoma of the vulva, Hodgkin's Disease, non-Hodgkin's lymphoma (NHL), primary mediastinal large B cell lymphoma (PMBC), diffuse large B cell lymphoma (DLBCL), follicular lymphoma (FL), transformed follicular lymphoma, splenic marginal zone lymphoma (SMZL), cancer of the esophagus, cancer of the
  • the cancer is relapsed or refractory. In some embodiments, the cancer is locally advanced. In some embodiments, the cancer is advanced. In some embodiments, the cancer is metastatic.
  • the cells are obtained from the subject. In some embodiments, the cells are obtained from a donor other than the subject. In some embodiments, the subject is preconditioned prior to the administering of the cells. In some embodiments, the preconditioning comprises administering to the subject a chemotherapy, a cytokine, a protein, a small molecule, or any combination thereof. In some embodiments, the preconditioning comprises administering an interleukin. In some embodiments, the preconditioning comprises administering IL-2, , IL-4, IL-7, IL-9, IL- 15, IL-21, or any combination thereof.
  • the preconditioning comprises administering a preconditioning agent selected from the group consisting of cyclophosphamide, fludarabine, vitamin C, an AKT inhibitor, ATRA, Rapamycin, or any combination thereof. In some embodiments, the preconditioning comprises administering cyclophosphamide, fludarabine, or both.
  • a preconditioning agent selected from the group consisting of cyclophosphamide, fludarabine, vitamin C, an AKT inhibitor, ATRA, Rapamycin, or any combination thereof.
  • the preconditioning comprises administering cyclophosphamide, fludarabine, or both.
  • Certain aspects of the present disclosure are directed to an HLA class I molecule complexed to a peptide, wherein the HLA class I molecule comprises an al domain, an a2 domain, an a3 domain and a b2ih, and wherein the peptide consists of an amino acid sequence as set forth in SEQ ID NO: 14.
  • the HLA class I molecule is an HLA-A, HLA-B, HLA-
  • the HLA class I molecule is an HLA-C. In some embodiments, the HLA class I molecule is an HLA-C *03 allele. In some embodiments, the HLA class I molecule is selected from an HLA-C*03:02 allele, an HLA-C*03:03 allele, an HLA-C*03:04 allele, an HLA-C*03:05 allele, and an HLA- C*03:06 allele. In some embodiments, the HLA class I molecule is an HLA-C*03:03 allele. In some embodiments, the HLA class I molecule is an HLA-C*03:04 allele.
  • the HLA class I molecule is a monomer. In some embodiments, the HLA class I molecule is a dimer. In some embodiments, the HLA class I molecule is a trimer. In some embodiments, the HLA class I molecule is a tetramer. In some embodiments, the HLA class I molecule is a pentamer.
  • Certain aspects of the present disclosure are directed to an antigen presenting cell (APC), comprising an HLA class I molecule disclosed herein.
  • APC antigen presenting cell
  • the HLA class I molecule is expressed on the surface of the APC.
  • Certain aspects of the present disclosure are directed to a method of enriching a target population of T cells obtained from a human subject, comprising contacting the T cells with an HLA class I molecule disclosed herein or an APC disclosed herein, wherein following the contacting, the enriched population of T cells comprises a higher number of T cells capable of binding the HLA class I molecule relative to the number of T cells capable of binding the HLA class I molecule prior to the contacting.
  • Certain aspects of the present disclosure are directed to a method of enriching a target population of T cells obtained from a human subject, comprising contacting the T cells in vitro with a peptide, wherein the peptide consists of an amino acid sequence as set forth in SEQ ID NO: 13, wherein following the contacting, the enriched population of T cells comprises a higher number of T cells capable of targeting a tumor cell relative to the number of T cells capable of targeting a tumor cell prior to the contacting.
  • the T cells obtained from the human subject are tumor infiltrating lymphocytes (TIL).
  • TIL tumor infiltrating lymphocytes
  • Certain aspects of the present disclosure are directed to a method of treating a tumor in a subject in need thereof, comprising administering to the subject an enriched population of T cells disclosed herein.
  • Certain aspects of the present disclosure are directed to a method of enhancing cytotoxic T cell-mediated targeting of cancer cells in a subject afflicted with a cancer, comprising administering to the subject a peptide having an amino acid sequence as set forth in SEQ ID NO: 13.
  • Certain aspects of the present disclosure are directed to a cancer vaccine comprising a peptide having an amino acid sequence as set forth in SEQ ID NO: 13.
  • Certain aspects of the present disclosure are directed to a method of selecting a
  • T cell capable of targeting a tumor cell, comprising contacting a population of isolated T cells in vitro with a peptide, wherein the peptide consists of an amino acid sequence as set forth in SEQ ID NO: 11.
  • the T cell is a tumor infiltrating lymphocytes (TIL).
  • FIG. 1 is a bar graph illustrating the number of C*03:04/NY-ESO-1 T cells in melanoma TILs following stimulation with artificial APCs pulsed with overlapping peptides.
  • the TILs were used as responder cells in IFN-g ELISPOT analysis.
  • C*03:04- artificial APCs pulsed with overlapping peptides to cover the whole protein of NY-ESO-1 were employed as stimulator cells.
  • the TILs When stimulated with C*03:04-artificial APCs pulsed with NY-ESO-1 -derived overlapping peptides, the TILs showed positive responses to two adjacent peptides with the shared sequence 91YLAMPFATPM100 (see also Table 5).
  • FIGs. 2A-2C are graphical representations of C*03:04/NY-ESO-l92-ioo multimer staining of melanoma TILs.
  • FIG. 2A shows staining of the TILs with C*03:04/NY-ESO-l92-ioo multimer.
  • C*03:04/MAGE-Al 23 o-2 38 (FIG. 2B) and C* 03: 04/unexchanged (FIG. 2C) multimers were used as negative controls. The percentage of multimeC cells in CD8 + T cells is shown.
  • FIG. 3 is a bar graph illustrating the functional assessment of C*03:04/NY-
  • ESO-192-100 multimer-positive melanoma TILs ESO-192-100 multimer-positive melanoma TILs. IFN-g production by the TILs in a C*03:04/NY-ESO-l92-ioo-specific manner. The TILs were employed as responder cells in IFN-g ELISPOT analysis. C*03:04-artificial APCs pulsed with the indicated peptides were used as stimulator cells. The MAGE-A1230-238 peptide was employed as a control. Experiments were carried out in triplicate, and error bars depict standard deviation (SD). ***P ⁇ 0.001.
  • FIGs. 4A-4I are graphical representations of positive staining of Jurkat
  • FIGs. 4G, 4H, and 41 were employed as controls, as well as Jurkat 76/CD8 not transduced with a TCR (FIGs. 4A, 4D, and 4G). The percentage of multimer CD8 + cells is shown.
  • FIGs. 5A-5D are graphical representations of positive staining of human primary T cells transduced with C*03:04/NY-ESO-l92-ioo TCR genes (FIGs. 5B and 5D) with a cognate multimer.
  • Primary T cells transduced with the C*03:04/NY-ESO-l92-ioo TCR were stained with the C*03:04/NY-ESO-l92-ioo (FIG. 5B) or C*03:04/HIV gagier- control multimer (FIG. 5D).
  • Untransduced primary T cells were employed as negative controls (FIGs. 5A and 5C). The percentage of multimeU CD8 + T cells is shown.
  • FIG. 6 is a bar graph illustrating that human primary T cells transduced with
  • C*03:04/NY-ESO-l92-ioo TCR genes react strongly with the cognate peptide presented by the target class I molecule.
  • Primary T cells transduced with C*03:04/NY-ESO-l92-ioo TCR genes or untransduced primary T cells (x-axis) were used as responder cells in IFN- g ELISPOT analysis.
  • HLA-C*03:04-transduced T2 cells (T2-C*03:04) were generated.
  • T2 or T2-C*03:04 cells pulsed with the NY-ESO-192-100 or HIV gagi 64 -ra peptide (control) were used as stimulator cells. Experiments were carried out in triplicate, and error bars depict SD. ***p ⁇ 0.001.
  • FIGs. 7A and 7B are a graphical representation of illustrating that primary T cells transduced with C*03:04/NY-ESO-192-100 TCR genes recognize tumor cells (FIG. 7A) and its legend (FIG. 7B).
  • Primary T cells transduced with C*03:04/NY-ESO-l92-ioo TCR genes or untransduced primary T cells were employed as responder cells in IFN-g ELISPOT analysis.
  • A375, SK-MEL-37, LM-MEL-53, and SK-MEL-21 cells that were either untransduced or transduced with HLA-C*03:04 or NY-ESO-1, as indicated in FIG. 7B (legend for FIG.
  • FIGs. 8A-8E are graphical representations of the expression of NY-ESO-1 derived from endogenous or transduced full-length gene.
  • the expression of NY-ESO-1 derived from endogenous or transduced full-length gene in target cells was analyzed via intracellular flow cytometry following staining with anti -NY-ESO-1 mAh (open curve) and an isotype control (filled curve).
  • FIGs. 9A-9D are graphical representations of the expression of ANGFR in target cells transduced with the full-length HLA-C*03:04 gene tagged with ANGFR (FIG. 9B and 9D).
  • Surface expression of ANGFR in target cells transduced with the full-length HLA-C*03:04 gene tagged with ANGFR was analyzed by flow cytometry following staining with an anti-NGFR mAh (open curve) and an isotype control (filled curve). ANGFR alone was used as a control (FIG. 9A and 9C).
  • a or “an” entity refers to one or more of that entity; for example, “a nucleotide sequence,” is understood to represent one or more nucleotide sequences.
  • the terms “a” (or “an”), “one or more,” and “at least one” can be used interchangeably herein.
  • administering refers to the physical introduction of an agent to a subject, using any of the various methods and delivery systems known to those skilled in the art.
  • exemplary routes of administration for the formulations disclosed herein include intravenous, intramuscular, subcutaneous, intraperitoneal, spinal or other parenteral routes of administration, for example by injection or infusion.
  • parenteral administration means modes of administration other than enteral and topical administration, usually by injection, and includes, without limitation, intravenous, intramuscular, intraarterial, intrathecal, intralymphatic, intralesional, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, subcapsular, subarachnoid, intraspinal, epidural and intrasternal injection and infusion, as well as in vivo electroporation.
  • the formulation is administered via a non-parenteral route, e.g., orally.
  • non-parenteral routes include a topical, epidermal or mucosal route of administration, for example, intranasally, vaginally, rectally, sublingually or topically.
  • Administering can also be performed, for example, once, a plurality of times, and/or over one or more extended periods.
  • T cell receptor refers to a heteromeric cell- surface receptor capable of specifically interacting with a target antigen.
  • TCR includes but is not limited to naturally occurring and non-naturally occurring TCRs; full-length TCRs and antigen binding portions thereof; chimeric TCRs; TCR fusion constructs; and synthetic TCRs. In human, TCRs are expressed on the surface of T cells, and they are responsible for T cell recognition and targeting of antigen presenting cells.
  • Antigen presenting cells display fragments of foreign proteins (antigens) complexed with the major histocompatibility complex (MHC; also referred to herein as complexed with an HLA molecule, e.g. , an HLA class 1 molecule).
  • MHC major histocompatibility complex
  • a TCR recognizes and binds to the antigemHLA complex and recruits CD3 (expressed by T cells), activating the TCR. The activated TCR initiates downstream signaling and an immune response, including the destruction of the EPC.
  • a TCR can comprise two chains, an alpha chain and a beta chain
  • Each chain comprises a variable domain (alpha chain variable domain and beta chain variable domain) and a constant region (alpha chain constant region and beta chain constant region).
  • the variable domain is located distal to the cell membrane, and the variable domain interacts with an antigen.
  • the constant region is located proximal to the cell membrane.
  • a TCR can further comprises a transmembrane region and a short cytoplasmic tail.
  • the term "constant region” encompasses the transmembrane region and the cytoplasmic tail, when present, as well as the traditional "constant region.”
  • variable domains can be further subdivided into regions of hypervariability, termed complementarity determining regions (CDRs), interspersed with regions that are more conserved, termed framework regions (FR).
  • CDRs complementarity determining regions
  • FR framework regions
  • Each alpha chain variable domain and beta chain variable domain comprises three CDRs and four FRs: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4.
  • Each variable domain contains a binding domain that interacts with an antigen. Though all three CDRs on each chain are involved in antigen binding, CDR3 is believed to be the primary antigen binding region. CDR1 is also interacts with the antigen, while CD2 is believed to primarily recognize the ELLA complex.
  • TCR also includes an antigen-binding fragment or an antigen-binding portion of any TCR disclosed herein, and includes a monovalent and a divalent fragment or portion, and a single chain TCR.
  • TCR is not limited to naturally occurring TCRs bound to the surface of a T cell.
  • TCR further refers to a TCR described herein that is expressed on the surface of a cell other than a T cell (e.g ., a cell that naturally expresses or that is modified to express CD3, as described herein), or a TCR described herein that is free from a cell membrane (e.g., an isolated TCR or a soluble TCR).
  • An "antigen binding molecule,” “portion of a TCR,” or “TCR fragment” refers to any portion of an TCR less than the whole.
  • An antigen binding molecule can include the antigenic complementarity determining regions (CDRs).
  • an "antigen” refers to any molecule, e.g, a peptide, that provokes an immune response or is capable of being bound by a TCR.
  • An “epitope,” as used herein, refers to a portion of a polypeptide that provokes an immune response or is capable of being bound by a TCR.
  • the immune response may involve either antibody production, or the activation of specific immunologically-competent cells, or both.
  • any macromolecule including virtually all proteins or peptides, can serve as an antigen.
  • An antigen and/or an epitope can be endogenously expressed, i.e. expressed by genomic DNA, or can be recombinantly expressed.
  • an antigen and/or an epitope can be specific to a certain tissue, such as a cancer cell, or it can be broadly expressed. In addition, fragments of larger molecules can act as antigens. In one embodiment, antigens are tumor antigens.
  • An epitope can be present in a longer polypeptide (e.g, in a protein), or an epitope can be present as a fragment of a longer polypeptide.
  • an epitope is complexed with a major histocompatibility complex (MHC; also referred to herein as complexed with an HLA molecule, e.g, an HLA class 1 molecule).
