WO2020162697A1 - 퇴행성 뇌질환 진단용 바이오마커 조성물 - Google Patents
퇴행성 뇌질환 진단용 바이오마커 조성물 Download PDFInfo
- Publication number
- WO2020162697A1 WO2020162697A1 PCT/KR2020/001736 KR2020001736W WO2020162697A1 WO 2020162697 A1 WO2020162697 A1 WO 2020162697A1 KR 2020001736 W KR2020001736 W KR 2020001736W WO 2020162697 A1 WO2020162697 A1 WO 2020162697A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- domain
- degenerative brain
- protein
- disease
- sqstm1
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Images
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
- G01N33/6893—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
- G01N33/6896—Neurological disorders, e.g. Alzheimer's disease
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
- G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2500/00—Screening for compounds of potential therapeutic value
- G01N2500/04—Screening involving studying the effect of compounds C directly on molecule A (e.g. C are potential ligands for a receptor A, or potential substrates for an enzyme A)
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2500/00—Screening for compounds of potential therapeutic value
- G01N2500/10—Screening for compounds of potential therapeutic value involving cells
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/28—Neurological disorders
Definitions
- the present invention relates to a biomarker composition for diagnosing degenerative brain diseases.
- Degenerative brain disease refers to a disease that occurs in the brain among degenerative diseases that occur with age, and can be classified by considering the main symptoms and the invading brain regions. Representatively, Alzheimer's disease and frontotemporal dementia ), Lewy body dementia, Parkinson's disease, Huntington's disease, and amyotrophic lateral sclerosis. Degenerative brain disease is known to be caused by neurodegeneration due to aging and by the aggregation of specific proteins for each disease and death of neurons due to genetic and environmental factors, but the exact pathological mechanism has not yet been identified. Basic research is being actively conducted.
- Alzheimer's disease develops gradually due to decreased memory and progresses to progressive loss of extensive cognitive functions such as loss of spatiotemporal ability, speech impairment, and executive ability, resulting in symptoms of dementia in which independent daily life cannot be performed.
- pathological mechanism has not yet been accurately identified, it is reported to be due to the interaction between aging, genetic risk factors, and environmental factors.
- Alzheimer's disease has been known to be mainly due to the accumulation of beta-amyloid and tau proteins, and research has been focused on removing amyloid plaques and neurofibrillary tangles formed by aggregation of these proteins.
- tau protein has become more prominent as a major target for the development of therapeutics, and international attention is being focused.
- tau protein is not limited to Alzheimer's disease, and it is known to play a major role in the onset and progression of anterior temporal dementia, amyotrophic lateral sclerosis, and some Parkinson's disease.Therefore, if a therapeutic agent targeting tau protein is developed, several We can expect a common therapeutic effect for degenerative brain diseases.
- tau protein is a material necessary to stabilize microtubules like railroad connecting reinforcement, and when tau protein is released from microtubules and accumulated excessively, the microtubules collapse and the network of normal neurons is disrupted. It is thought that the most well-known mechanism for the accumulation of tau protein lies in the formation of a heavy body due to hyperphosphorylation due to excessive phosphorus attachment to tau protein.
- tauopathy a disease caused by aggregation in nerve cells.
- Alzheimer's disease anterior temporal dementia, amyotrophic lateral sclerosis, some Parkinson's disease, progressive supranuclear palsy, cortex It has been pointed out as the cause of various degenerative brain diseases such as corticobasal degeneration and Pick's disease.
- An object of the present invention is to provide a biomarker composition for diagnosing degenerative brain diseases.
- Another object of the present invention is to provide a kit for diagnosing degenerative brain diseases.
- Another object of the present invention is to provide a method of providing information necessary for diagnosis of degenerative brain diseases.
- Another object of the present invention is to provide a method of providing a screening method for treating degenerative brain diseases.
- the present invention provides a biomarker composition for diagnosing degenerative brain diseases comprising a TB (TRAF-6 binding) domain in SQSTM1/p62 protein.
- the present invention provides a kit for diagnosing degenerative brain diseases including an agent capable of measuring the exposure level of the TB (TRAF-6 binding) domain in the SQSTM1/p62 protein.
- the present invention comprises the steps of: a) measuring the exposure level of the TB (TRAF-6 binding) domain in the tertiary structure of the SQSTM1/p62 protein in a sample isolated from the patient; b) comparing the exposure level of the TB domain with a control sample; And c) when the exposure level of the TB domain is lower than that of the control sample, determining that it is a degenerative brain disease. It provides a method of providing information necessary for diagnosing a degenerative brain disease.
- the present invention comprises the steps of: a) treating a candidate drug in a sample isolated from a patient; b) measuring the exposure level of the TB (TRAF-6 binding) domain in the tertiary structure of the SQSTM1/p62 protein before and after the treatment of the candidate drug; And b) selecting a candidate drug that increases the exposure level of the TB domain compared to the control sample. It provides a screening method for treating a degenerative brain disease comprising.
- the TB (TRAF-6 binding) domain in the SQSTM1/p62 protein directly binds to the tau protein to remove the tau protein, and exposure of the TB domain in the degenerative brain disease where tauopathy is observed is degenerative brain It may be usefully utilized in diagnosing and/and treating diseases.
- 5 is a result of confirming the TB domain specificity after the production of a monoclonal antibody ( ⁇ TB-p62) that specifically binds to the TB domain in the SQSTM1/p62 protein.
- the present invention provides a biomarker composition for diagnosing degenerative brain diseases comprising a TB (TRAF-6 binding) domain in the SQSTM1/p62 protein.
- biomarker as used in the present invention is a substance capable of diagnosing a tissue or cell of a subject with degenerative brain disease by distinguishing it from a tissue or cell of a normal control, and the tissue or cell of a subject with a disease compared to the normal control.
- organic biomolecules such as proteins or nucleic acids, lipids, glycolipids, glycoproteins, and the like showing an increase or decrease in
- the TB domain may be represented by the amino acid sequence of SEQ ID NO: 1, and may be represented by the nucleotide sequence of SEQ ID NO: 2.
- the TB domain is increased in degenerative brain disease to remove tau protein bound to tau protein, so that degenerative brain disease can be prevented or treated.
- the degenerative brain diseases include Alzheimer's disease, Frontotemporal dementia, Parkinson's disease, Amyotrophic lateral sclerosis, Progressive supranuclear palsy, and cortical organs. Corticobasal degeneration), Pick's disease, mild cognitive impairment, and dementia may be selected from the group consisting of, but is not limited thereto.
- the present invention provides a kit for diagnosing degenerative brain diseases including an agent capable of measuring the exposure level of the TB (TRAF-6 binding) domain in the SQSTM1/p62 protein.
- the agent may be selected from the group consisting of primers, probes, antibodies, peptides, and aptamers, but is not limited thereto.
