WO2020123011A1 - Anti-il-27 antibodies and uses thereof - Google Patents

Anti-il-27 antibodies and uses thereof Download PDF

Info

Publication number
WO2020123011A1
WO2020123011A1 PCT/US2019/053036 US2019053036W WO2020123011A1 WO 2020123011 A1 WO2020123011 A1 WO 2020123011A1 US 2019053036 W US2019053036 W US 2019053036W WO 2020123011 A1 WO2020123011 A1 WO 2020123011A1
Authority
WO
WIPO (PCT)
Prior art keywords
antigen binding
antibody
binding portion
seq
isolated monoclonal
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2019/053036
Other languages
English (en)
French (fr)
Inventor
Jonathan Hill
Scott Chappel
Michael GLADSTONE
Bianka Prinz
Andrew LAKE
Christine Miller
Kerry White
Jing Hua
Pamela M. Holland
Matthew RAUSCH
Devapregasan MOODLEY
Gege TAN
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Adimab LLC
Surface Oncology Inc
Original Assignee
Adimab LLC
Surface Oncology Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to EP19895768.0A priority Critical patent/EP3894440A4/en
Priority to US17/413,269 priority patent/US12358978B2/en
Priority to KR1020217019243A priority patent/KR102933484B1/ko
Priority to AU2019399474A priority patent/AU2019399474A1/en
Priority to MX2021006980A priority patent/MX2021006980A/es
Priority to CA3121420A priority patent/CA3121420A1/en
Priority to SG11202105161YA priority patent/SG11202105161YA/en
Priority to BR112021011393-2A priority patent/BR112021011393A2/pt
Priority to JP2021533517A priority patent/JP7535045B2/ja
Application filed by Adimab LLC, Surface Oncology Inc filed Critical Adimab LLC
Priority to CN201980082814.5A priority patent/CN113544151B/zh
Priority to EA202191666A priority patent/EA202191666A1/ru
Publication of WO2020123011A1 publication Critical patent/WO2020123011A1/en
Priority to IL283875A priority patent/IL283875A/en
Anticipated expiration legal-status Critical
Priority to JP2024077880A priority patent/JP7805395B2/ja
Priority to US19/236,197 priority patent/US20260055176A1/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/24Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against cytokines, lymphokines or interferons
    • C07K16/244Interleukins [IL]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/02Immunomodulators
    • A61P37/04Immunostimulants
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/52Cytokines; Lymphokines; Interferons
    • C07K14/54Interleukins [IL]
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/24Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against cytokines, lymphokines or interferons
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2803Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2803Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
    • C07K16/2827Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily against B7 molecules, e.g. CD80, CD86
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2851Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the lectin superfamily, e.g. CD23, CD72
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/575Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6863Cytokines, i.e. immune system proteins modifying a biological response such as cell growth proliferation or differentiation, e.g. TNF, CNF, GM-CSF, lymphotoxin, MIF or their receptors
    • G01N33/6869Interleukin
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/505Medicinal preparations containing antigens or antibodies comprising antibodies
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/20Immunoglobulins specific features characterized by taxonomic origin
    • C07K2317/24Immunoglobulins specific features characterized by taxonomic origin containing regions, domains or residues from different species, e.g. chimeric, humanized or veneered
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/30Immunoglobulins specific features characterized by aspects of specificity or valency
    • C07K2317/33Crossreactivity, e.g. for species or epitope, or lack of said crossreactivity
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/30Immunoglobulins specific features characterized by aspects of specificity or valency
    • C07K2317/34Identification of a linear epitope shorter than 20 amino acid residues or of a conformational epitope defined by amino acid residues
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/50Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
    • C07K2317/565Complementarity determining region [CDR]
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/70Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/76Antagonist effect on antigen, e.g. neutralization or inhibition of binding
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/90Immunoglobulins specific features characterized by (pharmaco)kinetic aspects or by stability of the immunoglobulin
    • C07K2317/92Affinity (KD), association rate (Ka), dissociation rate (Kd) or EC50 value
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/435Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
    • G01N2333/52Assays involving cytokines
    • G01N2333/54Interleukins [IL]

