WO2024051765A1

WO2024051765A1 - T cell with silenced cd59 gene and use thereof

Info

Publication number: WO2024051765A1
Application number: PCT/CN2023/117395
Authority: WO
Inventors: 李录英
Original assignee: 上海康景生物医药科技有限公司
Priority date: 2022-09-08
Filing date: 2023-09-07
Publication date: 2024-03-14

Abstract

Provided is a method for promoting T cell proliferation and function by means of intracellular CD59, comprising silencing a CD59 gene in a T cell. Further provided is a nucleic acid molecule for CD59 gene interference. The target sequence in the CD59 gene is represented by SEQ ID NO: 1. Gene editing is carried out by means of shRNA, siRNA or CRISPR-Cas9 technology, and sgRNA specifically targeting the CD59 gene is used for silencing the expression of human CD59 gene. The constructed lentiviral vector realizes heritable silencing of the CD59 gene in the T cell, and the expression level of CD59 in the edited T cell is significantly reduced, resulting in a marked acceleration of cell proliferation and a marked increase in cytokine release, thereby markedly enhancing the function, and providing a new strategy for the treatment of tumors and immune diseases.

Description

A CD59 gene-silenced T cell and its application

Technical field

The present application relates to the field of biomedicine, specifically to a method for promoting T cell proliferation and function, a CD59 gene-silencing T cell, and an inhibitor capable of silencing the CD59 gene in T cells.

Background technique

The complement system is an important component of innate immunity and an important regulator of acquired immunity. It is an important bridge between innate immunity and adaptive immunity. CD59 is an important complement membrane regulatory protein. It is anchored to the cell membrane through glycosylphosphatidylinositol (GPI). Its molecular weight is 18-20kDa. It can bind to complement C8 and C9 to prevent the membrane attack complex (Membrane Attack Complex, The formation of MAC) inhibits complement activation at the final stage of the complement cascade. Humans have one gene encoding CD59, while mice have two genes: mCd59a and mCd59b. They have similar functions but different tissue expression localizations. The homology of mCd59a and mCd59b at the nucleotide and amino acid levels is 85% and 63% respectively. mCd59a is highly expressed in a variety of tissues including heart, kidney and lung, while mCd59b is mainly expressed in mouse testis. , mCd59a is considered the mouse homolog of human CD59. CD59 is widely expressed on normal cell membranes in the body and plays an important role in protecting self-tissues from complement attack. However, studies have found that CD59 is abnormally highly expressed in tumor cells and can help tumor cells escape complement attack. Currently, in terms of potential treatments targeting CD59, in complement-dependent cytotoxicity (CDC)-resistant lymphoma cell lines, the recombinant inhibitor rILYd4 is used to inhibit CD59, and combined with rituximab in vitro Combined application with the body shows synergistic effect. Another study reported that neutralizing CD59 with specific antibodies can enhance the anti-tumor effect of anti-tumor drugs, and bispecific antibodies that simultaneously recognize CD59 and CD20 can improve the effect of antibody immunotherapy for chronic lymphocytic leukemia. In addition to complement-related functions, CD59 also exerts complement-independent functions. It has been reported that CD59 is associated with T cell immune responses through its membrane-bound form. Cross-linking of CD59 with its specific antibody can activate intracellular calcium ion flow, and PMA treatment can promote T cell proliferation and IL-2 production. Immune responses were significantly enhanced in mCd59a-deleted virus-specific mouse CD4 ⁺ T cells, which was independent of complement activation and required the presence of APC, suggesting that unknown ligands expressed on the surface of APC interact with CD59 on CD4 ⁺ T cells Binding, thereby negatively regulating T cells. The above studies mainly focus on CD59 expressed on the cell membrane surface, while there are few studies on intracellular CD59.

Existing technology shows that gene editing of T cells provides new means for treating cancer and autoimmune diseases. Design shRNA, siRNA or sgRNA targeting CD59, use gene silencing technology to down-regulate the expression level of CD59, promote T cell proliferation and enhance T cell function by enhancing Ras signaling, providing useful ideas for improving immunotherapy. This technology is used as The mechanism targets CD59 in cells rather than on the cell membrane.

Contents of the invention

This application provides a method for modifying T cells, reagents for modifying T cells, engineered T cells and their applications. The methods and engineered T cells described in this application have one or more uses selected from the following group: (1) preparing tumor treatment drugs; (2) improving the ability of T cells to secrete cytokines; (3) improving T Cell killing efficiency; (4) Increase T cell expansion fold; (5) Prolong T cell survival time.

The expression of CD59 in the engineered T cells described in this application is significantly reduced, and its immunological function is significantly enhanced, which provides new methods and ideas for the treatment of tumors and immune diseases.

In one aspect, the present application provides a method of promoting T cell proliferation, which includes inhibiting the expression, function and/or activity of CD59 molecules in T cells.

In another aspect, the present application provides a method of promoting cytokine secretion in T cells, which includes inhibiting the expression, function and/or activity of CD59 molecules in T cells.

In certain embodiments, the CD59 molecule is an intracellular CD59 molecule.

In certain embodiments, the method includes administering a CD59 inhibitor to T cells.

In certain embodiments, the method includes knocking down/silencing the CD59 gene of a T cell.

In certain embodiments, the CD59 inhibitors include nucleic acid molecules, proteins, small molecule compounds, and/or PROTAC technology.

In certain embodiments, the CD59 inhibitor includes a nucleic acid molecule targeting the CD59 gene.

In certain embodiments, the CD59 inhibitor is a single-stranded nucleic acid molecule or a double-stranded nucleic acid molecule.

In certain embodiments, the nucleic acid molecules targeting the CD59 gene include shRNA, siRNA and/or sgRNA.

In certain embodiments, the CD59 inhibitor targets a target sequence of the CD59 gene in T cells, and the target sequence of the CD59 gene is set forth in SEQ ID NO: 1.

In certain embodiments, the siRNA includes the sequence shown in any one of SEQ ID NOs: 28-32 or a sequence that differs from it by no more than 3 nucleotides.

In certain embodiments, the siRNA includes one or more modified nucleotides.

In certain embodiments, the shRNA includes a sense strand fragment and an antisense strand fragment, and a stem-loop structure connecting the sense strand fragment and the antisense strand fragment, the sense strand fragment and the antisense strand Fragments contain complementary regions.

In certain embodiments, the sense strand of the shRNA includes the nucleotide sequence shown in any one of SEQ ID NOs: 3-7 or a sequence that differs from it by no more than 3 nucleotides.

In certain embodiments, the antisense strand of the shRNA comprises a nucleoside shown in any one of SEQ ID NOs: 9-13 acid sequence or a sequence that differs from it by no more than 3 nucleotides.

In certain embodiments, the sense strand and/or antisense strand of the shRNA independently comprise one or more modified nucleotides.

In certain embodiments, the method includes editing the target gene using a CRISPR/Cas system.

In certain embodiments, the nucleic acid molecule comprises sgRNA.

In certain embodiments, the sgRNA comprises the nucleotide sequence set forth in any one of SEQ ID NOs: 33-44.

On the other hand, the present application provides a CD59 inhibitor capable of inhibiting the function and/or activity of CD59 molecules in T cells. The CD59 inhibitor targets the target sequence of the CD59 gene in T cells. The CD59 gene The target sequence is shown in SEQ ID NO:1.

In certain embodiments, the CD59 inhibitor targets the target sequence in the region of nucleotides 82-165 in SEQ ID NO: 1.

In certain embodiments, the CD59 inhibitor targets the target sequence in the region of nucleotides 248-294 in SEQ ID NO: 1.

In certain embodiments, the CD59 inhibitor targets the target sequence in the region of nucleotides 248-269 in SEQ ID NO: 1.

In certain embodiments, the CD59 inhibitor includes a nucleic acid molecule capable of knocking down/silencing the CD59 gene.

In certain embodiments, the CD59 inhibitor includes shRNA, siRNA, and/or sgRNA.

In certain embodiments, the shRNA, siRNA and/or sgRNA is identical or complementary to any contiguous fragment of 16-35 nucleotides in length in the sequence shown in SEQ ID NO: 1.

In certain embodiments, the siRNA includes one or more modified nucleotides.

In certain embodiments, the shRNA comprises the nucleotide sequence shown in any one of SEQ ID NOs: 3-7, 9-13, and 16-27.

In certain embodiments, the modification includes chemical modification.

In certain embodiments, the stem loop of the shRNA includes the nucleotide sequence represented by any one of CTCGAG or GAGCTC.

In certain embodiments, the CD59 inhibitor includes an expression vector for the shRNA, siRNA and/or sgRNA.

In certain embodiments, the expression vector includes a viral vector.

In certain embodiments, the viral vectors include lentiviral vectors, retroviral vectors, or adeno-associated viral vectors.

In certain embodiments, the preparation of the shRNA expression vector includes the following steps:

(1) Design the shRNA according to the CD59 gene shown in SEQ ID NO:1;

(2) Insert the shRNA into the expression vector.

In certain embodiments, the shRNA is inserted into the XhoI and Agel restriction sites of the expression vector.

In certain embodiments, the CD59 inhibitor includes recombinant lentivirus, which is prepared by co-transfecting mammalian cells with the expression vector and packaging helper plasmid.

In certain embodiments, the CD59 inhibitor includes a host cell transfected with at least one CD59 inhibitor described herein.

On the other hand, the present application provides a method of inhibiting the expression, function and/or activity of CD59 molecules in T cells, which includes: contacting the T cells with the CD59 inhibitor.

On the other hand, the present application provides a method for silencing the CD59 gene in T cells, which includes contacting the T cells with the CD59 inhibitor.

In another aspect, the present application provides an engineered T cell that has reduced expression, function and/or activity of CD59 molecules compared to non-engineered T cells.