- primer refers to a short nucleic acid sequence that is capable of forming a base pair with a complementary template with a nucleic acid sequence having a short free 3-terminal hydroxyl group and serves as a starting point for template strand copying. .
- Primers can initiate DNA synthesis in the presence of reagents for polymerization (ie, DNA polymerase or reverse transcriptase) and four different nucleotide triphosphates at an appropriate buffer and temperature.
- primers are sense and antisense nucleic acids having a sequence of 7 to 50 nucleotides, and may incorporate additional features that do not change the basic properties of the primers serving as the starting point of DNA synthesis.
- probe refers to a nucleic acid fragment such as RNA or DNA corresponding to a few bases or hundreds of bases that can be specifically bound in addition to mRNA, and is labeled so that the presence or absence of a specific mRNA , The expression level can be confirmed.
- the probe may be manufactured in the form of an oligonucleotide probe, a single strand DNA probe, a double strand DNA probe, an RNA probe, or the like. Selection of an appropriate probe and conditions for hybridization can be appropriately selected according to techniques known in the art.
- antibody means a specific immunoglobulin directed against an antigenic site, and any one prepared according to a conventional method in the art or a commercially available one can be used.
- the antibody includes a polyclonal antibody, a monoclonal antibody, and a fragment capable of binding to an epitope.
- the antibody refers to a complete form having two full-length light chains and two heavy chains, and also includes special antibodies such as humanized antibodies.
- the term "peptide” has an advantage of high binding power to a target material, and denaturation does not occur even during thermal/chemical treatment.
- the molecular size is small, it can be attached to other proteins and used as a fusion protein. Specifically, since it can be used by attaching it to a polymer protein chain, it can be used as a diagnostic kit and a drug delivery material.
- aptamer as used in the present invention is a single-stranded nucleic acid (DNA, RNA or modified nucleic acid) that has a stable tertiary structure by itself and can bind to a target molecule with high affinity and specificity. . Aptamer is compared to a single antibody because of its inherent high affinity (usually pM level) and specificity that it can bind to a target molecule, and has a high potential as an alternative antibody, especially as a "chemical antibody”.
- the kit of the present invention includes an antibody that specifically binds to a marker component, a secondary antibody conjugate to which a label that develops color is conjugated by reaction with a substrate, a color developing substrate solution to react with the label, a washing solution, and It may contain an enzyme reaction stop solution, etc., and may be prepared as a plurality of separate packaging or compartments including the reagent components used.
- the present invention comprises the steps of: a) measuring the exposure level of the TB (TRAF-6 binding) domain in the tertiary structure of the SQSTM1/p62 protein in a sample isolated from the patient; b) comparing the exposure level of the TB domain with a control sample; And c) when the exposure level of the TB domain is lower than that of the control sample, determining that it is a degenerative brain disease. It provides a method of providing information necessary for diagnosing a degenerative brain disease.
- the present invention comprises the steps of: a) treating a candidate drug in a sample isolated from a patient; b) measuring the exposure level of the TB (TRAF-6 binding) domain in the tertiary structure of the SQSTM1/p62 protein before and after the treatment of the candidate drug; And b) selecting a candidate drug that increases the exposure level of the TB domain compared to the control sample. It provides a screening method for treating a degenerative brain disease comprising.
- sample isolated from a patient used in the present invention may include samples such as tissues, cells, whole blood, serum, plasma, saliva, sputum, cerebrospinal fluid or urine that differ from the control in the exposure level of the TB domain. However, it should be stated that it is not limited thereto.
- the Chinese hamster ovary (CHO) cell line was cultured in DMEM medium supplemented with 10% fetal bovine serum (FBS) and 1% penicillin/streptomycin. Cells were inoculated into 12 well plates at a density of 1.2 ⁇ 10 5 cells/well, incubated for 24 hours, and then GFP tagged tau plasmid constructs (plasmid constructs, GFP-3R, GFP-) using Lipofectamine 2000 (Invitrogen). 4R) and different concentrations (+, ++, +++) HA tagged p62 plasmid constructs were transfected together. After 24 hours, cells were recovered, protein was extracted, and Western blot was performed with the same amount of protein.
- FBS fetal bovine serum
- the antibodies used were antibodies to total tau protein (anti-Tau5 antibody), antibodies to phosphorylated tau (anti-pT212 antibody, anti-pT231 antibody, anti-pS199 antibody, depending on the phosphorylation site), and an antibody against actin (anti- actin antibody).
- fetal cerebral cortex and hippocampal cells were isolated, and then inoculated into a 12-well plate containing coverslips coated with nerve cells at a density of 1.2 ⁇ 10 5 cells/well, and B- 27 and L-GlutMAX-1 was added to the Neurobasal medium was cultured for 7 days at 37 °C, 5% CO 2 incubator. Every 3-4 days, half of the culture medium was replaced with a new medium.
- a lentiviral vector was transduced into cultured primary neurons and cultured for 48 hours, followed by immunocytochemistry. Briefly, the coverslip in which the nerve cells were cultured was taken out and washed twice with cold phosphate buffered saline (PBS), and the cells were fixed at 4° C. for 10 minutes using 4% formaldehyde. Thereafter, the coverslip was washed with PBS, and then immersed in PBS containing 0.1% Triton X-100 and 2% FBS to permeate the cell membrane at room temperature for 5 minutes. Thereafter, cells were washed with primary antibody (4R tau and p62 antibody, 1:1000 dilution) overnight at 4°C.
- PBS cold phosphate buffered saline
- Example 3 Analysis of direct binding between TB domain and tau protein in SQSTM1/p62 protein
- mutant constructs (p62 ⁇ _PB1, p62 ⁇ _TB, p62 ⁇ _LIR, p62 ⁇ _UBA) from which the p62 wild-type construct and its main domain were removed were transfected with the Tau plasmid construct in CHO cell line, and then cultured for 24 hours. Thereafter, the cells were washed with cold PBS, and for immunoprecipitation, the protein extract of the cells was extracted with NP-40 extraction buffer, and then 1 g of the Tau antibody was reacted overnight at 4°C. Then, the immune precipitate was reacted with protein G-agarose bead (30 ⁇ L) at 4° C. for 4 hours. Thereafter, the obtained immunoprecipitate was electrophoresed on an SDS-PAGE gel to separate proteins, transferred to a nitrocellulose membrane, and reacted with an anti-p62 antibody to perform Western blot.
- amino acid sequence and nucleotide sequence of the TB domain in the SQSTM1/p62 protein are shown in Table 1 below.