Definitions

  • the disclosure provides an isolated monoclonal antibody, or antigen binding portion thereof, wherein the antibody or antigen binding portion thereof comprises heavy and light chain variable regions, wherein the heavy chain variable region comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 712, 734, 756 and 778; and wherein the light chain variable region comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 720, 742, 764 and 786.
  • the disclosure provides an isolated monoclonal antibody, or antigen binding portion thereof, wherein the antibody or antigen binding portion thereof comprises a heavy chain and a light chain, wherein the heavy chain comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 726, 748, 770 and 792; and wherein the light chain comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 724, 746, 768 and 790.
  • the disclosure provides an isolated monoclonal antibody, or antigen binding portion thereof, wherein the antibody or antigen binding portion thereof comprises a heavy chain and a light chain comprising amino acid sequences selected from the group consisting of:
  • the disclosure provides an isolated monoclonal antibody, or antigen binding portion thereof, wherein the antibody or antigen binding portion thereof comprises a heavy chain and a light chain comprising amino acid sequences at least 90% identical to the amino acid sequences set forth in SEQ ID NO: 766 and 768, respectively.
  • the disclosure provides an isolated monoclonal antibody, or antigen binding portion thereof, wherein the antibody or antigen binding portion thereof comprises a heavy chain and a light chain comprising amino acid sequences at least 90% identical to the amino acid sequences set forth in SEQ ID NO: 788 and 790, respectively.
  • the disclosure provides an isolated monoclonal antibody, or antigen binding portion thereof, wherein the antibody or antigen binding portion thereof comprises a heavy chain and a light chain comprising amino acid sequences set forth in SEQ ID NO: 726 and 724, respectively.
  • the disclosure provides an isolated monoclonal antibody, or antigen binding portion thereof, wherein the antibody or antigen binding portion thereof comprises a heavy chain and a light chain comprising amino acid sequences at least 90% identical to the amino acid sequences set forth in SEQ ID NO: 792 and 790, respectively.
  • the disclosure provides a pharmaceutical composition comprising an isolated monoclonal antibody or antigen binding portion thereof, of the above aspects, and a pharmaceutically acceptable carrier.
  • the disclosure provides a cell transformed with the above expression vector.
  • the disclosure provides that the one or more additional therapeutic agents is selected from the group consisting of sunitinib (Sutent ® ), Cabozantinib (Cabometyx ® ), Axitinib (Inlyta ® ), Lenvatinib (Lenvima ® ), Everolimus (Afmitor ® ), Bevacizumab (Avastin ® ), epacadostat, NKTR-214 (CD-122-biased agonist), tivozanib (Fotivda ® ), abexinostat, Ipilimumab (Yervoy ® ), tremelimumab, Pazopanib (Votrient ® ), Sorafenib (Nexavar ® ), Temsirolimus (Torisel ® ), Ramucirumab (Cyramza ® ), niraparib, savolitinib, voro
  • the disclosure provides that the one or more additional therapeutic agents is a LAG-3 inhibitor, optionally wherein the LAG-3 inhibitor is selected from the group consisting of LAG525, BMS-986016, and TSR-033.
  • the detection antibody is coupled to a detectable label.
  • the fluid sample is blood, serum, plasma, cell lysates or tissue lysates.
  • the cancer is selected from leukemia and lymphoma or the cancer is ovarian cancer.
  • the disclosure provides an isolated monoclonal antibody, or antigen binding portion thereof, wherein a mutation of the epitope bound by the antibody or antigen binding portion thereof inhibits, reduces, or blocks binding to both the antibody or antigen binding portion thereof and to the antibody or antigen binding portion thereof according to any of the above antibodies, or antigen binding fragments thereof.
  • the disclosure provides a method of detecting WSX-1 in a sample from a subject, the method comprising the steps of (a) contacting a sample from the subject with a detection antibody under conditions to permit the detection antibody to form a detection antibody- WSX-1 complex, if WSX-1 is present in the sample, wherein the detection antibody is an antibody, or antigen binding fragment thereof, according to any one of the above WSX-1 binding antibodies; and (b) detecting the presence of the complex, if any, produced in step (a).
  • alanine scanning refers to a technique used to determine the contribution of a specific wild-type residue to the stability or function(s) (e.g., binding affinity) of given protein or polypeptide.
  • the technique involves the substitution of an alanine residue for a wild-type residue in a polypeptide, followed by an assessment of the stability or function(s) (e.g., binding affinity) of the alanine-substituted derivative or mutant polypeptide and comparison to the wild-type polypeptide.
  • Techniques to substitute alanine for a wild-type residue in a polypeptide are known in the art.
  • the elevated expression of a substance (e.g., a protein marker, such as PD-L1) in a sample refers to an increase in the amount of the substance of about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% relative to the amount of the substance in a control sample, as determined by techniques known in the art (e.g., FACS).“Reduced expression,” “reduced expression levels,” or“reduced levels” refers to a decrease expression or decreased levels of a substance (e.g., a protein marker) in an individual relative to a control, such as an individual or individuals who are not suffering from the disease or disorder (e.g., cancer) or an internal control.
  • a substance e.g., a protein marker
  • angiogenesis refers to the process by which new blood vessels develop from pre-existing vessels (Varner et a! ., (1999) Angiogen. 3 :53- 60; Mousa et al., (2000) Angiogen. Stint. Inhib. 35:42-44; Kim et al., (2000) Amer. J. Path. 156: 1345-1362; Kim et al., (2000) J Biol ( ' hem. 275:33920-33928; Kumar et al. (2000) Angiogenesis: From Molecular to Integrative Pharm. 169-180).
  • these methods include, but are not limited to, binding assays such as enzyme-linked immuno-absorbent assay (ELISA), Forte Bio ⁇ systems, radioimmunoassay (RIA), Meso Scale Discovery assay (e.g., Meso Scale Discovery Electrochemiluminescence (MSD-ECL), and bead-based Luminex ® assay.
  • binding assays such as enzyme-linked immuno-absorbent assay (ELISA), Forte Bio ⁇ systems, radioimmunoassay (RIA), Meso Scale Discovery assay (e.g., Meso Scale Discovery Electrochemiluminescence (MSD-ECL), and bead-based Luminex ® assay.
  • binding assays such as enzyme-linked immuno-absorbent assay (ELISA), Forte Bio ⁇ systems, radioimmunoassay (RIA), Meso Scale Discovery assay (e.g., Meso Scale Discovery Electrochemiluminescence (MSD-ECL), and bead-
  • a functional assay may comprise contacting a polypeptide with a candidate antagonist molecule and measuring a detectable change in one or more biological activities normally associated with the polypeptide.
  • the potency of an antagonist is usually defined by its IC50 value (concentration required to inhibit 50% of the agonist response). The lower the IC50 value the greater the potency of the antagonist and the lower the concentration that is required to inhibit the maximum biological response.
  • the term“antibody” refers to a whole antibody comprising two light chain polypeptides and two heavy chain polypeptides. Whole antibodies include different antibody isotypes including IgM, IgG, IgA, IgD, and IgE antibodies.
  • the term“antibody” includes a polyclonal antibody, a monoclonal antibody, a chimerized or chimeric antibody, a humanized antibody, a primatized antibody, a deimmunized antibody, and a fully human antibody.
  • the antibody can be made in or derived from any of a variety of species, e.g., mammals such as humans, non-human primates (e.g., orangutan, baboons, or chimpanzees), horses, cattle, pigs, sheep, goats, dogs, cats, rabbits, guinea pigs, gerbils, hamsters, rats, and mice.
  • the antibody can be a purified or a recombinant antibody.
  • the term“antibody fragment,”“antigen binding fragment,” or similar terms refer to a fragment of an antibody that retains the ability to bind to a target antigen (e.g., IL-27) and inhibit the activity of the target antigen.
  • an antigen-binding fragment includes the variable region of a heavy chain polypeptide and the variable region of a light chain polypeptide. In some embodiments, an antigen-binding fragment described herein comprises the CDRs of the light chain and heavy chain polypeptide of an antibody.
  • Bispecific antibodies also include cross-linked or heteroconjugate antibodies. Heteroconjugate antibodies may be made using any convenient cross-linking methods. Suitable cross-linking agents are well known in the art, and are disclosed in U.S. Pat. No. 4,676,980, along with a number of cross-linking techniques.
  • CD112R refers to a member of poliovirus receptor-like proteins and is a co-inhibitory receptor for human T cells. CD112R is preferentially expressed on T cells and inhibits T cell receptor-mediated signals. CD112, widely expressed on antigen-presenting cells and tumor cells, is the ligand for CD112R. CD112R competes with CD226 to bind to CD112. Disrupting the CD112R-CD112 interaction enhances human T cell response. CD112R as a novel checkpoint for human T cells via interaction with CD112.
  • CD112R inhibitor refers to an agent that disrupts, blocks or inhibits the biological function or activity of CD112R.
  • the term“CD137” refers to a member of the tumor necrosis factor (TNF) receptor superfamily.
  • 4- IBB is a co-stimulatory immune checkpoint molecule, primarily for activated T cells. Crosslinking of CD137 enhances T cell proliferation, IL- 2 secretion, survival and cytolytic activity.
  • the term“4- IBB agonist” refers to an agent that stimulates, induces or increases one or more function of 4-1BB.
  • An exemplary 4-1BB agonist is Utomilumab (PF-05082566), a fully human IgG2 monoclonal antibody that targets this 4- IBB to stimulate T cells.
  • IL-27 can have proinflammatory effects, many studies suggest an important role of IL-27 as an immunosuppressive agent (Shimizu et al. (2006) J. Immunol. 176:7317-7324, Hisada et al. (2004) Cancer Res. 64: 1152-1156, Diakowski (2013) supra).
  • amino acid sequence of an exemplary human EBI3 protein is provided in SEQ ID NO: 698 (NCBI Reference Sequence: NP_005746.2; N-
  • a polypeptide includes an amino acid sequence having at least 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 200, 300, 400, or 500 (or any integer within these numbers) contiguous amino acids of an amino acid sequence selected from a sequence set forth in Table 12.
  • a nucleotide sequence includes a nucleotide sequence having at least 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 200, 300, 400, or 500 (or any integer within these numbers) contiguous nucleotides of a nucleotide sequence selected from a sequence set forth in Table 12.
  • Families of amino acid residues having similar side chains have been defined in the art, including basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine).
  • basic side chains e.g., lysine, arginine, histidine
  • acidic side chains e.g., aspartic acid
  • a nonessential amino acid residue in a binding polypeptide is preferably replaced with another amino acid residue from the same side chain family.
  • a string of amino acids can be replaced with a structurally similar string that differs in order and/or composition of side chain family members.
  • mutations may be introduced randomly along all or part of a coding sequence, such as by saturation mutagenesis, and the resultant mutants can be incorporated into binding polypeptides of the invention and screened for their ability to bind to the desired target.
  • the term“dendritic cell activation” refers to the transition from immature to mature dendritic cell; and the activated dendritic cells encompass mature dendritic cells and dendritic cells in the process of the transition, wherein the expression of CD80 and CD86 that induce costimulatory signals are elevated by the activating stimuli.
  • Mature human dendritic cells are cells that are positive for the expression of CD40, CD80, CD86, and HLA-class II (e.g., HLA- DR).
  • An immature dendritic cell can be distinguished from a mature dendritic cell, for example, based on markers selected from the group consisting of CD80 and CD86.
  • the term“effective dose” or“effective dosage” is defined as an amount sufficient to achieve or at least partially achieve the desired effect.
  • therapeutically effective dose is defined as an amount sufficient to cure or at least partially arrest the disease and its complications in a patient already suffering from the disease. Amounts effective for this use will depend upon the severity of the disorder being treated and the general state of the patient’s own immune system.
  • An epitope typically includes at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15 amino acids in a unique spatial conformation.
  • Methods for determining what epitopes are bound by a given antibody i.e., epitope mapping
  • epitope mapping include, for example, immunoblotting and immunoprecipitation assays, wherein overlapping or contiguous peptides from IL-27 are tested for reactivity with the given anti-IL-27 antibody.
  • Methods of determining spatial conformation of epitopes include techniques in the art and those described herein, for example, x-ray crystallography and 2-dimensional nuclear magnetic resonance (see, e.g. , Epitope Mapping Protocols inMethods in Molecular Biology, Vol. 66, G. E. Morris, Ed. (1996)).
  • epitope mapping methods such as, x-ray analyses of crystals of anti gen: antibody complexes which provides atomic resolution of the epitope and mass spectrometry combined with hydrogen/deuterium (H/D) exchange which studies the conformation and dynamics of anti gen: antibody interactions.
  • H/D hydrogen/deuterium
  • Other methods monitor the binding of the antibody to antigen fragments or mutated variations of the antigen where loss of binding due to a modification of an amino acid residue within the antigen sequence is often considered an indication of an epitope component.
  • computational combinatorial methods for epitope mapping can also be used. These methods rely on the ability of the antibody of interest to affinity isolate specific short peptides from combinatorial phage display peptide libraries. The peptides are then regarded as leads for the definition of the epitope corresponding to the antibody used to screen the peptide library.
  • computational algorithms have also been developed which have been shown to map conformational discontinuous epitopes.
  • human antibody includes antibodies having variable and constant regions (if present) of human germline immunoglobulin sequences.
  • Human antibodies of the disclosure can include amino acid residues not encoded by human germline immunoglobulin sequences (e.g., mutations introduced by random or site-specific mutagenesis in vitro or by somatic mutation in vivo) (See, e.g., Lonberg et al., (1994 ) Nature 368(6474): 856-859); Lonberg, (1994) Handbook of Experimental Pharmacology 113 :49-101; Lonberg & Huszar, (1995) Intern. Rev. Immunol. 13 :65-93, and Harding & Lonberg, (1995) Ann. N.Y.
  • inducing an immune response and“enhancing an immune response” are used interchangeably and refer the stimulation of an immune response (i.e., either passive or adaptive) to a particular antigen.
  • inducing CDC or ADCC refer to the stimulation of particular direct cell killing mechanisms.
  • Inhibition and blocking are also intended to include any measurable decrease in the binding affinity of IL-27 when in contact with an anti-IL-27 antibody as compared to IL-27 not in contact with an anti-IL-27 antibody, e.g, inhibits binding of IL-27 by at least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75% , 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%.
  • the terms “inhibits angiogenesis,” “diminishes angiogenesis,” and “reduces angiogenesis” refer to reducing the level of angiogenesis in a tissue to a quantity which is at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99% or less than the quantity in a corresponding control tissue, and most preferably is at the same level which is observed in a control tissue.