  • MHC major histocompatibility complex
  • NY-ESO-1 "New York esophageal squamous cell carcinoma 1,” “cancer- testis antigen IB,” or “CTAG1B,” as used herein, refers to a tumor antigen with expression in numerous cancer types.
  • NY-ESO-1 is a member of the cancer-testis antigen family, which are characterized by expression that is largely limited to the testicular germ cells and placenta trophoblasts, with little or no expression in healthy adult somatic cells.
  • NY-ESO-1 expression can be detected during embryonic development, and NY-ESO-1 expression is maintained in the spermatogonia and primary spermatocytes. In females, NY-ESO-1 expression quickly decreases in the female oogonia.
  • NY-ESO-1 RNA has been detected at low levels in ovarian and endometrial tissue; however, NY-ESO-1 protein has not been found in these tissues.
  • the NY-ESO-1 protein (SEQ ID NO: 52; Table 1) is an 18-kDa protein with 180 amino acids. See, e.g. , Thomas et ah, Front. Immunol. 9: 947 (2016).
  • HLA refers to the human leukocyte antigen.
  • HLA genes encode the major histocompatibility complex (MHC) proteins in humans. MHC proteins are expressed on the surface of cells, and are involved in activation of the immune response.
  • HLA class I genes encode MHC class I molecules, which are expressed on the surface of cells in complex with peptide fragments (antigens) of self or non-self proteins.
  • T cells expressing TCR and CD3 recognize the antigemMHC class I complex and initiate an immune response to target and destroy antigen presenting cells displaying non-self proteins.
  • an "HLA class I molecule” or “HLA class I molecule” refers to a protein product of a wild-type or variant HLA class I gene encoding an MHC class I molecule. Accordingly, "HLA class I molecule” and “MHC class I molecule” are used interchangeably herein.
  • the MHC Class I molecule comprises two protein chains: the alpha chain and the P2-microglobulin (b2ih) chain.
  • Human b2ih is encoded by the B2M gene.
  • the amino acid sequence of b2ih is set forth in SEQ ID NO: 16 (Table 2).
  • the alpha chain of the MHC Class I molecule is encoded by the HLA gene complex.
  • the HLA complex is located within the 6p21.3 region on the short arm of human chromosome 6 and contains more than 220 genes of diverse function.
  • the HLA gene are highly variant, with over 20,000 HLA alleles and related alleles, including over 15,000 HLA Class I alleles, known in the art, encoding thousands of HLA proteins, including over 10,000 HLA Class I proteins (see, e.g., hla.alleles.org, last visited February 27, 2019).
  • HLA-A HLA-A
  • HLA-B HLA-B
  • HLA-C HLA-C
  • HLA-E, HLA-F, and HLA-G encode proteins that associate with the MHC Class I molecule.
  • autologous refers to any material derived from the same individual to which it is later to be re-introduced.
  • an autologous T cell therapy comprises administering to a subject a T cell that was isolated from the same subject.
  • allogeneic refers to any material derived from one individual which is then introduced to another individual of the same species.
  • an allogeneic T cell transplantation comprises administering to a subject a T cell that was obtained from a donor other than the subject.
  • a "cancer” refers to a broad group of various diseases characterized by the uncontrolled growth of abnormal cells in the body. Unregulated cell division and growth results in the formation of malignant tumors that invade neighboring tissues and may also metastasize to distant parts of the body through the lymphatic system or bloodstream.
  • a “cancer” or “cancer tissue” can include a tumor. Examples of cancers that can be treated by the methods of the present invention include, but are not limited to, cancers of the immune system including lymphoma, leukemia, and other leukocyte malignancies.
  • the methods of the present invention can be used to reduce the tumor size of a tumor derived from, for example, bone cancer, renal cancer, prostate cancer, breast cancer, colon cancer, lung cancer, cutaneous or intraocular malignant melanoma, pancreatic cancer, skin cancer, cancer of the head or neck, cutaneous or intraocular malignant melanoma, uterine cancer, ovarian cancer, rectal cancer, cancer of the anal region, stomach cancer, testicular cancer, uterine cancer, carcinoma of the fallopian tubes, carcinoma of the endometrium, carcinoma of the cervix, carcinoma of the vagina, carcinoma of the vulva, Hodgkin's Disease, non-Hodgkin's lymphoma (NHL), primary mediastinal large B cell lymphoma (PMBC), diffuse large B cell lymphoma (DLBCL), follicular lymphoma (FL), transformed follicular lymphoma, splenic marginal zone lymphoma (SMZL), cancer of the a tumor derived
  • the particular cancer can be responsive to chemo- or radiation therapy or the cancer can be refractory.
  • a refractory cancer refers to a cancer that is not amendable to surgical intervention, and the cancer is either initially unresponsive to chemo- or radiation therapy or the cancer becomes unresponsive over time.
  • an "anti-tumor effect” as used herein refers to a biological effect that can present as a decrease in tumor volume, a decrease in the number of tumor cells, a decrease in tumor cell proliferation, a decrease in the number of metastases, an increase in overall or progression-free survival, an increase in life expectancy, or amelioration of various physiological symptoms associated with the tumor.
  • An anti-tumor effect can also refer to the prevention of the occurrence of a tumor, e.g ., a vaccine.
  • progression-free survival which can be abbreviated as PFS, as used herein refers to the time from the treatment date to the date of disease progression per the revised IWG Response Criteria for Malignant Lymphoma or death from any cause.
  • PD refers to a worsening of one or more symptom associated with a particular disease.
  • disease progression for a subject afflicted with a cancer can include an increase in the number or size of one or more malignant lesions, tumor metastasis, and death.
  • overall survival which can be abbreviated as OS, is defined as the time from the date of treatment to the date of death.
  • a "cytokine,” as used herein, refers to a non-antibody protein that is released by one cell in response to contact with a specific antigen, wherein the cytokine interacts with a second cell to mediate a response in the second cell.
  • a cytokine can be endogenously expressed by a cell or administered to a subject. Cytokines may be released by immune cells, including macrophages, B cells, T cells, and mast cells to propagate an immune response. Cytokines can induce various responses in the recipient cell. Cytokines can include homeostatic cytokines, chemokines, pro-inflammatory cytokines, effectors, and acute-phase proteins.
  • homeostatic cytokines including interleukin (IL) 7 and IL-15, promote immune cell survival and proliferation, and pro-inflammatory cytokines can promote an inflammatory response.
  • homeostatic cytokines include, but are not limited to, IL-2, IL-4, IL-5, IL-7, IL-10, IL-12p40, IL-12p70, IL-15, and interferon (IFN) gamma.
  • IFN interferon
  • pro-inflammatory cytokines include, but are not limited to, IL-la, IL-lb, IL-6, IL-13, IL-17a, tumor necrosis factor (TNF)-alpha, TNF-beta, fibroblast growth factor (FGF) 2, granulocyte macrophage colony-stimulating factor (GM-CSF), soluble intercellular adhesion molecule 1 (sICAM-1), soluble vascular adhesion molecule 1 (sVCAM-1), vascular endothelial growth factor (VEGF), VEGF-C, VEGF-D, and placental growth factor (PLGF).
  • IL-la tumor necrosis factor
  • FGF fibroblast growth factor
  • FGF fibroblast growth factor
  • GM-CSF granulocyte macrophage colony-stimulating factor
  • sICAM-1 soluble intercellular adhesion molecule 1
  • sVCAM-1 soluble vascular adhesion molecule 1
  • VEGF vascular endothelial growth factor
  • effectors include, but are not limited to, granzyme A, granzyme B, soluble Fas ligand (sFasL), and perforin.
  • acute phase-proteins include, but are not limited to, C-reactive protein (CRP) and serum amyloid A (SAA).
  • chemokines are a type of cytokine that mediates cell chemotaxis, or directional movement.
  • chemokines include, but are not limited to, IL-8, IL- 16, eotaxin, eotaxin-3, macrophage-derived chemokine (MDC or CCL22), monocyte chemotactic protein 1 (MCP-1 or CCL2), MCP-4, macrophage inflammatory protein la (MIP-la, MIP-la), MIP-Ib (MIP-lb), gamma-induced protein 10 (IP- 10), and thymus and activation regulated chemokine (TARC or CCL17).
  • MDC macrophage-derived chemokine
  • MCP-1 or CCL2 monocyte chemotactic protein 1
  • MCP-4 macrophage inflammatory protein la
  • MIP-la MIP-la
  • MIP-Ib MIP-Ib
  • IP- 10 gamma-induced protein 10
  • TARC or CCL17
  • analytes and cytokines of the present invention include, but are not limited to chemokine (C-C motif) ligand (CCL) 1, CCL5, monocyte-specific chemokine 3 (MCP3 or CCL7), monocyte chemoattractant protein 2 (MCP-2 or CCL8), CCL13, IL-1, IL-3, IL-9, IL-11, IL-12, IL-14, IL-17, IL-20, IL-21, granulocyte colony- stimulating factor (G-CSF), leukemia inhibitory factor (LIF), oncostatin M (OSM), CD 154, lymphotoxin (LT) beta, 4- IBB ligand (4-1BBL), a proliferation-inducing ligand (APRIL), CD70, CD153, CD178, glucocorticoid-induced TNFR-related ligand (GITRL), tumor necrosis factor superfamily member 14 (TNFSF14), OX40L, TNF- and
  • therapeutically effective dosage of a drug or therapeutic agent is any amount of the drug that, when used alone or in combination with another therapeutic agent, protects a subject against the onset of a disease or promotes disease regression evidenced by a decrease in severity of disease symptoms, an increase in frequency and duration of disease symptom- free periods, or a prevention of impairment or disability due to the disease affliction.
  • the ability of a therapeutic agent to promote disease regression can be evaluated using a variety of methods known to the skilled practitioner, such as in human subjects during clinical trials, in animal model systems predictive of efficacy in humans, or by assaying the activity of the agent in in vitro assays.
  • lymphocyte includes natural killer (NIC) cells, T cells, or B cells.
  • NIC natural killer
  • NK cells are a type of cytotoxic (cell toxic) lymphocyte that represent a major component of the inherent immune system. NK cells reject tumors and cells infected by viruses. It works through the process of apoptosis or programmed cell death. They were termed“natural killers” because they do not require activation in order to kill cells.
  • T-cells play a major role in cell-mediated-immunity (no antibody involvement).
  • T- cell receptors (TCR) differentiate T cells from other lymphocyte types. The thymus, a specialized organ of the immune system, is primarily responsible for the T cell’s maturation.
  • T-cells There are six types of T-cells, namely: Helper T-cells (e.g CD4+ cells), Cytotoxic T-cells (also known as TC, cytotoxic T lymphocyte, CTL, T-killer cell, cytolytic T cell, CD8+ T-cells or killer T cell), Memory T-cells ((i) stem memory TSCM cells, like naive cells, are CD45RO-, CCR7+, CD45RA+, CD62L+ (L-selectin), CD27+, CD28+ and IL-7Ra+, but they also express large amounts of CD95, IL-2R.p, CXCR3, and LFA-1, and show numerous functional attributes distinctive of memory cells); (ii) central memory TCM cells express L-selectin and the CCR7, they secrete IL-2, but not IFNy or IL-4, and (iii) effector memory TEM cells, however, do not express L-selectin or CCR7 but produce effector
  • B-cells play a principal role in humoral immunity (with antibody involvement).
  • a B cell makes antibodies and antigens and performs the role of antigen-presenting cells (APCs) and turns into memory B-cells after activation by antigen interaction.
  • APCs antigen-presenting cells
  • immature B-cells are formed in the bone marrow, where its name is derived from.
  • the term "genetically engineered” or “engineered” refers to a method of modifying the genome of a cell, including, but not limited to, deleting a coding or non coding region or a portion thereof or inserting a coding region or a portion thereof.
  • the cell that is modified is a lymphocyte, e.g ., a T cell or a modified cell that expresses CD3, which can either be obtained from a patient or a donor.
  • the cell can be modified to express an exogenous construct, such as, e.g. , a T cell receptor (TCR) disclosed herein, which is incorporated into the cell's genome.
  • TCR T cell receptor
  • the cell is modified to express CD3.
  • An "immune response” refers to the action of a cell of the immune system (for example, T lymphocytes, B lymphocytes, natural killer (NK) cells, macrophages, eosinophils, mast cells, dendritic cells and neutrophils) and soluble macromolecules produced by any of these cells or the liver (including Abs, cytokines, and complement) that results in selective targeting, binding to, damage to, destruction of, and/or elimination from a vertebrate's body of invading pathogens, cells or tissues infected with pathogens, cancerous or other abnormal cells, or, in cases of autoimmunity or pathological inflammation, normal human cells or tissues.
  • a cell of the immune system for example, T lymphocytes, B lymphocytes, natural killer (NK) cells, macrophages, eosinophils, mast cells, dendritic cells and neutrophils
  • soluble macromolecules produced by any of these cells or the liver (including Abs, cytokines, and complement) that results
  • immunotherapy refers to the treatment of a subject afflicted with, or at risk of contracting or suffering a recurrence of, a disease by a method comprising inducing, enhancing, suppressing or otherwise modifying an immune response.
  • immunotherapy include, but are not limited to, T cell therapies.
  • T cell therapy can include adoptive T cell therapy, tumor-infiltrating lymphocyte (TIL) immunotherapy, autologous cell therapy, engineered autologous cell therapy (eACT), and allogeneic T cell transplantation.
  • T cells used in an immunotherapy described herein can come from any source known in the art.
  • T cells can be differentiated in vitro from a hematopoietic stem cell population, or T cells can be obtained from a subject.
  • T cells can be obtained from, e.g. , peripheral blood mononuclear cells, bone marrow, lymph node tissue, cord blood, thymus tissue, tissue from a site of infection, ascites, pleural effusion, spleen tissue, and tumors.
  • the T cells can be derived from one or more T cell lines available in the art.
  • T cells can also be obtained from a unit of blood collected from a subject using any number of techniques known to the skilled artisan, such as FICOLLTM separation and/or apheresis. Additional methods of isolating T cells for a T cell therapy are disclosed in U.S. Patent Publication No. 2013/0287748, which is herein incorporated by references in its entirety.
  • An immunotherapy can also comprise administering a modified cell to a subject, wherein the modified cell expresses CD3 and a TCR disclosed herein. In some embodiments, the modified cell is not a T cell.
  • a "patient” as used herein includes any human who is afflicted with a cancer
