WO2020132946A1

WO2020132946A1 - Pharmaceutical compositions, kits and methods for treating tumors

Info

Publication number: WO2020132946A1
Application number: PCT/CN2018/123904
Authority: WO
Inventors: Xiaoqing Chen; Xusha ZHOU; Bernard Roizman; Grace Guoying ZHOU
Original assignee: Shenzhen International Institute For Biomedical Research
Priority date: 2018-12-26
Filing date: 2018-12-26
Publication date: 2020-07-02
Also published as: CN113227384A; CN113227384B

Abstract

Provided is a composition for treating tumors in a subject comprising a therapeutically effective amount of an exosome carrying inhibitory amount of CTLA4-targeting miRNA and an oncolytic virus, wherein an exo-motif is operably linked to the seed sequence of the CTLA4-targeting miRNA to enhance the packaging of the CTLA4-targeting miRNA into the exosome.

Description

PHARMACEUTICAL COMPOSITIONS, KITS AND METHODS FOR TREATING TUMORS

Technical Field

The present invention is related to a pharmaceutical composition for treating a tumor, and in particular, to a pharmaceutical composition comprising a therapeutically effective amount of an exosome carrying CTLA4 targeting miRNA and a therapeutically effective amount of an oncolytic virus. The present invention is also related to a kit comprising the exosome carrying CTLA4 targeting miRNA and an oncolytic virus, and methods of using the pharmaceutical composition and the kit for treating a tumor.

Background

Cancer as a disease is a multifaceted foe which may succumb to the prescribed treatment and may develop resistance against various therapies. A subset of cells within tumors are resistant to conventional treatment modalities and may be responsible for disease recurrence.

Surgical treatment of cancer is a common local treatment. In addition to some malignant tumors of the blood system, such as leukemia, lymphoma, etc., other various malignant tumors have one or more tangible solid tumors, which can be surgically removed. However, surgery always has certain risks and often has other comorbidities or potential organ dysfunction.

Non-surgical treatments of cancer (mainly conventional chemotherapy, targeted biological therapies, and radiotherapy) have not generated completely satisfactory results to date. The ongoing problems include low target selectivity, drug resistance, inability to effectively address metastatic disease and severe side effects. In contrast, immunotherapies that overall provoke host immunity to induce a systemic response against tumors currently offer much clinical promise.

Oncolytic viruses represent a new class of therapeutic agents which have been designed to selectively replicate in and kill cancer cells sparing normal cells from their effects. It is well established that oncolytic viruses can stimulate adaptive immune responses to tumor cells due to the release of tumor associated antigens (TAAs) , pathogen-associated molecular patterns (PAMPS) , and danger-associated molecular patters (DAMPS) from lysed tumor cells. These responses also shift tumors from cold (immune desert) to hot (inflamed) tumors. Once processed by antigen presenting cells (APCs) , TAAs can then induce anti-tumor T-cell responses in parallel with anti-viral responses. Based on these unique features, oncolytic viruses are now considered a cancer immunotherapy agent. However, oncolytic virus treatment alone is still unable to cure bulky and/or metastasized tumors and thus oncolytic viruses also require additional therapies to enhance their anti-tumor effect. Oncolytic viruses have the added advantage of being able to be engineered to encode a therapeutic gene that can further aid to the overall anti-tumor efficacy of the virus.

Oncolytic viruses are classified into DNA viruses and RNA viruses. The DNA virus is represented by adenovirus, herpes simplex virus, parvovirus and vaccinia virus. The RNA virus includes reovirus, coxsackievirus, polio virus, Seneca valley virus, measles virus, Newcastle disease virus, vesicular stomatitis virus, and so on. The ideal oncolytic virus should be able to effectively reduce the risk to patients and the population. For example, the oncolytic virus should have tumor selectivity, normal tissue non-pathogenicity, non-sustained in vivo, genetic (gene) stability for patients. In addition to the above characteristics, the oncolytic virus should also be non-infectious, and the population has been widely immunized against the virus.

Although extended studying and testing in pre-clinical and clinical setting, an unmet need continues to exist for methods of treating tumors.

Summary

In one aspect, an exosome carrying a miRNA targeting CTLA4 is disclosed in which an exosome-packaging-associated motif (also referred to as “exo-motif” hereinafter) is operably linked to the miRNA targeting CTLA4. In one embodiment, the exosome comprises an inhibitory amount of CTLA4-targeting miRNA, wherein the CTLA4-targeting miRNA has a seed sequence binding to mRNA of CTLA4; and an exo-motif operably linked to the seed sequence of the CTLA4-targeting miRNA to enhance the packaging of the CTLA4-targeting miRNA into the exosome. In some embodiments, the exo-motif is located downstream and covalently linked to the seed sequence of the CTLA4-targeting miRNA. In some embodiments, the exo-motif is located downstream and linked to the seed sequence of the CTLA4 by a linker. In some embodiments, the exo-motif is obtained by mutation of one or more nucleic acids of the CTLA4 targeting miRNA except for the seed sequence. In some embodiments, the exo-motif is a two-fold motif generated through combination of two single exo-motifs. In some embodiments, the CTLA4-targeting miRNA and the exo-motif, when operably linked, share at least one or two nucleotides.

Another aspect of the invention is related to a pharmaceutical composition comprising a therapeutically effective amount of an exosome carrying a miRNA targeting CTLA4, a therapeutically effective amount of an oncolytic virus, and a pharmaceutically acceptable carrier. The exosome comprises an exosome-packaging-associated motif operably linked, optionally through a linker, to the miRNA targeting CTLA4.

Another aspect of the invention is related to a kit comprising an exosome carrying a miRNA targeting CTLA4 and an oncolytic virus for treating a tumor. The kit may further comprise instructions for using the exosome and oncolytic virus for treating tumors.

A further aspect of the invention is related to a method for treating tumor in a subject, comprising administering to the subject a pharmaceutically effective amount of the exosome carrying a miRNA targeting CTLA4 in combination with a therapeutically effective amount of an oncolytic virus.

A further aspect of the invention is related to a method for enhancing efficacy of an oncolytic virus therapy in a subject comprising administering to the subject in need thereof a therapeutically effective amount of an exosomes carrying miRNA targeting CTLA4 of the invention in addition to the oncolytic virus therapy.

Other aspects of the invention will be readily available from reading the description below.

Brief Description of Drawings

Figure 1. On the left is schematic diagram of the plasmid encoding miRNAs targeting CTLA4. The right panel shows the nucleotide sequences of miRNA targeting mouse CTLA4 gene (miR-CTLA4) . The nucleotides highlighted in bold, italic, and underline indicate exosome-packaging-associated motifs (EXO-motifs) .

Figure 2. Down-regulation of CTLA4 by designed miRNAs. HEp-2 cells seeded in 24-well plates were co-transfected with 0.25 μg of plasmids expressing miR-CTLA4 or non-target miRNA (NT) and 0.25 μg of plasmid encoding a His-tagged mouse CTLA4 (mCTLA4-his) . The cells were harvested after 72 h post transfection and then accumulations of CTLA4 and GAPDH were measured.

Figure 3. Accumulation of CTLA4 protein in cells exposed to exosome containing miR-CTLA4. HEp-2 cells (5x10 ⁶) were transfected with 10 μg of selected plasmids expressing miR-CTLA4 (1#, 2#, 3# and 6#) . And after 4 h incubation the cells were washed with PBS for three times to exclude potential contamination of exosome in serum, and the cells were cultured in fetal bovine serum (FBS) free medium for another 48 h. The cell supernatant was collected and exosome were isolated by ultracentrifugation. Cultures containing 2.5x10 ⁵ HEp-2 cells were incubated with 10 μg purified exosome. After 24 h of incubation the inoculum then was replaced with fresh medium. After another 48 h, the cells were harvested and the cells lysates were electrophoretically separated in a 10%denaturing gel, and reacted with indicated antibodies.

Figure 4. Analysis of miR-CTLA4 from purified exosome. HEp-2 cells were transfected with 10 μg indicated plasmid encoding miRNA targeting CLTA4 (miR-CTLA4-3#) and exosome were purified. RNAs were extracted from cell pellet and exosome. miR-CTLA4 was quantified and normalized with respect to 18s rRNA using Real Time-PCR assay.

Figure 5. Schematic representation of murine IL-12 (mIL-12) -expressing oncolytic virus (T2850) and its prototype wild type HSV-1 (F) genome. The inverted repeats (b’a’and a’c’, IR) region was replaced by mIL-12 expression cassette.

Figure 6. Intratumoral injection of T2850 and exosome containing CTLA4 miRNA inhibits tumor growth of MFC and B16 in syngeneic mouse model. Mouse forestomach carcinoma MFC or mouse melanoma B16 cells were injected subcutaneously in the right flanks of 615 or C57BL/6J mice, respectively. MFC tumors averaging 80 mm ³ or B16 tumors averaging 70 mm ³ were injected intratumorally with 50 μl of PBS with 10%glycerol (w/v) (Control) or 1×10 ⁷ pfu of T2850 mixed with 10 μg exosome purified from non-target (miRNA-NT exo) or CLTA4 miRNA (miRNA-CTLA4 exo) plasmid transfected HEp-2 cell supernatant. Tumor volume was measured and presented as mean ± SEM of 8 animals in each group.