In certain embodiments, the CD59 gene of the engineered T cells is knocked down or silenced.

In certain embodiments, the engineering means include targeting CD59 via antisense RNA, antagomir, siRNA, shRNA, meganucleases, zinc finger nucleases, transcription activator-like effector nucleases, and/or CRISPR systems Target sequences in the gene silence the CD59 gene in the T cells.

In certain embodiments, the CD59 gene of the T cells can be silenced using the CRISPR/Cas9 system.

In certain embodiments, the CRISPR/Cas9 system includes sgRNA.

In certain embodiments, the sgRNA targets a target sequence in the CD59 gene, and the target sequence in the CD59 gene is set forth in SEQ ID NO: 1.

In certain embodiments, the sgRNA is identical or complementary to any contiguous fragment of 16-35 nucleotides in length in the sequence shown in SEQ ID NO: 1.

In certain embodiments, the siRNA comprises the nucleotide sequence set forth in any one of SEQ ID NOs: 28-32.

In certain embodiments, the shRNA includes a sense strand and an antisense strand, and a stem-loop structure connecting the sense strand fragment and the antisense strand fragment, and the sense strand fragment and the antisense strand fragment contain Complementary area.

In certain embodiments, the sense strand of the shRNA includes the nucleotide sequence shown in any one of SEQ ID NOs: 3-7.

In certain embodiments, the antisense strand of the shRNA includes the nucleotide sequence shown in any one of SEQ ID NOs: 9-13.

In certain embodiments, the stem-loop structure of the shRNA includes the nucleotide sequence represented by any one of CTCGAG or GAGCTC.

In certain embodiments, the engineered cells have one or more of the following properties:

(1) Compared with unengineered T cells, the ability to secrete cytokines is enhanced;

(2) Compared with unengineered T cells, tumor cell killing efficiency is enhanced;

(3) Enhanced expansion capacity compared with unengineered T cells; and

(4) Compared with unengineered T cells, the survival time in the body is enhanced.

On the other hand, the present application also provides a pharmaceutical composition comprising the CD59 inhibitor, and/or the engineered cells, and optionally a pharmaceutically acceptable carrier.

On the other hand, the application also provides the use of the CD59 inhibitor, the engineered cells, and/or the pharmaceutical composition in the preparation of medicines for preventing and/or treating diseases and/or disease.

In certain embodiments, the disease and/or disorder includes a tumor.

In certain embodiments, the disease and/or disorder includes an immunodeficiency disorder.

Those skilled in the art will readily appreciate other aspects and advantages of the present application from the detailed description below. Only exemplary embodiments of the present application are shown and described in the following detailed description. As those skilled in the art will realize, the contents of this application enable those skilled in the art to make changes to the specific embodiments disclosed without departing from the spirit and scope of the invention covered by this application. Accordingly, the descriptions in the drawings and description of this application are only exemplary and not limiting. compulsory.

Description of the drawings

The specific features of the invention to which this application relates are set forth in the appended claims. The features and advantages of the invention to which this application relates can be better understood by reference to the exemplary embodiments described in detail below and the accompanying drawings. A brief description of the drawings is as follows:

Figures 1A-1D show the tumor size in the subcutaneous tumor-bearing model of WT/mCd59ab-KO mice;

Figures 2A-2C show the liver metastasis of tumor cells in the spleen liver metastasis model of WT/mCd59ab-KO mice;

Figures 3A-3B show the detection of T cells in the subcutaneous tumor-bearing model of lung cancer cells in WT/mCd59ab-KO mice;

Figures 4A-4C show that T cells mediate anti-tumor immunity in mCd59ab-KO mice;

Figures 5A-5N show that in mouse primary T cells, mCd59ab knockout can enhance T cell activation, cytokine release and cell proliferation;

Figure 6 shows the pLKO.1-shRNA vector map and polyclonal restriction enzyme sites;

Figures 7A-7D show the detection of CD59 expression in Jurkat T cells and human peripheral blood T cells transfected with pLKO.1-shCD59;

Figures 8A-8D show the detection of the expression of activation marker CD69 and cytokines in Jurkat T cells and human peripheral blood T cells transfected with pLKO.1-shCD59;

Figures 9A-9E show the interaction between CD59 and Ras in Jurkat cells. Knocking down CD59 can affect the localization of Ras in the Golgi apparatus;

Figure 10A-10C shows Western Blot or flow cytometry detection of MAPK signaling pathway activation in Jurkat T cells and human peripheral blood T cells transfected with pLKO.1-shCD59;

Figure 11 shows a pattern diagram of CD59 negative regulatory T cells;

ns represents no significant difference, *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001.

Detailed ways

The implementation of the invention of the present application will be described below with specific examples. Those familiar with this technology can easily understand other advantages and effects of the invention of the present application from the content disclosed in this specification.

Definition of Terms

In this application, the term "T cell" generally refers to thymus-derived cells. T cells can participate in various cell-mediated immune responses. Including thymocytes, initial T lymphocytes, immature T lymphocytes, mature T lymphocytes, static resting T lymphocytes or activated T lymphocytes. T cell populations may include, but are not limited to, helper T cells (HTL; CD4+ T cells), cytotoxic T cells (CTL; CD8+ T cells), CD4+CD8+ T cells, CD4-CD8- T cells, or T cells any other subgroup of.

In this application, the "sequence" should be understood to include a sequence that is substantially the same as the sequence in this application. The term "substantially the same sequence" means that after optimal alignment, such as using the GAP or BESTFIT program. The default gap value determines the difference between two sequences with at least 80%, 83%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity, and have the same or similar function, or are derived from the deletion, substitution or addition of one or several amino acids/nucleotides to the described sequence Protein/nucleotide sequences with the same or similar functions.

In this application, the term "gene knockdown" generally refers to a technology that uses small RNA to efficiently and specifically bind and degrade mRNA containing homologous sequences to small RNA in cells, thereby blocking the expression of target genes in cells. After the mRNA is degraded, the cells exhibit a phenotype of target gene loss.

In this application, the term "interfering RNA" may generally include shRNA and siRNA, both of which can reduce protein expression at the RNA level. shRNA and siRNA cause the target gene mRNA to decrease through a similar mechanism. The difference between the two is that siRNA can directly target the target gene without processing, while shRNA contains a neck-loop structure. After being expressed in the nucleus, it is processed and transported to the cytoplasm by intracellular proteins. . In the cytoplasm, shRNA combines with Dicer to remove the circular sequence, then combines with RISC and removes one of the RNA strands, and finally recognizes the target gene mRNA, leading to the degradation of the mRNA.

In this application, the terms "nucleic acid" and "polynucleotide" are used interchangeably and refer to a polymeric form of nucleotides (deoxyribonucleotides or ribonucleotides or analogs thereof) of any length. Polynucleotides can have any three-dimensional structure and can perform any function. The following are non-limiting examples of polynucleotides: genes or gene fragments (e.g. probes, primers, EST or SAGE tags), exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, nuclear Enzymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, siRNA, miRNA, shRNA, RNAi reagents and primers. Polynucleotides may be modified or substituted at one or more bases, sugars, and/or phosphates with any of the various modifications or substitutions described herein or known in the art. Polynucleotides may contain modified nucleotides, such as methylated nucleotides and nucleotide analogs. If present, modifications to the nucleotide structure can be made before or after polymer assembly. Nucleotide sequences can be blocked by non-nucleotide components. The polynucleotide can be modified after polymerization, for example by coupling with a labeling component. The term can refer to double-stranded and single-stranded molecules. Unless otherwise stated or required, any embodiment herein as a polynucleotide includes the double-stranded form and each of the two complementary single-stranded forms known or predicted to constitute the double-stranded form.

In this application, the term "modified nucleoside" generally means a nucleoside that contains at least A modified nucleoside. For example, the modification may include chemical modification. Modified nucleosides contain modified sugar moieties and/or modified nucleobases.

In this application, the term "nucleobase" generally means heterocyclic pyrimidine or purine compounds, which are components of all nucleic acids and include adenine (A), guanine (G), cytosine (C), thymine (T) and uracil (U). Nucleotides may include modified nucleotides or nucleotide mimetics, abasic sites (Ab or X), or surrogate replacement moieties. As used herein, "nucleobase sequence" generally means a sequence of contiguous nucleobases that is independent of any sugar, linkage, or nucleobase modification. The term "unmodified nucleobase" or "naturally occurring nucleobase" generally means the naturally occurring heterocyclic nucleobases of RNA or DNA: the purine bases adenine (A) and guanine (G); and The pyrimidine bases are thymine (T), cytosine (C) (including 5-methylC), and uracil (U). "Modified nucleobase" generally means any nucleobase that is not a naturally occurring nucleobase.

In this application, the term "sugar moiety" generally means the naturally occurring sugar moiety or a modified sugar moiety of a nucleoside. The term "naturally occurring sugar moiety" generally means a ribofuranosyl group as found in naturally occurring RNA or a deoxyribofuranosyl group as found in naturally occurring DNA. "Modified sugar moiety" means a substituted sugar moiety or sugar substitute.

In this application, the term "antisense strand" generally refers to the strand of an RNAi agent (eg, shRNA) that includes a region that is substantially complementary to the target sequence. As used herein, the term "region of complementarity" generally refers to a region on the antisense strand that is substantially complementary to a sequence as defined herein (eg, a target sequence). When the region of complementarity is not completely complementary to the target sequence, the mismatch can be in the internal or terminal regions of the molecule. Typically, the most tolerated mismatches are in the terminal region, e.g., within 5, 4, 3 or 2 nucleotides of the 5' end and/or the 3' end.

In this application, the term "sense strand" (S) generally refers to a strand of an RNAi agent that includes a region that is substantially complementary to a region that is the antisense strand as the term is defined herein. The "just" chain may also be called the "meaningful" chain, the "passenger chain" or the "counter-leading" chain.