- the pET 28a plasmid containing the His-p62 gene was transfected with E. coli BL21 and cultured in Luria-Bertani (LB) medium with kanamycin until the optical density reached 660 of 0.8 expression. Then, the E. coli was recovered and centrifuged, and the pellet was stored at -80°C. For the experiment, 20 mL of Ni-NTA lysis buffer [50 mM NaH 2 PO 4 (pH 8.0), 10 mM imidazole and 300 mM NaCl] was added to the pellet, sonicated at 4°C, and Ni-NTA agarose was used. The target protein was purified by performing affinity chromatography. The mixture of Ni-NTA resin and protein was washed with a high concentration of Ni-NTA buffer to remove unbound protein. Finally, the protein was extracted using the elution buffer.
- Ni-NTA lysis buffer [50 mM NaH 2 PO 4 (pH 8.0), 10 mM imi
- Glutathione-sepharose beads (GE Healthcare, Buckinghamshire, England) and GST-tau (4R isoform, 441a, AnaSpec, Inc) or GST protein were reacted at 4° C. for 2 hours. Unbound material was removed by washing 4 times with TEN100 buffer [20 mM Tris (pH 7.4], 0.1 mM EDTA, 100 mM NaCl] corresponding to 10 times the volume of the beads, and then purified His-p62 (p62, p62 ⁇ TB, p62 ⁇ UBA) proteins were added and reacted for 2 hours at 4°C, and NETN buffer corresponding to 10 times the volume of beads [0.5% NP-40, 0.1 mM EDTA, 20 mM Tris (pH 7.4), 300 mM NaCl) After washing for 10 times, a sample buffer was added and boiled for 10 minutes, and the protein conjugate was eluted, followed by Western blot.
- TEN100 buffer 20 mM Tris (pH 7.
- Example 4 Construction of an antibody that specifically binds to the TB domain in the SQSTM1/p62 protein
- a monoclonal antibody ( ⁇ TB-p62) specifically binding to the TB domain in the SQSTM1/p62 protein was prepared by targeting 15 amino acids (N'-SGPSEDPSVNFLKNC - C') in the TB domain. Briefly, a peptide for the target sequence was prepared, followed by MonoExpress Bronze Antibody Production, followed by antibody purification.
- the p62 wild-type construct and its mutant construct (p62 ⁇ _PB1, p62 ⁇ _TB, p62 ⁇ _LIR/KIR, p62 ⁇ _UBA) were transfected with the Tau plasmid construct in a CHO cell line and cultured for 24 hours. Thereafter, the cells were recovered and Western blot was performed with the same amount of protein.
- the concentration of tau protein decreased. As shown in FIG. 6, it was confirmed that the effect of reducing tau protein by p62 was canceled when the ⁇ TB-p62 antibody was treated. It was confirmed that the concentration of tau protein was higher in the 2nd and 4th lanes treated with ⁇ TB-p62 antibody compared to the 1st and 3rd lanes treated with non-specific IgG. This shows that the ⁇ TB-p62 antibody binds to the TB domain of the p62 wild-type, thereby inhibiting the binding of the p62-tau protein, thereby inhibiting the effect of reducing tau protein by p62.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Immunology (AREA)
- Hematology (AREA)
- Chemical & Material Sciences (AREA)
- Urology & Nephrology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Pathology (AREA)
- Microbiology (AREA)
- Cell Biology (AREA)
- General Physics & Mathematics (AREA)
- General Health & Medical Sciences (AREA)
- Food Science & Technology (AREA)
- Medicinal Chemistry (AREA)
- Physics & Mathematics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Neurology (AREA)
- Neurosurgery (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Toxicology (AREA)
- Tropical Medicine & Parasitology (AREA)
- Peptides Or Proteins (AREA)
- Investigating Or Analysing Biological Materials (AREA)
Abstract
본 발명은 퇴행성 뇌질환 진단용 바이오마커 조성물에 관한 것으로, 본 발명에 따르면, SQSTM1/p62 단백 내 TB(TRAF-6 binding) 도메인은 타우 단백과 직접적으로 결합하여 타우 단백을 제거하는 바, 타우병증이 관찰되는 퇴행성 뇌질환에서 상기 TB 도메인의 노출은 퇴행성 뇌질환을 진단 또는/및 치료하는데 유용하게 활용될 수 있다.
Description
본 발명은 퇴행성 뇌질환 진단용 바이오마커 조성물에 관한 것이다.
퇴행성 뇌질환은 나이가 들어감에 따라 발생하는 퇴행성 질환 중에서도 뇌에서 발생하는 질환을 뜻하며, 주요 증상과 침범되는 뇌 부위를 고려해 구분할 수 있는데, 대표적으로 알츠하이머병(alzheimer's disease), 전측두치매(frontotemporal dementia), 루이소체치매(lewy body dementia), 파킨슨병(parkinson's disease), 헌팅턴병(huntington's disease), 근위축성측색경화증(amyotrophic lateral sclerosis) 등이 포함된다. 퇴행성 뇌질환은 노화에 따른 신경퇴화와 유전적·환경적 요인들로 인해 질환별 특정 단백질이 응집되어 신경세포가 사멸해 야기되는 것으로 알려져 있으나, 아직까지 정확한 병적 기전이 밝혀지지 않아 이를 규명하기 위한 기초 연구가 활발히 진행되고 있다.
알츠하이머병은 기억력 감퇴로 서서히 발병하여 시공간능력 소실, 언어 장애, 실행능력 장애 등 점진적·광범위한 인지기능의 소실로 진행되어 독립적인 일상생활 수행이 불가능한 치매 증상을 나타낸다. 아직까지 병적 기전이 정확하게 규명되진 않았지만 노화, 유전적 위험인자, 환경인자간의 상호작용에 기인하는 것으로 보고되고 있다.
알츠하이머병은 주로 베타 아밀로이드(beta-amyloid)와 타우 단백 축적으로 인한 것으로 알려져 왔으며, 이들 단백질이 응집되어 형성된 아밀로이드 플라크(plaque) 및 신경섬유 덩어리(neurofibrillary tangles)를 제거하기 위한 연구가 집중되어 왔다. 최근 들어 베타 아밀로이드를 타겟으로 하는 치료제들이 대규모 임상약물연구에서 실패함에 따라 타우 단백은 치료제 개발을 위한 주요 타겟으로 더욱 부각되어 국제적인 관심이 집중되고 있다. 또한, 타우 단백의 응집은 알츠하이머병에 국한되지 않고, 전측두치매, 근위축성측색경화증, 일부 파킨슨병의 발병 및 진행에서도 주된 역할을 하는 것으로 알려져 있기 때문에 타우 단백을 타겟으로 하는 치료제가 개발된다면 여러 퇴행성 뇌질환의 공통적인 치료 효과를 기대할 수 있다.