  • the term“inhibits growth” is intended to include any measurable decrease in the growth of a cell, e.g, the inhibition of growth of a cell by at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 99%, or 100%.
  • antibody isotypes e.g., IgGl, IgG2, IgG3, IgG4, IgM, IgAl IgA2, IgD, and IgE
  • IgGl immunoglobulin Gl
  • IgG2, IgG3, IgG4, IgM immunoglobulin A2
  • IgA2 immunoglobulin A2
  • IgD immunoglobulin D
  • ka is intended to refer to the on-rate constant for the association of an antibody with an antigen.
  • the value of ka is a numeric representation of the number of antibody/antigen complexes formed per second in a 1 molar (1M) solution of antibody and antigen, and is expressed in units M ⁇ sec 1 .
  • lymphocytes refers to a type of leukocyte or white blood cell that is involved in the immune defenses of the body. There are two main types of lymphocytes: B- cells and T-cells.
  • the term“monocyte” refers to a type of leukocyte and can differentiate into macrophages and dendritic cells to effect an immune response.
  • degenerate codon substitutions can be achieved by generating sequences in which the third position of one or more selected (or all) codons is substituted with mixed-base and/or deoxyinosine residues (Batzer et al., Nucleic Acid Res. 19:5081, 1991; Ohtsuka et ah, Biol. Chem. 260:2605-2608, 1985; and Cassol et al, 1992; Rossolini et al, Mol. Cell. Probes 8:91-98, 1994).
  • arginine and leucine modifications at the second base can also be conservative.
  • nucleic acid is used interchangeably with gene, cDNA, and mRNA encoded by a gene.
  • BLAST algorithm One example of an algorithm that is suitable for determining percent sequence identity and sequence similarity is the BLAST algorithm, which is described in Altschul et al., J. Mol. Biol. 215:403-410 (1990). Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information website.
  • “pharmaceutically acceptable” refers to those compounds, materials, compositions, and/or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues, organs, and/or bodily fluids of human beings and animals without excessive toxicity, irritation, allergic response, or other problems or complications commensurate with a reasonable benefit/risk ratio.
  • PD-1 Programmmed Cell Death Protein 1
  • Alternative names or synonyms for PD-1 include: PDCD1, PD1, CD279 and SLEB2.
  • PD-1 is expressed predominantly on previously activated T cells, B cells, and myeloid cells in vivo , and binds to two ligands, PD-L1 and PD-L2.
  • variable and constant regions that utilize particular human germline immunoglobulin sequences are encoded by the germline genes, but include subsequent rearrangements and mutations which occur, for example, during antibody maturation.
  • the variable region contains the antigen binding domain, which is encoded by various genes that rearrange to form an antibody specific for a foreign antigen.
  • the variable region can be further modified by multiple single amino acid changes (referred to as somatic mutation or hypermutation) to increase the affinity of the antibody to the foreign antigen.
  • the constant region will change in further response to an antigen (i.e ., isotype switch).
  • STAT3 phosphorylation refers to the phosphorylation of the Signal Transducer and Activator of Transcription 3 (STAT3) polypeptide, a transcription factor encoded by the STAT3 gene in humans.
  • STAT3 mediates the expression of a variety of genes in response to cell stimuli, and thus plays a key role in many cellular processes such as cell growth and apoptosis.
  • Methods to determine STAT3 phosphorylation as a result of IL-27 signaling include, but are not limited to, analysis of cells or cell extracts labeled with antibodies that specifically recognize phosphorylated STAT3 (see e.g., Fursov et ah, (2011) Assay Drug Dev Technol 9(4):420-429).
  • T reg cells or suppressor T cells and subtypes, including CD4 + FOXP3 + T reg cells, CD4 + FOXP3 T reg cells, Trl cells, Th3 cells, and T reg 17 cells, natural killer T cells (a.k.a. NKT cells), mucosal associated invariant T cells (MAITs), and gamma delta T cells (gd T cells), including Vy9/V52 T cells.
  • T reg cells or suppressor T cells including CD4 + FOXP3 + T reg cells, CD4 + FOXP3 T reg cells, Trl cells, Th3 cells, and T reg 17 cells, natural killer T cells (a.k.a. NKT cells), mucosal associated invariant T cells (MAITs), and gamma delta T cells (gd T cells), including Vy9/V52 T cells.
  • Any one or more of the aforementioned or unmentioned T cells may be the target cell type for a method of use of the invention.
  • the terms“therapeutically effective amount” or“therapeutically effective dose,” or similar terms used herein are intended to mean an amount of an agent (e.g., an anti-IL- 27 antibody or an antigen-binding fragment thereof) that will elicit the desired biological or medical response (e.g., an improvement in one or more symptoms of a cancer).
  • an agent e.g., an anti-IL- 27 antibody or an antigen-binding fragment thereof
  • TAM receptor refers to the TAM receptor protein tyrosine kinases (TYR03, AXL and MER). TAM receptors are involved in the regulation of immune system homeostasis. In a cancer setting, TAM receptors have a dual regulatory role, controlling the initiation and progression of tumor development and, at the same time, the associated anti tumor responses of diverse immune cells. Further description of TAM receptors is found in Paolino and Penninger (2016) Cancers 8(97): doi: 10.3390/cancers8100097). As used herein, the term “TAM receptor inhibitor” or“TAM inhibitor” refers to an agent that inhibits, blocks or reduces the function or activity of a TAM receptor.
  • 3D is a graph depicting the inhibition of IL- 27-mediated phosphorylation of STAT1 in HUT-78 cells by anti-IL-27 antibodies, as indicated, as measured by flow cytometry.
  • FIG. 3E is graph showing that SRF388 inhibits IL-27-mediated pSTATl in human whole blood T cells.
  • FIG. 4 is a graph depicting the reversal of IL-27-mediated inhibition of CD161 expression in T cells by a range of concentrations of anti-IL-27 antibodies, as indicated. CD161 expression was determined using flow cytometry.
  • CBA Cytometric Bead Array
  • IFN y interferon gamma
  • MSD Meso Scale Discovery
  • PBMCs peripheral blood mononuclear cells
  • PD-1 programmed death receptor- 1
  • RCC renal cell carcinoma
  • TNF a tumor necrosis factor alpha
  • 7D is a dotplot depicting the total tumor area as a percentage of total tissue area of fixed, sectioned lung tissue B16F 10 tumor tissue stained with hematoxylin and eosin isolated from B16F 10 tumor-bearing mice treated with anti-IL27 antibody (SRF388), isotype control antibody, aWSX-1 antibody or combined aPD-1 and aCTLA-4 antibodies, as indicated, as determined by image analysis software.
  • SRF388 anti-IL27 antibody
  • aWSX-1 antibody or combined aPD-1 and aCTLA-4 antibodies as indicated, as determined by image analysis software.
  • a similar reduction in surface lung metastasis number and total tumor area was observed with IL-27RA (WSX-1) mediated antibody blockade and with anti -PD- 1 + anti-CTLA-4 combination therapy.
  • FIG. 9 presents a tabulated summary of select monoclonal antibody properties.
  • FIG. 10A presents a chart of antibody sequences, with sequence partitioning reflecting NT numbering.
  • FIG. 10B presents a chart of antibody sequences (corresponding to the sequence chart of FIG. 10A), with sequence partitioning reflecting ImMunoGeneTics (IMGT) numbering.
  • IMGT ImMunoGeneTics
  • highlighted amino acids in CDR sequences show mutations from germline-encoded sequence.
  • antibody numbering including determination of CDR sequences, framework sequences, etc., can be performed in a number of art-recognized manners, including via the NT and IMGT numbering systems presented in FIG. 10A and FIG. 10B and employed elsewhere herein.
  • WSX-1 is a class I cytokine receptor that is homologous to the b2 chain of the IL-12R in both sequence and structure. This receptor is highly expressed by resting/naive CD4 + T cells and CD8 + T cells. Recent studies have identified IL-27, heterodimeric cytokine composed of the subunits EBI3 and IL-27p28, as the ligand for WSX-1. EBI3, a member of the class I cytokine receptor family, shares significant structural homology to IL-12p40, and IL-27p28 is closely related to IL-12p35.
  • the hybrid cells obtained in the fusion are cloned, and cell clones secreting the desired antibodies are selected.
  • spleen cells of Balb/c mice immunized with a suitable immunogen can be fused with cells of the myeloma cell line PAI or the myeloma cell line Sp2/0-Ag 14.
  • suitable culture medium which is supplemented with a selection medium, for example HAT medium, at regular intervals in order to prevent normal myeloma cells from overgrowing the desired hybridoma cells.
  • the cDNA coding for the variable regions of the heavy chain and light chain polypeptides of immunoglobulins are used to construct the phage display library. Methods for generating such a library are described in, e.g., Merz et al. (1995) J Neurosci Methods 62( 1 -2):213-9; Di Niro et al. (2005) Biochem J 388(Pt 3):889-894; and Engberg et al. (1995) Methods Mol Biol 51 :355-376.
  • a combination of selection and screening can be employed to identify an antibody of interest from, e.g., a population of hybridoma-derived antibodies or a phage display antibody library.
  • Suitable methods are known in the art and are described in, e.g., Hoogenboom (1997) Trends in Biotechnology 15:62-70: Brinkman et al. (1995), supra ; Ames et al. (1995), supra ; Kettleborough et al. (1994), supra ; Persic et al. (1997), supra ; and Burton et al. (1994), supra.
  • nucleic acids encoding the CDRs can be chemically synthesized as described in, e.g., Shiraishi et al. (2007) Nucleic Acids Symposium Series 51(1): 129- 130 and U.S. Patent No. 6,995,259.
  • the region of the nucleic acid sequence encoding the CDRs can be replaced with the chemically synthesized nucleic acids using standard molecular biology techniques.
  • the 5’ and 3’ ends of the chemically synthesized nucleic acids can be synthesized to comprise sticky end restriction enzyme sites for use in cloning the nucleic acids into the nucleic acid encoding the variable region of the donor antibody.
  • Modulation refers to an increase, decrease, or elimination of an effector function activity exhibited by a subject antibody containing an altered constant region as compared to the activity of the unaltered form of the constant region.
  • modulation includes situations in which an activity is abolished or completely absent.
  • the anti-IL-27 antibodies described herein comprise an IgG4 heavy chain constant region.
  • the IgG4 heavy chain constant region is a wild type IgG4 heavy chain constant region.
  • the IgG4 constant region comprises a mutation, e.g., one or both of S228P and L235E or L235A, e.g., according to EU numbering (Rabat, E.A., et al., supra).
  • Representative sequences for use in antibodies of the disclosure of wild-type and mutant IgG4 constant regions are set forth in Table 12.
  • the anti-IL-27 antibodies described herein comprise an IgGl constant region.
  • the IgGl heavy chain constant region is a wild type IgGl heavy chain constant region. In another embodiment, the IgGl heavy chain constant region comprises a mutation. Representative sequences for use in antibodies of the disclosure of wild-type and mutant IgG4 constant regions are set forth in Table 12.
  • an altered constant region that displays modulated ADCC and/or CDC activity may exhibit either increased or reduced ADCC and/or CDC activity compared to the unaltered constant region.
  • the anti-IL-27 antibody comprising an altered constant region can exhibit approximately 0 to 50% (e.g., less than 50, 49, 48, 47, 46, 45, 44, 43, 42, 41, 40, 39, 38,
  • An anti-IL-27 antibody described herein comprising an altered constant region displaying reduced ADCC and/or CDC may exhibit reduced or no ADCC and/or CDC activity.
  • an anti-IL-27 antibody described herein exhibits reduced or no effector function.
  • an anti-IL-27 antibody comprises a hybrid constant region, or a portion thereof, such as a G2/G4 hybrid constant region (see e.g., Burton et al. (1992) Adv Immun 5 L 1-18; Canfield et al. (1991) J Exp Med 173 : 1483-1491; and Mueller et al. (1997) Mol Immunol 34(61:441-452). See above.
  • an anti-IL-27 antibody may contain an altered constant region exhibiting enhanced or reduced complement dependent cytotoxicity (CDC).
  • Modulated CDC activity may be achieved by introducing one or more amino acid substitutions, insertions, or deletions in an Fc region of the antibody. See, e.g., U.S. patent no. 6,194,551. Alternatively or additionally, cysteine residue(s) may be introduced in the Fc region, thereby allowing interchain disulfide bond formation in this region.
  • the homodimeric antibody thus generated may have improved or reduced internalization capability and/or increased or decreased complement- mediated cell killing. See, e.g., Caron et al.
  • the antibodies or antigen-binding fragments thereof described herein can be produced using a variety of techniques known in the art of molecular biology and protein chemistry.
  • a nucleic acid encoding one or both of the heavy and light chain polypeptides of an antibody can be inserted into an expression vector that contains transcriptional and translational regulatory sequences, which include, e.g., promoter sequences, ribosomal binding sites, transcriptional start and stop sequences, translational start and stop sequences, transcription terminator signals, polyadenylation signals, and enhancer or activator sequences.
  • the regulatory sequences include a promoter and transcriptional start and stop sequences.
  • the expression vector can include more than one replication system such that it can be maintained in two different organisms, for example in mammalian or insect cells for expression and in a prokaryotic host for cloning and amplification.
  • Several possible vector systems are available for the expression of cloned heavy chain and light chain polypeptides from nucleic acids in mammalian cells.
  • One class of vectors relies upon the integration of the desired gene sequences into the host cell genome.
  • Cells which have stably integrated DNA can be selected by simultaneously introducing drug resistance genes such as E. coli gpt (Mulligan and Berg (1981) Proc Natl Acad Sci USA 78:2072) or Tn5 neo (Southern and Berg (1982) Mol Appl Genet 1:327).
  • the selectable marker gene can be either linked to the DNA gene sequences to be expressed, or introduced into the same cell by co-transfection (Wigler et al. (1979) Cell 16:77).
  • a second class of vectors utilizes DNA elements which confer autonomously replicating capabilities to an extrachromosomal plasmid.
  • These vectors can be derived from animal viruses, such as bovine papillomavirus (Sarver et al. (1982) Proc Natl Acad Sci USA , 79:7147), cytomegalovirus, polyoma virus (Deans et al. (1984) Proc Natl Acad Sci USA 81: 1292), or SV40 virus (Lusky and Botchan (1981 ) Nature 293 :79).
  • the expression vectors can be introduced into cells in a manner suitable for subsequent expression of the nucleic acid.
  • the method of introduction is largely dictated by the targeted cell type, discussed below.
  • Exemplary methods include CaPCE precipitation, liposome fusion, cationic liposomes, electroporation, viral infection, dextran-mediated transfection, polybrene-mediated transfection, protoplast fusion, and direct microinjection.
  • an antibody or fragment thereof can be expressed in, and purified from, transgenic animals (e.g., transgenic mammals).
  • transgenic animals e.g., transgenic mammals
  • an antibody can be produced in transgenic non-human mammals (e.g., rodents) and isolated from milk as described in, e.g., Houdebine (2002) Curr Opin Biotechnol 13(61:625-629: van Kuik-Romeijn et al. (2000) Transgenic Res 9(2): 155-159; and Pollock et al. (1999) J Immunol Methods 231(1-2): 147-157.
  • the antibodies and fragments thereof can be produced from the cells by culturing a host cell transformed with the expression vector containing nucleic acid encoding the antibodies or fragments, under conditions, and for an amount of time, sufficient to allow expression of the proteins.