Detailed Description of the Invention

Definitions

It is to be noted that the term “a” or “an” entity refers to one or more of that entity; for example, “an exosome, ” is understood to represent one or more exosomes. As such, the terms “a” (or “an” ) , “one or more, ” and “at least one” can be used interchangeably herein.

“Homology” or “identity” or “similarity” refers to sequence similarity between two peptides or between two nucleic acid molecules. Homology can be determined by comparing a position in each sequence which may be aligned for purposes of comparison. When a position in the compared sequence is occupied by the same base or amino acid, then the molecules are homologous at that position. A degree of homology between sequences is a function of the number of matching or homologous positions shared by the sequences. An “unrelated” or “non-homologous” sequence shares less than 40%identity, though preferably less than 25%identity, with one of the sequences of the present disclosure.

A polynucleotide or polynucleotide region (or a polypeptide or polypeptide region) has a certain percentage (for example, 60 %, 65 %, 70 %, 75 %, 80 %, 85 %, 90 %, 95 %, 98 %or 99 %) of “sequence identity” to another sequence means that, when aligned, that percentage of bases (or amino acids) are the same in comparing the two sequences. This alignment and the percent homology or sequence identity can be determined using software programs known in the art.

The term “linker” as used herein refers to a short fragment of nucleotide sequence containing two or more nucleotides which may be same or different, wherein the nucleotides are selected from a group consisting of Adenine (A) , Guanine (G) , Cytosine (C) , Thymine (T) and Uracil (U) .

As used herein, the terms “treat” or “treatment” refer to both therapeutic treatment and prophylactic or preventative measures, wherein the object is to prevent or slow down (lessen) an undesired physiological change or disorder, such as the progression of tumor. Beneficial or desired clinical results include, but are not limited to, alleviation of symptoms, diminishment of extent of disease, stabilized (i.e., not worsening) state of tumor, inhibition of tumor growth, reducing the volume of the tumor, delay or slowing of tumor progression, amelioration or palliation of the tumor state, and remission (whether partial or total) , whether detectable or undetectable. Those in need of treatment include those already have a tumor as well as those who are prone to have a tumor.

By “subject” or “individual” or “animal” or “patient” or “mammal, ” is meant any subject, particularly a mammalian subject, for whom diagnosis, prognosis, or therapy is desired. Mammalian subjects include humans, domestic animals, farm animals, and zoo, sport, or pet animals such as dogs, cats, guinea pigs, rabbits, rats, mice, horses, cattle, cows, and so on. The subject herein is preferably a human.

As used herein, phrases such as “to a patient in need of treatment” or “asubject in need of treatment” includes subjects, such as mammalian subjects, that would benefit from administration of a composition of the present disclosure used, e.g., for detection, for a diagnostic procedure and/or for treatment.

The present invention employs, among others, antisense oligomer and similar species for use in modulating the function or effect of nucleic acid molecules encoding CTLA4. The hybridization of an oligomer of this invention with its target nucleic acid is generally referred to as "antisense" . Consequently, the preferred mechanism believed to be included in the practice of some preferred embodiments of the invention is referred to herein as "antisense inhibition. " Such antisense inhibition is typically based upon hydrogen bonding-based hybridization of oligonucleotide strands or segments such that at least one strand or segment is cleaved, degraded, or otherwise rendered inoperable. In this regard, it is presently preferred to target specific nucleic acid molecules and their functions for such antisense inhibition.

The functions of RNA to be interfered with can include functions such as translocation of the RNA to a site of protein translation, translocation of the RNA to sites within the cell which are distant from the site of RNA synthesis, translation of protein from the RNA, splicing of the RNA to yield one or more RNA species, and catalytic activity or complex formation involving the RNA which may be engaged in or facilitated by the RNA. One preferred result of such interference with target nucleic acid function is modulation of the expression of CTLA4. In the context of the present invention, "modulation" and "modulation of expression" mean decrease (inhibition) in the amount or levels of a nucleic acid molecule encoding the gene, e.g., DNA or RNA. mRNA is often a preferred target nucleic acid.

In the context of this invention, "hybridization" means the pairing of complementary strands of oligomers. In the present invention, the preferred mechanism of pairing involves hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleoside or nucleotide bases (nucleobases) of the strands of oligomeric compounds. For example, adenine and thymine are complementary nucleobases which pair through the formation of hydrogen bonds. Hybridization can occur under varying circumstances.

An antisense oligomer is specifically hybridizable when binding of the oligomer to the target nucleic acid interferes with the normal function of the target nucleic acid to cause a loss of activity, and there is a sufficient degree of complementarity to avoid non-specific binding of the antisense oligomer to non-target nucleic acid sequences under conditions in which specific binding is desired, i.e., under physiological conditions in the case of in vivo assays or therapeutic treatment, and under conditions in which assays are performed in the case of in vitro assays.

In the present invention the phrase "stringent hybridization conditions" or "stringent conditions" refers to conditions under which a compound of the invention will hybridize to its target sequence, but to a minimal number of other sequences. Stringent conditions are sequence-dependent and will be different in different circumstances and in the context of this invention, "stringent conditions" under which oligomeric compounds hybridize to a target sequence are determined by the nature and composition of the oligomers and the assays in which they are being investigated.

"Complementary, " as used herein, refers to the capacity for precise pairing between two nucleobases of an oligomeric compound. For example, if a nucleobase at a certain position of an oligonucleotide (an oligomeric compound) , is capable of hydrogen bonding with a nucleobase at a certain position of a target nucleic acid, said target nucleic acid being a DNA, RNA, or oligonucleotide molecule, then the position of hydrogen bonding between the oligonucleotide and the target nucleic acid is considered to be a complementary position. The oligonucleotide and the further DNA, RNA, or oligonucleotide molecule are complementary to each other when a sufficient number of complementary positions in each molecule are occupied by nucleobases which can hydrogen bond with each other. Thus, "specifically hybridizable" and "complementary" are terms which are used to indicate a sufficient degree of precise pairing or complementarity over a sufficient number of nucleobases such that stable and specific binding occurs between the oligonucleotide and a target nucleic acid.

It is understood in the art that the sequence of an antisense oligomer need not be 100%complementary to that of its target nucleic acid to be specifically hybridizable. Moreover, an oligonucleotide may hybridize over one or more segments such that intervening or adjacent segments are not involved in the hybridization event (e.g., a loop structure or hairpin structure) . It is preferred that the antisense compounds of the present invention comprise at least 70%, or at least 75%, or at least 80%, or at least 85%sequence complementarity to a target region within the target nucleic acid, more preferably that they comprise at least 90%sequence complementarity and even more preferably comprise at least 95%or at least 99%sequence complementarity to the target region within the target nucleic acid sequence to which they are targeted. For example, an antisense compound in which 18 of 20 nucleobases of the antisense oligomer are complementary to a target region, and would therefore specifically hybridize, would represent 90 percent complementarity. In this example, the remaining noncomplementary nucleobases may be clustered or interspersed with complementary nucleobases and need not be contiguous to each other or to complementary nucleobases. As such, an antisense oligomer which is 18 nucleobases in length having 4 (four) noncomplementary nucleobases which are flanked by two regions of complete complementarity with the target nucleic acid would have 77.8%overall complementarity with the target nucleic acid and would thus fall within the scope of the present invention. Percent complementarity of an antisense compound with a region of a target nucleic acid can be determined routinely using BLAST programs (basic local alignment search tools) and PowerBLAST programs known in the art.

In the context of this invention, the term "oligonucleotide" refers to an oligomer or polymer of ribonucleic acid (RNA) or deoxyribonucleic acid (DNA) or mimetics, chimeras, analogs and homologs thereof. This term includes oligonucleotides composed of naturally occurring nucleobases, sugars and covalent internucleoside (backbone) linkages as well as oligonucleotides having non-naturally occurring portions which function similarly. Such modified or substituted oligonucleotides are often preferred over native forms because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for a target nucleic acid and increased stability in the presence of nucleases.

As used herein, the term “microRNA” , “miRNA” , or “miR” refers to RNAs that function post-transcriptionally to regulate expression of genes, usually by binding to complementary sequences in the three prime (3’) untranslated regions (3’UTRs) of target messenger RNA (mRNA) transcripts, usually resulting in gene silencing. miRNAs are typically small regulatory RNA molecules, for example, 21 or 22 nucleotides long. The terms “microRNA” , “miRNA” , and “miR” are used interchangeably.

