WO2020118305A1

WO2020118305A1 - Muc4 car-t cells for treating cancer

Info

Publication number: WO2020118305A1
Application number: PCT/US2019/065276
Authority: WO
Inventors: Timothy C. Wang; Siddhartha MUKHERJEE; Surinder K. Batra
Original assignee: The Trustees Of Columbia University In The City Of New York
Priority date: 2018-12-07
Filing date: 2019-12-09
Publication date: 2020-06-11

Abstract

Disclosed herein are methods of administering an agent targeting a mucin such as MUC4 for cancer immunotherapy.

Description

MUC4 CAR-T CELLS FOR TREATING CANCER

Field of the Invention

The present disclosure relates to methods and compositions for inhibiting tumor cell growth, increasing tumor cell death, and treating cancer. In particular, the present disclosure relates to the use of anti-MUC4 chimeric antigen receptor T cells (CAR-T cells) to inhibiting tumor cell growth or increasing tumor cell death.

Background of Disclosure

Chimeric antigen receptor T cells (CAR-T cells) are widely used to recognize antigens on cells with both high affinity and specificity. In a CAR-T cell, the T cell receptor is swapped with an antigen-binding fragment of an antibody, thereby obviating the need for HLA accessory molecules. The recombinant CAR is fused to signaling domains leading to activation of the T cell upon binding of the CAR to the target antigen. CAR-T cells have been slow in development for most solid malignancies, in part because of limitations in identifying common surface markers or antigens expressed by tumors.

MUC4 is normally expressed in early development, but shows limited expression in adult tissues, primarily salivary glands, reproductive tract, mammary epithelium and parotid and submandibular glands. However, it is upregulated in many cancers, including pancreatic ductal adenocarcinoma (PD AC), esophageal adenocarcinoma, colon cancer, gall bladder cancer, etc.

MUC4 is the most differentially overexpressed transmembrane mucin in PD AC and has been demonstrated to functionally contribute to the pathobiology of the disease. While essentially undetectable in normal pancreatic ducts, MUC4 expression is observed in the earlier pancreatic intraepithelial neoplasms (PanIN lesions) and its expression increases with disease progression. MUC4 is often overexpressed in pancreatic adenocarcinomas and has been shown to promote tumor growth and metastasis. Srivastava et al., MicroRNA-150 directly targets MUC-4 and suppresses growth and malignant behavior of pancreatic cancer cells, Carcinogenesis, 2011, 32 (12): 1832-9. MUC4 detection is emerging as a method to diagnose pancreatic cancer, especially since MUC4 is not detectably expressed in normal pancreas and increased expression of MUC-4 suggests a greater progression of the disease. MUC4 expression in esophageal cancer often leads to increased tumor proliferation and migration. Like with prostate cancer, increased expression of MUC4 suggests greater development of esophageal cancer. Unlike pancreatic and esophageal cancers, MUC4 expression is suppressed in the primary tumor when compared to normal cells. It, however, is found to be overexpressed in lymph node metastases. The initial reduction in MUC-4 appears to promote the transition to the primary tumor, but its subsequent increase in expression facilitate metastasis and ultimately increased malignancy. Workman et al., The membrane mucin MUC-4 is elevated in breast tumor lymph node metastases relative to matched primary tumors and confers aggressive properties to breast cancer cells, Breast Cancer Res. (2009) 11 (5): R70. MUC4 is found to be overexpressed in papillary thyroid carcinoma, and could serve as a potential marker of malignancy and prognosis. Nam et al., Expression of the membrane mucins MUC4 and MUC15, potential markers of malignancy and prognosis, in papillary thyroid carcinoma, Thyroid, (2011) 21 (7): 745-50. MUC-4 is also found to be a very sensitive and specific marker in low-grade fibromyxoid sarcoma. Doyle et al., MUC-4 is a highly sensitive and specific marker for low-grade fibromyxoid sarcoma, Am. J. Surg. Pathol. (2011) 35 (5): 733—41.

The clinical use of CAR-T cells has been limited to targeting a narrow range of cell surface antigens, further supporting the need for improved and novel approaches in the treatment of cancer.

Summary

The present disclosure provides for an immune cell expressing a chimeric antigen receptor (CAR), wherein the CAR comprises: i) an antigen-binding fragment that binds MUC4, ii) a transmembrane domain, and iii) at least one costimulatory domain. In one embodiment, the CAR comprises an intracellular signaling domain comprising at least one costimulatory domain.

In one embodiment, the CAR comprises two costimulatory domains.

The MUC4 may be a glycoform of MUC4, such as a Tn (GalNAcal-O-Ser/Thr) glycoform of MUC4, or a sialyl-Tn (STn) (NeuAca2-6-GalNAcal-0-Ser/Thr) glycoform of MUC4.

The antigen-binding fragment may be a single-chain antibody fragment (scFv) that specifically binds MUC4.

The antigen-binding fragment may bind to human MUC4. For example, the scFv may bind to human MUC4.

The immune cell may be a T cell.

The CAR may further comprise: a hinge domain, a cytoplasmic signaling domain, or a combination thereof.

The at least one costimulatory domain may be derived from a co- stimulatory receptor selected from the group consisting of CD28, 4- IBB, and ICOS.

The at least one costimulatory domain may comprise a signaling domain of CD28 and a signaling domain of ICOS.

The CAR may comprise a cytoplasmic signaling domain, which is from CD3z.

The CAR may comprise a hinge domain, which is from CD8a or CD28a.

The transmembrane domain may be from CD8, CD28, or ICOS.

In one embodiment, the CAR comprises: (i) a scFv that binds to MUC4, (ii) a hinge domain from CD8a, (iii) a transmembrane domain from CD8 or CD28, (iv) a costimulatory domain from CD28 or 4- IBB, or a combination thereof, and (v) a cytoplasmic signaling domain from CD3z.

The present disclosure provides for a nucleic acid molecule encoding a chimeric antigen receptor (CAR), wherein the CAR comprises: i) an antigen-binding fragment that binds MUC4, ii) a transmembrane domain, and iii) at least one costimulatory domain. Also encompassed by the present disclosure is a method of inhibiting tumor cell growth, and/or increasing tumor cell death, the method comprising administering to tumor cells the present immune cell or the present nucleic acid molecule.

The present disclosure also provides for a method of treating cancer in a subject, the method comprising administering to the subject the present immune cell or the present nucleic acid molecule.

The cancer may be pancreatic cancer (e.g., pancreatic ductal adenocarcinoma (PD AC)), esophageal adenocarcinoma, colon cancer, or gall bladder cancer.

Brief Description of the Drawings

The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.

The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present disclosure, which can be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein.

Figure 1A. pHIVzsGreen with MUC4 CD28z insert (Transfer Vector), and MUC4 CD28z CAR-T Design. Figure IB. Experimental design.

Figure 2. Background, and MUC4 CD28z CAR-T Design.

Figure 3. Amino acid sequence and DNA sequence of the CAR insert.

Figures 4A-4C. Antibody scFv, and MUC4 heavy chain Fv and light chain Fv sequences. Figure 5. scFv from antibody.

Figure 6 A. Insert assembly. Figure 6B. Digest enzyme + CIP cleanup/PCR before ligation. Figure 6C. Confirmation PCRs for insert to pHIVzsGreen.

Figures 7A-7B. Sequencing/alignment using primers EFla-FWD and TC017.

Figure 8. Infection of cells, and determination of virus titer (lowest concentration in which cells will be infected). FACS for zsGreen (virus titer).

Figures 9A-9B. IL-2 and IFN-y indirect ELISA for t-cell activation via recombinant MUC4. Western blot to show insert protein is expressed.