  • Such conditions for protein expression will vary with the choice of the expression vector and the host cell, and will be easily ascertained by one skilled in the art through routine experimentation.
  • antibodies expressed in E. coli can be refolded from inclusion bodies (see, e.g., Hou et al. (1998) Cytokine 1_0:319-30).
  • an antibody or fragment thereof can be isolated or purified in a variety of ways known to those skilled in the art depending on what other components are present in the sample.
  • Standard purification methods include electrophoretic, molecular, immunological, and chromatographic techniques, including ion exchange, hydrophobic, affinity, and reverse-phase HPLC chromatography.
  • an antibody can be purified using a standard anti-antibody column (e.g., a protein-A or protein-G column). Ultrafiltration and diafiltration techniques, in conjunction with protein concentration, are also useful. See, e.g., Scopes (1994)“Protein Purification, 3 rd edition,” Springer-Verlag, New York City, New York. The degree of purification necessary will vary depending on the desired use. In some instances, no purification of the expressed antibody or fragments thereof will be necessary.
  • the antibodies or antigen-binding fragments thereof can be modified following their expression and purification.
  • the modifications can be covalent or non-covalent modifications.
  • Such modifications can be introduced into the antibodies or fragments by, e.g., reacting targeted amino acid residues of the polypeptide with an organic derivatizing agent that is capable of reacting with selected side chains or terminal residues.
  • Suitable sites for modification can be chosen using any of a variety of criteria including, e.g., structural analysis or amino acid sequence analysis of the antibodies or fragments.
  • Suitable conjugation methods involve incubating an antibody protein, or fragment thereof, with the fluorophore under conditions that facilitate binding of the fluorophore to the protein. See, e.g., Welch and Redvanly (2003) “Handbook of Radiopharmaceuticals: Radiochemistry and Applications,” John Wiley and Sons (ISBN 0471495603).
  • the stabilization moiety can improve the stability, or retention of, the antibody (or fragment) by at least 1.5 (e.g., at least 2, 5, 10, 15, 20, 25, 30, 40, or 50 or more) fold.
  • the primary vehicle or carrier in a pharmaceutical composition can be either aqueous or non-aqueous in nature.
  • a suitable vehicle or carrier can be water for injection, physiological saline solution or artificial cerebrospinal fluid, possibly supplemented with other materials common in compositions for parenteral administration.
  • the saline comprises isotonic phosphate-buffered saline.
  • neutral buffered saline or saline mixed with serum albumin are further exemplary vehicles.
  • pharmaceutical compositions comprise Tris buffer of about pH 7.0-8.5, or acetate buffer of about pH 4.0-5.5, which can further include sorbitol or a suitable substitute therefore.
  • Sustained release matrices can include polyesters, hydrogels, polylactides (U.S. Pat. No. 3,773,919 and EP 058,481), copolymers of L-glutamic acid and gamma ethyl-L-glutamate (Sidman et ah, Biopolymers, 22:547-556 (1983)), poly (2-hydroxyethyl-methacrylate) (Langer et ah, J. Biomed. Mater. Res., 15: 167-277 (1981) and Langer, Chem.
  • an anti-IL-27 antibody can be delivered by implanting certain cells that have been genetically engineered, using methods such as those described herein, to express and secrete the polypeptides.
  • such cells can be animal or human cells, and can be autologous, heterologous, or xenogeneic.
  • the cells can be immortalized.
  • the cells in order to decrease the chance of an immunological response, the cells can be encapsulated to avoid infiltration of surrounding tissues.
  • the encapsulation materials are typically biocompatible, semi-permeable polymeric enclosures or membranes that allow the release of the protein product(s) but prevent the destruction of the cells by the patient's immune system or by other detrimental factors from the surrounding tissues.
  • compositions described herein can be used in a number of diagnostic and therapeutic applications.
  • detectably-labeled anti gen -binding molecules can be used in assays to detect the presence or amount of the target antigens in a sample (e.g., a biological sample).
  • the compositions can be used in in vitro assays for studying inhibition of target antigen function.
  • the compositions can be used as positive controls in assays designed to identify additional novel compounds that inhibit complement activity or otherwise are useful for treating a complement- associated disorder.
  • the disclosure provides a method of detecting IL-27 in a biological sample or in a subject, comprising (i) contacting the sample or the subject (and optionally, a reference sample or subject) with any antibody described herein under conditions that allow interaction of the antibody molecule and IL-27 to occur, and (ii) detecting formation of a complex between the antibody molecule and the sample or the subject (and optionally, the reference sample or subject).
  • the disclosure provides a method to inhibit or reduce STAT1 and/or STAT3 phosphorylation in a cell, the method comprising contacting the cell with an isolated monoclonal antibody, or antigen binding fragment, provided by the disclosure, wherein the antibody, or antigen binding portion thereof, inhibits or reduces STAT1 and/or STAT3 phosphorylation in a cell.
  • the disclosure provides a method to inhibit or reduce inhibition of CD161 expression in a cell, the method comprising contacting the cell with an isolated monoclonal antibody, or antigen binding fragment, provided by the disclosure, wherein the antibody, or antigen binding portion thereof, inhibits or reduces inhibition of CD161 expression in a cell.
  • the disclosure provides a method of stimulating an immune response in a subject, the method comprising administering to the subject an effective amount of an isolated monoclonal antibody, or antigen binding portion thereof, that specifically binds to and antagonizes IL-27, provided by the disclosure, or a pharmaceutical composition comprising the antibody or antigen binding portion thereof, and a pharmaceutically acceptable carrier.
  • the disclosure provides a method of treating a cancer in a subject, the method comprising administering to the subject an effective amount an isolated monoclonal antibody, or antigen binding portion thereof, that specifically binds to and antagonizes IL-27, provided by the disclosure, or a pharmaceutical composition comprising the antibody or antigen binding portion thereof, and a pharmaceutically acceptable carrier.
  • the disclosure provides a method of stimulating an immune response, or treating a cancer in a subject, the method comprising administering to the subject an effective amount of an isolated monoclonal antibody, or antigen binding fragment, provided by the disclosure, or a pharmaceutical composition comprising the antibody or antigen binding portion thereof, and a pharmaceutically acceptable carrier, wherein the antibody, or antigen binding portion thereof, or the pharmaceutical composition, inhibits or reduces PD-L1 and/or TIM- 3 expression in a cell, thereby stimulating the immune response, or treating the cancer.
  • Administration can be achieved by, e.g., local infusion, injection, or by means of an implant.
  • the implant can be of a porous, non-porous, or gelatinous material, including membranes, such as sialastic membranes, or fibers.
  • the implant can be configured for sustained or periodic release of the composition to the subject. See, e.g., U.S. Patent Application Publication No. 20080241223; U.S. Patent Nos. 5,501,856; 4,863,457; and 3,710,795; EP488401; and EP 430539, the disclosures of each of which are incorporated herein by reference in their entirety.
  • a suitable dose of an antibody or fragment thereof described herein, which dose is capable of treating or preventing cancer in a subject can depend on a variety of factors including, e.g., the age, sex, and weight of a subject to be treated and the particular inhibitor compound used. For example, a different dose of a whole anti-IL-27 antibody may be required to treat a subject with cancer as compared to the dose of a IL-27-binding Fab’ antibody fragment required to treat the same subject. Other factors affecting the dose administered to the subject include, e.g., the type or severity of the cancer. For example, a subject having metastatic melanoma may require administration of a different dosage of an anti-IL-27 antibody than a subject with glioblastoma.
  • the composition contains any of the antibodies or antigen-binding fragments thereof described herein and one or more (e.g., two, three, four, five, six, seven, eight, nine, 10, or 11 or more) additional therapeutic agents such that the composition as a whole is therapeutically effective.
  • a composition can contain an anti-IL-27 antibody described herein and an alkylating agent, wherein the antibody and agent are each at a concentration that when combined are therapeutically effective for treating or preventing a cancer (e.g., melanoma) in a subject.
  • Levels in plasma may be measured, for example, by high performance liquid chromatography.
  • cell culture or animal modeling can be used to determine a dose required to achieve a therapeutically effective concentration within the local site.
  • compositions described herein can be used to treat a variety of cancers such as but not limited to: Kaposi's sarcoma, leukemia, acute lymphocytic leukemia, acute myelocytic leukemia, myeloblasts promyelocyte myelomonocytic monocytic erythroleukemia, chronic leukemia, chronic myelocytic (granulocytic) leukemia, chronic lymphocytic leukemia, mantle cell lymphoma, primary central nervous system lymphoma, Burkitt’s lymphoma and marginal zone B cell lymphoma, Polycythemia vera Lymphoma, Hodgkin's disease, non-Hodgkin's disease, multiple myeloma, Waldenstrom's macroglobulinemia, heavy chain disease, solid tumors, sarcomas, and carcinomas, fibrosarcoma, myxosar
  • an anti-IL-27 antibody, or antigen binding portion thereof, provided by the disclosure can be combined with one or more additional therapeutics or treatments, e.g., another therapeutic or treatment for a cancer.
  • the anti-IL-27 antibody, or antigen binding portion thereof can be administered to a subject (e.g., a human patient) in combination with one or more additional therapeutics, wherein the combination provides a therapeutic benefit to a subject who has, or is at risk of developing, cancer.
  • the one or more additional therapeutic agents is a PD-1 antagonist, a TIM-3 inhibitor, a LAG-3 inhibitor, a TIGIT inhibitor, a CD112R inhibitor, a TAM inhibitor, a STING agonist, a 4-1BB agonist, or a combination thereof.
  • the one or more additional therapeutic agents is a PD-1 antagonist.
  • the PD-1 antagonist is selected from the group consisting of: PDR001, nivolumab, pembrolizumab, pidilizumab, MED 10680, REGN2810, TSR-042, PF-06801591, AMP -224, AB122, and JTX-4014.
  • the one or more additional therapeutic agents is a PD-L1 inhibitor.
  • the PD-L1 inhibitor is selected from the group consisting of: FAZ053, Atezolizumab, Avelumab, Durvalumab, and BMS-936559.
  • the heavy chain Ab7-Vm-IgGl has the following sequence (FR1-CDR1-FR2-CDR2- FR3-C DR3 - F R4-( "oust an! region ):
  • a nucleic acid sequence encoding the heavy chain Ab7-Vm-IgGl has the following sequence (FR1-CDR 1 -FR2-CDR2-FR3-CDR3-FR4-( A//.ste// region ):
  • a nucleic acid sequence encoding the heavy chain Ab7-V H3 -IgGl has the following sequence (FR1-CDR 1 -FR2-CDR2-FR3-CDR3-FR4-( A//.ste// region ): GAGGTGAAGCTGGTGGAGTCTGGGGGAGGCTTGGTACAGCCTGGGGGGTCCCTGAGACTCTCCT
  • a nucleic acid sequence encoding the light chain Ab7-V L3 -Kappa has the following sequence (FR1-CDR 1 -FR2-CDR2-FR3-CDR3-FR4-(A//.sP//// region ):
  • the Ab7 antibody and Ab7 antibody variants produced as described in Table 2 were tested in a series of in vitro assays to ascertain their biological characteristics and activities.
  • Additional anti-IL-27 monoclonal antibodies representing multiple epitope bins were selected from eight naive human synthetic yeast libraries using methods described below.
  • yeast cells ( ⁇ 10 10 cells/library) were incubated with 3 ml of 100 nM biotinylated antigen (recombinant human IL-27; R&D Systems) for 30 min at 30°C in wash buffer (phosphate- buffered saline (PBS)/0.1% bovine serum albumin (BSA)). After washing once with 40 ml ice- cold wash buffer, the cell pellet was resuspended in 20 mL wash buffer, and Streptavidin MicroBeads (500 m ⁇ ) were added to the yeast and incubated for 15 min at 4°C. Next, the yeast cells were pelleted, resuspended in 20 mL wash buffer, and loaded onto a Miltenyi LS column.
  • wash buffer phosphate- buffered saline (PBS)/0.1% bovine serum albumin (BSA)
  • PBS phosphate- buffered saline
  • BSA bovine serum albumin
  • Yeast clones were grown to saturation and then induced for 48 h at 30°C with shaking. After induction, yeast cells were pelleted and the supernatants were harvested for purification IgGs were purified using a Protein A column and eluted with acetic acid, pH 2.0. Fab fragments were generated by papain digestion and purified over Kappa Select (GE Healthcare LifeSciences).
  • SRF388 binds to the p28 subunit (but not the EBI3 subunit) of the heterodimeric cytokine IL-27.
  • SRF388 bound to human, nonhuman primate, and rodent recombinant IL-27, and the extent of the binding differed between species.
  • the binding specificity of SRF388 to IL-27 was confirmed by testing against a panel of -4500 cell surface and soluble molecules, and no off-target binding was observed.
  • the binding specificity of IL-27 for its receptor IL-27RA (WSX-1) was also confirmed; no other cell surface receptor bound human IL-27.
  • the ability of SRF388 to block the interaction between human IL-27 and IL-27RA (WSX-1) was confirmed by Surface Plasmon Resonance.
  • Anti-IL-27 antibodies were serially diluted as desired in endotoxin-free PBS. PBS alone was added to wells for unstimulated and stimulated controls. 5pL of each dilution was added to a well of 45 pL blood and mixed by shaking on plate shaker 15 seconds 1000 RPM (Eppendorf Mix Mate). The plate was incubated for 60 minutes at 37°C on a plate warmer or in a 37°C incubator.
  • Lyse/Fix reagent (BD #558049) was diluted 1 :5 in sterile water (Hyclone #SH3052902) and warmed to 37°C in a water bath. 500 pL Lyse/Fix reagent was added to each well of the deep well plate and the plate was mixed on a plate shaker for 15 seconds at 1000 RPM. The plate was incubated for 15 min at 37°C.
  • the plate was centrifuged for 5 minutes at 1500 RPM at room temperature (Eppendorf centrifuge 5810R) and supernatant was discarded by flicking. 1 mL of endotoxin-free PBS was added per well and the plate was shaken on plate shaker for 15 seconds at 1000 RPM. The plate was centrifuged for 5 minutes at 1500 RPM at room temperature (Eppendorf centrifuge 5810R) and supernatant was discarded by flicking. Cell pellets remained in the plate.
  • the plate was incubated for 1 hour at room temperature in the dark. After the 1-hour incubation, 100 pL of FACS buffer was added and the plate was centrifuged at 1500 RPM for 5 minutes at room temperature. The supernatant was discarded from the plate by flicking and the plate was resuspended in 100 pL FACS buffer for analysis by flow cytometry.
  • anti-IL-27 antibodies inhibit the phosphorylation of STAT1 in human whole blood.
  • the anti-IL-27 antibody Abl4 inhibited the phosphorylation of STAT1 at an IC50 of 24.7 ng/mL - in human whole blood.
  • Example 2 The anti-IL-27 antibodies described in Example 2 were further tested for their ability to inhibit IL-27-mediated phosphorylation of STAT1 in pooled human PBMCs by flow cytometry. Briefly, frozen cryovials of human PBMC’s (peripheral blood mononuclear cells), obtained from huffy coats, were removed from liquid nitrogen storage and quickly thawed in a 37°C water bath. The contents of each cryovial was removed with a PI 000 pipet and transferred to a 15 mL conical falcon tube. 2-3 mLs of complete RPMI-1640 (Gibco, 61870-036) was slowly added to the thawed cells and cells were gently swirled or flicked to suspend. Conical tubes were topped-off up to lOmLs with complete RPMI-1640 and tubes were inverted to mix. Conical tubes were centrifuged tube at 1400 RPM at room temperature for 8 minutes.