타우 단백은 철도의 연결 철근처럼 미세소관을 안정화시키는데 필요한 물질로서 타우 단백이 미세소관에서 유리되어 과도하게 축적되면 미세소관이 붕괴되면서 정상 신경세포의 네트워크가 와해되는 것으로 알려져 있다. 타우 단백이 축적되는 기전으로 가장 잘 알려진 것이 타우 단백에 인이 과도하게 부착되어 과인산화로 인한 중량체를 형성하는 데에 있다고 생각되고 있다. 이들 타우 단백이 축적되고 신경세포 내 응집으로 인한 질환을 통칭하여 타우병증(tauopathy)이라 불리고 있으며 알츠하이머병, 전측두치매, 근위축성측색경화증, 일부 파킨슨병, 진행성핵상마비(progressive supranuclear palsy), 피질기저핵변성(corticobasal degeneration), 피크병(Pick's disease) 등 여러 가지의 퇴행성 뇌질환의 원인으로 지목되고 있다.
그럼에도 불구하고 타우병증과 관련된 질환에 아직까지 뚜렷한 치료법이나 치료제가 존재하지 않고 있다. 따라서 궁극적인 치료제 개발을 위하여 타우 단백의 독성화 및 응집 기작을 충분히 규명하고 그 기작을 특이적으로 억제할 수 있는 치료제에 대한 연구가 필요한 실정이다.
본 발명의 목적은 퇴행성 뇌질환 진단용 바이오마커 조성물을 제공하는 데에 있다.
본 발명의 다른 목적은 퇴행성 뇌질환 진단용 키트를 제공하는 데에 있다.
본 발명의 또 다른 목적은 퇴행성 뇌질환 진단에 필요한 정보를 제공하는 방법을 제공하는 데에 있다.
본 발명의 또 다른 목적은 퇴행성 뇌질환 치료제 스크리닝 방법을 제공하는 방법을 제공하는 데에 있다.
상기 목적을 달성하기 위하여, 본 발명은 SQSTM1/p62 단백질 내 TB (TRAF-6 binding) 도메인을 포함하는 퇴행성 뇌질환 진단용 바이오마커 조성물을 제공한다.
또한, 본 발명은 SQSTM1/p62 단백질 내 TB (TRAF-6 binding) 도메인의 노출 수준을 측정할 수 있는 제제를 포함하는 퇴행성 뇌질환 진단용 키트를 제공한다.
또한, 본 발명은 a) 환자로부터 분리된 시료에서 SQSTM1/p62 단백질 3차 구조 내 TB (TRAF-6 binding) 도메인의 노출 수준을 측정하는 단계; b) 상기 TB 도메인의 노출 수준을 대조군 시료와 비교하는 단계; 및 c) 상기 TB 도메인의 노출 수준이 대조군 시료보다 낮은 경우, 퇴행성 뇌질환이라고 판단하는 단계;를 포함하는 퇴행성 뇌질환 진단에 필요한 정보를 제공하는 방법을 제공한다.
또한, 본 발명은 a) 환자로부터 분리된 시료에 후보 약물을 처리하는 단계; b) 상기 후보 약물의 처리 전과 후의 SQSTM1/p62 단백질 3차 구조 내 TB (TRAF-6 binding) 도메인의 노출 수준을 측정하는 단계; 및 b) 대조군 시료와 비교하여 상기 TB 도메인의 노출 수준을 증가시키는 후보 약물을 선별하는 단계;를 포함하는 퇴행성 뇌질환 치료제 스크리닝 방법을 제공한다.
본 발명에 따르면, SQSTM1/p62 단백 내 TB (TRAF-6 binding) 도메인은 타우 단백과 직접적으로 결합하여 타우 단백을 제거하는 바, 타우병증이 관찰되는 퇴행성 뇌질환에서 상기 TB 도메인의 노출은 퇴행성 뇌질환을 진단 또는/및 치료하는데 유용하게 활용될 수 있다.
도 1은 형질주입 실험을 수행하여 SQSTM1/p62 단백 발현 및 타우 단백 발현의 역방향 상관관계를 확인한 결과이다.
도 2는 면역형광염색을 수행하여 SQSTM1/p62 단백과 타우 단백의 신경세포 내 공존화를 확인한 결과이다.
도 3은 면역침강반응을 수행하여 SQSTM1/p62 단백 내 TB 도메인과 타우 단백이 직접적으로 결합하는 것을 확인한 결과이다.
도 4는 GST 풀 다운 분석을 수행하여 SQSTM1/p62 단백 내 TB 도메인과 타우 단백이 직접적으로 결합하는 것을 확인한 결과이다.
도 5는 SQSTM1/p62 단백 내 TB 도메인에 특이적으로 결합하는 단클론 항체(αTB-p62)를 제작 후 TB 도메인 특이도를 확인한 결과이다.
도 6은 αTB-p62 항체를 이용하여 SQSTM1/p62 단백 내 TB 도메인과 타우 단백이 직접적으로 결합하는 것을 확인한 결과이다.
이하, 본 발명을 보다 상세히 설명한다.
본 발명은 SQSTM1/p62 단백질 내 TB (TRAF-6 binding) 도메인을 포함하는 퇴행성 뇌질환 진단용 바이오마커 조성물을 제공한다.
본 발명에서 사용된 용어 "바이오마커"는 퇴행성 뇌질환이 발생한 대상체의 조직 또는 세포를 정상 대조군의 조직 또는 세포와 구분하여 진단할 수 있는 물질로, 정상 대조군에 비하여 질환이 발생한 대상체의 조직 또는 세포에서 증가 또는 감소 양상을 보이는 단백질 또는 핵산, 지질, 당지질, 당단백질 등과 같은 유기 생체 분자 등을 포함한다.
상기 TB 도메인은 서열번호 1의 아미노산 서열로 표시될 수 있고, 서열번호 2의 염기서열로 표시될 수 있다.
상기 TB 도메인은 퇴행성 뇌질환에 증가되어 타우(Tau) 단백질과 결합하여 있는 타우 단백질을 제거하는 바, 퇴행성 뇌질환을 예방 또는 치료할 수 있다.
상기 퇴행성 뇌질환은 알츠하이머병(Alzheimer’s disease), 전측두치매(Frontotemporal dementia), 파킨슨병(Parkinson’s disease), 근위축성측색경화증(Amyotrophic lateral sclerosis), 진행성핵상마비(Progressive supranuclear palsy), 피질기저핵변성(Corticobasal degeneration), 피크병(Pick's disease), 경도인지장애 및 치매로 이루어진 군에서 선택될 수 있으나, 이에 제한되는 것은 아님을 명시한다.
또한, 본 발명은 SQSTM1/p62 단백질 내 TB (TRAF-6 binding) 도메인의 노출 수준을 측정할 수 있는 제제를 포함하는 퇴행성 뇌질환 진단용 키트를 제공한다.
상기 제제는 프라이머, 프로브, 항체, 펩타이드 및 앱타머로 이루어진 군에서 선택될 수 있으나, 이에 제한되는 것은 아님을 명시한다.