Figure 10. Structures of secretory mucins and transmembrane mucins.

Figure 11. Muc4 human cell line expression.

Figures 12A-12B. MUC4 alone, Tn MUC4 alone, or sTn MUC4 alone can be used as a marker for pancreatic cancer. Posey et al., Engineered CAR T Cells Targeting the Cancer- Associated Tn-Glycoform of the Membrane Mucin MUC1 Control Adenocarcinoma, Immunity, 2016; 44(6): 1444-54. Clgaltl = t synthase. Clgaltlcl = cosmc (enzyme for tn to T). St6galnacl -> enzyme for tn to Stn. Remmers et al., Aberrant expression of mucin core proteins and O-linked glycans associated with progression of pancreatic cancer, Clin Cancer Res. 2013, 19(8): 1981-93.

Figure 13. Expression of O-Glycan Mucins in human pancreatic cancer cell lines.

Figure 14. Pathway for generation of O-linked glycans. Figure 15. Complete pHIVzsGreen Muc4 cd28 Sequence. Figure 16. N-terminal sequencing of monoclonal antibody 8G7.

Detailed Description of Disclosure

The present disclosure provides cancer immunotherapies targeting mucins, such as MUC4. Also provided herein are the chimeric antigen receptors (CAR), nucleic acids encoding such, vectors comprising such, and immune cells (e.g., T cells) expressing such a chimeric receptor.

Aspects of the disclosure provide agents targeting a mucin, such as MUC4, on a cancer cell. Such an agent may comprise an antigen-binding fragment that binds and targets a mucin, such as MUC4. In some instances, the antigen-binding fragment can be a single chain antibody (scFv) specifically binding to the mucin, such as MUC4.

The present disclosure provides for an immune cell expressing a chimeric antigen receptor (CAR), where the CAR comprises: i) an antigen-binding fragment that binds MUC4, ii) a transmembrane domain, and iii) an intracellular signaling domain comprising at least one costimulatory domain (e.g., two costimulatory domains).

The antigen-binding fragment may be a single-chain antibody fragment (scFv) that specifically binds MUC4, e.g., human MUC4.

MUC4 may be a glycoform of MUC4, such as a Tn (GalNAcal-O-Ser/Thr) glycoform of MUC4, or a sialyl-Tn (STn) (NeuAca2-6-GalNAcal-0-Ser/Thr) glycoform of MUC4.

The immune cell may be a T cell.

The present disclosure also provides for a nucleic acid molecule encoding the present chimeric antigen receptor (CAR). Also encompassed is an immune cell comprising the nucleic acid molecule.

The present cells and compositions may be used to inhibiting tumor cell growth, increasing tumor cell death, and/or treating cancer. In one embodiment, the method comprises administering to tumor cells the present immune cell or the nucleic acid molecule. In another embodiment, the method comprises administering the present immune cell or the nucleic acid molecule to the subject.

In certain embodiments, the CAR may be of any generation. First generation CARs are composed of an extracellular binding domain, a hinge region, a transmembrane domain, and one or more intracellular signaling domains. Extracellular binding domain may contain single -chain variable fragments (scFvs) derived from tumor antigen-reactive antibodies and usually have high specificity to tumor antigen. The CARs may harbor the CD3z chain domain as the intracellular signaling domain, which is the primary transmitter of signals. Second generation CARs also contain co-stimulatory domains, like CD28 and/or 4- IBB. The involvement of these intracellular signaling domains improve T cell proliferation, cytokine secretion, resistance to apoptosis, and in vivo persistence. Besides co-stimulatory domains, the third-generation CARs combine multiple signaling domains, such as CD3z-CD28-41BB or CD3z-CD28-OX40, to augment T cell activity. Recently, the fourth-generation CARs (also known as TRUCKS or armored CARs), combine the expression of a second-generation CAR with factors that enhance anti-tumor activity (e.g., cytokines, co-stimulatory ligands).

MUC4

Mucin 4 (MUC4, MUC-4) is a mucin protein that in humans is encoded by the MUC4 gene. Like other mucins, MUC4 is a high-molecular weight glycoprotein.

MUC4 has been found to play various roles in the progression of cancer, particularly due to its signaling and anti-adhesive properties which contribute to tumor development and metastasis. It is also found to play roles in other diseases such as endometriosis and inflammatory bowel disease.

The NCBI Reference Sequence (RefSeq) accession numbers for human MUC4 mRNA may include NM_138299, NM_004532, NM_018406, NM_138297, and

NM_138298. The NCBI RefSeq accession numbers for human ZNF274 protein may include NP_001309397, NP_004523, NP_060876, and NP_612154.

There may be a number of different isoforms for each of these proteins/polypeptides discussed in this disclosure, provided herein are the general accession numbers, NCBI Reference Sequence (RefSeq) accession numbers, GenBank accession numbers, and/or UniProt numbers to provide relevant sequences. The proteins/polypeptides may also comprise other sequences. Spliced variants encoding different isoforms for MUC4 are included in the present disclosure.

The term“MUC4” or“MUC4" is meant to include the DNA, RNA, mRNA, cDNA, recombinant DNA or RNA, or the protein arising from the gene. As used herein, MUC4 can refer to the gene or the protein encoded by the gene, as appropriate in the specific context utilized. Additionally, in certain contexts, the reference will be to the mouse gene or protein, and in others the human gene or protein as appropriate in the specific context.

A wide variety of antigens may be targeted by the methods and compositions of the present disclosure. Monoclonal antibodies to these antigens may be purchased commercially or generated using standard techniques, including immunization of an animal with the antigen of interest followed by conventional monoclonal antibody methodologies e.g., the standard somatic cell hybridization technique of Kohler and Milstein, Nature (1975) 256:

495. The antibodies or nucleic acids encoding for the antibodies may be sequenced using any standard DNA or protein sequencing techniques.

Other Tumor Antigens

Other tumor specific glycoproteins may be targeted using the methods of the present invention. These antigens include, for example, Carcinoma Embryonic Antigen (CEA), HER2, MUC-1 which is hypoglycosylated in adenocarcinomas, carbohydrate antigens (Tn, TF, STn), p53 - a tumor suppressor gene mutated in cancers, TERT, and WT1 in breast cancer. Criscitiello. Tumor-Associated Antigens in Breast Cancer, Breast Care 7(4):262-266 (2012). In ovarian cancer, CEA may be considered for targeting in mucinous ovarian cancer. Brown et al. Mucinous Tumors of the Ovary: Current Thoughts on Diagnosis and

Management. Curr. Oncol. Rep. 16(6):389 (20140.

Antigen-Binding Fragment

Any antibody or an antigen-binding fragment thereof can be used for constructing the agent that targets a mucin as described herein. Such an antibody or antigen-binding fragment can be prepared by a conventional method, for example, the hybridoma technology or recombinant technology.