  • PBMC peripheral blood mononuclear cells
  • Fifty microliters (pL) of the antibody stock (4x) was added to the first 10 rows the plate of PBMC cells in the round bottom plate. In rows 11 and 12, 50 pL of serum-free RPMI-1640 cell media was added. The plate was then incubated at 37°C for 2 hours.
  • the pelleted PBMC’s were stained with pSTATl PE (BD Phosflow, 526069) 1 : 100 in FACS buffer (2% FBS, 2mM EDTA in DPBS) for 45 minutes at room temperature in the dark. Special care was taken to mix each well with a 12-channel pipette when adding the stain. After the 45-minute incubation, 100 pL FACS buffer was added into each well and the plate was centrifuged at 2000 RPM for 5 minutes. Supernatant was discarded by flicking and the plate was washed 2 times as described previously. Cells were resuspended in 100 pL FACS buffer and analyzed by flow cytometry.
  • FIG. 3E Representative data for SRF388 signaling inhibition in human T cells are shown in FIG. 3E. Consistent with observations made on the affinity of SRF388 to different species, the potency of IL-27 signaling inhibition by SRF388 was strongest in human, followed by cynomolgus monkey, rat, and mouse (see e.g., Table 7).
  • the C-type lectin CD161 is a marker of T cells whose expression is suppressed by IL-27.
  • Anti-IL-27 antibodies described in Example 2 were tested for their ability to reverse the IL-27- mediated inhibition of CD161 in pooled human PBMC cells by flow cytometry. Briefly, frozen cryovials of pooled human PBMC’s (peripheral blood mononuclear cells), obtained from huffy coats, were removed from liquid nitrogen storage and quickly thawed in a 37°C water bath. Contents of each cryovial was removed with a PI 000 pipet and transferred to a 15 mL conical falcon tube.
  • Anti-IL-27 antibodies were diluted in complete RPMI-1640 in the first row of a 96 well polypropylene plate to a top concentration of 40 pg/ml (will be lOug/ml final). Serial dilutions as desired (1 :2, 1 :3, etc... ) were made in the remainder of the first 10 rows of the plate. 50 pL of the antibody stock (4x) was added to the first 10 rows the plate of PBMC cells in the round bottom plate. In rows 11 and 12, 50 pL of complete RPMI-1640 was added.
  • the plate was removed from the incubator and agitated on a plate shaker for 30 seconds at 600 RPM. The plate was centrifuged at 1800 RPM for 5 minutes. Media was removed and set aside for additional assays and the plate was washed with 150 pL DPBS (Gibco, #14190-144). The washing steps were repeated 2 more times. The cell pellets were stained with 50 pL per well of staining cocktail as described in the Table 8 below:
  • Example 6 Enhancement of PD-l-Mediated Secretion of TNFa, IL-6 and other Cytokines by Anti-IL-27 Antibodies, Including Additional In Vitro Characterization of Anti-IL-27 Antibodies
  • Anti-IL-27 antibodies were tested for their ability to enhance PD-1 -mediated secretion of TNFa and IL-6 in human PBMC cells from cancer patients.
  • Human PBMC cells from cancer patients were cultured essentially as described in Example 5 with the addition of wells also receiving anti -PD-1 antibody, as indicated, at 1 pg/mL.
  • Supernatants from the assay were analyzed for TNFa and IL-6 using Human CBA Thl/Th2/Thl7 Kit (BD, 560484).
  • anti-IL-27 antibodies enhance the PD-1 -mediated secretion of TNFa and IL-6 in pooled human PBMC cells.
  • Anti-PD-1 antibody was used as a control in these assays and the combination of PD-1 and IL-27 blockade was also explored as shown in FIG. 5C.
  • SRF388 treatment led to increased TNF a production in 6 of 11 PBMC samples tested (determined by > 2 fold increase) including 2 of 4 healthy donors, 3 of 5 patients with RCC, and 1 of 2 patients with ovarian cancer. When tested in a subset of donors this activity was SRF388 dose dependent (data not shown).
  • Anti-PD-1 (pembrolizumab) treatment showed an increase in TNF a in 2 of the 11 donors tested (1 of 5 RCC and 1 of 2 ovarian cancer) while the combination of SRF388 and anti-PD-1 led to an increase in 10 of 11 donors.
  • Example 7 Inhibition of IL-27-Mediated Expression of PD-L1 and TIM3 by Anti-IL-27 Antibodies
  • Anti-IL-27 antibodies described in Examples 1 and 2 were tested for their ability to inhibit IL-27-mediated expression PD-L1 and TIM-3 in pooled human monocytes by flow cytometry.
  • Outer wells should be filled with 200 pL per well of DPBS (Gibco, 14190-144).
  • Anti-IL-27 antibodies were diluted in complete RPMI-1640 in the first row of a 96-well polypropylene plate to a top concentration of 40 pg/ml (lOpg/ml final concentration). Serial dilutions as desired (1 :2, 1 :3, etc...) were made in the remainder of the first 10 rows of the plate. 50 pL of the antibody stock (4x) was added to the first 10 rows the plate of PBMC cells in the round bottom plate. In rows 11 and 12, 1250 pL of complete RPMI-1640 was added.
  • the plate was removed from the incubator and agitated on a plate shaker for 30 seconds at 600 RPM. The plate was centrifuged at 1800 RPM for 5 minutes. Media was discarded by flicking and plate was washed with 150 pL DPBS (Gibco, 14190-144). The washing steps were repeated twice. The cell pellets were stained with 50 pL per well of staining cocktail as described in the Table 9 below:
  • anti-IL-27 antibodies potently inhibit the IL-27 mediated expression of PD-L1 and TIM3 in pooled human monocytes.
  • Anti-IL-27 antibodies were further tested for their ability to inhibit IL-27-mediated expression of PD-L1 in resting T cells (inactivated) essentially as described for FIGS. 6A, 6B and 6C. Resting T-cells were isolated from human huffy coats using RosetteSepTM Human T cell Enrichment Cocktail (Stemcell #15061).
  • the cell pellets were stained with 50 pL per well of staining cocktail as described in the Table 10 below:
  • Example 8 In Vivo Efficacy of an Anti-IL-27 Antibody in a Disseminated B16F10 Model of Melanoma
  • a model of melanoma lung metastasis was used to assess the antitumor activity of IL-27 blockade using the clinical candidate SRF388.
  • the growth of disseminated B16F10 lung metastases is known to be significantly reduced in EBI3 and I127ra (Wsx-l)-deficient mice (Sauer et ah, J Immunology 181 : 6148-6157). Since lung nodule size and growth kinetics are dependent on the number of B16F10 cells transferred and can proceed variably and rapidly, the combination of anti-PD-1 and anti-CTLA-4 was studied as a benchmark for therapeutic activity.
  • SRF388 pre treatment resulted in a significant reduction in overall tumor burden.
  • the effect of Abl4 on tumor growth in a B16F10 melanoma tumor model was evaluated.
  • B 16F 10 tumor bearing mice were euthanized by CO2 asphyxiation 18 days-post tumor cell injection and lungs were perfused with PBS via cardiac puncture, removed, and fixed in 10% neutral buffered formalin for 24 hours. Fixed lungs were then transferred to 70% ethanol and surface lung metastases were counted visually.
  • B16-Luc tumor-bearing animals were injected i.v.
  • VivoGlo D-luciferin in 200 pi PBS (Promega) twice weekly.
  • Five minutes after luciferin injection animals were anesthetized and bioluminescent imaging was performed using an IVIS Lumina LT Series III imager. Images were analyzed using Living Image (version 4.5.5) software and represented as total flux measurements in photons/second.
  • FIGS. 7A-7D treatment of B16F10 tumor-bearing mice with the anti-IL-27 antibody SRF388 resulted in a significant reduction in overall tumor burden as measured by both total counts of surface lung metastases (# pulmonary nodules, FIG. 7A), and by a reduction of tumor area in lung tissue sections by immunohistochemistry (IHC) analysis (FIG. 7C and FIG. 7D).
  • Blockade of p28 with SRF388 resulted in a 42% reduction in the number of pulmonary B16 nodules compared to isotype control treatment.
  • SRF388 treatment resulted in an 83% reduction in overall lung tumor metastasis area as measured by IHC (16.43 ⁇ 1.39% in the isotype control group versus 2.83 ⁇ 1.45% in the SRF388 treatment group).
  • FIG. 7D A similar reduction in surface lung metastasis number and total tumor area was observed with IL-27RA (WSX-1) mediated antibody blockade and with anti-PD-1 + anti-CTLA-4 combination therapy, as shown in FIG. 7D.
  • IL-27RA WSX-1
  • FIG. 7D These data are from 2 independent experiments in which anti-PD- 1 and anti-CTLA-4 benchmark combination demonstrated antitumor activity.
  • B16F10 cells 2.5 x 10 5
  • Mice were treated IP with 1 mg of either SRF388, anti-IL-27RA (WSX-1), or human IgG isotype control antibody (Days -7, 0, 7, 14).
  • Some animals were treated IP with anti-PD-1 and anti-CTLA-4 (Days 0, 4, 7, and 11).
  • IL-27 is known to be species cross-reactive and can induce pSTATl signaling and PD LI in murine splenocytes in vitro. This species cross-reactivity was used to study the effects of human IL-27 overexpression in mice and its inhibition by SRF388.
  • DNA plasmid minicircles encoding human IL-27 were administered to mice by hydrodynamic transfection, as described below, which resulted in high systemic levels of IL-27.
  • mice Six -week-old female BALB/c mice were injected with 20 pg of either empty vector or linked human IL-27 minicircle DNA (System Biosciences, Palo Alto, CA) in 2 mL 0.9% normal saline via the tail vein over the course of 5 seconds. Injected animals were transferred to an empty cage with a heating pad to recover for 5 minutes. Whole blood was collected into K2-EDTA tubes for plasma separation 24 hours after mini circle injection and plasma IL-27 levels were confirmed by ELISA. PBMCs and total splenocytes were collected 5 days after transfection and cells were stained and analyzed by flow cytometry. Expression of the indicated markers were analyzed on CD4+ T cells and CD8+ T cells. Analysis was performed using FlowJo software.
  • RNA samples were prepared by mechanical dissociation of whole spleens, followed by ACK lysis of red blood cells.
  • Total RNA was extracted from splenocytes with the RNeasy ® Mini Kit (Qiagen, Cat. No: 74104) and adjusted to 20 ng/ul in nuclease free water (Qiagen, Cat. No: 19101).
  • Gene expression profiling on was performed on Affymetrix GeneChip TM Mouse Gene 2.0 ST Arrays (Applied Biosystems, Cat. No: 902118). Processing of RNA samples, hybridization and array scanning were carried out using standard Affymetrix GeneChipTM protocols at the Boston University Microarray and Sequencing Resource (BUMSR).
  • FcyRIII/II was blocked by preincubating cells with rat anti-mouse CD16/CD32 mAb (1 pg per million cells; Biolegend, San Diego, CA) in PBS with 2% FBS and 2mM EDTA.
  • Cells were stained with APC-, PE-, Brilliant Violet 510-, and Brilliant Violet 711- conjugated mAbs against murine CD4 (clone GK1.5), CD8 (53-6.7), PD-L1 (10F.9G2), TIM3 (RMT3-23), LAG3 (C9B7W), and TIGIT (1G9) (Biolegend).
  • Cell-associated fluorescence was measured using an LSRFortessa X-20 flow cytometer (BD Biosciences), and analysis was performed using FlowJo software (Tree Star, Ashland, OR).
  • IL-27 promotes expression of inhibitory receptors by T cells in vivo
  • IL-27 minicircles led to upregulation of PD-L1, LAG-3 and TIGIT in splenic (Spleen) and peripheral blood (PBMC) CD4 + T cells.
  • PBMC peripheral blood
  • IL-27 minicircles upregulated PD-L1, LAG-3, TIGIT, and TIM-3.
  • FIG. 8C administration of IL-27 minicircles led to upregulation of PD-L1, Lag-3, and Tigit in splenic and peripheral blood CD4 + T cells.
  • IL-27 minicircles upregulated PD-L1, Lag-3, Tigit, and Tim-3.
  • the EBI3 assay utilizes both capture and detection antibodies specific for 2 distinct epitopes of human EBI3 and since the minicircle derived IL-27 is a tethered heterodimer this assay allows for detection of total IL 27 irrespective of SRF388 binding.
  • FIG. 8D shows that SRF388 treatment completely inhibits IL-27 detection in plasma by MSD. Similar data were seen when a dose of 25 mg/kg of SRF388 was tested. These data suggest that SRF388 at a dose of 25 mg/kg or higher can completely saturate minicircle derived IL-27 in vivo. This complete target engagement was also confirmed in a pSTATl functional assay.
  • SRF388 To assess the ability of SRF388 to block the activity of IL-27 in vivo, the expression of PD LI, Tim-3, Lag-3, and Tigit were analyzed in murine PBMCs and splenocytes by flow cytometry. SRF388 significantly blocked IL 27-induced PD-L1 and Lag 3 expression in CD4+ PBMCs and PD-L1, Tim-3, Lag-3, and Tigit expression in CD8+ PBMCs. SRF388 treatment also blocked IL 27 induced PD-L1, Lag-3, and Tigit expression in CD4+ splenocytes and PD-L1 and Lag 3 expression in CD8+ splenocytes. These data suggest that SRF388 can both engage and block the activity of human IL-27 in vivo.
  • Example 10 SRF388 Binding Properties and IL-27 Receptor Blockade The association and dissociation of recombinant human IL-27 at concentrations ranging from 0 to 5.0 pg/mL with an SRF388 concentration of 1 m g/mL were determined. Final binding kinetic parameters are shown in Table 14 along with binding model fit parameters (R2 and c2) that demonstrate goodness of the model fitting to the data.
  • Human IL-27 displayed the strongest binding affinity for SRF388 of all species tested in this study (3.86 pM). Recombinant rat and cynomolgus monkey IL-27 also showed strong affinities for SRF388 with values of 80.9 and 37.4 pM, respectively, although somewhat weaker than the human protein. Recombinant mouse IL-27 had the weakest affinity for SRF388 by comparison with the human protein, with a value in the nM range (4.43 nM) as indicated by its slower association and faster dissociation rates.
  • IL-27 interleukin 27
  • k a association constant
  • k d dissociation constant
  • K D binding affinity
  • a number of sub-selections of anti-IL-27 antibodies of the instant disclosure share sequence homology across their CDR regions, providing a diversity of variant CDR sequences that have been validated as retaining functionality. It is expressly contemplated herein that the following consensus CDR sequences are fully supported by - and are therefore within the scope of - the instant disclosure.
  • a consensus heavy chain CDR1 (IMGT) sequence for these homologous antibodies is therefore N-GFTF[S/A/R][S/R][T/Y][G/S]-C (SEQ ID NO: 412) and, accordingly, more generally contemplated herein as a consensus heavy chain CDR1 (IMGT) sequence is N-GFTFXXXX-C (SEQ ID NO: 408), where X is any amino acid residue.
  • a consensus heavy chain CDR2 (IMGT) sequence for these homologous antibodies is therefore N-ISSS[S/G][S/A]YI-C (SEQ ID NO: 413) and, accordingly, more generally contemplated herein as a consensus heavy chain CDR2 (IMGT) sequence is N-ISSSXXYI-C (SEQ ID NO: 409), where X is any amino acid residue.
  • FTFRSYGMN 9 (SEQ ID NO: 164) 17 FTFASYGMN 9 (SEQ ID NO: 142)
  • Consensus heavy chain CDR1 (NT) and CDR2 (NT) sequences for these homologous antibodies are therefore N-FTF[S/A/R][S/R][T/Y][G/S]MN-C (SEQ ID NO: 414) and N- [G/S]ISSS[S/G][S/A]YI[L/Y]YADSVKG-C (SEQ ID NO: 415), respectively.
  • consensus heavy chain CDR1 (NT) and CDR2 (NT) sequences N-FTFXXXXMN-C (SEQ ID NO: 410) and N- XISSSXXYIXYADSVKG-C (SEQ ID NO: 411), respectively, where X is any amino acid residue.
  • Heavy chain CDR3 (IMGT or NT) and light chain CDRs CDR1 (IMGT or NT), CDR2 (IMGT or NT) and CDR3 (IMGT or NT) were fully conserved between SRF388, SRF381, SRF382, SRF384, SRF386 and SRF529.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Immunology (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Biophysics (AREA)
  • Urology & Nephrology (AREA)
  • Biomedical Technology (AREA)
  • Hematology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Cell Biology (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Biotechnology (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Food Science & Technology (AREA)
  • Microbiology (AREA)
  • Zoology (AREA)
  • Toxicology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Hospice & Palliative Care (AREA)
  • Oncology (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
PCT/US2019/053036 2018-12-13 2019-09-25 Anti-il-27 antibodies and uses thereof Ceased WO2020123011A1 (en)