본 발명에서 사용된 용어 "프라이머"는 짧은 자유 3 말단 수산화기를 가지는 핵산 서열로 상보적인 템플레이트 (template)와 염기쌍을 형성할 수 있고 템플레이트 가닥 복사를 위한 시작 지점으로 기능을 하는 짧은 핵산 서열을 의미한다. 프라이머는 적절한 완충용액 및 온도에서 중합반응 (즉, DNA 중합효소 또는 역전사효소)을 위한 시약 및 상이한 4가지 뉴클레오타이드 트리포스페이트의 존재 하에서 DNA 합성을 개시할 수 있다. 또한, 프라이머는 7개 내지 50개의 뉴클레오타이드 서열을 가진 센스 및 안티센스 핵산으로서, DNA 합성의 개시점으로 작용하는 프라이머의 기본 성질을 변화시키지 않는 추가의 특징을 혼입할 수 있다.
본 발명에서 사용된 용어 "프로브"는 mRNA 외 특이적으로 결합을 이룰 수 있는 짧게는 수 염기 내지 길게는 수백 염기에 해당하는 RNA 또는 DNA 등의 핵산 단편을 의미하며 라벨링되어 있어서 특정 mRNA의 존재 유무, 발현량을 확인할 수 있다. 프로브는 올리고뉴클레오타이드 (oligonucleotide) 프로브, 단쇄 DNA (single strand DNA) 프로브, 이중쇄 DNA (double strand DNA) 프로브, RNA 프로브 등의 형태로 제작될 수 있다. 적절한 프로브의 선택 및 혼성화 조건은 당해 기술 분야에 공지된 기술에 따라 적절히 선택할 수 있다.
본 발명에서 사용된 용어 "항체"는 항원성 부위에 대하여 지시되는 특이적인 면역 글로불린을 의미하며, 당해 기술분야의 통상적인 방법에 따라 제조된 것 또는 시판되어 구입한 것이 모두 사용 가능하다. 또한, 상기 항체는 다클론 항체, 단클론 항체 및 에피토프 (epitope)와 결합할 수 있는 단편 등을 포함한다. 상기 항체는 2개의 전체 길이의 경쇄 및 2개의 길이의 중쇄를 갖는 완전한 형태를 의미하며, 또한, 인간화 항체 등 특수 항체도 포함한다.
본 명세서에서 용어 "펩타이드"는 표적 물질에 대한 결합력 높은 장점이 있으며, 열/화학 처리 시에도 변성이 일어나지 않는다. 또한, 분자 크기가 작기 때문에 다른 단백질에 붙여서 융합 단백질로의 이용이 가능하다. 구체적으로 고분자 단백질 체인에 붙여서 이용이 가능하므로 진단 키트 및 약물전달 물질로 이용될 수 있다.
본 발명에서 사용된 용어 "앱타머 (aptamer)"는 그 자체로 안정된 삼차구조를 가지면서 표적분자에 높은 친화성과 특이성으로 결합할 수 있는 특징을 가진 단일가닥 핵산 (DNA, RNA 또는 변형 핵산)이다. 앱타머는 고유의 높은 친화성 (보통 pM 수준)과 특이성으로 표적분자에 결합할 수 있다는 특성 때문에 단일 항체와 비교가 되고, 특히 "화학 항체"라고 할 만큼 대체 항체로서의 높은 가능성이 있다.
또한, 본 발명의 키트는 마커 성분에 특이적으로 결합하는 항체, 기질과의 반응에 의해서 발색하는 표지체가 접합된 2차 항체 접합체 (conjugate), 상기 표지체와 발색 반응할 발색 기질 용액, 세척액 및 효소반응 정지용액 등을 포함할 수 있으며, 사용되는 시약 성분을 포함하는 다수의 별도 패키징 또는 컴파트먼트로 제작될 수 있다.
또한, 본 발명은 a) 환자로부터 분리된 시료에서 SQSTM1/p62 단백질 3차 구조 내 TB (TRAF-6 binding) 도메인의 노출 수준을 측정하는 단계; b) 상기 TB 도메인의 노출 수준을 대조군 시료와 비교하는 단계; 및 c) 상기 TB 도메인의 노출 수준이 대조군 시료보다 낮은 경우, 퇴행성 뇌질환이라고 판단하는 단계;를 포함하는 퇴행성 뇌질환 진단에 필요한 정보를 제공하는 방법을 제공한다.
또한, 본 발명은 a) 환자로부터 분리된 시료에 후보 약물을 처리하는 단계; b) 상기 후보 약물의 처리 전과 후의 SQSTM1/p62 단백질 3차 구조 내 TB (TRAF-6 binding) 도메인의 노출 수준을 측정하는 단계; 및 b) 대조군 시료와 비교하여 상기 TB 도메인의 노출 수준을 증가시키는 후보 약물을 선별하는 단계;를 포함하는 퇴행성 뇌질환 치료제 스크리닝 방법을 제공한다.
본 발명에서 사용된 용어 “환자로부터 분리된 시료”는 TB 도메인의 노출 수준에 있어서 대조구와 차이가 나는 조직, 세포, 전혈, 혈청, 혈장, 타액, 객담, 뇌척수액 또는 뇨와 같은 시료를 포함할 수 있으나, 이에 제한되는 것은 아님을 명시한다.
이하에서는 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로, 본 발명의 요지에 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 당업계에서 통상의 지식을 가진 자에 있어서 자명할 것이다.
실시예 1: 형질주입을 이용한 SQSTM1/p62 단백 및 타우 단백의 역방향 상관관계 분석
CHO(chinese hamster ovary) 세포주는 10% 우태아혈청(fetal bovine serum; FBS) 및 1% 페니실린/스트렙토마이신이 첨가된 DMEM 배지에서 배양하였다. 세포를 12 웰 플레이트에 1.2×105 세포/웰 밀도로 접종하고 24시간 동안 배양한 다음 Lipofectamine 2000 (Invitrogen)을 사용하여 GFP 테그(tag)된 타우 플라스미드 구조물 (plasmid constructs, GFP-3R, GFP-4R) 및 농도를 달리한 (+, ++, +++) HA 테그된 p62 플라스미드 구조물을 같이 형질주입(transfection) 시켰다. 24시간 후 세포들을 회수하고, 단백질을 추출하여 동량의 단백량으로 웨스턴 블롯을 수행하였다. 사용된 항체는 총 타우 단백에 대한 항체 (anti-Tau5 antibody), 인산화 타우에 대한 항체 (인산화 부위에 따라 anti-pT212 antibody, anti-pT231 antibody, anti-pS199 antibody), actin에 대한 항체 (anti-actin antibody) 이다.