  • a lymphoma or a leukemia e.g., a lymphoma or a leukemia.
  • subject e.g ., a lymphoma or a leukemia.
  • patient e.g ., a lymphoma or a leukemia.
  • peptide refers to a compound comprised of amino acid residues covalently linked by peptide bonds.
  • a protein or peptide must contain at least two amino acids, and no limitation is placed on the maximum number of amino acids that can comprise a protein's or peptide's sequence.
  • Polypeptides include any peptide or protein comprising two or more amino acids joined to each other by peptide bonds.
  • the term refers to both short chains, which also commonly are referred to in the art as peptides, oligopeptides and oligomers, for example, and to longer chains, which generally are referred to in the art as proteins, of which there are many types.
  • Polypeptides include, for example, biologically active fragments, substantially homologous polypeptides, oligopeptides, homodimers, heterodimers, variants of polypeptides, modified polypeptides, derivatives, analogs, fusion proteins, among others.
  • the polypeptides include natural peptides, recombinant peptides, synthetic peptides, or a combination thereof.
  • stimulation refers to a primary response induced by binding of a stimulatory molecule with its cognate ligand, wherein the binding mediates a signal transduction event.
  • a "stimulatory molecule” is a molecule on a T cell, e.g., the T cell receptor (TCR)/CD3 complex, that specifically binds with a cognate stimulatory ligand present on an antigen present cell.
  • a "stimulatory ligand” is a ligand that when present on an antigen presenting cell (e.g, an aAPC, a dendritic cell, a B-cell, and the like) can specifically bind with a stimulatory molecule on a T cell, thereby mediating a primary response by the T cell, including, but not limited to, activation, initiation of an immune response, proliferation, and the like.
  • Stimulatory ligands include, but are not limited to, an MHC Class I molecule loaded with a peptide, an anti-CD3 antibody, a superagonist anti- CD28 antibody, and a superagonist anti-CD2 antibody.
  • conditioning and “pre-conditioning” are used interchangeably herein and indicate preparing a patient in need of a T cell therapy for a suitable condition.
  • Conditioning includes, but is not limited to, reducing the number of endogenous lymphocytes, removing a cytokine sink, increasing a serum level of one or more homeostatic cytokines or pro-inflammatory factors, enhancing an effector function of T cells administered after the conditioning, enhancing antigen presenting cell activation and/or availability, or any combination thereof prior to a T cell therapy.
  • conditioning comprises increasing a serum level of one or more cytokines, e.g., interleukin 7 (IL-7), interleukin 15 (IL-15), interleukin 10 (IL-10), interleukin 5 (IL-5), gamma-induced protein 10 (IP- 10), interleukin 8 (IL-8), monocyte chemotactic protein 1 (MCP-1), placental growth factor (PLGF), C-reactive protein (CRP), soluble intercellular adhesion molecule 1 (sICAM-1), soluble vascular adhesion molecule 1 (sVCAM-1), or any combination thereof.
  • cytokines e.g., interleukin 7 (IL-7), interleukin 15 (IL-15), interleukin 10 (IL-10), interleukin 5 (IL-5), gamma-induced protein 10 (IP- 10), interleukin 8 (IL-8), monocyte chemotactic protein 1 (MCP-1), placental growth factor (PLGF), C-reactive protein (CRP), soluble
  • Treatment or “treating” of a subject refers to any type of intervention or process performed on, or the administration of an active agent to, the subject with the objective of reversing, alleviating, ameliorating, inhibiting, slowing down or preventing the onset, progression, development, severity or recurrence of a symptom, complication or condition, or biochemical indicia associated with a disease.
  • treatment or “treating” includes a partial remission. In another embodiment, “treatment” or “treating” includes a complete remission.
  • the terms "about” or “comprising essentially of refer to a value or composition that is within an acceptable error range for the particular value or composition as determined by one of ordinary skill in the art, which will depend in part on how the value or composition is measured or determined, i.e., the limitations of the measurement system.
  • “about” or “comprising essentially of can mean within 1 or more than 1 standard deviation per the practice in the art.
  • “about” or “comprising essentially of can mean a range of up to 10% (i.e., ⁇ 10%).
  • about 3mg can include any number between 2.7 mg and 3.3 mg (for 10%).
  • the terms can mean up to an order of magnitude or up to 5-fold of a value.
  • the meaning of "about” or “comprising essentially of should be assumed to be within an acceptable error range for that particular value or composition.
  • any concentration range, percentage range, ratio range or integer range is to be understood to include the value of any integer within the recited range and, when appropriate, fractions thereof (such as one-tenth and one-hundredth of an integer), unless otherwise indicated.
  • the present disclosure is directed to T Cell Receptors (TCRs) or antigen binding portions thereof that specifically bind to an epitope on NY-ESO-1, nucleic acid molecules that encode the same, and cells that comprise the TCR or the nucleic acid molecule.
  • TCRs T Cell Receptors
  • Some aspects of the present disclosure are directed to methods of treating a caner in a subject in need thereof, comprising administering to the subject a cell comprising the TCRs described herein.
  • Other aspects of the present disclosure are directed to an epitope of NY-ESO-1 that the TCRs bind to and ELLA class I molecules complexed to a peptide comprising the epitope of NY-ESO-1.
  • T-cell receptor is a molecule found on the surface of T cells, or
  • T lymphocytes that is responsible for recognizing fragments of antigen as peptides bound to major histocompatibility complex (MHC) molecules.
  • MHC major histocompatibility complex
  • the binding between TCR and antigen peptides is of relatively low affinity and is degenerate: that is, many TCRs recognize the same antigen peptide and many antigen peptides are recognized by the same TCR.
  • the TCR is composed of two different protein chains (that is, it is a heterodimer). In humans, in 95% of T cells the TCR consists of an alpha (a) chain and a beta (b) chain (encoded by TRA and TRB, respectively), whereas in 5% of T cells, the TCR consists of gamma and delta (g/d) chains (encoded by TRG and TRD, respectively). This ratio changes during ontogeny and in diseased states (such as leukemia). It also differs between species. Orthologues of the 4 loci have been mapped in various species. Each locus can produce a variety of polypeptides with constant and variable regions. [0104] When the TCR engages with antigenic peptide and MHC (peptide/MHC), the TCR consists of an alpha (a) chain and a beta (b) chain (encoded by TRA and TRB, respectively), whereas in 5% of T cells, the TCR consists of gamma and delta (g/d) chains
  • T lymphocyte is activated through signal transduction, that is, a series of biochemical events mediated by associated enzymes, co-receptors, specialized adaptor molecules, and activated or released transcription factors.
  • nucleic acid molecules comprising (i) a first nucleotide sequence encoding a recombinant TCR or an antigen binding portion thereof that specifically binds human NY-ESO-1 ("anti-NY-ESO-1 TCR"); and (ii) a second nucleotide sequence, wherein the second nucleotide sequence or the polypeptide encoded by the second nucleotide sequence inhibits the expression of an endogenous TCR.
  • the second nucleotide sequence is a non- naturally occurring sequence. In other embodiments, the second nucleotide sequence is synthetic.
  • the second nucleotide sequence comprises a sequence that targets a nucleotide sequence encoding the endogenous TCR.
  • the anti-NY-ESO-1 TCR cross competes for binding to human NY-ESO-1 with a reference TCR.
  • the anti-NY-ESO-1 TCR binds the same epitope or an overlapping epitope of human NY-ESO-1 as a reference TCR.
  • the reference TCR comprises an alpha chain and a beta chain; wherein the alpha chain comprises a complementarity determining region 1 (CDR1), a CDR2, and a CDR3; wherein the beta chain comprises a CDR1, a CDR2, and a CDR3; and wherein the reference TCR comprises the alpha chain CDR3 set forth in SEQ ID NO: 7 and the beta chain CDR3 set forth in SEQ ID NO: 10.
  • reference TCR comprises the beta chain CDR1, CDR2, and CDR3 sequences present in the amino acid sequence set forth in SEQ ID NO: 2.
  • the reference TCR comprises an alpha chain and a beta chain, wherein the alpha chain comprises an amino acid sequence as set forth in SEQ ID NO: 1 and the beta chain comprises an amino acid sequence as set forth in SEQ ID NO: 2.
  • the present disclosure is directed to a TCR encoded by the first nucleotide sequence described herein.
  • the anti-NY-ESO-1 TCR encoded by the first nucleotide sequence comprises an alpha chain and a beta chain, wherein the alpha chain comprises a variable domain comprising an alpha chain CDR1, an alpha chain CDR2, and an alpha chain CDR3; and wherein the beta chain comprises variable domain comprising a beta chain CDR1, a beta chain CDR2, and a beta chain CDR3.
  • the anti-NY-ESO-1 TCR comprises an alpha chain CDR3 comprising an amino acid sequence as set forth in SEQ ID NO: 7 (CAGMDSNYQLIW).
  • the anti-NY-ESO-1 TCR comprises a beta chain CDR3 comprising an amino acid sequence as set forth in SEQ ID NO: 10 (CASSLPLGYEQYF).
  • the non-CDR regions in the alpha chain and/or the beta chain are further modified, e.g ., substitution or mutation of one amino acid, two amino acids, three amino acids, four amino acids, five amino acids, or six amino acids, thereby the alpha chain and/or the beta chain are not naturally occurring.
  • the substitutions or mutations can improve the TCRs described herein in various ways, e.g. , binding affinity, binding specificity, stability, viscosity, or any combination thereof.
  • the anti-NY-ESO-1 TCR encoded by the first nucleotide sequence comprises an alpha chain CDR1, wherein the alpha chain CDR1 of the anti-NY-ESO-1 TCR comprises an amino acid sequence as set forth in SEQ ID NO: 5 (YGATPY).
  • the anti-NY-ESO-1 TCR encoded by the first nucleotide sequence comprises a beta chain CDR1, wherein the beta chain CDR1 of the anti-NY-ESO-1 TCR comprises an amino acid sequence as set forth in SEQ ID NO: 8 (MNHNS).
  • the anti-NY-ESO-1 TCR encoded by the first nucleotide sequence comprises an alpha chain CDR2, wherein the alpha chain CDR2 of the anti-NY-ESO-1 TCR comprises an amino acid sequence as set forth in SEQ ID NO: 6 (YFSGDTLV).
  • the anti-NY-ESO-1 TCR encoded by the first nucleotide sequence comprises a beta chain CDR2, wherein the beta chain CDR2 of the anti-NY-ESO-1 TCR comprises an amino acid sequence as set forth in SEQ ID NO: 9 (SASEGT).
  • the anti-NY-ESO-1 TCR encoded by the first nucleotide sequence comprises an alpha chain variable domain having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97% at least about 98%, at least about 99%, or about 100% sequence identity with a variable domain of the alpha chain amino acid sequence set forth in SEQ ID NO: 1.
  • the anti-NY-ESO-1 TCR encoded by the first nucleotide sequence comprises an alpha chain variable domain having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97% at least about 98%, or at least about 99% sequence identity with a variable domain of the alpha chain amino acid sequence set forth in SEQ ID NO: 1, wherein the anti-NY-ESO-1 TCR comprises an alpha chain CDR3 comprising an amino acid sequence as set forth in SEQ ID NO: 7.
  • the anti-NY-ESO-1 TCR encoded by the first nucleotide sequence comprises an alpha chain variable domain present in the alpha chain amino acid sequence set forth in SEQ ID NO: 1.
  • the anti-NY-ESO-1 TCR encoded by the first nucleotide sequence comprises a beta chain variable domain having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97% at least about 98%, at least about 99%, or about 100% sequence identity with a variable domain of the beta chain amino acid sequence set forth in SEQ ID NO: 2.
  • the anti-NY-ESO-1 TCR encoded by the first nucleotide sequence comprises a beta chain variable domain having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97% at least about 98%, or at least about 99% sequence identity with a variable domain of the beta chain amino acid sequence set forth in SEQ ID NO: 2, wherein the anti-NY-ESO-1 TCR comprises a beta chain CDR3 comprising an amino acid sequence as set forth in SEQ ID NO: 10.
  • the anti-NY-ESO-1 TCR encoded by the first nucleotide sequence comprises a beta chain variable domain present in the amino acid sequence set forth in SEQ ID NO: 2.
  • the anti-NY-ESO-1 TCR encoded by the first nucleotide further comprises an alpha chain constant region, a beta chain constant region, or both an alpha chain constant region and a beta chain constant region.
  • the anti-NY-ESO-1 TCR encoded by the first nucleotide sequence comprises an alpha chain constant region having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97% at least about 98%, at least about 99%, or about 100% sequence identity with a constant region of the alpha chain amino acid sequence set forth in SEQ ID NO: 1.
  • the anti-NY-ESO-1 TCR encoded by the first nucleotide sequence comprises an alpha chain constant region having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97% at least about 98%, or at least about 99% sequence identity with a constant region of the alpha chain amino acid sequence set forth in SEQ ID NO: 1, wherein the anti-NY-ESO-1 TCR comprises an alpha chain CDR3 comprising an amino acid sequence as set forth in SEQ ID NO: 7.
  • the anti-NY-ESO-1 TCR encoded by the first nucleotide sequence comprises an alpha chain constant region present in the alpha chain amino acid sequence set forth in SEQ ID NO: 1.
  • the anti-NY-ESO-1 TCR encoded by the first nucleotide further comprises an alpha constant region that is different from endogenous, e.g ., naturally occurring, constant regions of the alpha chain.
  • the alpha chain constant region comprises an amino acid sequence comprising at least 1, at least 2, at least 3, at least 4, or at least 5 amino acid substitutions relative to the amino acid sequence of the constant region of the alpha chain amino acid sequence set forth in SEQ ID NO: 1.
  • the anti-NY-ESO-1 TCR encoded by the first nucleotide sequence comprises a beta chain constant region having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97% at least about 98%, at least about 99%, or about 100% sequence identity with a constant region of the beta chain amino acid sequence set forth in SEQ ID NO: 2.
  • the anti-NY-ESO-1 TCR encoded by the first nucleotide sequence comprises a beta chain constant region having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97% at least about 98%, or at least about 99% sequence identity with a constant region of the beta chain amino acid sequence set forth in SEQ ID NO: 2, wherein the anti-NY-ESO-1 TCR comprises a beta chain CDR3 comprising an amino acid sequence as set forth in SEQ ID NO: 10.