Priority Applications (14)

Application Number Priority Date Filing Date Title
JP2021533517A JP7535045B2 (ja) 2018-12-13 2019-09-25 抗il-27抗体及びその使用
KR1020217019243A KR102933484B1 (ko) 2018-12-13 2019-09-25 항-il-27 항체 및 그의 용도
AU2019399474A AU2019399474A1 (en) 2018-12-13 2019-09-25 Anti-IL-27 antibodies and uses thereof
MX2021006980A MX2021006980A (es) 2018-12-13 2019-09-25 Anticuerpos anti-il-27 y usos de estos.
CA3121420A CA3121420A1 (en) 2018-12-13 2019-09-25 Anti-il-27 antibodies and uses thereof
SG11202105161YA SG11202105161YA (en) 2018-12-13 2019-09-25 Anti-il-27 antibodies and uses thereof
BR112021011393-2A BR112021011393A2 (pt) 2018-12-13 2019-09-25 Anticorpos anti-il-27 e usos dos mesmos
EP19895768.0A EP3894440A4 (en) 2018-12-13 2019-09-25 ANTI-IL-27 ANTIBODIES AND USES THEREOF
CN201980082814.5A CN113544151B (zh) 2018-12-13 2019-09-25 抗il-27抗体及其用途
US17/413,269 US12358978B2 (en) 2018-12-13 2019-09-25 Anti-IL-27 antibodies and uses thereof
EA202191666A EA202191666A1 (ru) 2018-12-13 2019-09-25 Антитела к il-27 и их применение
IL283875A IL283875A (en) 2018-12-13 2021-06-10 Anti-il-27 antibodies and uses thereof
JP2024077880A JP7805395B2 (ja) 2018-12-13 2024-05-13 抗il-27抗体及びその使用
US19/236,197 US20260055176A1 (en) 2018-12-13 2025-06-12 Anti-il-27 antibodies and uses thereof