In this application, the term "complementary" generally refers to the ability of two oligonucleotide strands to form base pairs with each other. Base pairs are typically formed by hydrogen bonds between nucleotides in antiparallel oligonucleotide chains. Complementary oligonucleotide strands may be base paired in a Watson-Crick manner (e.g., A-T, A-U, C-G), or in any other manner that allows for duplex formation (e.g., Hoogsteen-type or reverse Hoogsteen-type base pairing). base pairing.

In this application, "complementary" includes both perfect complementarity and imperfect complementarity. Complete complementarity or 100% complementarity means that every nucleotide from the first oligonucleotide strand in the double-stranded region of the double-stranded oligonucleotide molecule can be matched with a nucleoside at the corresponding position in the second oligonucleotide strand. Acids form hydrogen bonds without "mismatching". Incomplete complementarity refers to a situation where not all of the nucleotide units of the two strands are hydrogen-bonded to each other. For example, for two oligonucleotide chains with double-stranded regions of 20 nucleotides in length, if only two base pairs on each strand can hydrogen bond to each other, the oligonucleotide chains exhibit 10% complementarity. In the same example, an oligonucleotide chain exhibits 90% complementarity if the 18 base pairs on each strand can hydrogen bond to each other. Substantial complementarity means at least about 75%, about 79%, about 80%, about 85%, about 90%, about 95% or 99% complementarity.

The term "target gene" or "target sequence" as used herein may be a nucleic acid sequence naturally occurring in an organism, a transgene, a viral or bacterial sequence, chromosomal or extrachromosomal and/or transiently or stably transfected or incorporated into a cell and /or its chromatin. The target gene can be a protein-coding gene or a non-protein-coding gene (such as a microRNA gene, a long non-coding RNA gene).

In this application, the terms "inhibit", "enhance", "elevate", "increase", "decrease", "decrease", etc. generally denote a quantitative difference between two states. The terms apply, for example, to expression level and activity level. The terms "reduce" and "lower" are used interchangeably and generally mean any change that is less than the original. "Reduced" and "lowered" are relative terms that require comparison between before and after measurement. "Reduce" and "lower" include complete depletion or elimination.

As used herein, the term "expression vector" generally refers to a vector carrying a nucleic acid molecule of the present application. In this application, the expression vector may include any vector type in the art. For example, the expression vector may include a viral vector. For example, the expression vector may include a lentiviral vector.

As used herein, the term "pharmaceutically acceptable" generally refers to one or more nontoxic substances that do not interfere with the effectiveness of the biological activity of the active ingredient. Such formulations may generally contain salts, excipients, buffers, preservatives, compatible carriers, and optionally other therapeutic agents. Such pharmaceutically acceptable preparations will generally also contain compatible solid or liquid fillers, diluents or encapsulating materials suitable for administration to humans. When used in medicine, the salt should be a pharmaceutically acceptable salt, but non-pharmaceutically acceptable salts can be conveniently used to prepare pharmaceutically acceptable salts, and they cannot be excluded from the scope of this application. Such pharmacologically and pharmaceutically acceptable salts include, but are not limited to, salts prepared from the following acids: hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, maleic acid, acetic acid, salicylic acid, citric acid, boric acid , formic acid, malonic acid, succinic acid, etc. Pharmaceutically acceptable salts may also be prepared as alkali metal salts or alkaline earth metal salts, such as sodium, potassium or calcium salts.

In this application, the term "prevention and/or treatment" includes not only the prevention and/or treatment of a disease, but also generally includes preventing the onset of a disease, slowing or reversing the progression of a disease, preventing or slowing one or more symptoms associated with a disease the onset of, reduce and/or alleviate one or more symptoms associated with the disease, reduce the severity and/or duration of the disease and/or any symptoms associated therewith and/or prevent the disease and/or any symptoms associated therewith further increase in severity, prevention, reduction or reversal of any physiological impairment caused by the disease, and any pharmacological effects generally beneficial to the patient being treated. It is not necessary for CD59 inhibitors or pharmaceutical compositions of the present application to be viable therapeutic agents to achieve complete cure or eradication of any symptoms or manifestations of the disease. As recognized in the related art, drugs used as therapeutic agents reduce the severity of a given disease state but do not need to eliminate every manifestation of the disease to be considered a useful therapeutic agent. Similarly, a prophylactically administered treatment need not be completely effective in preventing the onset of the disorder to constitute a viable prophylactic agent. Simply reduce the effects of a disease in a subject (for example, by reducing the number or severity of his or her symptoms, or by increasing the effectiveness of another treatment, or by producing another beneficial effect It is sufficient to reduce the likelihood of occurrence or progression of the disease.

In this application, the terms "disease" or "disorder" are used interchangeably and generally refer to any deviation in a subject from the normal state, such as any change in the state of the body or of some organ that prevents or disrupts the performance of a function. , and/or cause symptoms such as discomfort, dysfunction, suffering, or even death in people who are sick or in contact with them. Disease or condition may also be called disorder, ailing, ailment, malady, disorder, sickness, illness, complaint, inderdisposition or affectation.

In this application, the term "tumor" generally refers to any new pathological growth of tissue. For the purposes of this application, angiogenesis may be part of the characteristics of the tumor. Tumors may be benign, such as hemangioma, glioma, teratoma, etc., or they may be malignant, such as adenocarcinoma, sarcoma, glioblastoma, astrocytoma, neuroblastoma, and retinoblastoma. Tumor etc. The term "tumor" is generally used to refer to benign or malignant tumors, while the term "carcinoma" is generally used to refer to malignant tumors, which may be metastatic or non-metastatic. For research, these tissues can be isolated from readily available sources by methods well known to those skilled in the art.

As used herein, the term "administration" generally refers to the introduction of the pharmaceutical formulation of the present application into the body of a subject by any route of introduction or delivery. Any method known to those skilled in the art for contacting cells, organs or tissues with the drug may be employed. Such administration may include, without limitation, intravenous, intraarterial, intranasal, intraabdominal, intramuscular, subcutaneous, or oral. The daily dose may be divided into one, two or more doses in suitable forms for administration at one, two or more times during a certain period of time.

In this application, the term "effective amount" or "effective dose" generally refers to an amount sufficient to achieve, or at least partially achieve, the desired effect. A "therapeutically effective amount" or "therapeutically effective dose" of a drug or therapeutic agent is generally one that, when used alone or in combination with another therapeutic agent, promotes resolution of disease (either through a reduction in the severity of disease symptoms, the frequency of asymptomatic periods of disease An amount of any drug that is evidenced by an increase in the intensity and duration of the disease, or by the prevention of impairment or disability due to the disease. A "prophylactically effective amount" or "prophylactically effective dose" of a drug generally refers to the amount of the drug that inhibits the development or recurrence of the disease when administered alone or in combination with another therapeutic agent to a subject at risk for the development or recurrence of the disease. . The ability of a therapeutic or prophylactic agent to promote disease regression or inhibit disease progression or recurrence can be assessed using a variety of methods known to those skilled in the art, such as in human subjects during clinical trials, in animal model systems Predicting efficacy in humans, or by measuring the activity of the agent in in vitro assays. In certain embodiments, an "effective amount" refers to an amount of a CD59 inhibitor that produces the desired pharmacological, therapeutic, or prophylactic result.

In this application, the term "subject" generally refers to a human or non-human animal (including mammals), such as humans, non-human primates (apes), for which diagnosis, prognosis, amelioration, prevention and/or treatment of disease is required. , gibbons, gorillas, chimpanzees, orangutans, macaques), domestic animals (dogs and cats), farm animals (poultry such as chickens and ducks, horses, cattle, goats, sheep, pigs) and experimental animals (mice, Rat, rabbit, guinea pig). Human subjects include fetal, neonatal, infant, adolescent, and adult subjects. Subjects included animal disease models.

In this application, the terms "includes", "includes", "has", "can", "contains" and variations thereof are generally open-ended transitional phrases, terms or words which do not exclude the possibility of additional actions or structures sex. The term "consisting of" generally means that no other components (or similarly, features, integers, steps, etc.) can be present. The singular forms "a", "an" and "the" include plural referents unless the context clearly dictates otherwise.

In this application, the term "about" generally means approximately, within the region of, roughly, or around. When the term "about" is used to refer to a range of values, the cutoff or specific value is used to indicate that the stated value may vary by up to 10% from the recited value. Thus, the term "about" may be used to encompass a variation of ±10% or less, a variation of ±5% or less, a variation of ±1% or less, a variation of ±0.5% or less, or a variation of ± 0.1% or less variation.

In this application, the abbreviations have the following meanings: "h" refers to hours, "min" refers to minutes, "s" refers to seconds, "d" refers to days, "μL" refers to microliters, "mL" refers to milliliters, and "L" refers to liters, "bp" refers to base pairs, "mM" refers to millimoles, and "μM" refers to micromoles.

Detailed description of the invention

On the other hand, the present application also provides a method for promoting T cell factor secretion, which includes inhibiting the expression, function and/or activity of CD59 molecules in T cells.

In this application, the CD59 molecule is an intra-T cell CD59 molecule.

In this application, the method includes administering a CD59 inhibitor to T cells.

In this application, the method includes knocking down/silencing the CD59 gene of T cells.

On the other hand, the present application also provides CD59 inhibitors, which can inhibit the expression and/or activity of CD59 in T cells.

On the other hand, the present application also provides engineered T cells whose CD59 gene is knocked down or silenced.

CD59 inhibitor

In this application, the inhibitor used to inhibit CD59 gene expression may include any method known in the art that can inhibit gene expression. For example, the inhibitor may comprise a protein. For example, the inhibitor may comprise an antibody. For example, the inhibitor may comprise a small molecule compound. For example, the inhibitor may comprise a nucleic acid molecule. For example, the inhibitor may comprise PROTAC technology.