  • the anti-NY-ESO-1 TCR encoded by the first nucleotide sequence comprises a beta chain constant region present in the amino acid sequence set forth in SEQ ID NO: 2.
  • the anti-NY-ESO-1 TCR encoded by the first nucleotide further comprises a beta constant region that is different from endogenous, e.g. , naturally occurring, constant regions of the beta chain.
  • the beta chain constant region comprises an amino acid sequence comprising at least 1, at least 2, at least 3, at least 4, or at least 5 amino acid substitutions relative to the amino acid sequence of the constant region of the beta chain amino acid sequence set forth in SEQ ID NO: 2.
  • the anti-NY-ESO-1 TCR encoded by the first nucleotide sequence comprises an alpha chain having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97% at least about 98%, at least about 99%, or about 100% sequence identity with the alpha chain amino acid sequence set forth in SEQ ID NO: 1.
  • the anti- NY-ESO-1 TCR encoded by the first nucleotide sequence comprises an alpha chain having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97% at least about 98%, at least about 99%, or about 100% sequence identity with the alpha chain amino acid sequence set forth in SEQ ID NO: 1, wherein the anti-NY-ESO-1 TCR comprises an alpha chain CDR3 comprising an amino acid sequence as set forth in SEQ ID NO: 7.
  • the anti-NY-ESO-1 TCR encoded by the first nucleotide sequence comprises an alpha chain comprising the amino acid sequence set forth in SEQ ID NO: 1.
  • the anti-NY-ESO-1 TCR encoded by the first nucleotide sequence comprises a beta chain having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97% at least about 98%, at least about 99%, or about 100% sequence identity with the beta chain amino acid sequence set forth in SEQ ID NO: 2.
  • the anti-NY- ESO-1 TCR encoded by the first nucleotide sequence comprises a beta chain having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97% at least about 98%, at least about 99%, or about 100% sequence identity with the beta chain amino acid sequence set forth in SEQ ID NO: 2, wherein the anti-NY-ESO-1 TCR comprises a beta chain CDR3 comprising an amino acid sequence as set forth in SEQ ID NO: 10.
  • the anti-NY-ESO-1 TCR encoded by the first nucleotide sequence comprises a beta chain comprising the amino acid sequence set forth in SEQ ID NO: 2.
  • the anti-NY-ESO-1 TCR encoded by the first nucleotide sequence comprises an alpha chain constant region, a beta chain constant region, or both; and wherein the alpha chain constant region, the beta chain constant region, or both comprises an amino acid sequence having at least 1, at least 2, at least 3, at least 4, or at least 5 substitutions within the target sequence relative to the corresponding amino acid sequence of an endogenous TCR.
  • the anti-NY-ESO-1 TCR encoded by the first nucleotide sequence binds the same epitope as a reference TCR.
  • the anti-NY-ESO-1 TCR binds to an epitope of NY-ESO-1 comprising the amino acid sequence set forth in SEQ ID NO: 13 (LAMPFATPM).
  • the anti- NY-ESO-1 TCR binds to an epitope of NY-ESO-1 consisting of an amino acid sequence as set forth in SEQ ID NO: 13.
  • the epitope consists of amino acid residues 92-100 of NY-ESO-1 (SEQ ID NO: 52), e.g ., "NY-ESO-192-100.”
  • the epitope is complexed with an HLA class I molecule.
  • HLA human leukocyte antigen
  • MHC major histocompatibility complex
  • TCR T-cell receptor
  • Class I MHC molecules are present as transmembrane glycoproteins on the surface of all nucleated cells.
  • Intact class I molecules consist of an alpha heavy chain bound to a beta-2 microglobulin molecule.
  • the heavy chain consists of 2 peptide-binding domains, an Ig-like domain, and a transmembrane region with a cytoplasmic tail.
  • the heavy chain of the class I molecule is encoded by genes at HLA-A, HLA-B, and HLA-C loci.
  • T cells that express CD8 molecules react with class I MHC molecules. These lymphocytes often have a cytotoxic function, requiring them to be capable of recognizing any infected cell.
  • class I MHC genes encode nonclassical MHC molecules, such as HLA-G (which may play a role in protecting the fetus from the maternal immune response) and HLA-E (which presents peptides to certain receptors on natural killer [NK] cells).
  • the HLA class 1 molecule is selected from an HLA-A,
  • the HLA class 1 molecule is selected from an HLA-E, HLA-F, and HLA-G allele. In certain embodiments, the HLA class 1 molecule is an HLA-A allele. In certain embodiments, the HLA class 1 molecule is an HLA-B allele. In certain embodiments, the HLA class 1 molecule is an HLA-C allele.
  • HLA-A, HLA-B, and HLA-C alleles are known in the art, and any of the known alleles can be used in the present disclosure.
  • An updated list of HLA alleles is available at hla.alleles.org/ (last visited on February 27, 2019).
  • the HLA class 1 molecule is an HLA-C allele selected from an HLA-C*03:02 allele, an HLA-C *03: 03 allele, an HLA-C*03:04 allele, an HLA-C*03:05 allele, and an HLA- C*03:06 allele.
  • the HLA-C allele is an HLA-C*03:02 allele.
  • the HLA-C allele is an HLA-C*03:03 allele. In certain embodiments, the HLA-C allele is an HLA-C*03:04 allele. In certain embodiments, the HLA-C allele is an HLA-C*03:05 allele. In certain embodiments, the HLA-C allele is an HLA-C*03: 06 allele.
  • the HLA class 1 molecule is an HLA-C allele selected from the group consisting of HLA-C*03:02:01; HLA-C*03:02:02:01; HLA- C*03:02:02:02; HLA-C*03:02:02:03; HLA-C *03: 02: 02: 04; HLA-C*03:02:02:05; HLA- C*03:02:03; HLA-C*03:02:04; HLA-C*03:02:05; HLA-C*03:02:06; HLA-C*03:02:07; HLA-C*03:02:08; HLA-C*03:02:09; HLA-C*03:02:10; HLA-C*03:02:11; HLA-C*03:02:01; HLA-C*03:02:01; HLA- C*03:02:02:01; HLA- C*03:02:02:02; HLA-C*03:02:
  • the HLA class 1 molecule is an HLA-C allele selected from the group consisting of HLA- C*03:03:01:01; HLA-C*03:03:01:02; HLA-C*03:03:01:03; HLA-C*03:03:01:04; HLA- C*03:03:01:05; HLA-C*03:03:01:06; HLA-C*03:03:01:07; HLA-C*03:03:01:08; HLA- C*03:03:01:09; HLA-C*03:03:01:10; HLA-C*03:03:01:11; HLA-C*03:03:01:12; HLA- C*03:03:01:13; HLA-C*03:03:01:14; HLA-C*03:03:02; HLA-C*03:03:03;03;
  • the HLA class 1 molecule is an HLA-C allele selected from the group consisting of HLA-C*03:04:01:01; HLA- C*03:04:01:02; HLA-C*03:04:01:03; HLA-C*03:04:01:04; HLA-C*03:04:01:05; HLA- C*03:04:01:06; HLA-C*03:04:01:07; HLA-C*03:04:01:08; HLA-C*03:04:01:09; HLA- C*03:04:01:10; HLA-C*03:04:01:11; HLA-C*03:04:01:12; HLA-C*03:04:01:13; HLA-C*03:04:10; HLA-C*03:04:01:11; HLA-C*03:04:01:12; HLA-C*03:04:01:13; HLA-C*03:04:10:10;
  • the HLA class 1 molecule is an HLA-C allele selected from the group consisting of HLA-C*03:05; HLA-C*03:06:01; and HLA- C*03:06:02.
  • the second nucleotide sequence of the nucleic acid molecule disclosed herein can be any sequence or can encode for any polypeptide that is capable of inhibiting the expression of an endogenous TCR.
  • the second nucleotide sequence is one or more siRNAs.
  • the one or more siRNAs are complementary to a target sequence within a nucleotide sequence encoding a constant region of an endogenous TCR.
  • the one or more siRNAs are complementary to a target sequence within a nucleotide sequence encoding a constant region of wild-type, human TCR.
  • the one or more siRNAs are complementary to a target sequence within a nucleotide sequence encoding a constant region of the alpha chain of wild-type TCR. In some embodiments, the one or more siRNAs are complementary to a target sequence within a nucleotide sequence encoding a constant region of the beta chain of wild-type TCR.
  • the one or more siRNAs comprise (i) one or more siRNA's that are complementary to a target sequence within a nucleotide sequence encoding a constant region of the alpha chain of wild-type TCR and (ii) one or more siRNA's that are complementary to a target sequence within a nucleotide sequence encoding a constant region of the beta chain of wild-type TCR.
  • the one or more siRNAs comprise a nucleotide sequence selected from the group consisting of SEQ ID NOs: 53-56 (Table 4).
  • the second nucleotide sequence of the nucleic acid molecule encodes one or more siRNAs, wherein the one or more siRNAs are complementary to a target sequence within a nucleotide sequence encoding a constant region of the alpha chain of wild-type TCR, and wherein the one or more siRNAs comprise the nucleic acid sequences set forth in SEQ ID NOs: 53 and 54.
  • the second nucleotide sequence of the nucleic acid molecule encodes one or more siRNAs, wherein the one or more siRNAs are complementary to a target sequence within a nucleotide sequence encoding a constant region of the beta chain of wild-type TCR, and wherein the one or more siRNAs comprise the nucleic acid sequences set forth in SEQ ID NOs: 55 and 56.
  • the second nucleotide sequence of the nucleic acid molecule encodes one or more siRNAs, wherein the one or more siRNAs comprise (i) one or more siRNAs that are complementary to a target sequence within a nucleotide sequence encoding a constant region of the alpha chain of wild-type TCR, wherein the one or more siRNAs comprise the nucleic acid sequences set forth in SEQ ID NOs: 53 and 54; and (ii) one or more siRNAs that are complementary to a target sequence within a nucleotide sequence encoding a constant region of the beta chain of wild-type TCR, wherein the one or more siRNAs comprise the nucleic acid sequences set forth in SEQ ID NOs: 55 and 56.
  • the second nucleotide sequence of the nucleic acid molecule comprises SEQ ID NOs: 53-56. In some embodiments, the second nucleotide sequence comprises SEQ ID NOs: 53-56, wherein one or more of SEQ ID NOs: 53-56 is separated by one or more nucleic acids that do not encode an siRNA. In certain embodiments, the one or more siRNAs are selected from the siRNAs disclosed in U.S. Publication No. 2010/0273213 Al, which is incorporated by reference herein in its entirety.
  • the second nucleotide sequence of the nucleic acid molecule encodes a protein, wherein the protein is capable of inhibiting the expression of an endogenous, e.g ., wild-type, TCR.
  • the second nucleotide sequence encodes Cas9.
  • the vector is a viral vector.
  • the vector is a viral particle or a virus.
  • the vector is a mammalian vector.
  • the vector is a bacterial vector.
  • the vector is a retroviral vector.
  • the vector is selected from the group consisting of an adenoviral vector, a lentivirus, a Sendai virus, a baculoviral vector, an Epstein Barr viral vector, a papovaviral vector, a vaccinia viral vector, a herpes simplex viral vector, and an adeno associated virus (AAV) vector.
  • the vector is an AAV vector.
  • the vector is a lentivirus.
  • the vector is an AAV vector.
  • the vector is a Sendai virus.
  • the vector is a hybrid vector. Examples of hybrid vectors that can be used in the present disclosure can be found in Huang and Kamihira, Biotechnol. Adv. 37(2):208-23 (2103), which is incorporated by reference herein in its entirety.
  • TCRs T Cell Receptors
  • Certain aspects of the present disclosure are directed to recombinant T cell receptors (TCRs) or an antigen binding portion thereof that specifically bind human NY- ESO-1 ("an anti-NY-ESO-1 TCR").
  • TCRs T cell receptors
  • an antigen binding portion thereof that specifically bind human NY- ESO-1
  • the anti-NY-ESO-1 TCR is encoded by the a nucleic acid molecule disclosed herein.
  • the anti-NY-ESO-1 TCR cross competes for binding to human NY-ESO-1 with a reference TCR.
  • the anti-NY-ESO-1 TCR binds the same epitope or an overlapping epitope of human NY-ESO-1 as a reference TCR.
  • the reference TCR comprises an alpha chain and a beta chain, and the alpha chain comprises of the reference TCR comprises an amino acid sequence as set forth in SEQ ID NO: 1.
  • the beta chain of the reference TCR comprises an amino acid sequence as set forth in SEQ ID NO: 2.
  • the anti-NY-ESO-1 TCR comprises an alpha chain and a beta chain, wherein the alpha chain comprises a constant region, and wherein the beta chain comprises a constant region; wherein the alpha chain constant region comprises an amino acid sequence having a least 1, at least 2, at least 3, at least 4, or at least 5 amino acid substitutions relative to the constant region of an alpha chain comprising the amino acid sequence set forth in SEQ ID NO: 1.
  • the anti-NY-ESO-1 TCR comprises an alpha chain and a beta chain, wherein the alpha chain comprises a constant region, and wherein the beta chain comprises a constant region; wherein the beta chain constant region comprises an amino acid sequence having a least 1, at least 2, at least 3, at least 4, or at least 5 amino acid substitutions relative to the constant region of a beta chain comprising the amino acid sequence set forth in SEQ ID NO: 2.
  • the anti-NY-ESO-1 TCR comprises an alpha chain and a beta chain, wherein the alpha chain comprises a constant region, and wherein the beta chain comprises a constant region; wherein (i) the alpha chain constant region comprises an amino acid sequence having a least 1, at least 2, at least 3, at least 4, or at least 5 amino acid substitutions relative to the constant region of an alpha chain comprising the amino acid sequence set forth in SEQ ID NO: 1; and (ii) the beta chain constant region comprises an amino acid sequence having a least 1, at least 2, at least 3, at least 4, or at least 5 amino acid substitutions relative to the constant region of a beta chain comprising the amino acid sequence set forth in SEQ ID NO: 2.
  • the alpha chain of the anti-NY-ESO-1 TCR comprises a variable domain comprising an alpha chain CDR1, an alpha chain CDR2, and an alpha chain CDR3; and the beta chain of the anti-NY-ESO-1 TCR comprises a variable domain comprising a beta chain CDR1, a beta chain CDR2, and a beta chain CDR3.
  • the anti-NY-ESO-1 TCR comprises an alpha chain CDR3 comprising an amino acid sequence as set forth in SEQ ID NO: 7.
  • the anti-NY- ESO-1 TCR comprises a beta chain CDR3 comprising an amino acid sequence as set forth in SEQ ID NO: 10.
  • the alpha chain CDR1 of the anti-NY-ESO-1 TCR comprises an amino acid sequence as set forth in SEQ ID NO: 5.
  • the beta chain CDR1 of the anti-NY-ESO-1 TCR comprises an amino acid sequence as set forth in SEQ ID NO: 8.
  • the alpha chain CDR2 of the anti-NY-ESO-1 TCR comprises an amino acid sequence as set forth in SEQ ID NO: 6.
  • the beta chain CDR2 of the anti-NY-ESO-1 TCR comprises an amino acid sequence as set forth in SEQ ID NO: 9.
  • the anti-NY-ESO-1 TCR comprises an alpha chain variable domain having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97% at least about 98%, at least about 99%, or about 100% sequence identity with a variable domain of the alpha chain amino acid sequence set forth in SEQ ID NO: 1.
  • the anti-NY-ESO-1 TCR comprises an alpha chain variable domain having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97% at least about 98%, or at least about 99% sequence identity with a variable domain of the alpha chain amino acid sequence set forth in SEQ ID NO: 1, wherein the anti-NY-ESO-1 TCR comprises an alpha chain CDR3 comprising an amino acid sequence as set forth in SEQ ID NO: 7. In some embodiments, the anti-NY-ESO-1 TCR comprises an alpha chain variable domain present in the alpha chain amino acid sequence set forth in SEQ ID NO: 1