As used herein, the term "tumor" refers to a malignant tissue comprising transformed cells that grow uncontrollably (i.e., is a hyperproliferative disease) . Tumors include leukemias, lymphomas, myelomas, plasmacytomas, and the like; and solid tumors. Examples of solid tumors that can be treated according to the invention include but are not limited to sarcomas and carcinomas such as melanoma, fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteogenic sarcoma, chordoma, angiosarcoma, endotheliosarcoma, lymphangiosarcoma, lymphangioendotheliosarcoma, synovioma, mesothelioma, Ewing's tumor, leiomyosarcoma, rhabdomyosarcoma, colon carcinoma, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, sweat gland carcinoma, sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinomas, cystadenocarcinoma, medullary carcinoma, bronchogenic carcinoma, renal cell carcinoma, hepatoma, bile duct carcinoma, choriocarcinoma, seminoma, embryonal carcinoma, Wilms'tumor, cervical cancer, testicular tumor, lung carcinoma, small cell lung carcinoma, bladder carcinoma, epithelial carcinoma, glioma, astrocytoma, medulloblastoma, craniopharyngioma, ependymoma, pinealoma, hemangioblastoma, acoustic neuroma, oligodendroglioma, meningioma, neuroblastoma, retinoblastoma, gastric carcinoma and forestomach carcinoma.

The term “CTLA4” as used herein refers to “cytotoxic T-lymphocyte-associated protein 4” which is one of many coinhibitory molecules that can attenuate T cell activation by inhibiting co-stimulation and transmitting inhibitory signals to T cells. Amino acid sequences of CTLA4 are available from NCBI through accession numbers NP_033973.2 or NP_001268905.1. CTLA4 is also known as Ctla-4, Cd152 or Ly-56. The NCBI sequence accession numbers of CTLA4 is NC_000067.6 and gene ID is 12477. The human CTLA4 gene encodes a 233 amino-acid protein belonging to the immunoglobulin superfamily. CTLA4 consists of one V-like domain flanked by two hydrophobic regions. CTLA4 also can change the structure of immune synapses, which serve a pivotal role in T cell proliferation and differentiation CTLA4. Polymorphisms in CTLA4 have been associated with susceptibility to multiple diseases, including type I diabetes, primary biliary cirrhosis and Graves'disease.

By “therapeutically effective amount” it is meant that the oncolytic virus and/or the exosome of the present disclosure is administered in an amount that is sufficient for "treatment" as described above. The amount which will be therapeutically effective in the treatment of a particular individual's disorder or condition will depend on the symptoms and severity of the disease, and can be determined by standard clinical techniques. In addition, in vitro or in vivo assays may optionally be employed to help identify optimal dosage ranges. The precise dose to be employed in the formulation will also depend on the route of administration, and the seriousness of the disease or disorder, and should be decided according to the judgment of a practitioner and each patient's circumstances. Effective doses may be extrapolated from dose-response curves derived from in vitro or animal model test systems.

The term “oncolytic virus” as used herein refers to any oncolytic virus known in the art designed, usable or effective to kill a tumor cell. By way of example, the oncolytic viruses include type 1 herpes simplex viruses, type 2 herpes simplex viruses, vesicular stomatitis viruses, Newcastle disease viruses, vaccinia viruses, adenovirus, a rhabdovirus, a non-VSV rhabdovirus, reovirus, polio virus, mumps virus, measles virus, influenza virus, a mutant strain of any of these viruses, or a genetically engineered strain of any of these viruses. In addition, the oncolytic virus used in the present disclosure can also be genetically engineered, so that one or more of the features of the natural oncolytic virus is deleted. In addition or alternatively, a naturally occurring oncolytic virus may be genetically engineered to introduce to the genome of the virus one or more exogenous fragments of coding sequences, so as to provide one or more additional functionality of the virus, such as immunotherapeutic or immunostimulatory properties. For example, the oncolytic virus is a genetically engineered HSV-1 oncolytic virus expressing IL-12. In another example, the oncolytic virus is a genetically engineered HSV-1 oncolytic virus expressing PD-1 and IL-12.

miRNAs Targeting CTLA4

The terms “miRNAs targeting CTLA4” , “amiRNA targeting CTLA4” , and “CTLA4-targeting miRNA” which are used interchangeably herein, refer to a small non-coding RNA (microRNA or miRNA) designed to target or specifically bind to mRNA encoding protein CTLA4 such that the transcription, translation and, in turn, expression of the CTLA4 in a cell is impaired, reduced, or eliminated. As described above, miRNA is not necessarily bind to target mRNA by 100%specificity. It is known that miRNA has a seed sequence (2-8 nucleotides from 5’end) which determines the specificity of biding to a target mRNA, while the remaining nucleotides are not necessarily exactly complementary to the target mRNA. Therefore, in one embodiment, the miRNA has a seed sequence of any of nucleotide sequences SEQ ID NO. 1, SEQ ID NO: 2, SEQ ID NO. 3 or SEQ ID NO. 4. In some embodiments, the miRNA targeting CTLA4 blocks the expression of CTLA4 protein in a cell after delivered to a tumor cell.

Exosomes Carrying miRNA Targeting CTLA4

Exosomes are small, relatively uniform-sized vesicles derived from cellular membranes. For example, exosomes may have a diameter of about 30 to about 100 nm. They contain several key proteins (e.g. CD9, CD63, CD81, CD82, Annexin, Flotillin, etc) and in addition they package proteins, mRNAs, long non-coding RNAs and miRNAs. Exosomes transport the payload from cell to cell. On entry into recipient cells the exosome payload is released into cytoplasm.

In some embodiments, the miRNA targeting CTLA4 is delivered to a cell via an exosome. Therefore, in one embodiment, an exosome carrying any of the CTLA4-targeting miRNAs as described above is provided. The present invention uses a fragment of nucleotide sequence, referred to as “exo-motif” herein, to facilitate or enhance the packaging of a miRNA into an exosome. In one embodiment, the exo-motif is selected from any of the sequences identified in Table 1.

Table 1. Sequences of exo-motifs used with miRNAs of the invention

Sequence ID	Nucleotide Sequence	Sequence ID	Nucleotide Sequence
SEQ ID NO. 21	5’-GGAG-3’	SEQ ID NO. 36	5’-CGCC-3’
SEQ ID NO. 22	5’-GGAC-3’	SEQ ID NO. 37	5’-CGGG-3’
SEQ ID NO. 23	5’-GGCG-3’	SEQ ID NO. 38	5’-CGGC-3’
SEQ ID NO. 24	5’-GGCC-3’	SEQ ID NO. 39	5’-CCCU-3’
SEQ ID NO. 25	5’-GGGG-3’	SEQ ID NO. 40	5’-CCCG-3’
SEQ ID NO. 26	5’-GGGC-3’	SEQ ID NO. 41	5’-CCCA-3’
SEQ ID NO. 27	5’-UGAG-3’	SEQ ID NO. 42	5’-UCCU-3’
SEQ ID NO. 28	5’-UGAC	SEQ ID NO. 43	5’-UCCG-3’
SEQ ID NO. 29	5’-UGCG	SEQ ID NO. 44	5’-UCCA-3’
SEQ ID NO. 30	5’-UGCC	SEQ ID NO. 45	5’-GCCU-3’
SEQ ID NO. 31	5’-UGGG	SEQ ID NO. 46	5’-GCCG-3’
SEQ ID NO. 32	5’-UGGC	SEQ ID NO. 47	5’-GCCA-3’
SEQ ID NO. 33	5’-CGAG	SEQ ID NO. 48	5’-GGAGGAC-3’
SEQ ID NO. 34	5’-CGAC	SEQ ID NO. 49	5’-GGACUGGGAG-3’
SEQ ID NO. 35	5’-CGCG-3’	SEQ ID NO. 50	5’-GGAGGAG-3’
SEQ ID NO. 51	5’-GGACGGAG-3’	SEQ ID NO. 52	5’-GGAGGCGGAG-3’

In some embodiments, the exo-motifs are used in combination. For example, two or more exo-motifs as identified in the Table are combined to form a two-fold exo-motif. The motifs can be combined linearly by linking the 5’-end of one exo-motif to the 3’-end of another exo-motif. In this context, when the first nucleotide of the 5’-end of one exo-motif is identical with the last nucleotide of the 3’-end of another exo-motif, one of the identical nucleotides can be designed to be omitted. For example, “GGAG” (SEQ ID NO. 21) is combined with “GGAC” (SEQ ID NO. 22) to form a two-fold exo-motif “GGAGGAC” (SEQ ID NO. 48) . When the first nucleotide of the 5’-end of one exo-motif is different from the last nucleotide of the 3’-end of another exo-motif, the two exo-motifs can be connected by a linker or directly by a covalent bond. For example, ” GGAC” (SEQ ID NO. 22) may be combined with ” GGAG” (SEQ ID NO. 21) by a linker “TG” to form a two-fold exo-motif “GGACUGGGAG” (SEQ ID NO. 49) , ” GGAC” (SEQ ID NO. 22) may also be combined with ” GGAG” (SEQ ID NO. 21) by a covalent bond to form a two-fold exo-motif “GGACGGAG” (SEQ ID NO. 51) . The present invention also contemplates a three-fold or more exo-motif, i.e., an exo-motif consisted of three or more motifs of SEQ ID NO. 21 to SEQ ID NO. 47. Therefore, the term “exo-motif” used herein is meant to include nucleotide sequences that are able to enhance or facilitate packaging of miRNA to an exosome, including any of the single exo-motif of SEQ ID NO. 21 to SEQ ID NO. 47 and any two-fold (e.g. any one of SEQ ID NO. 48-52) , three-fold or more fold exo-motifs generated by the combinations of the single motifs.