For example, the CD59 inhibitor may target an oligonucleotide encoding a nucleic acid molecule encoding CD59. In the present application, the nucleic acid molecule encoding CD59 may comprise the nucleotide sequence shown in SEQ ID NO:1.

For example, the CD59 inhibitor may comprise a nucleic acid molecule targeting CD59.

In this application, the nucleic acid molecule targeting CD59 can target at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, in SEQ ID NO: 1 At least 21, at least 22, at least 23, at least 24, at least 25 or at least 26 consecutive nucleotides.

In this application, the CD59-targeting nucleic acid molecule may comprise at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, which are partially or completely complementary to the nucleotide sequence shown in SEQ ID NO:1. A nucleotide sequence of at least 18, at least 19, at least 20, at least 21, at least 22 or at least 23 contiguous nucleotides.

In certain embodiments, for example, the length of the CD59-targeting nucleic acid molecule can be 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 22, 23, 24, 25 , 26, 27, 28, 29 or 30 nucleotides long. For another example, the length of the oligonucleotide may be 17, 18, 19, 20, 21, 22, 23, 24, 25 or 26 nucleotides long.

For example, the CD59-targeting nucleic acid molecule can target the target sequence of the 82-165 nucleotide region of SEQ ID NO:1.

For example, the CD59-targeting nucleic acid molecule can target the target sequence of the 248-294 nucleotide region of SEQ ID NO:1.

For example, the CD59-targeting nucleic acid molecule can target the target sequence of the 248-269 nucleotide region of SEQ ID NO:1.

For example, the CD59-targeting nucleic acid molecule can target the target sequence of the 1-81 nucleotide region of SEQ ID NO:1.

For example, the CD59-targeting nucleic acid molecule can target the target sequence of the 165-248th nucleotide region of SEQ ID NO:1.

For example, the CD59-targeting nucleic acid molecule can target the target sequence of the 269-387 nucleotide region of SEQ ID NO:1.

In this application, the CD59 inhibitor may include shRNA, siRNA and/or sgRNA that specifically targets the CD59 gene through gene editing using CRISPR-Cas9 technology.

For example, the sequence/target sequence of each nucleic acid molecule may be as follows.

Target sequence of shRNA (sense strand sequence, the sequence is in sequence form in the expression vector):

SEQ ID NO:3：CCGTCAATTGTTCATCTGATT

SEQ ID NO:4：GCTAACGTACTACTGCTGCAA

SEQ ID NO:5：GCTACAACTGTCCTAACCCAA

SEQ ID NO:6：GATGCGTGTCTCATTACCAAA

SEQ ID NO:7：GACCTGTGTAACTTTAACGAA

The antisense strand sequence of shRNA is reverse complementary to the sense strand sequence and is a sequence from the 5' end to the 3' end, and the sequence is the sequence form in the expression vector):

SEQ ID NO:9：AATCAGATGAACAATTGACGG

SEQ ID NO:10：TTGCAGCAGTAGTACGTTAGC

SEQ ID NO:11：TTGGGTTAGGACAGTTGTAGC

SEQ ID NO:12：TTTGGTAATGAGACACGCATC

SEQ ID NO:13：TTCGTTAAAGTTACACAGGTC

siRNA sequence:

SEQ ID NO:28：CCGUCAAUUGUUCAUCUGAUU

SEQ ID NO:29：GCUAACGUACUACUGCUGCAA

SEQ ID NO:30：GCUACAACUGUCCUAACCCAA

SEQ ID NO:31：GAUGCGUGUCUCAUUACCAAA

SEQ ID NO:32：GACCUGUGUAACUUUAACGAA

sgRNA sequence (targeting sequence, the sequence is in the form of a sequence in an expression vector):

SEQ ID NO:33：ACGACGTCACAACCCGCTTG

SEQ ID NO:34：GTTCGGGCTGCTGCTCGTCC

SEQ ID NO:35：TAGGACAGTTGTAGCACTGC

SEQ ID NO:36：GCTGTTCGTTAAAGTTACAC

SEQ ID NO:37：CGAACAGGACAGACCCTCCT

SEQ ID NO:38：GCGTGTTCATTACCAAAGC

In this application, the shRNA may include stem-loop linked inverted repeat sequences.

In this application, the shRNA may include a sense strand and an antisense strand.

In this application, the stem loop of the shRNA may include the nucleic acid sequence shown in SEQ ID NO: 26 and/or SEQ ID NO: 27.

SEQ ID NO:26：CTCGAG

SEQ ID NO:27：GAGCTC

In this application, the shRNA may comprise a primer sequence. For example, shRNA including a primer may include the amino acid sequence shown in any one of SEQ ID NO: 16-25. Among them, SEQ ID NO:16 and SEQ ID NO:17 are mutually positive and antisense strands; SEQ ID NO:18 and SEQ ID NO:19 are mutually positive and antisense strands; SEQ ID NO:20 and SEQ ID NO: 21 is the sense and antisense strands of each other; SEQ ID NO:22 and SEQ ID NO:23 are the sense and antisense strands of each other; SEQ ID NO:24 and SEQ ID NO:25 are the sense and antisense strands of each other.

In this application, the nucleic acid sequence involved may include one or more nucleotide sequences that differ from it. The sequences that differ by multiple nucleotides may be sequences that differ by two nucleotides, sequences that differ by three nucleotides, sequences that differ by four nucleotides, sequences that differ by five nucleotides, or sequences that differ by five nucleotides. More nucleotide sequences. For example, the sense strand of the shRNA includes the nucleotide sequence shown in any one of SEQ ID NOs: 3-7 or a sequence that differs from it by no more than 3 nucleotides. For example, the antisense strand of the shRNA includes the nucleotide sequence shown in any one of SEQ ID NOs: 9-13 or a sequence that differs from it by no more than 3 nucleotides. For example, the siRNA includes the sequence shown in any one of SEQ ID NOs: 28-32 or a sequence that differs from it by no more than 3 nucleotides. For example, the sgRNA includes the nucleotide sequence shown in any one of SEQ ID NOs: 33-44 or a sequence that differs from it by no more than 3 nucleotides.

In certain embodiments, the sense and antisense strands of the nucleic acid molecules described herein contain the same number of nucleotides. In certain embodiments, the sense and antisense strands of the nucleic acid molecules described herein contain different numbers of nucleotides. In certain embodiments, the 5' end of the sense strand and the 3' end of the antisense strand of the nucleic acid molecule form a blunt end. In certain embodiments, the 3' end of the sense strand and the 5' end of the antisense strand of the nucleic acid molecule form blunt ends. In certain embodiments, the two ends of the nucleic acid molecule form blunt ends. In certain embodiments, neither end of the nucleic acid molecule is blunt-ended. As used herein, blunt end refers to the end of a double-stranded nucleic acid in which the terminal nucleotides of the two annealed strands are complementary (forming complementary base pairs). In certain embodiments, the 5' end of the sense strand and the 3' end of the antisense strand of the nucleic acid molecule form loose ends. In certain embodiments, the 3' end of the sense strand and the 5' end of the antisense strand of the nucleic acid molecule form loose ends. In certain embodiments, the two ends of the nucleic acid molecule form loose ends. In certain embodiments, neither end of the nucleic acid molecule is a loose end. As used herein, loose ends generally refer to the ends of a double-stranded nucleic acid molecule in which the terminal nucleotides of the two annealed strands form a pair (i.e., do not form an overhang) but are not complementary (i.e., form a non-complementary pair). As used herein, an overhang is a stretch of one or more unpaired nucleotides at the end of one strand of a double-stranded nucleic acid molecule. The unpaired nucleotides can be on the sense or antisense strand, creating 3’ or 5’ overhangs. In certain embodiments, the nucleic acid molecule contains: blunt ends and loose ends, blunt ends and 5' overhang ends, blunt ends and 3' overhang ends, loose ends and 5' overhang ends, loose ends and 3' tab end, two 5' tab ends, two 3' tab ends, 5' tab end and 3' tab end, two stray ends, or two blunt ends.

The present application also includes expression vectors for the nucleic acid molecules. For example, the expression vector may comprise a viral vector. For example, the expression vector may comprise a lentiviral vector, a retroviral vector, or an adeno-associated viral vector.

In this application, the type of lentiviral vector is well known in the art, for example, it is selected from: pLKO.1-puro, pLKO.1-CMV-tGFP, pLKO.1-puro-CMV-tGFP, pLKO.1- CMV-Neo, pLKO.1-Neo, pLKO.1-Neo-CMV- tGFP, pLKO.1-puro-CMV-TagCFP, pLKO.1-puro-CMV-TagYFP, pLKO.1-puro-CMV-TagRFP, pLKO.1-puro-CMV-TagFP635, pLKO.1-puro-UbC- TurboGFP, pLKO.1-puro-UbC-TagFP635, pLKO.1-puro-IPTG-LxLacO, pLKO.1-puro-IPTG-3xLacO, pLP1, pLP2, pLP/VSV-G, pENTR/U6, pLenti6/BlOCK- iT-DEST, pLenti6-GE/U6-laminshrna, pcDNA1.2/V5-GW/lacZ, pLenti6.2/N-Lumio/V5-DEST, pGCSIL-GFP or pLenti6.2/N-Lumio/V5-GW/ lacZ et al.

This application also includes recombinant lentivirus obtained by co-transfecting mammalian cells using the expression vector and packaging helper plasmid. For example, the mammalian cells may include any one or a combination of at least two of 293 cells, 293T cells or 293F cells.