  • the anti-NY-ESO-1 TCR comprises a beta chain variable domain having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97% at least about 98%, at least about 99%, or about 100% sequence identity with a variable domain of the beta chain amino acid sequence set forth in SEQ ID NO: 2.
  • the anti-NY-ESO-1 TCR comprises a beta chain variable domain having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97% at least about 98%, or at least about 99% sequence identity with a variable domain of the beta chain amino acid sequence set forth in SEQ ID NO: 2, wherein the anti-NY-ESO-1 TCR comprises a beta chain CDR3 comprising an amino acid sequence as set forth in SEQ ID NO: 10.
  • the anti-NY-ESO-1 TCR comprises a beta chain variable domain present in the beta chain amino acid sequence set forth in SEQ ID NO: 2.
  • the anti-NY-ESO-1 TCR encoded by the first nucleotide further comprises an alpha chain constant region, a beta chain constant region, or both an alpha chain constant region and a beta chain constant region.
  • the anti-NY-ESO-1 TCR comprises an alpha chain constant region having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97% at least about 98%, at least about 99%, or about 100% sequence identity with a constant region of the alpha chain amino acid sequence set forth in SEQ ID NO: 1.
  • the anti-NY-ESO-1 TCR comprises an alpha chain constant region having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97% at least about 98%, or at least about 99% sequence identity with a constant region of the alpha chain amino acid sequence set forth in SEQ ID NO: 1, wherein the anti-NY-ESO-1 TCR comprises an alpha chain CDR3 comprising an amino acid sequence as set forth in SEQ ID NO: 7. In some embodiments, the anti-NY-ESO-1 TCR comprises an alpha chain constant region present in the alpha chain amino acid sequence set forth in SEQ ID NO: 1.
  • the anti-NY-ESO-1 TCR encoded by the first nucleotide further comprises an alpha constant region that is different from endogenous, e.g ., naturally occurring, constant regions of the alpha chain.
  • the alpha chain constant region comprises an amino acid sequence comprising at least 1, at least 2, at least 3, at least 4, or at least 5 amino acid substitutions relative to the amino acid sequence of the constant region of the alpha chain amino acid sequence set forth in SEQ ID NO: 1.
  • the anti-NY-ESO-1 TCR comprises a beta chain constant region having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97% at least about 98%, at least about 99%, or about 100% sequence identity with a constant region of the beta chain amino acid sequence set forth in SEQ ID NO: 2.
  • the anti-NY-ESO-1 TCR comprises a beta chain constant region having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97% at least about 98%, or at least about 99% sequence identity with a constant region of the beta chain amino acid sequence set forth in SEQ ID NO: 2, wherein the anti-NY-ESO-1 TCR comprises a beta chain CDR3 comprising an amino acid sequence as set forth in SEQ ID NO: 10.
  • the anti-NY-ESO-1 TCR comprises a beta chain constant region present in the beta chain amino acid sequence set forth in SEQ ID NO: 2.
  • the anti-NY-ESO-1 TCR encoded by the first nucleotide further comprises a beta constant region that is different from endogenous, e.g. , naturally occurring, constant regions of the beta chain.
  • the beta chain constant region comprises an amino acid sequence comprising at least 1, at least 2, at least 3, at least 4, or at least 5 amino acid substitutions relative to the amino acid sequence of the constant region of the beta chain amino acid sequence set forth in SEQ ID NO: 2.
  • the anti-NY-ESO-1 TCR comprises an alpha chain having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97% at least about 98%, at least about 99%, or about 100% sequence identity with the alpha chain amino acid sequence set forth in SEQ ID NO: 1.
  • the anti-NY-ESO-1 TCR comprises an alpha chain having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97% at least about 98%, at least about 99%, or about 100% sequence identity with the alpha chain amino acid sequence set forth in SEQ ID NO: 1, wherein the anti-NY-ESO-1 TCR comprises an alpha chain CDR3 comprising an amino acid sequence as set forth in SEQ ID NO: 7. In some embodiments, the anti-NY-ESO-1 TCR comprises an alpha chain comprising the amino acid sequence set forth in SEQ ID NO: 1.
  • the anti-NY-ESO-1 TCR comprises a beta chain having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97% at least about 98%, at least about 99%, or about 100% sequence identity with the beta chain amino acid sequence set forth in SEQ ID NO: 2.
  • the anti-NY-ESO-1 TCR comprises a beta chain having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97% at least about 98%, at least about 99%, or about 100% sequence identity with the beta chain amino acid sequence set forth in SEQ ID NO: 2, wherein the anti-NY- ESO-1 TCR comprises a beta chain CDR3 comprising an amino acid sequence as set forth in SEQ ID NO: 10. In some embodiments, the anti-NY-ESO-1 TCR comprises a beta chain comprising the amino acid sequence set forth in SEQ ID NO: 2.
  • the anti-NY-ESO-1 TCR comprises an alpha chain constant region, a beta chain constant region, or both; and wherein the alpha chain constant region, the beta chain constant region, or both comprises an amino acid sequence having at least 1, at least 2, at least 3, at least 4, or at least 5 substitutions within the target sequence relative to the corresponding amino acid sequence of an endogenous TCR.
  • the anti-NY-ESO-1 TCR binds the same epitope as a reference TCR. In some embodiments, the anti-NY-ESO-1 TCR binds to an epitope of NY-ESO-1 comprising the amino acid sequence set forth in SEQ ID NO: 13 (LAMPFATPM). In some embodiments, the anti-NY-ESO-1 TCR binds to an epitope of NY-ESO-1 consisting of an amino acid sequence as set forth in SEQ ID NO: 13. In some embodiments, the epitope consists of amino acid residues 92-100 of NY-ESO-1 (SEQ ID NO: 52), e.g., "NY-ESO-192-100.”
  • the epitope is complexed with an HLA class I molecule.
  • the HLA class 1 molecule is selected from an HLA-A, HLA-B, and HLA-C allele.
  • the HLA class 1 molecule is selected from an HLA-E, HLA-F, and HLA-G allele.
  • the HLA class 1 molecule is an HLA-A allele.
  • the HLA class 1 molecule is an HLA-B allele.
  • the HLA class 1 molecule is an HLA-C allele.
  • HLA-A, HLA-B, and HLA-C alleles are known in the art, and any of the known alleles can be used in the present disclosure.
  • An updated list of HLA alleles is available at hla.alleles.org/ (last visited on February 27, 2019).
  • the HLA class 1 molecule is an HLA-C allele selected from an HLA-C*03:02 allele, an HLA-C *03: 03 allele, an HLA-C*03:04 allele, an HLA-C*03:05 allele, and an HLA- C*03:06 allele.
  • the HLA-C allele is an HLA-C*03:02 allele.
  • the HLA-C allele is an HLA-C*03:03 allele. In certain embodiments, the HLA-C allele is an HLA-C*03:04 allele. In certain embodiments, the HLA-C allele is an HLA-C*03:05 allele. In certain embodiments, the HLA-C allele is an HLA-C*03: 06 allele.
  • the HLA class 1 molecule is an HLA-C allele selected from the group consisting of HLA-C*03:02:01; HLA-C*03:02:02:01; HLA- C*03:02:02:02; HLA-C*03:02:02:03; HLA-C *03: 02: 02: 04; HLA-C*03:02:02:05; HLA- C*03:02:03; HLA-C*03:02:04; HLA-C*03:02:05; HLA-C*03:02:06; HLA-C*03:02:07; HLA-C*03:02:08; HLA-C*03:02:09; HLA-C*03:02:10; HLA-C*03:02:11; HLA-C*03:02:01; HLA-C*03:02:01; HLA- C*03:02:02:01; HLA- C*03:02:02:02; HLA-C*03:02:
  • the HLA class 1 molecule is an HLA-C allele selected from the group consisting of HLA- C*03:03:01:01; HLA-C*03:03:01:02; HLA-C*03:03:01:03; HLA-C*03:03:01:04; HLA- C*03:03:01:05; HLA-C*03:03:01:06; HLA-C*03:03:01:07; HLA-C*03:03:01:08; HLA- C*03:03:01:09; HLA-C*03:03:01:10; HLA-C*03:03:01:11; HLA-C*03:03:01:12; HLA- C*03:03:01:13; HLA-C*03:03:01:14; HLA-C*03:03:02; HLA-C*03:03:03;03;
  • the HLA class 1 molecule is an HLA-C allele selected from the group consisting of HLA-C*03:04:01:01; HLA- C*03:04:01:02; HLA-C*03:04:01:03; HLA-C*03:04:01:04; HLA-C*03:04:01:05; HLA- C*03:04:01:06; HLA-C*03:04:01:07; HLA-C*03:04:01:08; HLA-C*03:04:01:09; HLA- C*03:04:01:10; HLA-C*03:04:01:11; HLA-C*03:04:01:12; HLA-C*03:04:01:13; HLA-C*03:04:10; HLA-C*03:04:01:11; HLA-C*03:04:01:12; HLA-C*03:04:01:13; HLA-C*03:04:10:10;
  • the HLA class 1 molecule is an HLA-C allele selected from the group consisting of HLA-C*03:05; HLA-C*03:06:01; and HLA- C*03:06:02. II.B.3. Bispecific T Cell Receptors (TCRs)
  • Certain aspects of the present disclosure are directed to a bispecific TCR comprising a first antigen-binding domain and a second antigen-binding domain, wherein the first antigen-binding domain comprises a TCR or an antigen-binding portion thereof disclosed herein.
  • the first antigen-binding domain comprises a single chain variable fragment ("scFv").
  • the second antigen-binding domain binds specifically to a protein expressed on the surface of a T cell. Any protein expressed on the surface of a T cell can be targeted by the bispecific antibody disclosed herein. In certain embodiments, the protein expressed on the surface of a T cell is not expressed by other cells. In some embodiments, the protein expressed on the surface of a T cell is expressed on the surface of one or more other human immune cells. In some embodiments, the protein expressed on the surface of a T cell is expressed on the surface of one or more other human immune cells, but it is not expressed on the surface of a human non-immune cell.
  • the second antigen-binding domain binds specifically to a protein expressed on the surface of a T cell selected from CD3, CD2, CD5, CD6, CD8, CDl la (LFA-Ia), CD43, CD45, and CD53. In certain embodiments, the second antigen binding domain binds specifically to CD3. In some embodiments, the second antigen binding domain comprises an scFv.
  • first antigen-binding domain and the second antigen-binding domain are linked or associated by a covalent bond. In some embodiments, the first antigen-binding domain and the second antigen-binding domain are linked by a peptide bond.
  • Certain aspects of the present disclosure are directed to cells comprising a nucleic acid molecule disclosed herein, a vector disclosed herein, a recombinant TCR disclosed herein, a bispecific TCR disclosed herein, or any combination thereof. Any cell can be used in the present disclosure.
  • the cell expresses CD3.
  • CD3 expression can be naturally occurring, e.g ., the CD3 is expressed from a nucleic acid sequence that is endogenously expressed by the cell.
  • T cells and natural killer (NK) cells naturally express CD3.
  • the cell is a T cell or a natural killer cell.
  • the cell is a T cell selected from a natural killer T (NKT) cell and an innate lymphoid cell (ILC).
  • the T cell is isolated from a human subject.
  • the human subject is the same subject that will ultimately receive the T cell therapy.
  • the subject is a donor subject, wherein the donor subject is not the same subject that will receive the T cell therapy.
  • the cell is a cell that does not naturally express CD3, wherein the cell has been modified to express CD3.
  • the cell comprises a transgene encoding CD3, wherein the transgene is expressed by the cell.
  • the cell comprises a transgene encoding a protein that activates expression of endogenous CD3 by the cell.
  • the cell comprises a transgene encoding a protein or siRNA that inhibits an inhibitor of CD3 expression in the cell.
  • the transgene is incorporated into the genome of the cell. In some embodiments, the transgene is not incorporated into the genome of the cell.
  • the cell that is modified to express CD3 is isolated from a human subject.
  • the human subject is the same subject that will ultimately receive the cell therapy.
  • the subject is a donor subject, wherein the donor subject is not the same subject that will receive the cell therapy.
  • Certain aspects of the present disclosure are directed to a HLA class I molecule complexed to a peptide, wherein the peptide comprises the amino acid sequence set forth in SEQ ID NO: 13.
  • the peptide comprises the amino acid sequence set forth in SEQ ID NO: 13.
  • he peptide consists of the amino acid sequence set forth in SEQ ID NO: 13.
  • the HLA Class I molecule is an HLA-A, HLA-B, or an
  • the HLA Class I molecule is an HLA-E, HLA-F, or HLA- G.
  • the HLA class 1 molecule is an HLA-C allele selected from an HLA-C *03: 02 allele, an HLA-C*03:03 allele, an HLA-C*03:04 allele, an HLA-C*03:05 allele, and an HLA-C*03:06 allele.
  • the HLA-C allele is an HLA- C*03:02 allele.
  • the HLA-C allele is an HLA-C*03:03 allele.
  • the HLA-C allele is an HLA-C*03:04 allele. In certain embodiments, the HLA-C allele is an HLA-C*03:05 allele. In certain embodiments, the HLA-C allele is an HLA-C*03:06 allele. In some embodiments, the HLA allele is any HLA allele disclosed herein, e.g ., supra.
  • the HLA Class I molecule comprises an alpha chain and a b2ih.
  • the alpha chain comprises an al domain, an a2 domain, an a3 domain.
  • the b2ih comprises an amino acid sequence having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97% at least about 98%, at least about 99%, or about 100% sequence identity with the amino acid sequence set forth in SEQ ID NO: 16.
  • the sequence of the alpha chain is selected from any of the HLA protein sequences available at hla.alleles.org (last visited February 27, 2019).
  • the HLA class I molecule is a monomer. In some embodiments, the HLA class I molecule is a dimer. In some embodiments, the HLA class I molecule is a multimer. In some embodiments, the HLA class I molecule is a trimer. In some embodiments, the HLA class I molecule is a tetramer. In some embodiments, the HLA class I molecule is a pentamer.
  • Certain aspects of the present disclosure are directed to antigen presenting cells (APCs) comprising any HLA class I molecule disclosed herein.
  • the APC expressed the HLA class I molecule on the surface of the APC.
  • the APC comprises more than one HLA class I molecule disclosed herein.
  • cancer vaccine comprising a peptide comprising an amino acid sequence as set forth in SEQ ID NO: 13.
  • the cancer vaccine comprises a peptide that consists of the amino acid sequence set forth in SEQ ID NO: 13.
  • the vaccine further comprises one or more excipient.
  • the vaccine further comprises one or more additional peptides.
  • the one or more additional peptides comprise one or more additional epitopes.
  • Certain aspects of the present disclosure are directed to methods of treating a cancer in a subject in need thereof. Other aspects of the present disclosure are directed to methods of engineering an antigen-targeting cell. Other aspects of the present disclosure are directed to methods of enriching a target population of T cells obtained from a human subject.