In the present invention, the exo-motif is operably linked to the seed sequence of the miRNA. The term "operably linked" refers to functional linkage between a regulatory sequence (e.g. the exo-motif) and a nucleic acid sequence (e.g., the seed sequence of the miRNA) resulting in an enhance of, or facilitating the packaging of the miRNA into an exosome. For example, a first nucleic acid sequence is operably linked with a second nucleic acid sequence when the first nucleic acid sequence is placed in a functional relationship with the second nucleic acid sequence. Operably linked RNA sequences can be contiguous with each other or can be connected with a linker.

In some embodiments, an exo-motif is located downstream the seed sequence of the miRNA. In some embodiments, an exo-motif is located upstream the seed sequence of the miRNA. In some embodiments, the seed sequence of the miRNA is flanked by exo-motifs. In one embodiment, an exo-motif is operably linked to the seed sequence of the miRNA. In one embodiment, an exo-motif is obtained by mutation of one or more of the nucleotide sequences of the miRNA except for the seed sequence. In one embodiment, the miRNA targeting CTLA4 with exo-motif contains a nucleotide sequence of SEQ ID NO. 5, SEQ ID NO. 6, SEQ ID NO. 7 or SEQ ID NO. 8. In one embodiment, the miRNA targeting CTLA4 with exo-motif is a nucleotide sequence of SEQ ID NO. 5, SEQ ID NO. 6, SEQ ID NO. 7 or SEQ ID NO. 8.

In some embodiments where an exo-motif is located downstream the seed sequence of the miRNA, the 3’end last nucleotide of the seed sequence and the 5’end first nucleotide of the exo-motif share a same nucleotide, for example, guanine nucleotide “G” . For example, SEQ ID NO. 6 shows the sharing of the guanine nucleotide “G” between the exo-motif and the seed sequence. In some embodiments where an exo-motif is located downstream the seed sequence of the miRNA, the 3’end last two nucleotides of the seed sequence and the 5’end first two nucleotides of the exo-motif share the same two nucleotides, for example, two guanine nucleotides “GG” . For example, SEQ ID NO. 8 shows the sharing of the two guanine nucleotides “GG” between the exo-motif and the seed sequence.

In some embodiments, the exo-motif is located downstream of the seed sequence of the miRNA and is connected to the seed sequence of the miRNA by a linker, for example, “GC” . For example, SEQ ID NO. 7 shows the exo-motif and the seed sequence are connected by a linker “GC” .

In addition to the seed sequence and the exo-motif, the miRNA also includes additional nucleic acid sequence to facilitate binding to the target region of the mRNA. These additional nucleic acids are normally located downstream the exo-motif with a length of several nucleotides, e.g., 1 to 10 nucleotides. The additional nucleic acid sequences are preferably complementary to the corresponding segment of the target mRNA, but, as described above, not necessarily 100%complementary.

Methods for transferring miRNAs into an exosome are available in the art, such as by co-transfecting a cell with a miRNA expression vector and a plasmid encoding CTLA4, as described in the Example. Isolation, identification or characterization of an exosome is technically feasible in the art. Several proteins, e.g. CD9, CD63, CD81, CD82, Annexin, Flotillin, etc can be used as a marker of exosomes. Other methods for packaging miRNAs into exosomes may also be applicable with the present invention.

The exosome of the present invention contains an inhibitory amount of miRNA targeting CTLA4. An inhibitory amount is meant an amount sufficient for inhibiting the expression of the protein CTLA4 once the miRNA in question was delivered into a tumor cell.

The table below lists the nucleic acid sequences of miRNAs, seed sequences, and miRNA-motif used in the Example of the invention.

Table 2. Nucleic acid sequences of miRNAs, seed sequences, and miRNAs linked with exo-motifs

Sequence ID	Identity	Description	Nucleic Acid Sequence
SEQ ID NO. 1	miR-CTLA4-1#	Seed Sequence	5’-ACCUUCA-3’
SEQ ID NO. 2	miR-CTLA4-2#	Seed Sequence	5’-UUCAGUG-3’

SEQ ID NO. 3	miR-CTLA4-3#	Seed Sequence	5’-CUGUGCU-3’
SEQ ID NO. 4	miR-CTLA4-6#	Seed Sequence	5’-UCCAAGG-3’
SEQ ID NO. 5	miR-CTLA4-1#	miRNA + exo-motif	5’-AACCUUCAGU GGAGUUGGCGA-3’
SEQ ID NO. 6	miR-CTLA4-2#	miRNA + exo-motif	5’-CUUCAGU GGAGUUGGCGAGCA-3’
SEQ ID NO. 7	miR-CTLA4-3#	miRNA + exo-motif	5’-ACUGUGCUGC GGAGGACAAAU-3’
SEQ ID NO. 8	miR-CTLA4-6#	miRNA + exo-motif	5’-AUCCAA GGACUG GGAGCUGUU-3’
SEQ ID NO. 9	miR-CTLA4-4#	Seed Sequence	5’-GACAUUC-3’
SEQ ID NO. 10	miR-CTLA4-5#	Seed Sequence	5’-AACCUCA-3’
SEQ ID NO. 11	miR-CTLA4-7#	Seed Sequence	5’-CUCAUGU-3’
SEQ ID NO. 12	miR-CTLA4-8#	Seed Sequence	5’-GCAACGG-3’
SEQ ID NO. 13	miR-CTLA4-9#	Seed Sequence	5’-GGCAACG-3’
SEQ ID NO. 14	miR-CTLA4-10#	Seed Sequence	5’-GACUGUG-3’
SEQ ID NO. 15	miR-CTLA4-4#	miRNA + exo-motif	5’-CGACAUUCAC GGAGGAGAAUA-3’
SEQ ID NO. 16	miR-CTLA4-5#	miRNA + exo-motif	5’-GAACCUCACCCUCCAA GGACU-3’
SEQ ID NO. 17	miR-CTLA4-7#	miRNA + exo-motif	5’-ACUCAUGUACCCUC CGCCAUA-3’
SEQ ID NO. 18	miR-CTLA4-8#	miRNA + exo-motif	5’-GGCAACG GGAGGC GGAGUUAU-3’
SEQ ID NO. 19	miR-CTLA4-9#	miRNA + exo-motif	5’-GGGCAACG GGACGGAGAUUUA-3’
SEQ ID NO. 20	miR-CTLA4-10#	miRNA + exo-motif	5’-UGACUGUGCUGCGGC GGACAA-3’

Methods and Therapies

An aspect of the disclosure provides a method for treatment of tumor in a subject comprising administering to the subject in need thereof a therapeutically effective amount of an exosome carrying miRNA targeting CTLA4 of the invention and a therapeutically effective amount of an oncolytic virus.

An aspect of the disclosure provides a method for enhancing efficacy of an oncolytic virus therapy in a subject comprising administering to the subject in need thereof a therapeutically effective amount of an exosomes carrying miRNA targeting CTLA4 of the invention in addition to the oncolytic virus therapy.

In some embodiments, in the methods of the disclosure, the administering of the exosomes carrying miRNA targeting CTLA4 inhibitor and the oncolytic virus is carried out by administering to the subject a pharmaceutical composition comprising a therapeutically effective amount of the exosome carrying miRNA targeting CTLA4 and a therapeutically effective amount of an oncolytic virus, and a pharmaceutically acceptable carrier.

In some embodiments, in the methods of the disclosure, the administering of the exosomes carrying miRNA targeting CTLA4 and the oncolytic virus is carried out by administering to the subject the exosomes carrying miRNA targeting CTLA4 and the oncolytic virus separately. In some embodiments, the exosomes carrying miRNA targeting CTLA4 is administered before, simultaneously or after the administering of the oncolytic virus. In such instances, it is contemplated that one may administer the subject with both modalities within about 12 to 72 hrs of each other. In some situations, it may be desirable to extend the time period for treatment significantly, however, where several days (2, 3, 4, 5, 6 or 7) to several weeks (1, 2, 3, 4, 5, 6, 7 or 8) lapse between the respective administrations.