This application also provides a CD59 gene interference lentivirus, which is packaged by the virus with the help of the aforementioned interference nucleic acid construct and lentivirus packaging plasmid and cell line.

engineered T cells

On the other hand, the present application also provides an engineered T cell whose CD59 gene is knocked down or silenced.

In this application, the engineered T cells may undergo one or more engineering methods. In this application, the engineering approach includes targeting the CD59 gene through antisense RNA, antagomir, siRNA, shRNA, meganuclease, zinc finger nuclease, transcription activator-like effector nuclease and/or CRISPR system The target sequence in silences the CD59 gene in the T cells. In this application, the engineering approach includes using PROTAC to inhibit the activity of the CD59 gene in T cells.

For example, the engineered T cells can be obtained by administering a CD59 inhibitor described herein.

In this application, the T cells may include thymocytes, naive T lymphocytes, immature T lymphocytes, mature T lymphocytes, resting T lymphocytes or activated T lymphocytes. In this application, the T cells may include helper T cells (HTL; CD4+T cells), cytotoxic T cells (CTL; CD8+T cells), CD4+CD8+T cells, CD4-CD8-T cells Or any other subset of T cells.

In this application, the engineered T cells may also include other modifications. For example, the engineered T cells can also be modified to express chimeric antigen receptors. For example, the engineered T cells can also be modified to express T cell receptors (TCR).

pharmaceutical composition

In another aspect, the present application provides a pharmaceutical composition comprising a CD59 inhibitor and optionally a pharmaceutically acceptable excipient.

In certain embodiments, the CD59 inhibitor can be used to inhibit expression of the CD59 gene in cells, cell populations, or tissues, such as in a subject. In certain embodiments, CD59 inhibitors are used to formulate compositions, ie, pharmaceutical compositions or medicaments, for administration to a subject. For example, a pharmaceutical composition or medicament may comprise a pharmacologically effective amount of at least one of the CD59 inhibitors and one or more pharmaceutically acceptable carriers. Pharmaceutically acceptable carriers are those that have undergone appropriate safety evaluation Substances other than active pharmaceutical ingredients that are intentionally included in a drug delivery system. The carrier does not exert or is not intended to exert a therapeutic effect at the intended dose. The carrier may be used to a) aid in handling of the drug delivery system during manufacturing, b) protect, support or enhance the stability, bioavailability or patient acceptability of the CD59 inhibitor, c) aid in product identification and/or or d) any other attribute that enhances the overall safety, effectiveness of the delivered CD59 inhibitor during storage or use. Pharmaceutically acceptable carriers may or may not be inert substances.

Carriers include, but are not limited to: absorption enhancers, anti-adhesive agents, defoaming agents, antioxidants, binders, adhesives, buffers, carriers, coatings, pigments, delivery enhancers, delivery polymers, Dextran, dextrose, diluent, disintegrant, emulsifier, extender, filler, flavoring agent, glidant, humectant, lubricant, oil, polymer, preservative, brine, salt, Solvents, sugars, suspending agents, sustained release matrices, sweeteners, thickeners, tonicity agents, vehicles, hydrophobic agents and wetting agents.

use

In another aspect, the application provides the use of the CD59 inhibitor, the engineered cell, and/or the pharmaceutical composition in the preparation of a medicament for preventing and/or treating diseases and/or conditions .

In another aspect, the present application provides a method of preventing and/or treating a disease and/or disorder, comprising administering to a subject in need thereof the CD59 inhibitor, the engineered cell, and/or the Pharmaceutical compositions.

In another aspect, the application provides the CD59 inhibitor, the engineered cell, and/or the pharmaceutical composition for use in preventing and/or treating diseases and/or disorders.

In certain embodiments, the disease and/or disorder may include a tumor.

In certain embodiments, the disease and/or disorder may include an immunodeficiency disorder.

Without intending to be bound by any theory, the following examples are only to illustrate the methods, inhibitors and uses of the present application, and are not intended to limit the scope of the invention of the present application.

Example

Example 1 Deletion of mCD59ab in mice reduces tumor proliferation and metastasis in tumor-bearing mice

1. Tumor proliferation in subcutaneous tumor-bearing models of WT and mCd59ab-KO mice

WT and mCd59ab-KO mice were subcutaneously inoculated with mouse lung cancer TC-1 cells (2×10 ⁵ cells/mouse). The size of the tumor was monitored in real time on the 9th day after inoculation, and the long and short diameters of the tumors were measured respectively, and the tumor volume was calculated = 0.5×long diameter×short diameter ² , and then measured every two to three days, and at On the 22nd day after inoculation, when the tumor size meets ethical requirements, the mice were anesthetized and sacrificed, and then the samples were collected. The model results showed that tumor proliferation in the mCd59ab-KO group was almost completely inhibited. Tumor proliferation showed a trend of first growth and then regression. Some mice even experienced complete tumor regression. We treat tumors Quantitative statistical analysis was performed on the weight of mice, and the results showed that the tumors of mice in the mCd59ab-KO group were significantly smaller than those in the WT group, indicating that knockout of mCd59ab in mice can significantly inhibit tumor proliferation (Figure 1).

2. WT and mCd59ab-KO mouse spleen and liver metastasis models to explore the effect of CD59 on tumor cell metastasis

Mouse lung cancer TC-1 cells (4×10 ⁶ cells/mouse) were injected into the spleens of WT and mCd59ab-KO mice respectively to construct a spleen-to-liver metastasis model. After inoculation, the status of the mice was observed every day. After the model construction was completed, the modeling mice were anesthetized and killed, and the liver and spleen were harvested respectively. Figure 2A shows that multiple tumor metastases can be observed in the liver of the WT group, while there are almost no or very few liver tumor metastases in the mCd59ab-KO group; HE staining was performed on the livers of the model mice (Figure 2C), and the results were This conclusion was further verified. This part of the results shows that knocking out mCd59ab can significantly inhibit the metastasis of transplanted tumor cells. In addition, tumor tissue growth was found in the spleens of mice in the WT group and mCd59ab-KO group, and there was no obvious difference in the growth of tumor tissue (Figure 2B).

Example 2 Detection of T cells in subcutaneous tumor-bearing models of lung cancer cells in WT and mCd59ab-KO mice

White blood cells were collected from the spleen and blood of mice in the subcutaneous tumor-bearing model, and flow cytometry was used to detect the contents of CD4 ⁺ (CD3 ⁺ CD4 ⁺ ) and CD8 ⁺ T cells (CD3 ⁺ CD8 ⁺ ). The results showed (Figure 3) that the percentage content of CD4 ⁺ and CD8 ⁺ T cells in the spleen and blood of mice in the mCd59ab-KO group was higher than that in the WT group, and the content of CD4 ⁺ or CD8 ⁺ T cells in the spleen and blood was related to the weight of mouse tumors. There is a negative correlation, indicating that knockout of mCd59ab in mice can promote T cell proliferation and may participate in the inhibition of transplanted tumor growth.

Example 3 T cells mediate anti-tumor immunity in mCd59ab-KO mice

To construct a mouse CD4 ⁺ T or/and CD8 ⁺ T cell depletion model, this experiment used Bioxcell InVioMab anti-mouse CD4 antibody (Clone: GK1.5, catalog: BE0003-1) and InVioMAb anti-mouse CD8α antibody ( clone: 2.43, catalog: BE0061), these two antibodies can be used to eliminate CD4 ⁺ T cells or CD8 ⁺ T cells in mice, and their isotype control is InVivoMAb rat IgG2b isotype control antibody (clone: LTF-2, catalog: BE0090 ).

Two days before the mice were tumor-bearing, 150 μg/150 μL anti-IgG2b, CD4, and CD8 antibodies diluted in PBS were injected intraperitoneally. The experiment was divided into an IgG2b control group, a CD4 ⁺ T cell depletion group, a CD8 ⁺ T cell depletion group, and a CD4 ⁺ T cell depletion group. In the cell and CD8 ⁺ T cell depletion group, CD4 ⁺ T or/and CD8 ⁺ T cells were eliminated from the mice, and then injected twice a week. Two days after the antibody injection, mouse lung cancer TC-1 cells were subcutaneously inoculated. When the tumors grew to be visible to the naked eye, the tumor size was recorded and then measured every three days until the end of the model. As shown in Figure 4, in mCd59ab-KO mice, compared with the mCd59ab-KO IgG group, tumor proliferation accelerated after deletion of CD4 ⁺ T cells or CD8 ⁺ T cells, and dual combination depletion of CD4 ⁺ T and CD8 ⁺ T cells After cells were injected into the mCd59ab-KO mice, the tumor proliferation rate was not significantly different from that in the WT IgG group, indicating that CD4 ⁺ T and CD8 ⁺ T cells played a crucial role in the tumor proliferation process in mCd59ab-KO mice.

Example 4 In mouse primary T cells, mCd59ab knockout can enhance T cell activation, cytokine release and cell proliferation.

The spleens of WT and mCd59ab-KO mice were taken, prepared into single cell suspensions, and primary CD4 ⁺ or CD8 ⁺ T cells were isolated using magnetic bead negative selection. The purity of the cell separation could reach more than 90%. The isolated cells were resuspended in complete culture medium and plated into a 48-well plate coated with CD3/CD28 (2 μg/mL) antibody to stimulate culture. First, the expression of T cell activation markers CD69 and CD25 was detected. The flow cytometry results showed that compared with the WT group, the mCd59ab-KO group could enhance CD4 ⁺ (Figure 5A, C) and CD8 ⁺ T (Figure 5B, D) In response to stimulation by CD3 and CD28 antibodies, the expression of CD69 and CD25 increased, and the cell activation was more obvious. Then the PMA ionomycin mixture containing Brefeldin A was added to stimulate for 4-6 hours, and the expression of cytokines was detected by flow cytometry. The results showed that compared with the WT group, mCd59ab-KO CD4 ⁺ T cells expressed IL-2 and IFN-γ (Figure 5E, G) and mCd59ab-KO CD8 ⁺ T cells secreted IL-2, IFN-γ, Granzyme B and The content of Perforin (Figure 5F, H, I, J) was higher, indicating that knocking out mCd59ab in T cells can enhance their immunological response.