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201862779341P 2018-12-13 2018-12-13
US62/779,341 2018-12-13

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US17/413,269 A-371-Of-International US12358978B2 (en) 2018-12-13 2019-09-25 Anti-IL-27 antibodies and uses thereof
US19/236,197 Division US20260055176A1 (en) 2018-12-13 2025-06-12 Anti-il-27 antibodies and uses thereof

Publications (1)

Publication Number Publication Date
WO2020123011A1 true WO2020123011A1 (en) 2020-06-18

Family

ID=71075792

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2019/053036 Ceased WO2020123011A1 (en) 2018-12-13 2019-09-25 Anti-il-27 antibodies and uses thereof

Country Status (14)

Country Link
US (2) US12358978B2 (https=)
EP (1) EP3894440A4 (https=)
JP (2) JP7535045B2 (https=)
KR (1) KR102933484B1 (https=)
CN (1) CN113544151B (https=)
AU (1) AU2019399474A1 (https=)
BR (1) BR112021011393A2 (https=)
CA (1) CA3121420A1 (https=)
EA (1) EA202191666A1 (https=)
IL (1) IL283875A (https=)
MA (1) MA54469A (https=)
MX (1) MX2021006980A (https=)
SG (1) SG11202105161YA (https=)
WO (1) WO2020123011A1 (https=)

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2021062244A1 (en) * 2019-09-25 2021-04-01 Surface Oncology, Inc. Anti-il-27 antibodies and uses thereof
US20220089714A1 (en) * 2020-09-22 2022-03-24 Institute For Cancer Research D/B/A The Research Institute Of Fox Chase Cancer Center Treatment Of Non-Alcoholic Steatohepatitis (NASH) With IL-27 Antibody
WO2023230116A1 (en) * 2022-05-25 2023-11-30 Surface Oncology, Inc. Use of anti-il-27 antibodies
WO2023230128A1 (en) * 2022-05-25 2023-11-30 Surface Oncology, Inc. Use of anti-il-27 antibodies
WO2024028773A1 (en) * 2022-08-03 2024-02-08 Pfizer Inc. Anti- il27r antibodies and methods of use thereof
WO2024097641A3 (en) * 2022-11-01 2024-07-18 Surface Oncology, LLC Methods of treating a tumor
WO2026055168A1 (en) * 2024-09-06 2026-03-12 Surface Oncology, LLC Anti-il-27 antibodies and uses and doses thereof
WO2026055167A1 (en) * 2024-09-05 2026-03-12 Surface Oncology, LLC Anti-il-27 antibodies and use of biomarkers in uses thereof

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20080124345A1 (en) * 2005-12-30 2008-05-29 Mike Rothe Antibodies directed to HER-3 and uses thereof
US20130189262A1 (en) * 2011-01-14 2013-07-25 Five Prime Therapeutics, Inc. IL-27 Antagonists for Treating Inflammatory Diseases
WO2018098363A2 (en) * 2016-11-23 2018-05-31 Bioverativ Therapeutics Inc. Bispecific antibodies binding to coagulation factor ix and coagulation factor x
WO2019183499A1 (en) * 2018-03-22 2019-09-26 Surface Oncology, Inc. Anti-il-27 antibodies and uses thereof