In some embodiments, the exosomes carrying miRNA targeting CTLA4 is administered simultaneously with the administering of the oncolytic virus. In some embodiments, the exosomes carrying miRNA targeting CTLA4 is administered in the form of a pharmaceutical composition comprising a therapeutically effective amount of the exosomes carrying miRNA targeting CTLA4 and a pharmaceutically acceptable carrier, and the oncolytic virus is administered in the form of a pharmaceutical composition comprising a therapeutically effective amount of oncolytic virus and a pharmaceutically acceptable carrier. In such embodiments, the pharmaceutical composition comprising a therapeutically effective amount of the exosomes carrying miRNA targeting CTLA4 and a pharmaceutically acceptable carrier, and the pharmaceutical composition comprising a therapeutically effective amount of oncolytic virus and a pharmaceutically acceptable carrier may be packaged in a single kit.

In certain embodiments, any of the pharmaceutical composition is administered parenterally or non-parenterally, e.g. intratumorally, intravenously, intramuscularly, percutaneously or intracutaneously.

In certain embodiments, the method of treating a tumor is to enhance the anti-tumor efficacy of oncolytic virus therapy, for example, in terms of inhibiting tumor growth, and/or reducing the volume of tumors. Thus, in some embodiments, the disclosure provides a method for treating a tumor comprising administering a therapeutically effective amount of the exosome as described above in combination with a therapeutically effective amount of an oncolytic virus to a subject in need thereof. In certain embodiments, the methods of treating a tumor prevent the onset, progression and/or recurrence of a symptom associated with a tumor. Thus, in some embodiments, a method for preventing a symptom associated with a tumor in a subject comprises administering a therapeutically effective amount of the exosome as described above and a therapeutically effective amount of an oncolytic virus to a subject in need thereof.

In some embodiments, the oncolytic viruses include type 1 herpes simplex viruses, type 2 herpes simplex viruses, vesicular stomatitis viruses, Newcastle disease viruses, vaccinia viruses, adenovirus, a rhabdovirus, a non-VSV rhabdovirus, reovirus, polio virus, mumps virus, measles virus, influenza virus, a mutant strain of any of these viruses, or a genetically engineered strain of any of these viruses. In some embodiments, the oncolytic virus is an HSV-1 oncolytic virus expressing IL-12.

The methods of the disclosure are contemplated to treat various tumors, especially solid tumors. Examples of solid tumors that can be treated according to the invention include but are not limited to sarcomas and carcinomas such as melanoma, fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteogenic sarcoma, chordoma, angiosarcoma, endotheliosarcoma, lymphangiosarcoma, lymphangioendotheliosarcoma, synovioma, mesothelioma, Ewing's tumor, leiomyosarcoma, rhabdomyosarcoma, colon carcinoma, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, sweat gland carcinoma, sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinomas, cystadenocarcinoma, medullary carcinoma, bronchogenic carcinoma, renal cell carcinoma, hepatoma, bile duct carcinoma, choriocarcinoma, seminoma, embryonal carcinoma, Wilms'tumor, cervical cancer, testicular tumor, lung carcinoma, small cell lung carcinoma, bladder carcinoma, epithelial carcinoma, glioma, astrocytoma, medulloblastoma, craniopharyngioma, ependymoma, pinealoma, hemangioblastoma, acoustic neuroma, oligodendroglioma, meningioma, neuroblastoma, retinoblastoma, gastric carcinoma and forestomach carcinoma.

Pharmaceutical Compositions and Kits

An aspect of the disclosure provides a pharmaceutical composition comprising a therapeutically effective amount of an exosome as described above, a therapeutically effective amount of an oncolytic virus and a pharmaceutically acceptable carrier. The pharmaceutical composition is useful for prophylaxis or treatment of a tumor in a subject. The pharmaceutical composition may be prepared in a suitable pharmaceutically acceptable carrier or excipient.

Another aspect of the disclosure provides a first pharmaceutical composition comprising a therapeutically effective amount of an exosome as described above and a pharmaceutically acceptable carrier. In addition, a second pharmaceutical composition is provided comprising a therapeutically effective amount of an oncolytic virus and a pharmaceutically acceptable carrier. In such aspect, a kit is provided to include the first pharmaceutical composition and the second pharmaceutical composition in a single package. The kit may further include a specification for use that a physician can refer during clinical use.

In some embodiments, the oncolytic viruses include any of type 1 herpes simplex viruses, type 2 herpes simplex viruses, vesicular stomatitis viruses, Newcastle disease viruses, vaccinia viruses, adenovirus, a rhabdovirus, a non-VSV rhabdovirus, reovirus, polio virus, mumps virus, measles virus, influenza virus, a mutant strain of any of these viruses, or a genetically engineered strain of any of these viruses. In some embodiments, the oncolytic virus is an HSV-1 oncolytic virus expressing IL-12.

Under ordinary conditions of storage and use, these preparations/compositions contain a preservative to prevent the growth of microorganisms. The pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. In all cases the form must be sterile and must be fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms, such as bacteria and fungi.

The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol, and the like) , suitable mixtures thereof, and/or vegetable oils. Proper fluidity may be maintained, for example, by the use of a coating, such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. The prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars, sodium chloride or phosphate buffered saline. Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin.

For parenteral administration in an aqueous solution, for example, the solution should be suitably buffered if necessary and the liquid diluent first rendered isotonic with sufficient saline or glucose. These particular aqueous solutions are especially suitable for intravenous, intramuscular, subcutaneous, intratumoral and intraperitoneal administration. In this connection, sterile aqueous media that can be employed will be known to those of skill in the art in light of the present disclosure. For example, one dosage may be dissolved in 1 mL of isotonic NaCI solution and either added to 1000 mL of hypodermoclysis fluid or injected at the proposed site of infusion, (see for example, "Remington's Pharmaceutical Sciences" 15th Edition, pages 1035-1038 and 1570-1580) . Some variation in dosage will necessarily occur depending on the condition of the subject being treated. The person responsible for administration will, in any event, determine the appropriate dose for the individual subject. Moreover, for human administration, preparations should meet sterility, pyrogenicity, general safety and purity standards as required by FDA.

Sterile injectable solutions are prepared by incorporating the active compounds in the required amount in the appropriate solvent with various other ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the various sterilized active ingredients into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum-drying and freeze-drying techniques which yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.

The compositions disclosed herein may be formulated in a neutral or salt form. Pharmaceutically acceptable salts include the acid addition salts (formed with the free amino groups of the protein) and which are formed with inorganic acids such as, for example, hydrochloric or phosphoric acids, or such organic acids as acetic, oxalic, tartaric, mandelic, and the like. Salts formed with the free carboxyl groups can also be derived from inorganic bases such as, for example, sodium, potassium, ammonium, calcium, or ferric hydroxides, and such organic bases as isopropylamine, trimethylamine, histidine, procaine and the like. Upon formulation, solutions will be administered in a manner compatible with the dosage formulation and in such amount as is therapeutically effective. The formulations are easily administered in a variety of dosage forms such as injectable solutions, drug release capsules and the like.

As used herein, "carrier" includes any and all solvents, dispersion media, vehicles, coatings, diluents, antibacterial and antifungal agents, isotonic and absorption delaying agents, buffers, carrier solutions, suspensions, colloids, and the like. The use of such media and agents for pharmaceutical active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active ingredient, its use in the therapeutic compositions is contemplated. Supplementary active ingredients can also be incorporated into the compositions.

The phrase "pharmaceutically acceptable" refers to molecular entities and compositions that do not produce an allergic or similar untoward reaction when administered to a human. The preparation of an aqueous composition that contains a protein as an active ingredient is well understood in the art. Typically, such compositions are prepared as injectables, either as liquid solutions or suspensions; solid forms suitable for solution in, or suspension in, liquid prior to injection can also be prepared.

Examples

In principle, enhancing anti-tumor efficacy can be done in only three ways, i.e. by the use of inhibitors of tumorous or cellular functions, by mutagenesis of the promoter regulating the expression of a key gene or by delivering to the tumors a miRNA targeting the mRNA encoding the gene product. In the studies described in this report the desired exosome payload was a miRNA.

miRNAs are potent tools that in principle can be used to control the replication of certain protein coding RNAs. The objectives were to design miRNAs that can block the replication of cytotoxic T-lymphocyte-associated protein 4 and which could be delivered to infected cells via exosomes. We designed 10 miRNAs targeting the mRNA encoding CTLA4. Of the 10 miRNAs, miR-CTLA4-1#, miR-CTLA4-2#, miR-CTLA4-3# and miR-CTLA4-6# effectively blocked CTLA4 accumulation on transfection into susceptible cells. To facilitate packaging of the miRNA into exosomes we incorporated into the sequence of miR-CTLA4-1#, miR-CTLA4-2#, miR-CTLA4-3# and miR-CTLA4-6# an exosome packaging motif. miR-CTLA4-3# was shown to be packaged into exosomes and successfully delivered by exosomes to susceptible cells where it remained stable for at least 72 hrs. Finally, the results show that miR-CTLA4-3# delivered to tumors via exosomes effectively reduced the expression of CTLA4. The protocol described in this report can be applied to study viral gene functions without actually deleting or mutagenizing the gene.