The isolated mouse primary T cells were stimulated and cultured, adding 1 μL 5mM CFSE at 10-100×10 ⁶ cells/mL, and performing CFSE experiments at different time points to detect cell proliferation. Among CD4 ⁺ T cells (Figure 5K,L), CFSE results showed that at the 36h, 48h and 72h time points, the proliferation of cells in the mCd59ab-KO group was faster than that of WT CD4 ⁺ T cells, and there was no significant difference between the two groups at 96h. Among CD8 ⁺ T cells (Figure 5M,N), mCd59ab-KO CD8 ⁺ T cells proliferated faster than WT CD8 ⁺ T cells at 72h and 96h, indicating that mCd59ab knockout can enhance the proliferation ability of T cells.

Example 5 Construction of CD59 knockdown expression vector

1.CD59 shRNA design

Use the shRNA Design Tool (www.sigmaaldrich.com) to find available shRNA sequence information targeting CD59. Sequence alignment was performed using the BLAST tool (https://blast.ncbi.nlm.nih.gov/Blast.cgi). Select the target site with the lowest off-target effect, and select 5 target sites (shRNA-CD59-1, shRNA-CD59-2, shRNA-CD59-3, shRNA-CD59-4, shRNA-CD59-5) and 1 Control target site (shRNA-NC), shRNA target site sequence is shown in Table 1. The stem-loop structure and enzyme cleavage site (EcoR1 and Agel) were designed respectively for the specific target site to obtain the oligonucleotide sequence of shRNA. A total of five pairs of shRNA (shRNA-CD59-1, shRNA-CD59-2, shRNA) were designed. -CD59-3, shRNA-CD59-4, shRNA-CD59-5), and non-specific control shRNA (shRNA-NC) was designed at the same time. The primers required for synthesizing shRNA are shown in Table 2 (shRNA primers were provided by Boshang Biotechnology (Shanghai) ) Ltd. Synthetic).

Table 1. CD59 shRNA target site DNA sequence

Table 2. CD59 shRNA primer sequence list

2.Construction of shRNA lentiviral expression vector of CD59 gene

2.1 The shRNA primers to be annealed were diluted to 50 μM with distilled water, and the primer synthesis was completed by Shanghai Boshang Biotechnology Co., Ltd. According to the following annealing reaction system, add various reagents in sequence and mix well.

Annealing reaction system:

Heat the water bath to 95°C, place the annealing system prepared above in the 95°C water bath and heat for 5 minutes, then turn off the power, let the temperature naturally cool to room temperature, and the annealing is completed.

2.2 Vector double enzyme digestion

Take 2 μg of the extracted pLKO.1 vector (Figure 6) and digest it with the corresponding restriction enzyme at 37°C overnight. The digestion system is as follows;

2.3 Recovery of digested products

Take 0.4g agarose in 40mL 1×TAE and heat it in the microwave for 2 minutes. After the liquid boils, leave it to room temperature to cool naturally. When the temperature drops to about 50-60°C, add 4μL 10000×goldview, shake well and pour into the gel making tank. Reserved.

Add the enzyme digestion product digested overnight to 6× loading buffer, load the sample, run the gel at 100V, observe the band under UV, and recover the target band into a 1.5mL EP tube.

Add equal mass of membrane-binding solution and 56°C sol. After the gel is completely melted, mix it by inverting it upside down. Add it to the column and incubate for 5 minutes. Centrifuge, add 500 μL PW rinse solution, centrifuge, idle for 2 minutes, and leave it at room temperature for 5 minutes. Add Elute the DNA with an appropriate amount of eluent and measure the concentration.

2.4 T4 ligation reaction

Connect the purified enzyme digestion product to the annealed product. The connection system is as follows:

Connect overnight at 16°C;

2.5 Conversion

Take 50 μL of DH5α, melt it on ice, add the ligation product to DH5α, mix well, and place it on ice for 30 minutes. Place the centrifuge tube in a 42°C water bath for 90 seconds, then quickly transfer the EP tube to ice to cool the cells for 3 minutes.

Add 1 mL of sterile antibiotic-free LB culture medium to the centrifuge tube, mix well, place on a 37°C shaker, and incubate with shaking at 220 rpm for 45 minutes to revive the bacteria until the relevant resistance genes on the plasmid are expressed. Centrifuge at 4000 rpm for 2 minutes, remove part of the supernatant culture medium, keep 100 μL, mix by pipetting, apply it to an LB culture plate containing ampicillin, and culture at 37°C for 12-16 hours.

2.6 Clone identification

Select multiple clones in the plate and send them to Plasmid Biotechnology (Shanghai) Co., Ltd. for sequencing, and compare the consistent plasmids. Used for subsequent experiments. The successfully constructed plasmids containing the CD59-shRNA expression cassette are numbered pLKO.1-shRNA-NC, pLKO.1-shCD59-1, pLKO.1-shCD59-2, pLKO.1-shCD59-3, pLKO.1- shCD59-4 and pLKO.1-shCD59-5.

Example 6 pLKO.1-shRNA-NC/pLKO.1-shCD59 lentivirus packaging

Discard the supernatant of 293T cells, rinse once with PBS, and add 0.25% EDTA-containing trypsin digestion solution for digestion; when the cells fall off the culture dish, add DMEM medium containing 10% fetal bovine serum to terminate digestion. Transfer the suspension containing cells to a 15 mL centrifuge tube, centrifuge at 800 rpm for 5 minutes, and plate the cells (10 cm ² cell culture plate). The next day, the cell density reaches 80%, which is more suitable for cell transfection.

1. Plasmid transfection

Add the following plasmids to 500ul Opti-MEM, 7.5ug of psPAX2 plasmid, 2.5ug of pMD2.G plasmid, and lentiviral vector plasmid (pLKO.1-shRNA-NC, pLKO.1-shCD59-1 and pLKO.1-shCD59- 2) 10ug, then add 20ul of transfection reagent Neofect ^TM DNA transfection reagent, mix well, and let stand at room temperature for 20 minutes. Finally, add the transfection complex to the cell culture medium and shake gently. Transfer to a 37 °C cell culture incubator with 5% CO2.

2. Virus collection and concentration

48 hours after plasmid transfection, collect the cell supernatant in a 50 mL centrifuge tube, centrifuge at 2000 rpm for 10 min, and filter with a 0.45 μm filter. Open the lid of the cleaned virus ultracentrifugation tube and sterilize it with UV light for 2 hours. Dispense the processed cell supernatant into the virus ultracentrifugation tube. Balance the two symmetrical ultracentrifugation tubes so that the weight error is less than 0.01g. After balancing, place it in the ultracentrifuge rotor and centrifuge at 100,000g at 4°C for 2 hours. After centrifugation, you can see a cluster of virus particles precipitating at the bottom of the centrifuge tube. Discard the supernatant. Add 500μL Opti-MEM to resuspend the virus particles, aliquot and store at -80°C. The used virus ultraion tubes are filled with glutaraldehyde and soaked overnight, cleaned, and reserved for next time.

Example 7 pLKO.1-shRNA-NC/pLKO.1-shCD59 lentivirus transduces Jurkat T cells or human primary T cells

1. Lentiviral transduction of Jurkat T cells: Seed Jurkat T cells in good growth status into ^25cm2 cell culture flasks and divide them into pLKO.1-puro-shRNA-NC and pLKO.1-puro-shRNA-CD59-1 and pLKO.1-puro-shRNA-CD59-2 group, add 4.5mL of 1640 complete medium, the cell density is about 50%, add 500μL of virus liquid (the amount of virus super-isolated in a ^10cm2 culture dish), polybrene 6ug/ml , 48h after infection. After 48 hours, the cells were centrifuged, the supernatant was discarded, and the state was adjusted with complete culture medium. After one generation of culture, puromycin screening was started. Start screening with a dose of 2 μg/mL, and then increase the dose according to the cell status. When the concentration increases to about 6 μg/mL, the cells no longer die. At this time, the stable transfection cell line with CD59 knockdown is successfully constructed and can be replaced with Complete medium expansion culture, using qPCR and Western Blot respectively and flow cytometry methods to detect knockdown efficiency.

2. Lentiviral transduction of human peripheral blood T cells

Mix the collected peripheral blood and physiological saline at a ratio of 1:1, add Ficoll to the centrifuge tube, slowly add the diluted peripheral blood, centrifuge at 800g for 20 minutes, gently absorb the PBMC layer and add it to another centrifuge tube. Wash PBMC with physiological saline, transfer to X-VIVO medium (containing 5% human AB serum, 200IU/mL IL-2), and add Dynabeads human T-activator according to the ratio of cells:magnetic beads to 1:1. CD3/CD28 (Gibco #11132D) was used for activation, followed by lentiviral infection 2 days later. Divide into three groups: pLKO.1-GFP-shRNA-NC, pLKO.1-GFP-shRNA-CD59-1 and pLKO.1-GFP-shRNA-CD59-2. Add T cells and lentivirus solution to pre-coated RetroNectin (5ug/mL) in a 24-well plate, centrifuged at 1200g for 90 minutes, and cultured in a cell culture incubator at 37°C, 5% CO ₂ and a certain humidity.