For example, antibodies specific to a mucin of interest can be made by the conventional hybridoma technology. The mucin, which may be coupled to a carrier protein such as KLH, can be used to immunize a host animal for generating antibodies binding to that complex. The route and schedule of immunization of the host animal are generally in keeping with established and conventional techniques for antibody stimulation and production, as further described herein. General techniques for production of mouse, humanized, and human antibodies are known in the art and are described herein. It is contemplated that any mammalian subject including humans or antibody producing cells therefrom can be manipulated to serve as the basis for production of mammalian, including human hybridoma cell lines. Typically, the host animal is inoculated intraperitoneally, intramuscularly, orally, subcutaneously, intraplantar, and/or intradermally with an amount of immunogen, including as described herein. Hybridomas can be prepared from the lymphocytes and immortalized myeloma cells using the general somatic cell hybridization technique of Kohler, B. and Milstein, C. (1975) Nature 256:495-497 or as modified by Buck, D. W., et al., In Vitro, 18:377-381 (1982). Available myeloma lines, including but not limited to X63-Ag8.653 and those from the Salk Institute, Cell Distribution Center, San Diego, Calif., USA, may be used in the hybridization. Generally, the technique involves fusing myeloma cells and lymphoid cells using a fusogen such as polyethylene glycol, or by electrical means well known to those skilled in the art. After the fusion, the cells are separated from the fusion medium and grown in a selective growth medium, such as hypoxanthine-aminopterin-thymidine (HAT) medium, to eliminate unhybridized parent cells. Any of the media described herein, supplemented with or without serum, can be used for culturing hybridomas that secrete monoclonal antibodies. As another alternative to the cell fusion technique, EBV immortalized B cells may be used to produce the TCR-like monoclonal antibodies described herein. The hybridomas are expanded and subcloned, if desired, and supernatants are assayed for anti-immunogen activity by conventional immunoassay procedures (e.g., radioimmunoassay, enzyme immunoassay, or fluorescence immunoassay).

Hybridomas that may be used as source of antibodies encompass all derivatives, progeny cells of the parent hybridomas that produce monoclonal antibodies capable of binding to a mucin. Hybridomas that produce such antibodies may be grown in vitro or in vivo using known procedures. The monoclonal antibodies may be isolated from the culture media or body fluids, by conventional immunoglobulin purification procedures such as ammonium sulfate precipitation, gel electrophoresis, dialysis, chromatography, and ultrafiltration, if desired. Undesired activity if present, can be removed, for example, by running the preparation over adsorbents made of the immunogen attached to a solid phase and eluting or releasing the desired antibodies off the immunogen. Immunization of a host animal with a target antigen or a fragment containing the target amino acid sequence conjugated to a protein that is immunogenic in the species to be immunized, e.g., keyhole limpet hemocyanin, serum albumin, bovine thyroglobulin, or soybean trypsin inhibitor using a bifunctional or derivatizing agent, for example maleimidobenzoyl sulfosuccinimide ester (conjugation through cysteine residues), N-hydroxysuccinimide (through lysine residues), glutaraldehyde, succinic anhydride, SOC1, or R1N=C=NR, where R and R1 are different alkyl groups, can yield a population of antibodies (e.g., monoclonal antibodies). If desired, an antibody of interest (e.g., produced by a hybridoma) may be sequenced and the polynucleotide sequence may then be cloned into a vector for expression or propagation. The sequence encoding the antibody of interest may be maintained in vector in a host cell and the host cell can then be expanded and frozen for future use. In an alternative, the polynucleotide sequence may be used for genetic manipulation to "humanize" the antibody or to improve the affinity (affinity maturation), or other characteristics of the antibody. For example, the constant region may be engineered to more resemble human constant regions to avoid immune response if the antibody is used in clinical trials and treatments in humans. It may be desirable to genetically manipulate the antibody sequence to obtain greater affinity to the mucin. It will be apparent to one of skill in the art that one or more polynucleotide changes can be made to the antibody and still maintain its binding specificity to the target antigen.

In other embodiments, fully human antibodies can be obtained by using commercially available mice that have been engineered to express specific human immunoglobulin proteins. Transgenic animals that are designed to produce a more desirable (e.g., fully human antibodies) or more robust immune response may also be used for generation of humanized or human antibodies. Examples of such technology are XenomouseRTM from Amgen, Inc. (Fremont, Calif.) and HuMAb-MouseRTM and TC MouseTM from Medarex, Inc.

(Princeton, N.J.). In another alternative, antibodies may be made recombinantly by phage display or yeast technology. See, for example, U.S. Pat. Nos. 5,565,332; 5,580,717;

5,733,743; and 6,265,150; and Winter et al., (1994) Annu. Rev. Immunol. 12:433-455.

Alternatively, the phage display technology (McCafferty et al., (1990) Nature 348:552-553) can be used to produce human antibodies and antibody fragments in vitro, from

immunoglobulin variable (V) domain gene repertoires from unimmunized donors.

Antigen-binding fragments of an intact antibody (full-length antibody) can be prepared via routine methods. For example, F(ab')2 fragments can be produced by pepsin digestion of an antibody molecule, and Fab fragments that can be generated by reducing the disulfide bridges of F(ab')2 fragments.

Genetically engineered antibodies, such as humanized antibodies, chimeric antibodies, single-chain antibodies, and bi-specific antibodies, can be produced via, e.g., conventional recombinant technology. In one example, DNA encoding a monoclonal antibody specific to a target antigen can be readily isolated and sequenced using conventional procedures (e.g., by using oligonucleotide probes that are capable of binding specifically to genes encoding the heavy and light chains of the monoclonal antibodies). The hybridoma cells serve as a preferred source of such DNA. Once isolated, the DNA may be placed into one or more expression vectors, which are then transfected into host cells such as E. coli cells, simian COS cells, Chinese hamster ovary (CHO) cells, or myeloma cells that do not otherwise produce immunoglobulin protein, to obtain the synthesis of monoclonal antibodies in the recombinant host cells. See, e.g., PCT Publication No. WO 87/04462. The DNA can then be modified, for example, by substituting the coding sequence for human heavy and light chain constant domains in place of the homologous murine sequences, Morrison et al., (1984) Proc. Nat. Acad. Sci. 81:6851, or by covalently joining to the immunoglobulin coding sequence all or part of the coding sequence for a non-immunoglobulin polypeptide. In that manner, genetically engineered antibodies, such as“chimeric” or“hybrid” antibodies; can be prepared that have the binding specificity of a target antigen.

Techniques developed for the production of“chimeric antibodies” are well known in the art. See, e.g., Morrison et al. (1984) Proc. Natl. Acad. Sci. USA 81, 6851; Neuberger et al. (1984) Nature 312, 604; and Takeda et al. (1984) Nature 314:452.

Methods for constructing humanized antibodies are also well known in the art. See, e.g., Queen et al., Proc. Natl. Acad. Sci. USA, 86:10029-10033 (1989). In one example, variable regions of VH and VL of a parent non-human antibody are subjected to three- dimensional molecular modeling analysis following methods known in the art. Next, framework amino acid residues predicted to be important for the formation of the correct CDR structures are identified using the same molecular modeling analysis. In parallel, human VH and VL chains having amino acid sequences that are homologous to those of the parent non-human antibody are identified from any antibody gene database using the parent VH and VL sequences as search queries. Human VH and VL acceptor genes are then selected.

The CDR regions within the selected human acceptor genes can be replaced with the CDR regions from the parent non-human antibody or functional variants thereof. When necessary, residues within the framework regions of the parent chain that are predicted to be important in interacting with the CDR regions (see above description) can be used to substitute for the corresponding residues in the human acceptor genes.

A single-chain antibody can be prepared via recombinant technology by linking a nucleotide sequence coding for a heavy chain variable region and a nucleotide sequence coding for a light chain variable region. Preferably, a flexible linker is incorporated between the two variable regions. Alternatively, techniques described for the production of single chain antibodies (U.S. Patent Nos. 4,946,778 and 4,704,692) can be adapted to produce a phage or yeast scFv library and scFv clones specific to a mucin can be identified from the library following routine procedures. Positive clones can be subjected to further screening to identify those that bind mucin.