  • Certain aspects of the present disclosure are directed to methods of treating a cancer in a subject in need thereof, comprising administering to the subject a nucleic acid molecule disclosed herein, a recombinant TCR disclosed herein, a bispecific TCR disclosed herein, an epitope disclosed herein, or an HLA class I molecule disclosed herein, or a vector or cell comprising any of the above.
  • the cancer is selected from melanoma, bone cancer, renal cancer, prostate cancer, breast cancer, colon cancer, lung cancer, cutaneous or intraocular malignant melanoma, pancreatic cancer, skin cancer, cancer of the head or neck, uterine cancer, ovarian cancer, rectal cancer, cancer of the anal region, stomach cancer, testicular cancer, uterine cancer, carcinoma of the fallopian tubes, carcinoma of the endometrium, carcinoma of the cervix, carcinoma of the vagina, carcinoma of the vulva, Hodgkin's Disease, non-Hodgkin's lymphoma (NHL), primary mediastinal large B cell lymphoma (PMBC), diffuse large B cell lymphoma (DLBCL), follicular lymphoma (FL), transformed follicular lymphoma, splenic marginal zone lymphoma (SMZL), cancer of the esophagus, cancer of the small intestine, cancer of the endocrine system, cancer
  • NHL non-Hodg
  • the cancer is relapsed. In some embodiments, the cancer is refractory. In some embodiments, the cancer is advanced. In some embodiments, the cancer is metastatic. [0166] In some embodiments, the methods disclosed herein treat a cancer in a subject.
  • the methods disclosed herein reduce the severity of one or more symptom of the cancer. In some embodiments, the methods disclosed herein reduce the size or number of a tumor derived from the cancer. In some embodiments, the methods disclosed herein increase the overall survival of the subject, relative to a subject not provided the methods disclosed herein. In some embodiments, the methods disclosed herein increase the progressive-free survival of the subject, relative to a subject not provided the methods disclosed herein. In some embodiments, the methods disclosed herein lead to a partial response in the subject. In some embodiments, the methods disclosed herein lead to a complete response in the subject.
  • the methods disclosed herein comprise treating a cancer in a subject in need thereof, comprising administering to the subject a cell described herein, wherein the cell comprises a nucleic acid molecule disclosed herein, a vector disclosed herein, a recombinant TCR disclosed herein, and/or a bispecific antibody disclosed herein.
  • the cell is a T cell.
  • the cell is a cell that is modified to express CD3.
  • the cell e.g ., a T cell
  • the cell is obtained from the subject.
  • the cell e.g. , a T cell
  • the subject is preconditioned prior to administering the cells.
  • the preconditioning can comprise any substance that promotes T cell function and/or survival.
  • the preconditioning comprises administering to the subject a chemotherapy, a cytokine, a protein, a small molecule, or any combination thereof.
  • the preconditioning comprises administering an interleukin.
  • the preconditioning comprises administering IL-2, , IL-4, IL-7, IL-9, IL-15, IL-21, or any combination thereof.
  • the preconditioning comprises administering cyclophosphamide, fludarabine, or both.
  • the preconditioning comprises administering vitamin C, an ART inhibitor, ATRA (vesanoid, tretinoin), rapamycin, or any combination thereof.
  • the antigen is an NY-ESO-1 antigen.
  • the method comprises transducing a cell with a nucleic acid molecule disclosed herein or a vector disclosed herein.
  • the cell can be any cell described herein.
  • the cell is a T cell described herein.
  • the cell is a cell that is modified to express CD3, as described herein.
  • the cell e.g ., the T cell, is obtained from a subject in need of a T cell therapy.
  • the cell is obtained from a donor other than the subject in need of the T cell therapy.
  • the cell is a T cell or a natural killer cell.
  • Certain aspects of the present disclosure are directed to methods of enriching a target population of T cells obtained from a human subject.
  • the method comprises contacting the T cells with an HLA class I molecule disclosed herein.
  • the method comprises contacting the T cells with an APC disclosed herein.
  • the enriched population of T cells comprises a higher number of T cells capable of binding the HLA class I molecule relative to the number of T cells capable of binding the HLA class I molecule prior to the contacting.
  • the method comprises contacting the T cells in vitro with a peptide, wherein the peptide comprises the amino acid sequence set forth in SEQ ID NO: 13. In some embodiments, the method comprises contacting the T cells in vitro with a peptide, wherein the peptide consists of the amino acid sequence set forth in SEQ ID NO: 13. In some embodiments, following the contacting, the enriched population of T cells comprises a higher number of T cells capable of binding the HLA class I molecule relative to the number of T cells capable of binding the HLA class I molecule prior to the contacting.
  • Some aspects of the present disclosure are directed to a method of selecting a
  • the method comprises contacting a population of isolated T cells in vitro with a peptide, wherein the peptide consists of an amino acid sequence as set forth in SEQ ID NO: 13.
  • the T cells are obtained from a human subject.
  • the T cells obtained from the human subject can be any T cells disclosed herein.
  • the T cells obtained from the human subject are tumor infiltrating lymphocytes (TIL).
  • the method further comprises administering to the human subject the enriched T cells.
  • the subject is preconditioned prior to receiving the T cells, as described herein.
  • TILs were isolated from a metastatic melanoma patient, then polyclonally expanded in vitro , and the NY-ESO-1 antigen specificity for HLA-C*03:04 allele was examined.
  • the combination of structure-based analysis using peptide/HLA (pHLA) multimers and functional analysis has been used to measure Ag-specific T cell responses.
  • pHLA multimer production requires the use of a peptide with a known exact sequence, it is not straightforward or practical to conduct high-throughput screening for new epitope peptides using a pHLA multimer-based strategy.
  • functional analysis can be applied to determine the antigen specificity of T cells.
  • APCs artificial antigen- presenting cells
  • HLA-C*03:04 artificial APCs were pulsed with overlapping peptides to cover the whole protein of NY-ESO-1 (Table 5) and used as stimulators in cytokine ELISPOT assays.
  • C*03:04 + melanoma TILs showed positive responses to three adjacent peptides with the shared sequence 91YLAMPFATPM100 in the IFN-g ELISPOT analysis (FIG. 1).
  • Using a series of mutant deletion peptides we determined the minimally required peptide epitope, 92L AMPF ATPM loo presented by C*03:04 molecules.
  • the C*03:04/NY-ESO- 192-100 multimer successfully stained up to 18.2% of the polyclonally expanded TILs, suggesting that the C*03:04/NY-ESO-l92-ioo T cells were a dominant population of the TILs (FIGs. 2A-2C).
  • the multimer-positive T cells secreted detectable IFN-g in an HLA- restricted peptide-specific manner according to ELISPOT analysis (FIG.3).
  • the multimer-positive antitumor T cells were collected and their TCR genes were molecularly cloned (FIGs. 4A-4I, SEQ ID NOs: 1 and 2).
  • the antigen specificity and functional reactivity of the cloned TCR were verified by multimer staining and ELISPOT assay of TCR-reconstituted T cells.
  • C*03:04/NY-ESO-l92-ioo TCR-transduced T cells were successfully stained with the cognate multimer (FIGs. 5A-5D) and strongly reacted with the NY-ESO-192-1 00 peptide presented by surface C*03:04 molecules (FIG. 6).
  • both the A375 and SK-MEL-37 melanoma cell lines are negative for C*03:04, they express the NY-ESO-1 gene endogenously.
  • both melanoma cell lines were successfully recognized by C*03:04/NY-ESO-l92-ioo TCR-transduced T cells.
  • TCR genes may widen the applicability of anti -NY-ESO-1 TCR gene therapy beyond HLA-A*02: 01 -positive cancer patients.
  • K562 is an erythroleukemic cell line with defective HLA expression.
  • T2 is an HLA-A*02:01 + T cell leukemia/B-LCL hybrid cell line.
  • Jurkat 76 is a T cell leukemic cell line lacking TCR and CD8 expression.
  • A375, SK-MEL-21, SK-MEL-37, and LM-MEL-53 are melanoma cell lines. The melanoma cell lines except for LM-MEL-53 were grown in DMEM supplemented with 10% FBS and 50 pg/ml gentamicin (Invitrogen).
  • the K562, T2, Jurkat 76, and LM-MEL-53 cell lines were cultured in RPMI 1640 supplemented with 10% FBS and 50 pg/ml gentamicin. TILs isolated from a metastatic melanoma patient were grown in vitro.
  • HLA-C*03:04 gene was fused with a truncated version of the human nerve growth factor receptor (ANGFR) via the internal ribosome entry site.
  • ANGFR- transduced cells were isolated using anti-NGFR monoclonal antibody (mAh).
  • the full- length NY-ESO-1 gene was cloned from Me275 cells via RT-PCR according to the published sequence (SEQ ID NO: 52).
  • TCR genes were cloned by 5’-rapid amplification of cDNA ends (RACE) PCR using a SMART er RACE cDNA amplification kit (Takara Bio).
  • cDNA was amplified using a supplied 5’-RACE primer and a 3’-TCRa untranslated region primer (5’- GGAGAGTTCCCTCTGTTTGGAGAG-3’; SEQ ID NO: 57).
  • the second-round PCR was performed using a modified 5’ -RACE primer (5’- GTGTGGTGGTACGGGAATTCAAGCAGTGGTATCAACGCAGAGT-3’ ; SEQ ID NO: 58) and a 3’ -TCRa primer (5’-
  • cDNA was amplified using a supplied 5’ -RACE primer and b C region-specific reverse primers, 3 , -Ob-1 (5’- ATCGTCGACCACTGTGCTGGCGGCCGCTCGAGTTCCAGGGCTGCCTTCAGAA ATCC-3’; SEQ ID NO: 60) and 3’-Cp-2 (5’-
  • Jurkat 76/CD8 cells were transduced with individual TCRa and TCRb genes.
  • the Jurkat 76/CD8-derived TCR transfectants were purified (>95% purity) using CD3 Microbeads (Miltenyi Biotec).
  • the K562-based artificial APCs individually expressing various HLA class I genes as a single HLA allele in conjunction with CD80 and CD83 have been reported previously (Butler and Hirano, Immunol. Rev. 257: 191-209 (2014); Hirano et al., Clin. Cancer Res. 72:2967-75 (2006)).
  • PG13-derived retrovirus supernatants were used to transduce TCR genes into human primary T cells.
  • TransIT293 (Mirus Bio) was used to transfect TCR genes into the 293GPG cell line.
  • NY-ESO-G SK- MEL-21 cells were retrovirally transduced with the full-length NY-ESO-1 gene to generate SK-MEL-21/NY-ESO-1 cells.
  • the expression of transduced NY-ESO-1 was evaluated by flow cytometry after staining with an anti-NY-ESO-1 mAb (clone D1Q2U; Cell Signaling Technology).
  • HLA-C*03:04 A375 and SK-MEL-37 cells were retrovirally transduced with
  • HLA-C*03:04 to generate A375/C*03:04 and SK-MEL-37/C*03:04 cells.
  • HLA-C*03:04 gene were tagged with the ANGFR gene as described above, and the ANGFR + cells were purified (>95% purity) and used in subsequent experiments. The ANGFR gene alone was retrovirally transduced as a control.
  • Dead cells were discriminated with the LIVE/DEAD Fixable Aqua Dead Cell Stain kit (Life Technologies). For intracellular staining, cells were fixed and permeabilized by using a Cytofix/Cytoperm kit (BD Biosciences). Stained cells were analyzed with flow cytometry (BD Biosciences), and data analysis was performed using FlowJo (Tree Star). Cell sorting was conducted using a FACS Aria II (BD Bioscience).
  • IFN-g ELISPOT assays were conducted as described previously (see, e.g,
  • PVDF plates (Millipore, Bedford, MA) were coated with the capture mAb (1-DlK; MABTECH, Mariemont, OH), and T cells were incubated with 2 x 10 4 target cells per well in the presence or absence of a peptide for 20-24 hours at 37°C. The plates were subsequently washed and incubated with a biotin-conjugated detection mAb (7-B6-1; MABTECH).
  • HRP-conjugated SA Jackson ImmunoRe search
  • IFN-g spots were developed.
  • the reaction was stopped by rinsing thoroughly with cold tap water.
  • ELISPOT plates were scanned and counted using an ImmunoSpot plate reader and ImmunoSpot version 5.0 software (Cellular Technology Limited, Shaker Heights, OH).
  • CD3 + T cells were purified through negative magnetic selection using a Pan T
  • T cells were stimulated with artificial APC/mOKT3 irradiated with 200 Gy at an E:T ratio of 20: 1.
  • activated T cells were retrovirally transduced with the cloned TCR genes via centrifugation for 1 hour at 1,000 g at 32°C for 3 consecutive days.
  • 100 IU/ml IL-2 and 10 ng/ml IL-15 were added to the TCR-transduced T cells.
  • the culture medium was replenished every 2-3 days.
  • the affinity-matured HLA class I gene was engineered to carry a Glu (E) residue in lieu of the Gin (Q) residue at position 115 of the a2 domain and a mouse K b gene-derived a3 domain instead of the HLA class I a3 domain.
  • E Glu
  • Q Gin
  • GS Gly-Ser
  • 6x His tag 6x His tag
  • Stable HEK293T cells ectopically expressing soluble affinity-matured class I Q115E -K b grown until confluent, and the medium was then changed. Forty-eight hours later, the conditioned medium was harvested and immediately used or frozen until use.
  • the soluble HLA class I Q115E -K b -containing supernatant produced by the HEK293T transfectants was incubated with 100-1000 pg/ml of class I-restricted peptide of interest overnight at 37°C for in vitro peptide exchange.
  • Soluble monomeric class I Q I l5E -K b loaded with the peptide was dimerized using an anti -His mAh (clone AD 1.1.10; Abeam) conjugated to a fluorochrome such as phycoerythrin (PE) at a 2: 1 molar ratio for 2 hours at room temperature or overnight at 4°C.
  • the concentration of functional soluble HLA class I Q I l 5E -K b molecules was measured by specific ELISA using an anti-pan class I mAh (clone W6/32, in-house) and an anti-His tag biotinylated mAh (clone ADI.1.10, R&D systems) as capture and detection Abs, respectively.
  • T cells (1 x 10 5 ) were incubated for 30 minutes at 37°C in the presence of 50 nM dasatinib (LC laboratories). The cells were then washed and incubated with 5-10 pg/ml of multimer for 30 minutes at room temperature, and R-phycoerythrin-conjugated AffmiPure Fab fragment goat anti-mouse IgGl (Jackson ImmunoRe search Laboratories) was added for 15 minutes at 4°C. Next, the cells were washed three times and costained with an anti-CD8 mAh for 15 minutes at 4°C. Dead cells were finally discriminated using the LIVE/DEAD Fixable Dead Cell Stain kit.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Zoology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Biophysics (AREA)
  • Epidemiology (AREA)
  • General Engineering & Computer Science (AREA)
  • Cell Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Microbiology (AREA)
  • Toxicology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Hematology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Mycology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Oncology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
PCT/IB2020/051807 2019-03-04 2020-03-03 T cell receptors and methods of use thereof Ceased WO2020178738A1 (en)