그 결과, 도 1과 같이, CHO 세포주에서 SQSTM1/p62 단백 발현이 증가함에 따라 총 타우 단백 및 인산화 타우 단백 발현이 반대로 감소하는 것을 확인하였다 (왼쪽).
실시예 2: 신경세포 내 SQSTM1/p62 단백과 타우 단백의 공존화 분석
Sprague-Dawley 랫드의 임신 18일째, 태아의 대뇌 피질 및 해마세포를 분리한 후 신경세포를 코팅한 커버슬립(coverslip)이 담긴 12 웰 플레이트에 1.2×105 세포/웰 밀도로 접종하고, B-27 및 L-GlutMAX-1이 첨가된 Neurobasal 배지를 이용하여 37℃, 5% CO2 배양기에서 7일 동안 배양하였다. 3-4일마다 배양 배지의 반을 새로운 배지로 교체해 주었다.
배양 7일 후, 1×106 TU의 렌티바이러스 벡터를 배양된 일차 뉴런에 형질 도입시키고 48시간 동안 배양한 후 면역세포화학을 수행하였다. 간략하게, 신경세포가 배양된 커버슬립을 꺼내 차가운 인산완충식염수(PBS)로 2회 세척하고, 4% 포름알데히드를 이용하여 4℃에서 10분 동안 세포를 고정시켰다. 이후, 커버슬립을 PBS로 세척한 후, 0.1% Triton X-100과 2% FBS가 포함된 PBS에 담가 실온에서 5분 동안 세포막을 투과(penetration) 시켰다. 이후, 세포를 1차 항체 (4R 타우 및 p62 항체, 1:1000 희석) 와 4℃에서 밤새 반응시키고, PBS로 3회 세척한 다음 Alexa Fluor 647 (4R 타우) 또는 Alexa Fluor 405 (p62) 2차 항체 (모두 1:1000 희석)와 실온에서 1시간 동안 반응시켰다. 염색된 세포는 공초점 현미경 사용하여 관찰하였다.
그 결과, 도 1과 같이, 면역형광염색에서 SQSTM1/p62 단백과 타우 단백이 신경세포 내 같은 위치에 존재하는 것을 확인하였다 (오른쪽 도면 내 화살표).
실시예 3: SQSTM1/p62 단백 내 TB 도메인과 타우 단백의 직접 결합 분석
3-1. 웨스턴 블롯
p62 플라스미드 구조물 (Addgene, Cambridge, MA, USA)을 이용하여 Phox 및 Bem1 (PB1) 도메인, TRAF6-binding (TB) 도메인, Ubiquitin-binding (UBA) 도메인이 각각 선택적으로 제거된 돌연변이 구조물(mutant construct)을 제작하였다.
CHO 세포주에 p62 야생형(wild type; WT) 구조물 및 이의 돌연변이 구조물을 벡터(vector control) 또는 Tau 플라스미드 구조물과 같이 형질주입 시킨 후 24시간 동안 배양하고 이후 세포를 회수하여 동량의 단백량으로 웨스턴 블롯을 수행하였다. 이의 결과를 각 조건 별로 Image J 프로그램을 이용하여 정량 분석한 후 Tau 플라스미드 구조물이 벡터와 발현되었을 때의 Tau 단백량을 기준으로 정하고(100%), p62 야생형(WT) 또는 TB 도메인이 제거된 p62 돌연변이 구조물(ΔTB)과 같이 발현되었을 때의 tau 단백량을 분석하였다.
그 결과, 도 2와 같이, SQSTM1/p62 단백의 TB 도메인이 제거되었을 때, SQSTM1/p62 단백에 의한 타우 단백의 감소 효과가 약화되는 것을 확인하였다.
3-2. 면역침강반응(immunoprecipitation)
CHO 세포주에 p62 야생형 구조물 및 이의 주요 도메인이 제거된 돌연변이 구조물 (p62Δ_PB1, p62Δ_TB, p62Δ_LIR, p62Δ_UBA)을 Tau 플라스미드 구조물과 같이 형질주입 시킨 후 24시간 동안 배양하였다. 이후, 세포를 차가운 PBS로 세척하고 면역침강반응(immunoprecipitation)을 위해, 세포들의 단백 추출물을 NP-40 추출 버퍼로 추출한 후 1 g의 양을 타우 항체와 4℃에서 밤새 반응시켰다. 이후, 면역 침전물을 protein G-agarose bead (30 μL)와 4℃에서 4시간 동안 반응시켰다. 이후, 획득한 면역 침전물을 SDS-PAGE gel에 전기영동 하여 단백질을 분리하고, 니트로셀룰로스 멤브레인으로 이동시킨 다음 anti-p62 항체와 반응시켜 웨스턴 블롯을 수행하였다.
그 결과, 도 3과 같이, SQSTM1/p62 단백의 주요 도메인을 선택적으로 제거한 결과, TB 도메인이 제거되었을 때, SQSTM1/p62 단백과 타우 단백의 결합이 없어지는 것을 확인하였다(화살표). 이는 TB 도메인을 통해서 SQSTM1/p62 단백과 타우 단백이 직접적으로 결합함을 보여준다.
SQSTM1/p62 단백 내 TB 도메인의 아미노산 서열 및 염기서열은 하기 표 1과 같다.
| TB 도메인의 아미노산 서열 (서열번호 1): SQSTM1/p62 단백의 크기가 440 aa인 경우, 225-250 aa 시퀀스에 해당하는 26 aa 길이 | TB 도메인의 염기 서열 (서열번호 2) |
| SGPSEDPSVNFLKNVGESVAAALSPL(= Ser Gly Pro Ser Glu Asp Pro Ser Val Asn Phe Leu Lys Asn Val Gly Glu Ser Val Ala Ala Ala Leu Ser Pro Leu) | TCTGGTCCATCGGAGGATCCGAGTGTGAATTTCCTGAAGAACGTTGGGGAGAGTGTGGCAGCTGCCCTTAGCCCTCTG |
3-3. 정제 후
GST 풀 다운 분석(GST pull down assay)
His-p62 유전자가 들어 있는 pET 28a 플라스미드를 대장균 BL21로 형질주입 시킨 후 카나마이신(kanamycin)이 첨가된 Luria-Bertani(LB) 배지에서 광학 밀도가 660 of 0.8 expression이 될 때까지 배양하였다. 이후, 대장균을 회수하고 원심분리 하여, 펠릿을 -80℃에서 보관하였다. 실험을 위해, 펠릿에 20 mL의 Ni-NTA 용해 버퍼 [50 mM NaH2PO4 (pH 8.0), 10 mM 이미다졸 및 300 mM NaCl]를 첨가하여 4℃에서 초음파 처리하고, Ni-NTA agarose로 친화성 크로마토그래피(affinity chromatography)를 수행하여 표적 단백질을 정제하였다. Ni-NTA resin과 단백질의 혼합물을 고농도의 Ni-NTA 버퍼로 세척하여 결합되지 않은 단백질을 제거하였다. 최종적으로, 용리 버퍼를 이용하여 단백질을 추출하였다.