Incorporation of RNAs into exosomes is sequence dependent and facilitated by hnRNPA2B1, a component of exosomes. hnRNPA2B1 sorts into exosomes RNAs containing one of two known exosome-packaging motifs (EXO-motifs) . A key function of hnRNPA2B1 is to regulate mRNA trafficking to axons in neural cells that is mediated by binding a 21-nt RNA sequence called RNA trafficking sequence (RTS) . This sequence contains both of the EXO-motifs.

The Examples show that the anti-tumor efficacy of oncolytic virus can be enhanced and the volume of tumors can be reduced by delivering to the tumors via the composition comprising oncolytic virus and exosomes carrying a miRNA designed to target mRNA encoding CTLA4, a transmembrane protein expressed on the surface of activated T cells.

Materials and Methods

Cell lines. HEp-2 cells were obtained from the American Type Culture Collection and routinely cultured in DMEM (Life Technologies) supplemented with 5% (vol/vol) fetal bovine serum (FBS) . MFC (Murine Forestomach Carcinoma) cells were kindly provided by JOINN Laboratories, Inc. (Beijing, China) . B16 (Murine Melanoma) were kindly provided by Shenzhen International Institute for Biomedical Research (Shenzhen, China) .

Antibodies. Antibodies used in this study were anti-His-tag (Cat No. 66005-1-Ig, Proteintech Group) and anti-GAPDH (Cat No. #2118, Cell Signaling Technology) .

Plasmid Construction. Target miRNA sequences against mouse CTLA4 were designed using Life Technologies’BLOCK-iT ^TM RNAi Designer and synthesized by Ige Biotechnology (Guangzhou, China) . The synthesized miRNA fragments were digested with BamHI and XhoI restriction enzymes and cloned into the corresponding sites of pcDNA6.2-GW/EmGFP-miR-neg control plasmid (Invitrogen) . The sequences of miRNAs are as follows:

miR-CTLA4-1#:

5’- AACCTTCAGTGGAGTTGGCGAGTTTTGGCCACTGACTGACTcGCCAACCACTGAAGGTT-3’ (SEQ ID NO. 53) ;

miR-CTLA4-2#:

5’- CTTCAGTGGAGTTGGCGAGCAGTTTTGGCCACTGACTGACTGCTCGCCCtCCACTGAAG-3’ (SEQ ID NO. 54) ;

miR-CTLA4-3#:

5’- ACTGTGCTGCGGAGGACAAATGTTTTGGCCACTGACTGACATTTGTCCCGCAGCACAGT-3’ (SEQ ID NO. 55) ;

miR-CTLA4-4#:

5’- CGACATTCACGGAGGAGAATAGTTTTGGCCACTGACTGACTATTCTCCCGTGAATGTCG-3’ (SEQ ID NO. 56) ;

miR-CTLA4-5#:

5’- GAACCTCACCCTCCAAGGACTGTTTTGGCCACTGACTGACAGTCCTTGGGGTGAGGTTC-3’ (SEQ ID NO. 57) ;

miR-CTLA4-6#:

5’- ATCCAAGGACTGGGAGCTGTTGTTTTGGCCACTGACTGACAACAGCTCAGTCCTTGGAT-3’ (SEQ ID NO. 58) ;

miR-CTLA4-7#:

5’- ACTCATGTACCCTCCGCCATAGTTTTGGCCACTGACTGACTATGGCGGGGTACATGAGT-3’ (SEQ ID NO. 59) ;

miR-CTLA4-8#:

5’- GGCAACGGGAGGCGGAGTTATGTTTTGGCCACTGACTGACATAACTCCCTCCCGTTGCC-3’ (SEQ ID NO. 60) ;

miR-CTLA4-9#:

5’- GGGCAACGGGACGGAGATTTAGTTTTGGCCACTGACTGACTAAATCTCTCCCGTTGCCC-3’ (SEQ ID NO. 61) ;

miR-CTLA4-10#:

5’- TGACTGTGCTGCGGCGGACAAGTTTTGGCCACTGACTGACTTGTCCGCCAGCACAGTCA-3’ (SEQ ID NO. 62) ;

The underline indicates the mature miRNA sequence.

The His-tagged mouse CTLA4 expression plasmid (mCTLA4-his) was purchased from YouBio Biotechnology (Changsha, China) .

Exosome Isolation and Quantification. Cells seeded in T150 flask for 24 h were extensively rinsed with PBS and then incubated n serum free medium. After 18 h the cell-free extracellular medium was centrifuged at 2000g for 30 min. The supernatant fluid was harvested mixed with recommended dose of Total Exosome Isolation kit reagent (Thermo Fisher Cat No. 4478359) , stored overnight at 4℃ and then centrifuged for 1 h. The pelleted exosomes were then resuspended in 200 μl of PBS or were lysed in RIPA buffer and then quantified by a BCA assay using the Enhanced BCA Protein Assay Kit (Beyotime Biotechnology, China) according to manufacturer's instructions. Exosome protein content was determined by calibration against standard curve, which was prepared by plotting the absorbance at 562 nm versus bovine serum albumin standard concentration.

Exosome Isolation. Exosomes were purified by differential centrifugation processes. HEp-2 cells (5x106) were transfected with 10 μg of plasmids expressing miR-CTLA4. After 4 h incubation the cells were washed with PBS for three times to exclude potential contamination of exosome in serum, and the cells were cultured in fetal bovine serum (FBS) free medium for another 48 h. The supernatant medium was collected and spin at 300g for 10 min at 4 ℃ to remove nonadherent cells. Then the supernatant medium was centrifuge at 12,000g for 30 min at 4 ℃. Transfer the supernatants into a clean polycarbonate bottle for ultracentrifugation at 120,000g for 70 min at 4 ℃. The pelleted exosomes were then resuspended in 200 μl of PBS and then quantified by a BCA assay using the Enhanced BCA Protein Assay Kit (Beyotime Biotechnology, China) according to manufacturer's instructions. Exosome protein content was determined by calibration against standard curve, which was prepared by plotting the absorbance at 562 nm versus bovine serum albumin (BSA) standard concentration.

Quantitative Real Time-PCR for miRNA. Total RNAs from cells were isolated using TRIzol reagent (Thermo Fisher Scientific) according to the respective manufacturer’s instructions. The procedure was performed as described. The exosomal RNA was extracted using mirVanaTM miRNA Isolation kit (Thermo Fisher Cat. AM1561) according to manufacturer’s instructions. The miRNA tested were reverse-transcribed from 50 ng total RNA in duplicate by specific stem-loop primer as described in the TaqMan miRNA reverse transcription kit (Applied Biosystems, Inc. ) . The expression of miRNA was determined by real-time PCR using TaqMan Universal Master Mix II kit purchased from Applied Biosystems, Inc. miRNA copy number was normalized by comparison with cellular 18s rRNA. The primers of miR-CTLA4-3# were designed according to Chen et al. and synthesized by Ige Biotechnology. The sequences are as follows:

miR-CTLA4-3# stem loop primer,

5’-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACATTTGT-3’ (SEQ ID NO. 63) ;

forward primer, 5’-CCTGGACTGTGCTGCGGA-3’ (SEQ ID NO. 64) ;

reverse primer, 5’-CCAGTGCAGGGTCCGAGGTA-3’ (SEQ ID NO. 65) ;

probe, 5’- (6-FAM) CACTGGATACGACTCGCCA (MGB) -3’ (SEQ ID NO. 66) .

Immunoblot Assays. Cells were harvested and lysed with a RIPA lysis buffer (Beyotime) supplemented with 1 mM protease inhibitor phenylmethylsulfonyl fluoride (PMSF) (Beyotime) and phosphatase inhibitor (Beyotime) . Cell lysates were heat denatured, and separated by SDS-PAGE, transferred to polyvinylidene difluoride membranes (Millipore) . The proteins were detected by incubation with appropriate primary antibody, followed by horseradish peroxidase-conjugated secondary antibody (Pierce) and the ECL reagent (Pierce) and exposed to a film or images were captured using a ChemiDoc Touch Imaging System (Bio-Rad) and processed using ImageLab software. The densities of corresponding bands were quantified using ImageJ software.

Oncolytic virus construction. The construct of an exemplary oncolytic virus (herein after also referred to as T2850) involves deletion of inverted repeat region (IR) of herpes simplex virus type 1 strain F (HSV-1) for neurovirulence attenuation and insertion of exogenous gene coded for the active heterodimer (referred to as 'p70' ) of murine cytokine named Interlukin-12 (mIL-12) Heterodimeric mIL-12 p70 molecule consists IL-12 p40 and p35 subunit. The transcription of IL-12 is under the control of Egr-1 promoter and tailed with the hepatitis B virus poly A signal. Additionally, co-translation of the two subunits of IL-12 is directed by the Encephalomyocarditis virus (EMCV) internal ribosome entry site (IRES) residing between the two genes. A more detailed description of the construction and properties of the modified HSV-1 oncolytic virus is available from WO2017/181420.