Priority Applications (11)

Application Number Priority Date Filing Date Title
US17/436,929 US20220169695A1 (en) 2019-03-04 2020-03-03 T cell receptors and methods of use thereof
CA3132252A CA3132252A1 (en) 2019-03-04 2020-03-03 T cell receptors and methods of use thereof
JP2021552598A JP7748874B2 (ja) 2019-03-04 2020-03-03 T細胞受容体及びその使用方法
SG11202109588R SG11202109588RA (en) 2019-03-04 2020-03-03 T cell receptors and methods of use thereof
AU2020231106A AU2020231106A1 (en) 2019-03-04 2020-03-03 T cell receptors and methods of use thereof
KR1020217031582A KR20210149051A (ko) 2019-03-04 2020-03-03 T 세포 수용체 및 이의 사용 방법
EP20765782.6A EP3935173A4 (en) 2019-03-04 2020-03-03 T cell receptors and methods of use thereof
MX2021010533A MX2021010533A (es) 2019-03-04 2020-03-03 Receptores de linfocitos t y metodos de uso de estos.
CN202080028558.4A CN113853434B (zh) 2019-03-04 2020-03-03 T细胞受体及其使用方法
BR112021017486A BR112021017486A2 (pt) 2019-03-04 2020-03-03 Receptores de células t e métodos de uso dos mesmos
IL286032A IL286032A (en) 2019-03-04 2021-09-01 T cell receptors and methods of use thereof