In some instances, the mucin of interest is MUC4 and the antigen-binding fragment specifically binds MUC4, for example, human MUC4. In one embodiment, the heavy chain variable region and the light chain variable region are from a monoclonal antibody 8G7. Nucleic acid sequences of an exemplary heavy chain variable region and light chain variable region of an anti-human MUC4 antibody are provided below.

Nucleotide sequence of anti-MUC4 Mab 8G7 Light Chain Variable Region (VL) (SEQ

ID NO: 1)

GATGTTTTGATGACCCAAACTCCACTCACTTTGTCGGTTGCCATTGGACAACCAG

CCTCCATCTCTTGCAAGTCAAGTCAGAGTCTCTTAGATAAGAGTGGAAAGACATA

TTTGAATTGGTTGTTACAGAGGCCAGGCCAGTCTCCGAAGCGCCTAATCTATCTG

GTGTCTAAACTGGACTCTGGAGTCCCTGACAGGTTCACTGGCAGTGGATCAGGGA

CAGATTTCACACTGAAAATCAGCAGAGTGGAGGCTGAGGATTTGGGAGTTTATT

ATTGCTGGCAAGGTACACATTTTCCGCTCACGTTCGGTGCTGGGACCAAGCTGGA

AATAAAACGG

Nucleotide sequence of anti MUC4 Mab 8G7 Heavy Chain Variable Region (VH) (SEQ ID NO: 2)

GAGGTGCAGCTGCAGCAGTCAGGACCTGAACTGGTAAAGCCTGGGGCTTCAGTG

AAGATGTCCTGCAAGGCTTCTGGATACACATTCAGTAGCTATGTTATGCACTGGG

TGAAGCAGAAGCCTGGGCAGGGCCTTGAGTGGATTGGATATATTATTCCTTACAA

TGATGATATTAAGTACAGTGAGAAGCTTAAAGGCAAGGCCACACTGACTTCAGA

CAAATCCTCCAACACAGCCTACGTGGAGCTCAGCAGCCTGACCTCTGAGGACTCT

GGGGTCTATTACTGTGCAATTTTTGGTAACTACGTGAGTTATTGGGGCCAAGGGA

CCACGGTCACCGTCTCCTCA

The anti-MUC4 antibody binding fragment for use in constructing the agent that targets MUC4 as described herein may comprise the same heavy chain and/or light chain CDR regions as those in SEQ ID NO:l and SEQ ID NO:2. Such antibodies may comprise amino acid residue variations in one or more of the framework regions. In some instances, the anti-MUC4 antibody fragment may comprise a heavy chain variable region that shares at least 70% sequence identity (e.g., 75%, 80%, 85%, 90%, 95%, or higher) with SEQ ID NO:2 and/or may comprise a light chain variable region that shares at least 70% sequence identity (e.g., 75%, 80%, 85%, 90%, 95%, or higher) with SEQ ID NO:l.

The“percent identity” of two amino acid sequences is determined using the algorithm of Karlin and Altschul Proc. Natl. Acad. Sci. USA 87:2264-68, 1990, modified as in Karlin and Altschul Proc. Natl. Acad. Sci. USA 90:5873-77, 1993. Such an algorithm is incorporated into the NBLAST and XBLAST programs (version 2.0) of Altschul, et al. J. Mol. Biol. 215:403-10, 1990. BLAST protein searches can be performed with the XBLAST program, score=50, wordlength=3 to obtain amino acid sequences homologous to the protein molecules of the present disclosure. Where gaps exist between two sequences, Gapped BLAST can be utilized as described in Altschul et al., Nucleic Acids Res. 25(17):3389-3402, 1997. When utilizing BLAST and Gapped BLAST programs, the default parameters of the respective programs (e.g., XBLAST and NBLAST) can be used.

Immune Cells Expressing Chimeric Receptors

In some embodiments, the agent that targets a mucin as described herein is an immune cell that expresses a chimeric receptor, which comprises an antigen-binding fragment (e.g., a single-chain antibody) capable of binding to the mucin (e.g., MUC4).

Recognition of a target cell (e.g., a cancer cell) having the mucin on its cell surface by the antigen-binding fragment of the chimeric receptor transduces an activation signal to the signaling domain(s) (e.g., co-stimulatory signaling domain and/or the cytoplasmic signaling domain) of the chimeric receptor, which may activate an effector function in the immune cell expressing the chimeric receptor.

As used herein, a chimeric receptor refers to a non-naturally occurring molecule that can be expressed on the surface of a host cell and comprises an antigen-binding fragment that binds to a cell-surface mucin. In general, chimeric receptors comprise at least two domains that are derived from different molecules. In addition to the antigen-binding fragment described herein, the chimeric receptor may further comprise one or more of a hinge domain, a transmembrane domain, at least one co-stimulatory domain, and a cytoplasmic signaling domain. In some embodiments, the chimeric receptor comprises from N terminus to C terminus, an antigen-binding fragment that binds to a cell-surface mucin, a hinge domain, a transmembrane domain, and a cytoplasmic signaling domain. In some embodiments, the chimeric receptor further comprises at least one co-stimulatory domain.

In some embodiments, the chimeric receptors described herein comprise a hinge domain, which may be located between the antigen-binding fragment and a transmembrane domain. A hinge domain is an amino acid segment that is generally found between two domains of a protein and may allow for flexibility of the protein and movement of one or both of the domains relative to one another. Any amino acid sequence that provides such flexibility and movement of the antigen-binding fragment relative to another domain of the chimeric receptor can be used.

The hinge domain may contain about 10-200 amino acids, e.g., 15-150 amino acids, 20-100 amino acids, or 30-60 amino acids. In some embodiments, the hinge domain may be of about 10, 11, 12, 13, 14,15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26,

27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 amino acids in length.

In some embodiments, the hinge domain is a hinge domain of a naturally occurring protein. Hinge domains of any protein known in the art to comprise a hinge domain are compatible for use in the chimeric receptors described herein. In some embodiments, the hinge domain is at least a portion of a hinge domain of a naturally occurring protein and confers flexibility to the chimeric receptor. In some embodiments, the hinge domain is of CD8a or CD28a. In some embodiments, the hinge domain is a portion of the hinge domain of CD8a, e.g., a fragment containing at least 15 (e.g., 20, 25, 30, 35, or 40) consecutive amino acids of the hinge domain of CD8a or CD28a.

Hinge domains of antibodies, such as an IgG, IgA, IgM, IgE, or IgD antibody, are also compatible for use in the chimeric receptors described herein. In some embodiments, the hinge domain is the hinge domain that joins the constant domains CHI and CH2 of an antibody. In some embodiments, the hinge domain is of an antibody and comprises the hinge domain of the antibody and one or more constant regions of the antibody. In some embodiments, the hinge domain comprises the hinge domain of an antibody and the CH3 constant region of the antibody. In some embodiments, the hinge domain comprises the hinge domain of an antibody and the CH2 and CH3 constant regions of the antibody. In some embodiments, the antibody is an IgG, IgA, IgM, IgE, or IgD antibody. In some embodiments, the antibody is an IgG antibody. In some embodiments, the antibody is an IgGl, IgG2, IgG3, or IgG4 antibody. In some embodiments, the hinge region comprises the hinge region and the CH2 and CH3 constant regions of an IgGl antibody. In some embodiments, the hinge region comprises the hinge region and the CH3 constant region of an IgGl antibody. Also within the scope of the present disclosure are chimeric receptors comprising a hinge domain that is a non-naturally occurring peptide. In some embodiments, the hinge domain between the C-terminus of the extracellular ligand-binding domain of an Fc receptor and the N-terminus of the transmembrane domain is a peptide linker, such as a (GlyxSer)n linker, wherein x and n, independently can be an integer between 3 and 12, including 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or more.