Family Cites Families (59)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3773919A (en) 1969-10-23 1973-11-20 Du Pont Polylactide-drug mixtures
US3710795A (en) 1970-09-29 1973-01-16 Alza Corp Drug-delivery device with stretched, rate-controlling membrane
US4263428A (en) 1978-03-24 1981-04-21 The Regents Of The University Of California Bis-anthracycline nucleic acid function inhibitors and improved method for administering the same
IE52535B1 (en) 1981-02-16 1987-12-09 Ici Plc Continuous release pharmaceutical compositions
DE3374837D1 (en) 1982-02-17 1988-01-21 Ciba Geigy Ag Lipids in the aqueous phase
HUT35524A (en) 1983-08-02 1985-07-29 Hoechst Ag Process for preparing pharmaceutical compositions containing regulatory /regulative/ peptides providing for the retarded release of the active substance
EP0143949B1 (en) 1983-11-01 1988-10-12 TERUMO KABUSHIKI KAISHA trading as TERUMO CORPORATION Pharmaceutical composition containing urokinase
US4676980A (en) 1985-09-23 1987-06-30 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Target specific cross-linked heteroantibodies
US4863457A (en) 1986-11-24 1989-09-05 Lee David A Drug delivery device
WO1988007089A1 (en) 1987-03-18 1988-09-22 Medical Research Council Altered antibodies
EP0436597B1 (en) 1988-09-02 1997-04-02 Protein Engineering Corporation Generation and selection of recombinant varied binding proteins
US5223409A (en) 1988-09-02 1993-06-29 Protein Engineering Corp. Directed evolution of novel binding proteins
US5164188A (en) 1989-11-22 1992-11-17 Visionex, Inc. Biodegradable ocular implants
WO1991010737A1 (en) 1990-01-11 1991-07-25 Molecular Affinities Corporation Production of antibodies using gene libraries
US5780225A (en) 1990-01-12 1998-07-14 Stratagene Method for generating libaries of antibody genes comprising amplification of diverse antibody DNAs and methods for using these libraries for the production of diverse antigen combining molecules
US5427908A (en) 1990-05-01 1995-06-27 Affymax Technologies N.V. Recombinant library screening methods
GB9015198D0 (en) 1990-07-10 1990-08-29 Brien Caroline J O Binding substance
US5698426A (en) 1990-09-28 1997-12-16 Ixsys, Incorporated Surface expression libraries of heteromeric receptors
KR0185215B1 (ko) 1990-11-30 1999-05-01 요시다 쇼오지 서방성 안구삽입용 약제
CA2405246A1 (en) 1990-12-03 1992-06-11 Genentech, Inc. Enrichment method for variant proteins with alterred binding properties
US6565841B1 (en) 1991-03-15 2003-05-20 Amgen, Inc. Pulmonary administration of granulocyte colony stimulating factor
DK0580737T3 (da) 1991-04-10 2004-11-01 Scripps Research Inst Heterodimere receptorbiblioteker ved anvendelse af phagemider
ES2341666T3 (es) 1991-12-02 2010-06-24 Medimmune Limited Produccion de autoanticuerpos de repertorios de segmentos de anticue rpos expresados en la superficie de fagos.
WO1993015722A1 (en) 1992-02-07 1993-08-19 Syntex (Usa) Inc. Controlled delivery of pharmaceuticals from preformed porous microparticles
US5714350A (en) 1992-03-09 1998-02-03 Protein Design Labs, Inc. Increasing antibody affinity by altering glycosylation in the immunoglobulin variable region
US5733743A (en) 1992-03-24 1998-03-31 Cambridge Antibody Technology Limited Methods for producing members of specific binding pairs
US6005079A (en) 1992-08-21 1999-12-21 Vrije Universiteit Brussels Immunoglobulins devoid of light chains
AU701578B2 (en) 1992-08-21 1999-02-04 Vrije Universiteit Brussel Immunoglobulins devoid of light chains
WO1994025591A1 (en) 1993-04-29 1994-11-10 Unilever N.V. PRODUCTION OF ANTIBODIES OR (FUNCTIONALIZED) FRAGMENTS THEREOF DERIVED FROM HEAVY CHAIN IMMUNOGLOBULINS OF $i(CAMELIDAE)
AU691811B2 (en) 1993-06-16 1998-05-28 Celltech Therapeutics Limited Antibodies
EP0733070A1 (en) 1993-12-08 1996-09-25 Genzyme Corporation Process for generating specific antibodies
PT1231268E (pt) 1994-01-31 2005-11-30 Univ Boston Bancos de anticorpos policlonais
US5516637A (en) 1994-06-10 1996-05-14 Dade International Inc. Method involving display of protein binding pairs on the surface of bacterial pili and bacteriophage
US5731168A (en) 1995-03-01 1998-03-24 Genentech, Inc. Method for making heteromultimeric polypeptides
AU725609C (en) 1995-08-18 2002-01-03 Morphosys Ag Protein/(poly)peptide libraries
JP2978435B2 (ja) 1996-01-24 1999-11-15 チッソ株式会社 アクリロキシプロピルシランの製造方法
ES2292236T3 (es) 1998-04-02 2008-03-01 Genentech, Inc. Variantes de anticuerpos y sus fragmentos.
US6995259B1 (en) 1998-10-23 2006-02-07 Sirna Therapeutics, Inc. Method for the chemical synthesis of oligonucleotides
ES2350687T3 (es) 2002-07-03 2011-01-26 Ono Pharmaceutical Co., Ltd. Composiciones de inmunopotenciación.
CA2555421A1 (en) * 2004-02-17 2005-09-01 Schering Corporation Agonists and antagonists of p28 ebi3 and wsx/tccr for treating immune disorders
US8685435B2 (en) 2004-04-30 2014-04-01 Allergan, Inc. Extended release biodegradable ocular implants
RU2494107C2 (ru) 2005-05-09 2013-09-27 Оно Фармасьютикал Ко., Лтд. Моноклональные антитела человека к белку программируемой смерти 1 (pd-1) и способы лечения рака с использованием анти-pd-1-антител самостоятельно или в комбинации с другими иммунотерапевтическими средствами
CN104356236B (zh) 2005-07-01 2020-07-03 E.R.施贵宝&圣斯有限责任公司 抗程序性死亡配体1(pd-l1)的人单克隆抗体
KR20130108481A (ko) 2005-08-19 2013-10-02 아보트 러보러터리즈 이원 가변 도메인 면역글로불린 및 이의 용도
US7612181B2 (en) 2005-08-19 2009-11-03 Abbott Laboratories Dual variable domain immunoglobulin and uses thereof
HRP20131167T1 (hr) 2007-06-18 2014-01-03 Merck Sharp & Dohme B.V. Antitijela za humani receptor programirane smrti pd-1
US8877688B2 (en) 2007-09-14 2014-11-04 Adimab, Llc Rationally designed, synthetic antibody libraries and uses therefor
US8691730B2 (en) 2007-09-14 2014-04-08 Adimab, Llc Rationally designed, synthetic antibody libraries and uses therefor
WO2010098788A2 (en) 2008-08-25 2010-09-02 Amplimmune, Inc. Pd-i antagonists and methods for treating infectious disease
AU2009333580B2 (en) 2008-12-09 2016-07-07 Genentech, Inc. Anti-PD-L1 antibodies and their use to enhance T-cell function
US20100297127A1 (en) 2009-04-08 2010-11-25 Ghilardi Nico P Use of il-27 antagonists to treat lupus
WO2011066342A2 (en) 2009-11-24 2011-06-03 Amplimmune, Inc. Simultaneous inhibition of pd-l1/pd-l2
WO2011133931A1 (en) * 2010-04-22 2011-10-27 Genentech, Inc. Use of il-27 antagonists for treating inflammatory bowel disease
DK2593594T3 (en) 2010-07-16 2017-12-11 Adimab Llc ANTIBODY LIBRARIES
HRP20201595T1 (hr) 2011-11-28 2020-12-11 Merck Patent Gmbh Anti-pd-l1 protutijela i njihova uporaba
CN113967253A (zh) 2012-05-15 2022-01-25 百时美施贵宝公司 通过破坏pd-1/pd-l1信号传输的免疫治疗
BR112016015140A2 (pt) 2013-12-30 2018-01-23 Epimab Biotherapeutics Inc. imunoglobulina com fabs in-tandem e usos das mesmas
EP3916017A1 (en) 2014-12-22 2021-12-01 PD-1 Acquisition Group, LLC Anti-pd-1 antibodies
EP3528834A4 (en) * 2016-10-21 2020-07-01 Merck Sharp&Dohme Corp. TREATMENT OF CANCER USING A COMBINATION OF A PD-1 ANTAGONIST AND AN IL-27 ANTAGONIST

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20080124345A1 (en) * 2005-12-30 2008-05-29 Mike Rothe Antibodies directed to HER-3 and uses thereof
US20130189262A1 (en) * 2011-01-14 2013-07-25 Five Prime Therapeutics, Inc. IL-27 Antagonists for Treating Inflammatory Diseases
WO2018098363A2 (en) * 2016-11-23 2018-05-31 Bioverativ Therapeutics Inc. Bispecific antibodies binding to coagulation factor ix and coagulation factor x
WO2019183499A1 (en) * 2018-03-22 2019-09-26 Surface Oncology, Inc. Anti-il-27 antibodies and uses thereof

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See also references of EP3894440A4 *

Cited By (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2021062244A1 (en) * 2019-09-25 2021-04-01 Surface Oncology, Inc. Anti-il-27 antibodies and uses thereof
US20220089714A1 (en) * 2020-09-22 2022-03-24 Institute For Cancer Research D/B/A The Research Institute Of Fox Chase Cancer Center Treatment Of Non-Alcoholic Steatohepatitis (NASH) With IL-27 Antibody
US12240897B2 (en) * 2020-09-22 2025-03-04 Institute For Cancer Research Treatment of non-alcoholic steatohepatitis (NASH) with IL-27 antibody
WO2023230116A1 (en) * 2022-05-25 2023-11-30 Surface Oncology, Inc. Use of anti-il-27 antibodies
WO2023230128A1 (en) * 2022-05-25 2023-11-30 Surface Oncology, Inc. Use of anti-il-27 antibodies
WO2024028773A1 (en) * 2022-08-03 2024-02-08 Pfizer Inc. Anti- il27r antibodies and methods of use thereof
WO2024097641A3 (en) * 2022-11-01 2024-07-18 Surface Oncology, LLC Methods of treating a tumor
WO2026055167A1 (en) * 2024-09-05 2026-03-12 Surface Oncology, LLC Anti-il-27 antibodies and use of biomarkers in uses thereof
WO2026055168A1 (en) * 2024-09-06 2026-03-12 Surface Oncology, LLC Anti-il-27 antibodies and uses and doses thereof

Also Published As

Publication number Publication date
MA54469A (fr) 2021-10-20
KR20210104064A (ko) 2021-08-24
IL283875A (en) 2021-07-29
US20220259299A1 (en) 2022-08-18
SG11202105161YA (en) 2021-06-29
CN113544151A (zh) 2021-10-22
US20260055176A1 (en) 2026-02-26
CN113544151B (zh) 2025-03-14
JP2022514499A (ja) 2022-02-14
MX2021006980A (es) 2021-07-15
BR112021011393A2 (pt) 2021-08-31
JP2024109672A (ja) 2024-08-14
KR102933484B1 (ko) 2026-03-04
US12358978B2 (en) 2025-07-15
EP3894440A1 (en) 2021-10-20
EA202191666A1 (ru) 2022-03-14
JP7805395B2 (ja) 2026-01-23
EP3894440A4 (en) 2022-09-07
CA3121420A1 (en) 2020-06-18
AU2019399474A1 (en) 2021-06-03
JP7535045B2 (ja) 2024-08-15

Similar Documents

Publication Publication Date Title
US20260055176A1 (en) Anti-il-27 antibodies and uses thereof
US20250154244A1 (en) Anti-il-27 antibodies and uses thereof
EP3652209A2 (en) Agonist antibodies that bind human cd137 and uses thereof
US20240199732A1 (en) Anti-IL-27 Antibodies and Uses Thereof
WO2019089753A2 (en) Cd137 antibodies and pd-1 antagonists and uses thereof
EA051778B1 (ru) Антитела к il-27 и их применение
EA052811B1 (ru) Антитела против ил-27 и их применение

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 19895768

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 3121420

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2019399474

Country of ref document: AU

Date of ref document: 20190925

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2021533517

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112021011393

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 2019895768

Country of ref document: EP

Effective date: 20210713

ENP Entry into the national phase

Ref document number: 112021011393

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20210611

WWG Wipo information: grant in national office

Ref document number: 201980082814.5

Country of ref document: CN

WWG Wipo information: grant in national office

Ref document number: 17413269

Country of ref document: US