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201962813639P 2019-03-04 2019-03-04
US62/813,639 2019-03-04

Publications (1)

Publication Number Publication Date
WO2020178738A1 true WO2020178738A1 (en) 2020-09-10

Family

ID=72336933

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IB2020/051807 Ceased WO2020178738A1 (en) 2019-03-04 2020-03-03 T cell receptors and methods of use thereof

Country Status (13)

Country Link
US (1) US20220169695A1 (https=)
EP (1) EP3935173A4 (https=)
JP (1) JP7748874B2 (https=)
KR (1) KR20210149051A (https=)
CN (1) CN113853434B (https=)
AU (1) AU2020231106A1 (https=)
BR (1) BR112021017486A2 (https=)
CA (1) CA3132252A1 (https=)
IL (1) IL286032A (https=)
MX (1) MX2021010533A (https=)
SG (1) SG11202109588RA (https=)
TW (1) TWI875737B (https=)
WO (1) WO2020178738A1 (https=)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2022099543A1 (zh) * 2020-11-12 2022-05-19 深圳先进技术研究院 Ny-eso-1基因抑制剂作为抗肿瘤化疗药物增敏剂的应用

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP7748284B2 (ja) 2019-03-04 2025-10-02 ユニバーシティー ヘルス ネットワーク T細胞受容体及びその使用方法
MX2021010541A (es) 2019-03-04 2021-12-15 Univ Health Network Receptores de linfocitos t y metodos de uso de estos.
CN113795586B (zh) 2019-03-25 2026-03-27 大学健康网络 T细胞受体及其使用方法
CN117843800A (zh) * 2023-12-01 2024-04-09 浙江大学 一种靶向胞内ny-eso-1的双特异抗体及其应用

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002026778A2 (en) * 2000-09-26 2002-04-04 Ludwig Institute For Cancer Research Isolated peptides which bind to hla-c molecules and uses thereof
WO2012038055A1 (en) * 2010-09-20 2012-03-29 Unicell Gmbh Antigen-specific t cell receptors and t cell epitopes
WO2016073755A2 (en) * 2014-11-05 2016-05-12 Board Of Regents, The University Of Texas System Gene modified immune effector cells and engineered cells for expansion of immune effector cells
WO2017120428A2 (en) * 2016-01-06 2017-07-13 Health Research, Inc. Compositions and libraries comprising recombinant t-cell receptors and methods of using recombinant t-cell receptors

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2008042407A1 (en) * 2006-10-03 2008-04-10 Ludwig Institute For Cancer Research Melanoma repopulating cells
US8105831B2 (en) * 2007-03-09 2012-01-31 University Of Washington Parvoviral production of HLA homozygous cells
US9051391B2 (en) * 2007-06-11 2015-06-09 Takara Bio Inc. Method for expression of specific gene
WO2014160030A2 (en) * 2013-03-13 2014-10-02 Health Research, Inc. Compositions and methods for use of recombinant t cell receptors for direct recognition of tumor antigen
AU2017226199A1 (en) * 2016-03-04 2018-09-13 New York University Virus vectors expressing multiple epitopes of tumor associated antigens for inducing antitumor immunity

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002026778A2 (en) * 2000-09-26 2002-04-04 Ludwig Institute For Cancer Research Isolated peptides which bind to hla-c molecules and uses thereof
WO2012038055A1 (en) * 2010-09-20 2012-03-29 Unicell Gmbh Antigen-specific t cell receptors and t cell epitopes
WO2016073755A2 (en) * 2014-11-05 2016-05-12 Board Of Regents, The University Of Texas System Gene modified immune effector cells and engineered cells for expansion of immune effector cells
WO2017120428A2 (en) * 2016-01-06 2017-07-13 Health Research, Inc. Compositions and libraries comprising recombinant t-cell receptors and methods of using recombinant t-cell receptors

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See also references of EP3935173A4 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2022099543A1 (zh) * 2020-11-12 2022-05-19 深圳先进技术研究院 Ny-eso-1基因抑制剂作为抗肿瘤化疗药物增敏剂的应用

Also Published As

Publication number Publication date
TWI875737B (zh) 2025-03-11
BR112021017486A2 (pt) 2021-11-23
AU2020231106A1 (en) 2021-10-07
KR20210149051A (ko) 2021-12-08
JP7748874B2 (ja) 2025-10-03
JP2022523552A (ja) 2022-04-25
SG11202109588RA (en) 2021-10-28
EP3935173A1 (en) 2022-01-12
IL286032A (en) 2021-10-31
TW202100548A (zh) 2021-01-01
CN113853434A (zh) 2021-12-28
CA3132252A1 (en) 2020-09-10
CN113853434B (zh) 2026-04-21
US20220169695A1 (en) 2022-06-02
EP3935173A4 (en) 2023-05-31
MX2021010533A (es) 2021-12-10

Similar Documents

Publication Publication Date Title
JP7561133B2 (ja) T細胞受容体及びその使用方法
JP7748874B2 (ja) T細胞受容体及びその使用方法
TWI877144B (zh) T細胞受體及其使用方法
US12527809B2 (en) T cell receptors and methods of use thereof
US12522644B2 (en) T cell receptors and methods of use thereof
TWI877145B (zh) T細胞受體及其使用方法
JP7576037B2 (ja) T細胞受容体及びその使用方法
US12611450B2 (en) T cell receptors and methods of use thereof

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 20765782

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 3132252

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2021552598

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112021017486

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 2020231106

Country of ref document: AU

Date of ref document: 20200303

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2020765782

Country of ref document: EP

Effective date: 20211004

ENP Entry into the national phase

Ref document number: 112021017486

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20210902

WWE Wipo information: entry into national phase

Ref document number: 521430198

Country of ref document: SA

WWE Wipo information: entry into national phase

Ref document number: 521430198

Country of ref document: SA

WWR Wipo information: refused in national office

Ref document number: 521430198

Country of ref document: SA

WWW Wipo information: withdrawn in national office

Ref document number: 202192362

Country of ref document: EA