Animal models. The syngeneic mice were 615 for MFC and C57BL/6 for B16 tumors. The tumors were generated by implantation of 1×10 ⁶ cells subcutaneously into mouse flanks. The mice bearing tumors averaging volumes around 80 mm ³ for MFC or 70 mm ³ for B16 were randomized and injected with phosphate buffered saline PBS +10%glycerol (w/v) (Control) or 1×10 ⁷ pfu of T2850 mixed with 10 μg exosome purified from non-target (miRNA-NT exo) or CLTA4 miRNA (miRNA-CTLA4 exo) plasmid transfected HEp-2 cell supernatant. Tumor volumes were measured every three days.

Results

Design and construction of a miRNA capable of suppressing the accumulation of CTLA4.

The objective of the first series of experiments was to design a miRNA targeting CTLA4, a transmembrane protein expressed on the surface of activated T cells. To this end we have constructed 10 miRNAs designated miR-CTLA4-1#, miR-CTLA4-2#, miR-CTLA4-3#, miR-CTLA4-4#, miR-CTLA4-5#, miR-CTLA4-6#, miR-CTLA4-7#, miR-CTLA4-8#, miR-CTLA4-9#and miR-CTLA4-10#. The sequence of each of the miRNAs shown in Figure 1 contains downstream of miRNA seed sequence additional sequences embodying exosome-packaging-associated motifs (exo-motifs) . As illustrated in Figure 1, the miRNAs were cloned downstream of an open reading frame encoding EGFP into a miRNA expression vector named “pcDNA6.2-GW/EmGFP-miR-neg control plasmid” as described in Materials and Methods.

To test the miRNAs HEp-2 cells were co-transfected with the miRNA expression vectors (miRmCTLA4-1#, miRmCTLA4-2#, miRmCTLA4-3#, miRmCTLA4-4#, miRmCTLA4-5#, miRmCTLA4-6#, miRmCTLA4-7#, miRmCTLA4-8#, miRmCTLA4-9#, miRmCTLA4-10#. ) described above and a plasmid encoding CTLA4 tagged at the C terminus with His (mCTLA4-His) . As shown in Figure 2, miR-CTLA4-3# was the most effective of the 10 constructs in suppressing the accumulation of CTLA4. The results show that the accumulation of CTLA4 is repressed by miR-CTLA4-3# at higher efficiency. miR-CTLA4-1#, miR-CTLA4-2#, miR-CTLA4-4#, miR-CTLA4-5#, miR-CTLA4-6# and miR-CTLA4-7# showed moderate effect, whereas the non-targeting (NT) , miR-CTLA4-8#, miR-CTLA4-9# and miR-CTLA4-10# plasmids had no effect on accumulation of CTLA4 (Figure 2) . Therefore, miR-CTLA4-1#, miR-CTLA4-2#, miR-CTLA4-3# and miR-CTLA4-6# were selected for further studies.

miR-CTLA4-3# delivered by exosome knockdown expression of transfected mCTLA4

In the first step of this series of experiments, replicate cultures each containing 5x10 ⁶ HEp-2 cells were transfected with 10 μg of selected plasmids expressing miR-CTLA4 (1#, 2#, 3# and 6#) . After 4h incubation the cells were washed with PBS for three times, and the cells were cultured in fetal bovine serum (FBS) free medium for another 48h. Then, exosomes produced in HEp-2 were purified as described in Materials and Methods.

The second step, cultures each containing 2.5x10 ⁵ HEp-2 cells were transfected with the plasmid of mCTLA4. After 24 hours, it was incubated with 10 μg of the first-purified exosomes. After 24 h of incubation the inoculum then was replaced with fresh medium. After another 48 h, the cells were harvested and the cells lysates were electrophoretically separated in a 10%denaturing gel, and reacted with indicated antibodies. The results show that miR-CTLA4-3# delivered by exosome knockdown expression of transfected mCTLA4, whereas the non-targeting (NT) , miR-CTLA4-1#, miR-CTLA4-2# and miR-CTLA4-6# delivered by exosome had no effect on expression of transfected mCTLA4, as shown in Figure 3. Therefore, miR-CTLA4-3# was selected for in vivo study.

Amounts of miR-CTLA4 is detected from the purified exosome

In this series of experiments, HEp-2 cells were transfected with 10 μg indicated plasmid encoding miRNA targeting CLTA4 (miR-CTLA4-3#) and cell pellet were harvested and exosome were purified at indicated times after transfection. Total RNAs were extracted separately from cell pellet and the purified exosome as described in Materials and Methods. miR-CTLA4 was quantified and normalized with respect to 18s rRNA using Real Time-PCR assay. The results indicate that the miR-CTLA4 present in purified exosomes and cell pellet, and the copy number of miR-CTLA4 in the purified exosomes were more than those obtained from the cell pellet (Figure 4) .

Composition comprising the exosome containing miR-CTLA4-3# and oncolytic virus inhibit the growth of tumors

In the first step of this series of experiments, replicate cultures of HEp-2 were transfected with the plasmid of exo-miR-CTLA4-3#, and the cells were cultured for 48h. Then, exo-miR-CTLA4-3# produced in HEp-2 were purified as described in Materials and Methods.

In the second step, oncolytic virus T2850 was constructed as described in Materials and Methods (Figure 5) . Then mouse forestomach carcinoma MFC or mouse melanoma B16 cells were injected subcutaneously in the right flanks of 615 or C57BL/6J mice for generating tumors, respectively. The mice bearing tumors averaging volumes around 80 mm ³ for MFC or 70 mm ³ for B16 were randomized into three groups and intratumoral single injected with 50 μl of phosphate buffered saline PBS with 10%glycerol (w/v) (Control, n=8) or 1×10 ⁷ pfu of T2850 mixed with 10 μg exosome purified from non-target (T2850+miRNA-NT exo) or CLTA4 miRNA (T2850+miRNA-CTLA4 exo) plasmid transfected HEp-2 cell supernatant.

Finally, Tumor volumes were measured every 3 days until 28 days after injection. In the experiments of mouse with forestomach carcinoma, the result shows that the tumor volume in Control, T2850+miRNA-NT exo and T2850+miRNA-CTLA4 exo increased gradually after injection, and the tumor volume of the mouse injected with T2850+miRNA-CTLA4 exo increased more slowly than that of the Control and T2850+miRNA-NT exo. After 28 days of injection, the tumor volume of the mouse injected with T2850+miRNA-CTLA4 exo was smaller than that of the Control and T2850+miRNA-NT exo (Figure 6A) . In the experiments of mouse with melanoma, mouse in the control group died 16 days after the injection. After 10 days of injection, the tumor volume of the mouse injected with T2850+miRNA-NT exo and T2850+miRNA-CTLA4 exo did not increase. Between 10 and 22 days after injection, the tumor volume of the mouse injected with T2850+miRNA-NT exo and T2850+miRNA-CTLA4 exo increased gradually, and the tumor volume of the mouse injected with T2850+miRNA-CTLA4 exo increased more slowly than that of the Control and T2850+miRNA-NT exo. After 22 days of injection, the tumor volume of the mouse injected with T2850+miRNA-NT exo increased rapidly, but the tumor volume of the mouse injected with T2850+miRNA-CTLA4 exo decreased gradually (Figure 6B) .

The results of this series of experiments shows that Composition comprising the exosome containing miR-CTLA4-3# and oncolytic virus enhances the anti-tumor efficacy of oncolytic virus and inhibits the growth of tumors.

The results show that miR-CTLA4-3# is packaged in exosomes and is readily delivered to susceptible cells. We have also shown that the miRNA delivered via exosomes persists in recipient cells for at least 72 h. Lastly, we have shown that composition comprising the exosome containing miR-CTLA4-3# and oncolytic virus enhances the anti-tumor efficacy of oncolytic virus and inhibits the growth of tumors. The results presented herein also show that miRNAs can be used to define the targeted gene function as well as block viral replication if the targeted gene plays an essential role in viral replication. In many instances it may obviate the cumbersome process of deleting the targeted gene to define its function.

It should be understood that although the present disclosure has been specifically disclosed by preferred embodiments and optional features, modification, improvement and variation of the disclosures embodied therein herein disclosed may be resorted to by those skilled in the art, and that such modifications, improvements and variations are considered to be within the scope of this disclosure. The materials, methods, and examples provided here are representative of preferred embodiments, are exemplary, and are not intended as limitations on the scope of the disclosure.

All publications, patent applications, patents, and other references mentioned herein are expressly incorporated by reference in their entirety, to the same extent as if each were incorporated by reference individually. In case of conflict, the present specification, including definitions, will control. The disclosures illustratively described herein may suitably be practiced in the absence of any element or elements, limitation or limitations, not specifically disclosed herein. Thus, for example, the terms “comprising, ” “including, ” containing, ” etc. shall be read expansively and without limitation. Additionally, the terms and expressions employed herein have been used as terms of description and not of limitation, and there is no intention in the use of such terms and expressions of excluding any equivalents of the features shown and described or portions thereof, but it is recognized that various modifications are possible within the scope of the disclosure claimed.