그 후 Glutathione-sepharose beads (GE Healthcare, Buckinghamshire, England)와 GST-tau (4R isoform, 441a, AnaSpec, Inc) 또는 GST 단백질을 4℃에서 2시간 동안 반응시켰다. 비드 부피의 10배에 해당하는 TEN100 버퍼 [20 mM Tris(pH 7.4], 0.1 mM EDTA, 100 mM NaCl]로 4회 세척하여 결합되지 않은 물질을 제거하였다. 이후, 정제된 His-p62 (p62, p62ΔTB, p62ΔUBA) 단백들을 각각 추가하여 4℃에서 2시간 동안 반응시키고, 비드 부피의 10배에 해당하는 NETN 버퍼 [0.5% NP-40, 0.1 mM EDTA, 20 mM Tris(pH 7.4), 300 mM NaCl]로 10회 세척하였다. 이후, 샘플 버퍼를 첨가하여 10분간 끓인 후 단백결합체를 용출한 다음 웨스턴 블롯을 수행하였다.
그 결과, 도 4와 같이, TB 도메인이 제거된 His-p62ΔTB와 GST-Tau 단백의 직접 결합이 없어진 것을 확인하였다 (오른쪽 도면 내 화살표).
실시예 4: SQSTM1/p62 단백 내 TB 도메인에 특이적으로 결합하는 항체 제작
4-1. 항체 제작 및 TB 도메인과의 특이적 결합 분석
SQSTM1/p62 단백 내 TB 도메인에 특이적으로 결합하는 단클론 항체(αTB-p62)는 TB 도메인 내 15개의 아미노산 (N'-SGPSEDPSVNFLKNC-C')을 타겟으로 하여 제작하였다. 간략하게, 타겟 시퀀스에 대한 펩타이드를 제작한 후 MonoExpress Bronze Antibody Production 후 항체 정제(purification)를 수행하여 제작하였다.
제작 항체의 TB 도메인 특이성 분석을 위하여, CHO 세포주에 p62 야생형 구조물 및 이의 돌연변이 구조물 (p62Δ_PB1, p62Δ_TB, p62Δ_LIR/KIR, p62Δ_UBA)을 Tau 플라스미드 구조물과 같이 형질주입 시킨 후 24시간 동안 배양하였다. 이후 세포를 회수하여 동량의 단백량으로 웨스턴 블롯을 수행하였다.
그 결과, 도 5와 같이, SQSTM1/p62 단백의 주요 도메인을 선택적으로 제거한 결과, TB 도메인이 제거되었을 때 αTB-p62 항체의 반응이 사라지는 것을 확인함으로써(화살표), 제작된 항체가 TB 도메인에 특이적으로 결합하는 것을 확인하였다.
4-2. TB 도메인 특이 항체(αTB-p62 항체)의 타우 단백
CHO 세포주에 p62 야생형 구조물과 타우 단백을 같이 발현시켰을 때 타우 단백의 농도가 감소하는데, 도 6과 같이, αTB-p62 항체를 처리했을 때 p62에 의한 타우 단백 감소 효과가 상쇄되는 것을 확인하였다. 비특이적 IgG를 처리한 1번째, 3번째 lane에 비해서 αTB-p62 항체를 처리한 2번째, 4번째 lane에서 타우 단백 농도가 높은 것을 확인하였다. 이는 αTB-p62 항체가 p62 야생형의 TB 도메인에 결합하여 p62-타우 단백의 결합이 저해됨에 따라 p62에 의한 타우 단백 감소 효과가 저해됨을 보여준다.
이상으로 본 발명의 특정한 부분을 상세히 기술한 바, 당업계의 통상의 지식을 가진 자에게 있어서 이러한 구체적인 기술은 단지 바람직한 구현 예일 뿐이며, 이에 본 발명의 범위가 제한되는 것이 아닌 점은 명백하다. 따라서, 본 발명의 실질적인 범위는 첨부된 청구항과 그의 등가물에 의하여 정의된다고 할 것이다.
본 발명의 범위는 후술하는 특허청구범위에 의하여 나타내어지며, 특허청구범위의 의미 및 범위 그리고 그 균등 개념으로부터 도출되는 모든 변경 또는 변형된 형태가 본 발명의 범위에 포함되는 것으로 해석되어야 한다.
Claims (9)
- SQSTM1/p62 단백질 내 TB (TRAF-6 binding) 도메인을 포함하는 퇴행성 뇌질환 진단용 바이오마커 조성물.
- 제 1항에 있어서, 상기 TB 도메인은 서열번호 1의 아미노산 서열로 표시되는 것을 특징으로 하는 퇴행성 뇌질환 진단용 바이오마커 조성물.
- 제 1항에 있어서, 상기 TB 도메인은 서열번호 2의 염기서열로 표시되는 것을 특징으로 하는 퇴행성 뇌질환 진단용 바이오마커 조성물.
- 제 1항에 있어서, 상기 TB 도메인은 타우(Tau) 단백질과 결합하는 것을 특징으로 하는 퇴행성 뇌질환 진단용 바이오마커 조성물.
- 제 1항에 있어서, 상기 퇴행성 뇌질환은 알츠하이머병(Alzheimer’s disease), 전측두치매(Frontotemporal dementia), 파킨슨병(Parkinson’s disease), 근위축성측색경화증(Amyotrophic lateral sclerosis), 진행성핵상마비(Progressive supranuclear palsy), 피질기저핵변성(Corticobasal degeneration), 피크병(Pick's disease), 경도인지장애 및 치매로 이루어진 군에서 선택된 것을 특징으로 하는 퇴행성 뇌질환 진단용 바이오마커 조성물.
- SQSTM1/p62 단백질 내 TB (TRAF-6 binding) 도메인의 노출 수준을 측정할 수 있는 제제를 포함하는 퇴행성 뇌질환 진단용 키트.
- 제 6항에 있어서, 상기 제제는 프라이머, 프로브, 항체, 펩타이드 및 앱타머로 이루어진 군에서 선택된 것을 특징으로 하는 퇴행성 뇌질환 진단용 키트.
- a) 환자로부터 분리된 시료에서 SQSTM1/p62 단백질 3차 구조 내 TB(TRAF-6 binding) 도메인의 노출 수준을 측정하는 단계;b) 상기 TB 도메인의 노출 수준을 대조군 시료와 비교하는 단계; 및c) 상기 TB 도메인의 노출 수준이 대조군 시료보다 낮은 경우, 퇴행성 뇌질환이라고 판단하는 단계;를 포함하는 퇴행성 뇌질환 진단에 필요한 정보를 제공하는 방법.