Additional peptide linkers that may be used in a hinge domain of the chimeric receptors described herein are known in the art. See, e.g., Wriggers et al. Current Trends in Peptide Science (2005) 80(6): 736-746 and PCT Publication WO 2012/088461.

In some embodiments, the chimeric receptors described herein may comprise a transmembrane domain. The transmembrane domain for use in the chimeric receptors can be in any form known in the art. As used herein, a“transmembrane domain” refers to any protein structure that is thermodynamically stable in a cell membrane, preferably a eukaryotic cell membrane. Transmembrane domains compatible for use in the chimeric receptors used herein may be obtained from a naturally occurring protein. Alternatively, the transmembrane domain may be a synthetic, non-naturally occurring protein segment, e.g., a hydrophobic protein segment that is thermodynamically stable in a cell membrane.

Transmembrane domains are classified based on the transmembrane domain topology, including the number of passes that the transmembrane domain makes across the membrane and the orientation of the protein. For example, single-pass membrane proteins cross the cell membrane once, and multi-pass membrane proteins cross the cell membrane at least twice (e.g., 2, 3, 4, 5, 6, 7 or more times). In some embodiments, the

transmembrane domain is a single-pass transmembrane domain. In some embodiments, the transmembrane domain is a single-pass transmembrane domain that orients the N terminus of the chimeric receptor to the extracellular side of the cell and the C terminus of the chimeric receptor to the intracellular side of the cell. In some embodiments, the transmembrane domain is obtained from a single pass transmembrane protein. In some embodiments, the transmembrane domain is of CD8a. In some embodiments, the transmembrane domain is of CD28. In some embodiments, the transmembrane domain is of ICOS.

In some embodiments, the chimeric receptors described herein comprise one or more costimulatory signaling domains. The term“co-stimulatory signaling domain,” as used herein, refers to at least a portion of a protein that mediates signal transduction within a cell to induce an immune response, such as an effector function. The co-stimulatory signaling domain of the chimeric receptor described herein can be a cytoplasmic signaling domain from a co-stimulatory protein, which transduces a signal and modulates responses mediated by immune cells, such as T cells, NK cells, macrophages, neutrophils, or eosinophils.

In some embodiments, the chimeric receptor comprises more than one (at least 2,

3, 4, or more) co-stimulatory signaling domains. In some embodiments, the chimeric receptor comprises more than one co-stimulatory signaling domains obtained from different costimulatory proteins. In some embodiments, the chimeric receptor does not comprise a co-stimulatory signaling domain.

In general, many immune cells require co- stimulation, in addition to stimulation of an antigen-specific signal, to promote cell proliferation, differentiation and survival, and to activate effector functions of the cell. Activation of a co-stimulatory signaling domain in a host cell (e.g., an immune cell) may induce the cell to increase or decrease the production and secretion of cytokines, phagocytic properties, proliferation, differentiation, survival, and/or cytotoxicity. The co-stimulatory signaling domain of any co-stimulatory protein may be compatible for use in the chimeric receptors described herein. The type(s) of co stimulatory signaling domain is selected based on factors such as the type of the immune cells in which the chimeric receptors would be expressed (e.g., primary T cells, T cell lines, NK cell lines) and the desired immune effector function (e.g., cytotoxicity).

Examples of co-stimulatory signaling domains for use in the chimeric receptors can be the cytoplasmic signaling domain of co-stimulatory proteins, including, without limitation, CD27, CD28, 4-1BB, 0X40, CD30, Cd40, PD-1, ICOS, lymphocyte function-associated antigen-1 (LFA-1), CD2, CD7, LIGHT, NKG2C, B7-H3. In some embodiments, the co stimulatory domain is derived from 4- IBB, CD28, or ICOS. In some embodiments, the costimulatory domain is derived from CD28 and chimeric receptor comprises a second co stimulatory domain from 4-1BB or ICOS.

In some embodiments, the costimulatory domain is a fusion domain comprising more than one costimulatory domain or portions of more than one costimulatory domains. In some embodiments, the costimulatory domain is a fusion of costimulatory domains from CD28 and ICOS.

In some embodiments, the chimeric receptors described herein comprise a cytoplasmic signaling domain. Any cytoplasmic signaling domain can be used in the chimeric receptors described herein. In general, a cytoplasmic signaling domain relays a signal, such as interaction of an extracellular ligand-binding domain with its ligand, to stimulate a cellular response, such as inducing an effector function of the cell (e.g., cytotoxicity).

As will be evident to one of ordinary skill in the art, a factor involved in T cell activation is the phosphorylation of immunoreceptor tyrosine-based activation motif (IT AM) of a cytoplasmic signaling domain. Any ITAM-containing domain known in the art may be used to construct the chimeric receptors described herein. In general, an IT AM motif may comprise two repeats of the amino acid sequence YxxL/I separated by 6-8 amino acids, wherein each x is independently any amino acid, producing the conserved motif YxxL/Ix(6-8)YxxL/I. In some embodiments, the cytoplasmic signaling domain is from CD3z.

Exemplary chimeric receptors are provided in Tables 1 and 2 below.

Table 1: Exemplary components of a chimeric receptor

The nucleic acid sequence of exemplary components for construction of a chimeric receptor are provided below.

CD28 intracellular signaling domain-DNA-Human (SEQ ID NO: 3)

ATTGAAGTTATGTATCCTCCTCCTTACCTAGACAATGAGAAGAGCAATGGAACCATTATCCA

TGTGAAAGGGAAACACCTTTGTCCAAGTCCCCTATTTCCCGGACCTTCTAAGCCCTTTTGGG

TGCTGGTGGTGGTTGGTGGAGTCCTGGCTTGCTATAGCTTGCTAGTAACAGTGGCCTTTATT

ATTTTCTGGGTGAGGAGTAAGAGGAGCAGGCTCCTGCACAGTGACTACATGAACATGACTCC

CCGCCGCCCCGGGCCCACCCGCAAGCATTACCAGCCCTATGCCCCACCACGCGACTTCGCAG

CCTATCGCTCCAGAGTGAAGTTCAGCAGGAGCGCAGACGCCCCCGCGTACCAGCAGGGCCAG

AACCAGCTCTATAACGAGCTCAATCTAGGACGAAGAGAGGAGTACGATGTTTTGGACAAGAG

ACGTGGCCGGGACCCTGAGATGGGGGGAAAGCCGAGAAGGAAGAACCCTCAGGAAGGCCTGT

ACAATGAACTGCAGAAAGATAAGATGGCGGAGGCCTACAGTGAGATTGGGATGAAAGGCGAG

CGCCGGAGGGGCAAGGGGCACGATGGCCTTTACCAGGGTCTCAGTACAGCCACCAAGGACAC

CTACGACGCCCTTCACATGCAGGCCCTGCCCCCTCGC

ICOS intracellular signaling domain-DNA-Human (SEQ ID NO: 4)