Example 8 Interference Experiment Verification, CD59 Knockdown Level Detection

1. RT-PCR and Western Blot method to screen CD59 shRNA

Collect three groups of stably transfected cells with Jurkat-shRNA, lyse the cells with NucleoZOL, extract total RNA, perform reverse transcription, and use CD59 primers (Table 3) to measure the expression of CD59 at the mRNA level by fluorescence quantitative PCR (requires Primers to the internal reference gene β-actin, as shown in Table 3), Q-PCR analyzed the interference effect of the plasmid. The results are shown in Figure 7A. After pLKO.1-shRNA-CD59 lentivirus infects cells, it can significantly inhibit the transcription of CD59 mRNA, causing the expression of CD59 mRNA to drop to 40% of the original level. After RNA interference, the expression of CD59 gene was not only down-regulated at the transcription level, but also significantly changed at the protein level. That is, the expression of CD59 protein in Jurkat T cells infected with pLKO.1-shRNA-CD59 was significantly down-regulated. The results are shown in Figure 7B Show.

Table 3. Primer list

2. Screening of CD59 shRNA by flow cytometry

Take Jurkat and human peripheral blood T cells infected with pLKO.1-shRNA-NC, pLKO.1-shRNA-CD59-1 and pLKO.1-shRNA-CD59-2 lentivirus, rinse them twice with PBS, and use PE-CD59 formulated in 1% BSA/PBS Flow cytometry antibody (Biolegend; 304708), incubate on ice for 40 minutes. After staining, centrifuge at 1500 rpm for 5 minutes, discard the supernatant, rinse twice with PBS, and then resuspend into a flow tube with 500 μL PBS. The CD59 knockdown efficiency of cells is detected by flow cytometry. The results are shown in Figure 7C-D. Compared with cells transfected with pLKO-shRNA-NC alone, the expression of CD59 in the pLKO.1-shCD59-1(sh1) and pLKO.1-shCD59-2(sh2) groups The levels were significantly reduced, and statistical analysis showed significant differences in the expression levels of CD59. This indicates that these two CD59 shRNAs can reduce the expression of CD59 protein and exert gene silencing effects.

Example 9 In vitro study on knocking down the expression level of CD59 and enhancing the immunological function of T cells

1. Detection of T cell activation markers in CD59 gene-edited Jurkat T cells

Jurkat-shRNA-NC, Jurkat-shRNA-CD59-1, and Jurkat-shRNA-CD59-2 stably transfected cell lines were stimulated and cultured with 5 μg/mL anti-CD3 and CD28 antibodies for 24 h, and the expression of CD69 was detected by flow cytometry (Figure 8A ). The results showed that CD3 and CD28 antibodies could activate Jurkat T cells, and CD69 expression was higher in CD59 gene-edited Jurkat T cells.

2. Detection of cytokine content in T cells

2.1 RT PCR method to detect cytokine release in CD59 gene-edited Jurkat T cells

Jurkat-shRNA-NC, Jurkat-shRNA-CD59-1, and Jurkat-shRNA-CD59-2 stably transfected cell lines were stimulated and cultured with 5 μg/mL anti-CD3 and CD28 antibodies for 24 hours, and stimulated with PMA ionomycin mixture for 4-6 hours. Collect the cells to extract total RNA, reverse-transcribe it into cDNA, and use the primers of IL2 and the primers of the housekeeping gene β-action (as shown in Table 3) to measure the expression of IL2 at the mRNA level by fluorescence quantitative PCR. As shown in Figure 8B, the results showed that compared with the unstimulated group, the IL2 expression level in the stimulated cell line group was significantly increased, and compared with the shNC control group, knockdown of CD59 in the shCD59 group could significantly enhance the IL2 expression level.

2.2 CD59 gene-edited human peripheral blood T cells, flow cytometry method to detect factor release

Take the PBMC in Example 7 and wait for 7 days after being infected with lentivirus. Take three groups of cells: shRNA-NC, shRAN-CD59-1 and shRNA-CD59-2, and stimulate and culture them with 2ug/ml anti-CD3/CD28 antibody. Cells were stimulated with cell activation (with Brefeldin) (Biolegend #423303) for 4-6h before harvesting at 24h and 48h, and PE-IFNγ (Biolegend #502509) or PE-Cy7-TNFα (Biolegend #502930) flow cytometry antibodies were used to detect TNFα and IFNγ cytokine expression levels. As shown in Figure 8C-D, the ability of CD59 gene-edited human peripheral blood T cells to secrete TNFα and IFNγ cytokines was significantly enhanced.

Example 10 There is an interaction between CD59 and Ras in Jurkat cells. Knocking down CD59 can affect the localization of Ras in the Golgi apparatus.

Use co-immunoprecipitation (Co-IP) combined with liquid chromatography mass spectrometry technology to screen protein molecules that interact with CD59. It was found that Ras is one of the proteins that CD59 interacts with (Figure 9A). Similar experiments were also performed using Ras antibodies, showing that CD59 is one of the binding proteins of Ras (Figure 9B). The forward and reverse co-immunoprecipitation experiments further verified the interaction between the two. The results showed that Ras can be detected when using CD59 antibody forward IP, and CD59 can also be detected when using Ras antibody IP in the reverse direction, indicating that the two do exist. Interaction (Figure 9C)

Immunocytochemistry (ICC) was further used to verify the interaction between CD59 and Ras. The results showed (Figure 9D) that in the Jurkat-shNC cell line, CD59 and Ras were localized in the cell membrane and cytoplasm, and there was co-localization, which was consistent with the IP results. After knocking down CD59, the distribution of Ras changed significantly, and the cell membrane localization was significantly reduced and localized in the cytoplasm, suggesting that knocking down CD59 changed the distribution of Ras in intracellular subcellular organelles.

Studies have reported that growth factor-induced activation of Ras signaling on the plasma membrane is rapid and transient, while Ras signaling in the Golgi apparatus is slow and more sustained. We performed ICC experiments using Giantin, a specific protein marker expressed in the Golgi apparatus. The results showed that in the Jurkat-shCD59 cell line, Ras obviously accumulated and co-localized with Giantin (Figure 9E). Previous studies have reported that when Jurkat cell TCR is activated at low levels, N-Ras is activated on the Golgi membrane rather than the plasma membrane through the PLCγ and RasGRP1 signaling pathways. These results suggest that knockdown of CD59 expression levels Ras trafficking is mainly localized in the Golgi apparatus and may induce delayed and sustained signaling.

Example 11 Knocking down CD59 can enhance the MAPK signaling pathway downstream of TCR signaling

After TCR activation, a variety of downstream signaling pathways such as MAPK, PI3K-Akt, and NF-κB participate in the reaction, and Ras can activate a series of cascade reactions downstream of the MAPK signaling pathway. Jurkat-shRNA-NC, Jurkat-shRNA-CD59-1, and Jurkat-shRNA-CD59-2 stably transfected cell lines were stimulated and cultured with 5 μg/mL anti-CD3 and CD28 antibodies for 15 min, and MAPK signaling pathway-related indicators were detected by WB. As shown in Figure 10A, compared with the unstimulated group, after cells were stimulated with anti-CD3 and CD28 antibodies, their p-MEK1/2, p-ERk1/2, p-MKK3/6, p-p38, p-MKK4 and p -The phosphorylated protein level of JNK increased significantly, and the corresponding total proteins MER1/2, ERK1/2, MKK3/1/6, p38, MKK4, MKK7 and JNK did not change significantly, indicating that anti-CD3 and CD28 antibodies stimulated TCR-CD3 After the complex, the MAPK signaling pathway is activated.

In cells stimulated with anti-CD3 and CD28 antibodies, compared with Jurkat-shNC cells, the Jurkat-shCD59 cell line has p-MEK1/2, p-ERk1/2, p-MKK3/6, p-p38, p- The phosphorylation levels of MKK4 and p-JNK were significantly increased, and the corresponding total proteins MER1/2, ERK1/2, MKK3/6, p38, MKK4 and JNK did not change significantly. At the same time, the experiment used flow cytometry to further verify the protein phosphorylation levels of ERK, p38 and JNK in human peripheral blood T cells. The flow cytometry results It was shown that after stimulation with anti-CD3 and CD28 antibodies, knockdown of CD59 can also enhance the phosphorylation levels of ERK, p38 and JNK compared with the shNC group (Figure 10B-C). The above results indicate that knockdown of CD59 can enhance the phosphorylation level by activating the MAPK signaling pathway. T cell immunological response.

In summary, the present invention detects the function of primary T cells of WT/mCD59ab-KO mice and screens shRNA targeting CD59, packages lentivirus, and introduces it into T cells to silence the CD59 gene. The edited T The expression of CD59 in the cells was significantly reduced, and their cell proliferation and cytokine release were significantly enhanced. Mechanistically, CD59 interacts with Ras and changes the localization of Ras in the plasma membrane or Golgi apparatus. That is, when the intracellular expression level of CD59 increases, it helps Ras to transport to the plasma membrane. At this time, the activation of Ras signal is rapid and short-lived. , when the intracellular expression level of CD59 decreases or even disappears, the level of Ras membrane transport decreases and is mainly located in the Golgi apparatus. At this time, the activation of Ras signal is slow and continuous (Figure 11), and further regulates T by affecting the MAPK signaling pathway. Cellular anti-tumor immune response provides new methods and ideas for the treatment of tumors and immune diseases.

The applicant declares that the present invention illustrates the detailed methods of the present invention through the above embodiments, but the present invention is not limited to the above detailed methods, that is, it does not mean that the present invention must rely on the above detailed methods to be implemented. It will be apparent to those skilled in the art that various modifications and variations are possible in the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention shall be included in the protection scope of the present invention.