Claims

A pharmaceutical composition for treating a tumor in a subject comprises

a therapeutically effective amount of an exosome, and

a therapeutically effective amount of an oncolytic virus,

wherein the exosome comprising an inhibitory amount of CTLA4-targeting miRNA and an exo-motif operably linked to a seed sequence of the CTLA4-targeting miRNA to enhance the packaging of the CTLA4-targeting miRNA into the exosome.
The composition of claim 1, wherein the seed sequence of the CTLA4-targeting miRNA contains any one of the nucleic acid sequences of SEQ ID NO. 1 to SEQ ID NO. 4.
The composition of claim 1, wherein the exo-motif is selected from a group consisting of nucleic acid sequence of SEQ ID NO. 21 to SEQ ID NO. 49.
The composition of claim 1, wherein the exo-motif is located downstream and linked to the seed sequence of the CTLA4-targeting miRNA covalently.
The composition of claim 1, wherein the exo-motif is obtained by mutation of one or more nucleic acids of the CTLA4 targeting miRNA except for the seed sequence.
The composition of claim 1, wherein the exo-motif is a two-fold motif generated through combination of two single exo-motifs, wherein any of the two single exo-motifs is selected from a group consisting of nucleic acid sequence of SEQ ID NO. 21 to SEQ ID NO. 47.
The composition of claim 6, wherein the two-fold motif has a nucleic acid sequence of SEQ ID NO. 48.
The composition of claim 1, wherein CTLA4-targeting miRNA and the exo-motif, when operably linked, share at least one nucleotide or two nucleotides or connect through a linker.
The composition of claim 8, wherein the linker consists of two or more nucleotides selected from a group consisting of Adenine (A) , Guanine (G) , Cytosine (C) , Thymine (T) and Uracil (U) .
The composition of claim 9, wherein the linker is -GC-.
The composition of claim 1, wherein the CTLA4-targeting miRNA and the exo-motif, when operably linked, has a nucleic acid sequence of SEQ ID NO. 7.
The composition of claim 1, wherein the oncolytic virus is selected from type 1 herpes simplex viruses, type 2 herpes simplex viruses, vesicular stomatitis viruses, Newcastle disease viruses, vaccinia viruses, adenovirus, a rhabdovirus, a non-VSV rhabdovirus, reovirus, polio virus, mumps virus, measles virus, influenza virus, a mutant strain of any of these viruses, or a genetically engineered strain of any of these viruses.
The composition of claim 1, wherein the tumor is a malignant tumor.
The composition of claim 14, wherein the malignant tumor is selected from a group consisting of melanoma, fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteogenic sarcoma, chordoma, angiosarcoma, endotheliosarcoma, lymphangiosarcoma, lymphangioendotheliosarcoma, synovioma, mesothelioma, Ewing's tumor, leiomyosarcoma, rhabdomyosarcoma, colon carcinoma, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, sweat gland carcinoma, sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinomas, cystadenocarcinoma, medullary carcinoma, bronchogenic carcinoma, renal cell carcinoma, hepatoma, bile duct carcinoma, choriocarcinoma, seminoma, embryonal carcinoma, Wilms'tumor, cervical cancer, testicular tumor, lung carcinoma, small cell lung carcinoma, bladder carcinoma, epithelial carcinoma, glioma, astrocytoma, medulloblastoma, craniopharyngioma, ependymoma, pinealoma, hemangioblastoma, acoustic neuroma, oligodendroglioma, meningioma, neuroblastoma, retinoblastoma, gastric carcinoma and forestomach carcinoma..
The composition of claim 1, wherein the subject is human.
A kit for treating a tumor in a subject comprising:

(a) a therapeutically effective amount of an exosome, wherein the exosome comprising an inhibitory amount of CTLA4-targeting miRNA and an exo-motif operably linked to the seed sequence of the CTLA4-targeting miRNA to enhance the packaging of the CTLA4-targeting miRNA into the exosome,

(b) a therapeutically effective amount of an oncolytic virus, and optionally

(c) instructions for use.
The kit of claim 16, wherein the seed sequence of the CTLA4-targeting miRNA contains any one of the nucleic acid sequences of SEQ ID NO. 1 to SEQ ID NO. 4.
The kit of claim 16, wherein the exo-motif is selected from a group consisting of nucleic acid sequence of SEQ ID NO. 21 to SEQ ID NO. 49.
The kit of claim 16, wherein the exo-motif is located downstream and linked to the seed sequence of the CTLA4-targeting miRNA covalently.
The kit of claim 16, wherein the exo-motif is obtained by mutation of one or more nucleic acids of the CTLA4 targeting miRNA except for the seed sequence.
The kit of claim 16, wherein the exo-motif is a two-fold motif generated through combination of two single exo-motifs, wherein any of the two single exo-motifs is selected from a group consisting of nucleic acid sequence of SEQ ID NO. 21 to SEQ ID NO. 47.
The kit of claim 21, wherein the two-fold motif has a nucleic acid sequence of SEQ ID NO. 48.
The kit of claim 16, wherein CTLA4-targeting miRNA and the exo-motif, when operably linked, share at least one nucleotide or two nucleotides or connect through a linker.
The kit of claim 23, wherein the linker consists of two or more nucleotides selected from a group consisting of Adenine (A) , Guanine (G) , Cytosine (C) , Thymine (T) and Uracil (U) .
The kit of claim 24, wherein the linker is -GC-.
The kit of claim 16, wherein the CTLA4-targeting miRNA and the exo-motif, when operably linked, has a nucleic acid sequence of SEQ ID NO. 7.
The kit of claim 16, wherein the oncolytic virus is selected from type 1 herpes simplex viruses, type 2 herpes simplex viruses, vesicular stomatitis viruses, Newcastle disease viruses, vaccinia viruses, adenovirus, a rhabdovirus, a non-VSV rhabdovirus, reovirus, polio virus, mumps virus, measles virus, influenza virus, a mutant strain of any of these viruses, or a genetically engineered strain of any of these viruses.
The kit of claim 16, wherein the tumor is a malignant tumor.
The kit of claim 28, wherein the malignant tumor is selected from a group consisting of melanoma, fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteogenic sarcoma, chordoma, angiosarcoma, endotheliosarcoma, lymphangiosarcoma, lymphangioendotheliosarcoma, synovioma, mesothelioma, Ewing's tumor, leiomyosarcoma, rhabdomyosarcoma, colon carcinoma, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, sweat gland carcinoma, sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinomas, cystadenocarcinoma, medullary carcinoma, bronchogenic carcinoma, renal cell carcinoma, hepatoma, bile duct carcinoma, choriocarcinoma, seminoma, embryonal carcinoma, Wilms'tumor, cervical cancer, testicular tumor, lung carcinoma, small cell lung carcinoma, bladder carcinoma, epithelial carcinoma, glioma, astrocytoma, medulloblastoma, craniopharyngioma, ependymoma, pinealoma, hemangioblastoma, acoustic neuroma, oligodendroglioma, meningioma, neuroblastoma, retinoblastoma, gastric carcinoma and forestomach carcinoma.
The kit of claim 16, wherein the subject is human.
An exosome comprising an inhibitory amount of CTLA4-targeting miRNA and an exo-motif operably linked to the seed sequence of the CTLA4-targeting miRNA to enhance the packaging of the CTLA4-targeting miRNA into the exosome.
The exosome of claim 31, wherein the seed sequence of the CTLA4-targeting miRNA contains any one of the nucleic acid sequences of SEQ ID NO. 1 to SEQ ID NO. 4.
The exosome of claim 31 wherein the exo-motif is selected from a group consisting of nucleic acid sequence of SEQ ID NO. 21 to SEQ ID NO. 49.
The exosome of claim 31 wherein the exo-motif is located downstream and linked to the seed sequence of the CTLA4-targeting miRNA covalently.
The exosome of claim 31, wherein the exo-motif is obtained by mutation of one or more nucleic acids of the CTLA4 targeting miRNA except for the seed sequence.
The exosome of claim 31, wherein the exo-motif is a two-fold motif generated through combination of two single exo-motifs, wherein any of the two single exo-motifs is selected from a group consisting of nucleic acid sequence of SEQ ID NO. 21 to SEQ ID NO. 47.
The exosome of claim 36, wherein the two-fold motif has a nucleic acid sequence of SEQ ID NO. 48.
The exosome of claim 31, wherein CTLA4-targeting miRNA and the exo-motif, when operably linked, share at least one nucleotide or two nucleotides or connect through a linker.
The exosome of claim 38, wherein the linker consists of two or more nucleotides selected from a group consisting of Adenine (A) , Guanine (G) , Cytosine (C) , Thymine (T) and Uracil (U) .
The exosome of claim 39, wherein the linker is -GC-.
The exosome of claim 31, wherein the CTLA4-targeting miRNA and the exo-motif, when operably linked, has a nucleic acid sequence of SEQ ID NO. 7.