CTATCAATTTTTGATCCTCCTCCTTTTAAAGTAACTCTTACAGGAGGATATTTGCATATTTA

TGAATCACAACTTTGTTGCCAGCTGAAGTTCTGGTTACCCATAGGATGTGCAGCCTTTGTTG

TAGTCTGCATTTTGGGATGCATACTTATTTGTTGGCTTACAAAAAAGAAGTATTCATCCAGT

GTGCACGACCCTAACGGTGAATACATGTTCATGAGAGCAGTGAACACAGCCAAAAAATCTAG

ACTCACAGATGTGACCCTAAGAGTGAAGTTCAGCAGGAGCGCAGACGCCCCCGCGTACCAGC

AGGGCCAGAACCAGCTCTATAACGAGCTCAATCTAGGACGAAGAGAGGAGTACGATGTTTTG

GACAAGAGACGTGGCCGGGACCCTGAGATGGGGGGAAAGCCGAGAAGGAAGAACCCTCAGGA

AGGCCTGTACAATGAACTGCAGAAAGATAAGATGGCGGAGGCCTACAGTGAGATTGGGATGA

AAGGCGAGCGCCGGAGGGGCAAGGGGCACGATGGCCTTTACCAGGGTCTCAGTACAGCCACC

AAGGACACCTACGACGCCCTTCACATGCAGGCCCTGCCCCCTCGC

CD28/ICOS COSTIMULATORY SIGNALING REGION-DNA-Human (SEQ ID NO: 5)

ATTGAAGTTATGTATCCTCCTCCTTACCTAGACAATGAGAAGAGCAATGGAACCATTATCCA

TGTGAAAGGGAAACACCTTTGTCCAAGTCCCCTATTTCCCGGACCTTCTAAGCCCTTTTGGG

TGCTGGTGGTGGTTGGTGGAGTCCTGGCTTGCTATAGCTTGCTAGTAACAGTGGCCTTTATT

ATTTTCTGGGTGAGGAGTAAGAGGAGCAGGCTCCTGCACAGTGACTACATGTTCATGAGAGC

AGTGAACACAGCCAAAAAATCTAGACTCACAGATGTGACCCTAAGAGTGAAGTTCAGCAGGA

GCGCAGACGCCCCCGCGTACCAGCAGGGCCAGAACCAGCTCTATAACGAGCTCAATCTAGGA

CGAAGAGAGGAGTACGATGTTTTGGACAAGAGACGTGGCCGGGACCCTGAGATGGGGGGAAA

GCCGAGAAGGAAGAACCCTCAGGAAGGCCTGTACAATGAACTGCAGAAAGATAAGATGGCGG

AGGCCTACAGTGAGATTGGGATGAAAGGCGAGCGCCGGAGGGGCAAGGGGCACGATGGCCTT

TACCAGGGTCTCAGTACAGCCACCAAGGACACCTACGACGCCCTTCACATGCAGGCCCTGCC

CCCTCGC In some embodiments, the nucleic acid sequence encodes an antigen binding fragment that binds to MUC4 and comprises a heavy chain variable region which has the same CDRs as the CDRs in SEQ ID NO: 2 and a light chain variable region which has the same CDRs as the CDRs in SEQ ID NO: 1. In some embodiments, the antigen-binding fragment comprises a heavy chain variable region as provided by SEQ ID NO: 2 and a light chain variable region as provided by SEQ ID NO: 1. In some embodiments, the chimeric receptor further comprises at least a transmembrane domain and a cytoplasmic signaling domain. In some embodiments, the chimeric receptor further comprises a hinge domain and/or a co-stimulatory signaling domain.

Table 3 provides exemplary chimeric receptors described herein. The exemplary constructs have from N-terminus to C-terminus, the antigen-binding fragment, the transmembrane domain, and a cytoplasmic signaling domain. In some examples, the chimeric receptor further comprises a hinge domain located between the antigen-binding fragment and the transmembrane domain. In some example, the chimeric receptor further comprises one or more co- stimulatory domains, which may be located between the transmembrane domain and the cytoplasmic signaling domain.

Table 2: Exemplary chimeric receptors

Any of the chimeric receptors described herein can be prepared by routine methods, such as recombinant technology. Methods for preparing the chimeric receptors herein involve generation of a nucleic acid that encodes a polypeptide comprising each of the domains of the chimeric receptors, including the antigen-binding fragment and optionally, the hinge domain, the transmembrane domain, at least one co-stimulatory signaling domain, and the cytoplasmic signaling domain. In some embodiments, a nucleic acid encoding each of the components of chimeric receptor are joined together using recombinant technology.

Sequences of each of the components of the chimeric receptors may be obtained via routine technology, e.g., PCR amplification from any one of a variety of sources known in the art. In some embodiments, sequences of one or more of the components of the chimeric receptors are obtained from a human cell. Alternatively, the sequences of one or more components of the chimeric receptors can be synthesized. Sequences of each of the components (e.g., domains) can be joined directly or indirectly (e.g., using a nucleic acid sequence encoding a peptide linker) to form a nucleic acid sequence encoding the chimeric receptor, using methods such as PCR amplification or ligation. Alternatively, the nucleic acid encoding the chimeric receptor may be synthesized. In some embodiments, the nucleic acid is DNA. In other embodiments, the nucleic acid is RNA.

Mutation of one or more residues within one or more of the components of the chimeric receptor (e.g., the antigen-binding fragment, etc), prior to or after joining the sequences of each of the components. In some embodiments, one or more mutations in a component of the chimeric receptor may be made to modulate (increase or decrease) the affinity of the component for a target (e.g., the antigen-binding fragment for the target antigen) and/or modulate the activity of the component.

Any of the chimeric receptors described herein can be introduced into a suitable immune cell for expression via conventional technology. In some embodiments, the immune cells are T cells, such as primary T cells or T cell lines. Alternatively, the immune cells can be NK cells, such as established NK cell lines (e.g., NK-92 cells). In some embodiments, the immune cells are T cells that express CD8 (CD8⁺) or CD8 and CD4 (CD8⁺/CD4⁺). In some embodiments, the T cells are T cells of an established T cell line, for example, 293T cells or Jurkat cells.

Primary T cells may be obtained from any source, such as peripheral blood mononuclear cells (PBMCs), bone marrow, tissues such as spleen, lymph node, thymus, or tumor tissue. A source suitable for obtaining the type of immune cells desired would be evident to one of skill in the art. In some embodiments, the population of immune cells is derived from a human patient having a hematopoietic malignancy, such as from the bone marrow or from PBMCs obtained from the patient. In some embodiments, the population of immune cells is derived from a healthy donor. In some embodiments, the immune cells are obtained from the subject to whom the immune cells expressing the chimeric receptors will be subsequently administered. Immune cells that are administered to the same subject from which the cells were obtained are referred to as autologous cells, whereas immune cells that are obtained from a subject who is not the subject to whom the cells will be administered are referred to as allogeneic cells.

The type of host cells desired may be expanded within the population of cells obtained by co-incubating the cells with stimulatory molecules, for example, anti-CD3 and anti-CD28 antibodies may be used for expansion of T cells.

To construct the immune cells that express any of the chimeric receptor constructs described herein, expression vectors for stable or transient expression of the chimeric receptor construct may be constructed via conventional methods as described herein and introduced into immune host cells. For example, nucleic acids encoding the chimeric receptors may be cloned into a suitable expression vector, such as a viral vector in operable linkage to a suitable promoter. The nucleic acids and the vector may be contacted, under suitable conditions, with a restriction enzyme to create complementary ends on each molecule that can pair with each other and be joined with a ligase. Alternatively, synthetic nucleic acid linkers can be ligated to the termini of the nucleic acid encoding the chimeric receptors. The synthetic linkers may contain nucleic acid sequences that correspond to a particular restriction site in the vector. The selection of expression vectors/plasmids/viral vectors would depend on the type of host cells for expression of the chimeric receptors, but should be suitable for integration and replication in eukaryotic cells.