- a) 환자로부터 분리된 시료에 후보 약물을 처리하는 단계;b) 상기 후보 약물의 처리 전과 후의 SQSTM1/p62 단백질 3차 구조 내 TB(TRAF-6 binding) 도메인의 노출 수준을 측정하는 단계; 및b) 대조구 시료와 비교하여 상기 TB 도메인의 노출 수준을 증가시키는 후보 약물을 선별하는 단계;를 포함하는 퇴행성 뇌질환 치료제 스크리닝 방법.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US17/416,029 US20220065875A1 (en) | 2019-02-08 | 2020-02-07 | Biomarker composition for diagnosis of degenerative brain disease |
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR10-2019-0014992 | 2019-02-08 | ||
| KR20190014992 | 2019-02-08 | ||
| KR10-2019-0178182 | 2019-12-30 | ||
| KR1020190178182A KR20200097636A (ko) | 2019-02-08 | 2019-12-30 | 퇴행성 뇌질환 진단용 바이오마커 조성물 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2020162697A1 true WO2020162697A1 (ko) | 2020-08-13 |
Family
ID=71948338
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/KR2020/001736 Ceased WO2020162697A1 (ko) | 2019-02-08 | 2020-02-07 | 퇴행성 뇌질환 진단용 바이오마커 조성물 |
Country Status (2)
| Country | Link |
|---|---|
| US (1) | US20220065875A1 (ko) |
| WO (1) | WO2020162697A1 (ko) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20170016314A (ko) * | 2013-12-29 | 2017-02-13 | 큐어랩 온콜로지, 인크. | 염증―관련 질환의 예방 및 치료용 p62/SQSTM1관련 조성물 및 방법 |
-
2020
- 2020-02-07 WO PCT/KR2020/001736 patent/WO2020162697A1/ko not_active Ceased
- 2020-02-07 US US17/416,029 patent/US20220065875A1/en not_active Abandoned
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20170016314A (ko) * | 2013-12-29 | 2017-02-13 | 큐어랩 온콜로지, 인크. | 염증―관련 질환의 예방 및 치료용 p62/SQSTM1관련 조성물 및 방법 |
Non-Patent Citations (4)
| Title |
|---|
| GEETHA, THANGIAH: "TRAF6 and p62 inhibit amyloid 13-induced neuronal death through p75 neurotrophin receptor", NEUROCHEMISTRY INTERNATIONAL, vol. 61, no. 8, 2012, pages 1289 - 1293, XP055731276, DOI: 10.1016/j.neuint.2012.09.005 * |
| MA, SHIFAN: "SQSTM1/p62: a potential target for neurodegenerative disease", ACS CHEMICAL NEUROSCIENCE, vol. 10, no. 5, 18 January 2019 (2019-01-18), pages 2094 - 2114, XP055731267, DOI: 10.1021/acschemneuro.8b00516 * |
| MARIE W. WOOTEN, THANGIAH GEETHA, M. LAMAR SEIBENHENER, J. RAMESH BABU, MARIA T. DIAZ-MECO, JORGE MOSCAT: "The p62 Scaffold Regulates Nerve Growth Factor-induced NF-κB Activation by Influencing TRAF6 Polyubiquitination", THE JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 280, no. 42, 2005, pages 35625 - 35629, XP055731272 * |
| YANG DOU, XIAODI TIAN, JIAN ZHANG, ZHONG WANG, GANG CHEN: "Roles of TRAF6 in central nervous system", CURRENT NEUROPHARMACOLOGY, vol. 16, no. 9, 2018, pages 1306 - 1313, XP055731278, DOI: 10.2174/1570159X16666180412094655 * |
Also Published As
| Publication number | Publication date |
|---|---|
| US20220065875A1 (en) | 2022-03-03 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| KR20200097636A (ko) | 퇴행성 뇌질환 진단용 바이오마커 조성물 | |
| US10112982B2 (en) | Detection of anti-neurochondrin autoantibody in patients with cerebellar ataxia or cerebellitis | |
| EP3018478B1 (en) | A novel diagnostically relevant autoantibody | |
| US10215764B2 (en) | Assay reagents for a neurogranin diagnostic kit | |
| CN105579853B (zh) | 用于检测gaba(a)相关性自身免疫疾病的诊断方法和相关主题 | |
| CN117624357A (zh) | p-Tau 217特异性抗体及其在阿尔茨海默症辅助诊断试剂盒的应用 | |
| WO2017128880A1 (zh) | 一种特异性抑制连接蛋白26的全人抗体 | |
| WO2012076000A2 (de) | Verfahren zum nachweis von anti-nmda-rezeptor autoantikörpern zum einsatz in diagnoseverfahren | |
| US12174186B2 (en) | Method and reagents for the detection of an autoantibody | |
| WO2020162697A1 (ko) | 퇴행성 뇌질환 진단용 바이오마커 조성물 | |
| WO2011007209A1 (en) | Cleaved and phosphorylated crmp2 as blood marker of inflammatory diseases of the central nervous system | |
| US10877033B2 (en) | Method of detecting the presence or absence of autoantibodies | |
| US20230053910A1 (en) | Method and reagents for the detection of an autoantibody | |
| Inatani et al. | Upregulated expression of N-syndecan, a transmembrane heparan sulfate proteoglycan, in differentiated neural stem cells | |
| WO2007021003A1 (ja) | ドーパミン産生ニューロン増殖前駆細胞マーカーNato3 | |
| Sayer et al. | Interaction of the nuclear matrix protein NAKAP with HypA and huntingtin: implications for nuclear toxicity in Huntington’s disease pathogenesis | |
| KR102466369B1 (ko) | 자가면역 뇌염의 진단 방법 | |
| WO2021125732A1 (ko) | 콧물 시료를 이용한 경도 인지 장애의 진단용 바이오마커 조성물 및 이를 이용한 경도 인지 장애의 진단 방법 | |
| WO2024195973A1 (ko) | 시신경 손상 질환의 진단용 바이오마커 조성물 및 그의 용도 | |
| WO2016209013A1 (ko) | 비만 진단용 마커 tm4sf19 및 이를 이용한 방법 | |
| US20180188268A1 (en) | Cardiomyocyte-Specific Biological Markers and Uses Thereof | |
| WO2017065335A1 (ko) | 돌연변이 park2 유전자 및 이를 이용하여 파킨슨병을 진단하는 방법 | |
| WO2021025412A1 (ko) | 보체 성분 c8 감마를 이용한 알츠하이머병의 진단방법 | |
| US12306184B2 (en) | Biomarkers of membranous glomerulonephritis | |
| WO2020209469A1 (ko) | 말초신경병증 아형별 진단용 바이오마커 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 20752576 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 20752576 Country of ref document: EP Kind code of ref document: A1 |