Claims

A method of promoting T cell proliferation, which includes inhibiting the expression, function and/or activity of CD59 molecules in T cells.
A method for promoting T cell cytokine secretion and enhancing its function, which includes inhibiting the expression, function and/or activity of CD59 molecules in T cells.
The method of any one of claims 1-2, wherein the CD59 molecule is an intracellular CD59 molecule.
The method of any one of claims 1-3, comprising administering a CD59 inhibitor to the T cells.
The method according to any one of claims 1-4, comprising knocking down/silencing the CD59 gene of T cells.
The method according to any one of claims 4-5, wherein the CD59 inhibitor includes nucleic acid molecules, proteins, small molecule compounds and/or PROTAC technology.
The method of any one of claims 4-6, wherein the CD59 inhibitor comprises a nucleic acid molecule targeting the CD59 gene.
The method according to any one of claims 4-7, wherein the CD59 inhibitor is a single-stranded nucleic acid molecule or a double-stranded nucleic acid molecule.
The method according to any one of claims 7-8, wherein the nucleic acid molecule targeting the CD59 gene includes shRNA and/or siRNA.
The method according to any one of claims 4-9, wherein the CD59 inhibitor targets a target sequence of the CD59 gene in T cells, and the target sequence of the CD59 gene is as shown in SEQ ID NO: 1.
The method according to any one of claims 9-10, wherein the siRNA includes the sequence shown in any one of SEQ ID NOs: 28-32 or a sequence that differs from it by no more than 3 nucleotides.
The method of any one of claims 9-11, wherein the siRNA comprises one or more modified nucleotides.
The method according to any one of claims 9-12, wherein the shRNA comprises a sense strand fragment and an antisense strand fragment, and a stem-loop structure connecting the sense strand fragment and the antisense strand fragment, The sense strand fragment and the antisense strand fragment contain complementary regions.
The method according to any one of claims 9-13, wherein the sense strand of the shRNA comprises the nucleotide sequence shown in any one of SEQ ID NOs: 3-7.
The method according to any one of claims 9-14, wherein the antisense strand of the shRNA comprises the nucleotide sequence shown in any one of SEQ ID NOs: 9-13.
The method according to any one of claims 9-15, wherein the sense strand and/or antisense strand of the shRNA independently comprise one or more modified nucleotides.
The method according to any one of claims 1-16, comprising using a CRISPR/Cas system to target the CD59 gene Edit the target sequence.
The method of any one of claims 6-17, wherein the nucleic acid molecule comprises sgRNA.
The method of claim 18, wherein the sgRNA comprises the nucleotide sequence shown in any one of SEQ ID NOs: 33-44.
A CD59 inhibitor capable of inhibiting the expression, function and/or activity of CD59 molecules in T cells. The CD59 inhibitor targets the target sequence of the CD59 gene in T cells. The target sequence of the CD59 gene is such as SEQ ID NO:1 is shown.
The CD59 inhibitor of claim 20, wherein the CD59 molecule is an intracellular CD59 molecule.
The CD59 inhibitor according to any one of claims 20-21, which targets the target sequence of the 82-165th nucleotide region in SEQ ID NO:1.
The CD59 inhibitor according to any one of claims 20-22, which targets the target sequence of the nucleotide region 248-294 in SEQ ID NO:1.
The CD59 inhibitor according to any one of claims 20-23, which targets the target sequence of the nucleotide region 248-269 in SEQ ID NO:1.
The CD59 inhibitor according to any one of claims 20-24, which includes a nucleic acid molecule capable of knocking down/silencing the CD59 gene.
The CD59 inhibitor according to any one of claims 20-25, which is a single-stranded nucleic acid molecule or a double-stranded nucleic acid molecule.
The CD59 inhibitor according to any one of claims 20-26, which includes shRNA, siRNA and/or sgRNA.
The CD59 inhibitor according to claim 27, wherein the shRNA, siRNA and/or sgRNA is identical or complementary to any continuous fragment of 16-35 nucleotides in length in the sequence shown in SEQ ID NO:1 .
The CD59 inhibitor according to any one of claims 27-28, wherein the siRNA includes the sequence shown in any one of SEQ ID NOs: 28-32.
The CD59 inhibitor of any one of claims 27-29, wherein said siRNA comprises one or more modified nucleotides.
The CD59 inhibitor according to any one of claims 27-30, wherein the shRNA comprises the nucleotide sequence shown in any one of SEQ ID NOs: 3-7 and 9-25.
The CD59 inhibitor according to any one of claims 27-31, wherein the shRNA comprises a sense strand fragment and an antisense strand fragment, and a stem-loop structure connecting the sense strand fragment and the antisense strand fragment, so The sense strand fragment and the antisense strand fragment contain complementary regions.
The CD59 inhibitor according to any one of claims 27-32, wherein the sense strand of the shRNA comprises the nucleotide sequence shown in any one of SEQ ID NOs: 3-7.
The CD59 inhibitor according to any one of claims 27-33, wherein the antisense strand of the shRNA comprises the nucleotide sequence shown in any one of SEQ ID NOs: 9-13 or differs from it by no more than 3 sequence of nucleotides.
The CD59 inhibitor according to any one of claims 27-34, wherein the sense strand and/or antisense strand of the shRNA independently comprise one or more modified nucleotides.
The CD59 inhibitor according to any one of claims 27-35, wherein the stem loop of the shRNA contains the nucleotide sequence represented by CTCGAG or GAGCTC.
The CD59 inhibitor according to any one of claims 27-35, wherein the sgRNA comprises the nucleotide sequence shown in any one of SEQ ID NOs: 33-44.
The CD59 inhibitor according to any one of claims 30-37, wherein said modification includes chemical modification.
The CD59 inhibitor according to any one of claims 20-38, which includes the expression vector of shRNA, siRNA and/or sgRNA according to any one of claims 27-38.
The CD59 inhibitor of claim 39, wherein the expression vector includes a viral vector.
The CD59 inhibitor according to claim 40, wherein the viral vector includes a lentiviral vector, a retroviral vector or an adeno-associated viral vector.
The CD59 inhibitor according to any one of claims 39-41, wherein the preparation of the shRNA expression vector includes the following steps:

(1) Design the shRNA according to the CD59 gene shown in SEQ ID NO:1;

(2) Insert the shRNA into the expression vector.
The CD59 inhibitor according to claim 42, wherein the shRNA is inserted into the XhoI and Agel restriction sites of the expression vector.
The CD59 inhibitor according to any one of claims 20-43, which includes a recombinant lentivirus, which is co-transfected with the expression vector according to any one of claims 39-43 and a packaging helper plasmid. Prepared from mammalian cells.
The CD59 inhibitor according to any one of claims 20-44, comprising a host cell transfected with at least one CD59 inhibitor according to any one of claims 20-44.
The CD59 inhibitor of claim 45, wherein said host cells comprise immune cells.
The CD59 inhibitor of claim 46, wherein said immune cells comprise T cells.
A method of inhibiting the expression, function and/or activity of CD59 molecules in T cells, comprising: contacting the T cells with the CD59 inhibitor of any one of claims 20-47.
A method of silencing the CD59 gene in T cells, comprising: contacting the T cells with the CD59 inhibitor of any one of claims 20-47.
Engineered T cells that have reduced expression, function and/or activity of the CD59 molecule compared to unengineered T cells.
The engineered T cell according to claim 50, wherein the CD59 gene is knocked down or silenced.
The engineered T cell according to any one of claims 50-51, wherein the engineering method includes antisense RNA, antagomir, siRNA, shRNA, meganuclease, zinc finger nuclease, transcription activator-like Effector nucleases and/or CRISPR systems target target sequences in the CD59 gene to silence the CD59 gene in the T cells.
The engineered T cell according to any one of claims 50-52, comprising silencing the CD59 gene of the T cell using a CRISPR/Cas9 system.
The engineered cell of claim 53, wherein the CRISPR/Cas9 system includes sgRNA.
The engineered cell according to claim 54, wherein the sgRNA targets a target sequence in the CD59 gene, and the target sequence in the CD59 gene is as shown in SEQ ID NO: 1.
The engineered cell according to any one of claims 54-55, wherein the sgRNA is identical or complementary to any continuous fragment of 16-35 nucleotides in length in the sequence shown in SEQ ID NO:1 .
The engineered cell according to any one of claims 54-56, wherein the sgRNA comprises the nucleotide sequence shown in any one of SEQ ID NOs: 33-44.
The engineered cell according to any one of claims 52-57, wherein the siRNA comprises the nucleotide sequence shown in any one of SEQ ID NOs: 28-32.
The engineered cell according to any one of claims 52-58, wherein the shRNA includes a sense strand and an antisense strand, and a stem-loop structure connecting the sense strand fragment and the antisense strand fragment, The sense strand fragment and the antisense strand fragment contain complementary regions.
The engineered cell according to any one of claims 52-59, wherein the sense strand of the shRNA comprises the nucleotide sequence shown in any one of SEQ ID NOs: 3-7.
The engineered cell according to any one of claims 52-60, wherein the stem-loop structure of the shRNA comprises the nucleotide sequence shown in any one of SEQ ID NOs: 9-13.
The engineered cell according to any one of claims 50-61, which has one or more of the following properties:

(1) Compared with unengineered T cells, the ability to secrete cytokines is enhanced;

(2) Compared with unengineered T cells, tumor cell killing efficiency is enhanced;

(3) Enhanced expansion capacity compared with unengineered T cells; and

(4) Compared with unengineered T cells, the survival time in the body is enhanced.
A pharmaceutical composition comprising the CD59 inhibitor of any one of claims 20-47, and/or the engineered cell of any one of claims 50-62, and optionally a pharmaceutically acceptable carrier.
Use of the CD59 inhibitor according to any one of claims 20-47, the engineered cell according to any one of claims 50-62, and/or the pharmaceutical composition according to claim 63 in the preparation of medicines , the medicine is used to prevent and/or treat diseases and/or conditions.
The use according to claim 64, wherein the disease and/or condition includes tumors.
The use according to any one of claims 64-65, wherein the disease and/or disorder comprises an immunodeficiency disease.