A variety of promoters can be used for expression of the chimeric receptors described herein, including, without limitation, cytomegalovirus (CMV) intermediate early promoter, a viral LTR such as the Rous sarcoma virus LTR, HIV-LTR, HTLV-1 LTR, Maloney murine leukemia virus (MMLV) LTR, myeoloproliferative sarcoma virus (MPSV) LTR, spleen focus-forming virus (SFFV) LTR, the simian virus 40 (SV40) early promoter, herpes simplex tk virus promoter, elongation factor 1 -alpha (EFl-a) promoter with or without the EFl-a intron. Additional promoters for expression of the chimeric receptors include any constitutively active promoter in an immune cell. Alternatively, any regulatable promoter may be used, such that its expression can be modulated within an immune cell.

Additionally, the vector may contain, for example, some or all of the following: a selectable marker gene, such as the neomycin gene for selection of stable or transient transfectants in host cells; enhancer/promoter sequences from the immediate early gene of human CMV for high levels of transcription; transcription termination and RNA processing signals from SV40 for mRNA stability; 5’-and 3’-untranslated regions for mRNA stability and translation efficiency from highly-expressed genes like a-globin or b-globin; SV40 polyoma origins of replication and ColEl for proper episomal replication; internal ribosome binding sites (IRESes), versatile multiple cloning sites; T7 and SP6 RNA promoters for in vitro transcription of sense and antisense RNA; a“suicide switch” or“suicide gene” which when triggered causes cells carrying the vector to die (e.g., HSV thymidine kinase, an inducible caspase such as iCasp9), and reporter gene for assessing expression of the chimeric receptor. See section VI below. Suitable vectors and methods for producing vectors containing transgenes are well known and available in the art. Examples of the preparation of vectors for expression of chimeric receptors can be found, for example, in US2014/0106449, herein incorporated by reference in its entirety.

In some embodiments, the chimeric receptor construct or the nucleic acid encoding said chimeric receptor is a DNA molecule. In some embodiments, chimeric receptor construct or the nucleic acid encoding said chimeric receptor is a DNA vector and may be electroporated to immune cells (see, e.g., Till, et al. Blood (2012) 119(17): 3940-3950). In some embodiments, the nucleic acid encoding the chimeric receptor is an RNA molecule, which may be electroporated to immune cells.

Any of the vectors comprising a nucleic acid sequence that encodes a chimeric receptor construct described herein is also within the scope of the present disclosure. Such a vector may be delivered into host cells such as host immune cells by a suitable method. Methods of delivering vectors to immune cells are well known in the art and may include DNA, RNA, or transposon electroporation, transfection reagents such as liposomes or nanoparticles to delivery DNA, RNA, or transposons; delivery of DNA, RNA, or transposons or protein by mechanical deformation (see, e.g., Sharei et al. Proc. Natl. Acad. Sci. USA (2013) 110(6): 2082-2087); or viral transduction. In some embodiments, the vectors for expression of the chimeric receptors are delivered to host cells by viral transduction.

Exemplary viral methods for delivery include, but are not limited to, recombinant retroviruses (see, e.g., PCT Publication Nos. WO 90/07936; WO 94/03622; WO 93/25698; WO

93/25234; WO 93/11230; WO 93/10218; WO 91/02805; U.S. Pat. Nos. 5,219,740 and 4,777,127; GB Patent No. 2,200,651; and EP Patent No. 0 345 242), alphavirus-based vectors, and adeno-associated virus (AAV) vectors (see, e.g., PCT Publication Nos. WO 94/12649, WO 93/03769; WO 93/19191; WO 94/28938; WO 95/11984 and WO 95/00655).

In some embodiments, the vectors for expression of the chimeric receptors are retroviruses. In some embodiments, the vectors for expression of the chimeric receptors are lentiviruses.

In some embodiments, the vectors for expression of the chimeric receptors are adeno- associated viruses.

In examples in which the vectors encoding chimeric receptors are introduced to the host cells using a viral vector, viral particles that are capable of infecting the immune cells and carry the vector may be produced by any method known in the art and can be found, for example in PCT Application No. WO 1991/002805A2, WO 1998/009271 Al, and U.S. Patent 6,194,191. The viral particles are harvested from the cell culture supernatant and may be isolated and/or purified prior to contacting the viral particles with the immune cells.

The methods of preparing host cells expressing any of the chimeric receptors described herein may comprise activating and/or expanding the immune cells ex vivo.

Activating a host cell means stimulating a host cell into an activate state in which the cell may be able to perform effector functions (e.g., cytotoxicity). Methods of activating a host cell will depend on the type of host cell used for expression of the chimeric receptors.

Expanding host cells may involve any method that results in an increase in the number of cells expressing chimeric receptors, for example, allowing the host cells to proliferate or stimulating the host cells to proliferate. Methods for stimulating expansion of host cells will depend on the type of host cell used for expression of the chimeric receptors and will be evident to one of skill in the art. In some embodiments, the host cells expressing any of the chimeric receptors described herein are activated and/or expanded ex vivo prior to administration to a subject.

In some embodiments, the agents targeting a cell-surface mucin is an antibody-drug conjugate (ADC). As will be evident to one of ordinary skill in the art, the term“antibody- drug conjugate” can be used interchangeably with“immunotoxin” and refers to a fusion molecule comprising an antibody (or antigen-binding fragment thereof) conjugated to a toxin or drug molecule. Binding of the antibody to the corresponding antigen allows for delivery of the toxin or drug molecule to a cell that presents the antigen on the its cell surface (e.g. , target cell), thereby resulting in death of the target cell.

In some embodiments, the agent is an antibody-drug conjugate. In some

embodiments, the antibody-drug conjugate comprises an antigen-binding fragment and a toxin or drug that induces cytotoxicity in a target cell. In some embodiments, the antibody- drug conjugate targets MUC4. In some embodiments, the antigen-bind fragment of the antibody-drug conjugate has the same heavy chain CDRs as the heavy chain variable region provided by SEQ ID NO: 2 and the same light chain CDRS as the light chain variable region provided by SEQ ID NO: 1. In some embodiments, the antigen-bind fragment of the antibody-drug conjugate has the heavy chain variable region provided by SEQ ID NO: 2 and the same light chain variable region provided by SEQ ID NO: 1.

Toxins or drugs compatible for use in antibody-drug conjugate are well known in the art and will be evident to one of ordinary skill in the art. See, e.g., Peters et al. Biosci.

Rep.( 2015) 35(4): e00225. In some embodiments, the antibody-drug conjugate may further comprise a linker (e.g., a peptide linker, such as a cleavable linker) attaching the antibody and drug molecule.

An ADC described herein may be used as a follow-on treatment to subjects who have been undergone the combined therapy as described herein.

Combined Therapy

As used herein,“subject,”“individual,” and“patient” are used interchangeably, and refer to a vertebrate, preferably a mammal such as a human. Mammals include, but are not limited to, human primates, non-human primates or murine, bovine, equine, canine or feline species. In some embodiments, the subject is a human patient having a hematopoietic malignancy.

In some embodiments, the agents may be mixed with a pharmaceutically acceptable carrier to form a pharmaceutical composition, which is also within the scope of the present disclosure.

To perform the methods described herein, an effective amount of the agent comprising an antigen-binding fragment that binds to a cell-surface mucin can be

administered to a subject in need of the treatment. As used herein the term“effective amount” may be used interchangeably with the term“therapeutically effective amount” and refers to that quantity of an agent, cell population, or pharmaceutical composition (e.g., a composition comprising agents and/or hematopoietic cells) that is sufficient to result in a desired activity upon administration to a subject in need thereof. Within the context of the present disclosure, the term“effective amount” refers to that quantity of a compound, cell population, or pharmaceutical composition that is sufficient to delay the manifestation, arrest the progression, relieve or alleviate at least one symptom of a disorder treated by the methods of the present disclosure. Note that when a combination of active ingredients is administered the effective amount of the combination may or may not include amounts of each ingredient that would have been effective if administered individually.

Effective amounts vary, as recognized by those skilled in the art, depending on the particular condition being treated, the severity of the condition, the individual patient parameters including age, physical condition, size, gender and weight, the duration of the treatment, the nature of concurrent therapy (if any), the specific route of administration and like factors within the knowledge and expertise of the health practitioner. In some embodiments, the effective amount alleviates, relieves, ameliorates, improves, reduces the symptoms, or delays the progression of any disease or disorder in the subject. In some embodiments, the subject is a human. In some embodiments, the subject is a human patient having cancer.

As described herein, the immune cells expressing chimeric receptors may be autologous to the subject, i.e., the cells are obtained from the subject in need of the treatment, genetically engineered for expression of the chimeric receptor constructs, and then administered to the same subject. Administration of autologous cells to a subject may result in reduced rejection of the host cells as compared to administration of non-autologous cells. Alternatively, the host cells are allogeneic cells, i.e., the cells are obtained from a first subject, genetically engineered for expression of the chimeric receptor constructs, and administered to a second subject that is different from the first subject but of the same species. For example, allogeneic immune cells may be derived from a human donor and administered to a human recipient who is different from the donor.

In some embodiments, the immune cells are allogeneic cells and have been further genetically engineered to reduced graft-versus-host disease.

In some embodiments, the immune cells expressing any of the chimeric receptors described herein are administered to a subject in an amount effective in to reduce the number of target cells (e.g., cancer cells) by least 20%, e.g., 50%, 80%, 100%, 2-fold, 5-fold, 10-fold, 20-fold, 50-fold, 100-fold or more.

A typical amount of cells, i.e., immune cells, administered to a mammal (e.g., a human) can be, for example, in the range of one million to 100 billion cells; however, amounts below or above this exemplary range are also within the scope of the present disclosure. For example, the daily dose of cells can be about 1 million to about 50 billion cells (e.g., about 5 million cells, about 25 million cells, about 500 million cells, about 1 billion cells, about 5 billion cells, about 20 billion cells, about 30 billion cells, about 40 billion cells, or a range defined by any two of the foregoing values), preferably about 10 million to about 100 billion cells (e.g., about 20 million cells, about 30 million cells, about 40 million cells, about 60 million cells, about 70 million cells, about 80 million cells, about 90 million cells, about 10 billion cells, about 25 billion cells, about 50 billion cells, about 75 billion cells, about 90 billion cells, or a range defined by any two of the foregoing values), more preferably about 100 million cells to about 50 billion cells (e.g., about 120 million cells, about 250 million cells, about 350 million cells, about 450 million cells, about 650 million cells, about 800 million cells, about 900 million cells, about 3 billion cells, about 30 billion cells, about 45 billion cells, or a range defined by any two of the foregoing values).

In one embodiment, the chimeric receptor (e.g., a nucleic acid encoding the chimeric receptor) is introduced into an immune cell, and the subject (e.g., human patient) receives an initial administration or dose of the immune cells expressing the chimeric receptor. One or more subsequent administrations of the agent (e.g., immune cells expressing the chimeric receptor) may be provided to the patient at intervals of 15 days, 14, 13, 12, 11, 10, 9, 8, 7, 6,

5, 4, 3, or 2 days after the previous administration. More than one dose of the agent can be administered to the subject per week, e.g., 2, 3, 4, or more administrations of the agent. The subject may receive more than one doses of the agent (e.g., an immune cell expressing a chimeric receptor) per week, followed by a week of no administration of the agent, and finally followed by one or more additional doses of the agent (e.g., more than one administration of immune cells expressing a chimeric receptor per week). The immune cells expressing a chimeric receptor may be administered every other day for 3 administrations per week for two, three, four, five, six, seven, eight or more weeks.

In the context of the present disclosure insofar as it relates to any of the disease conditions recited herein, the terms“treat,”“treatment,” and the like mean to relieve or alleviate at least one symptom associated with such condition, or to slow or reverse the progression of such condition. Within the meaning of the present disclosure, the term“treat” also denotes to arrest, delay the onset (i.e., the period prior to clinical manifestation of a disease) and/or reduce the risk of developing or worsening a disease. For example, in connection with cancer the term“treat” may mean eliminate or reduce a patient's tumor burden, or prevent, delay or inhibit metastasis, etc.

The efficacy of the therapeutic methods using an agent comprising an antigen binding fragment that binds a cell-surface mucin may be assessed by any method known in the art and would be evident to a skilled medical professional. For example, the efficacy of the therapy may be assessed by survival of the subject or cancer burden in the subject or tissue or sample thereof. In some embodiments, the efficacy of the therapy is assessed by quantifying the number of cells belonging to a particular population or lineage of cells. In some embodiments, the efficacy of the therapy is assessed by quantifying the number of cells presenting the cell-surface mucin.

In some embodiments, the agent comprising an antigen-binding fragment that binds a cell-surface mucin (e.g., immune cells expressing a chimeric receptor as described herein) is administered prior to a second treatment. In some embodiments, the agent comprising an antigen-binding fragment that binds a cell- surface mucin (e.g., immune cells expressing a chimeric receptor as described herein) is administered at least about 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 9 weeks, 10 weeks, 11 weeks, 12 weeks, 3 months, 4 months, 5 months, 6 months or more prior to a second treatment.

In some embodiments, a second treatment is administered prior to the agent comprising an antigen-binding fragment that binds a cell-surface mucin (e.g., immune cells expressing a chimeric receptor as described herein). In some embodiments, a second treatment is administered at least about 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 1 week,

2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 9 weeks, 10 weeks, 11 weeks, 12 weeks, 3 months, 4 months, 5 months, 6 months or more prior to administration of the agent comprising an antigen-binding fragment that binds to the cell-surface mucin.

In some embodiments, the agent targeting the cell-surface mucin and a second treatment are administered at substantially the same time. In some embodiments, agent targeting the cell-surface mucin is administered and the patient is assessed for a period of time, after which a second treatment is administered. In some embodiments, a second treatment is administered and the patient is assessed for a period of time, after which an agent targeting the cell-surface mucin is administered.

Also within the scope of the present disclosure are multiple administrations (e.g. , doses) of the agents. In some embodiments, the agents are administered to the subject once. In some embodiments, the agents are administered to the subject more than once (e.g., at least 2, 3, 4, 5, or more times). In some embodiments, the agents are administered to the subject at a regular interval, e.g. , every six months. The disease or disorder treated by the present composition and method may be pancreatic cancer. Pancreatic cancers that can be treated include, but are not limited to, exocrine pancreatic cancers and endocrine pancreatic cancers. Exocrine pancreatic cancers include, but are not limited to, adenocarcinomas, acinar cell carcinomas, adenosquamous carcinomas, colloid carcinomas, undifferentiated carcinomas with osteoclast-like giant cells, hepatoid carcinomas, intraductal papillary-mucinous neoplasms, mucinous cystic neoplasms, pancreatoblastomas, serous cystadenomas, signet ring cell carcinomas, solid and

pseuodpapillary tumors, pancreatic ductal carcinomas, and undifferentiated carcinomas. In some embodiments, the exocrine pancreatic cancer is pancreatic ductal carcinoma. Endocrine pancreatic cancers include, but are not limited to, insulinomas and glucagonomas.

In some embodiments, the pancreatic cancer is any of early stage pancreatic cancer, non-metastatic pancreatic cancer, primary pancreatic cancer, resected pancreatic cancer, advanced pancreatic cancer, locally advanced pancreatic cancer, metastatic pancreatic cancer, unresectable pancreatic cancer, pancreatic cancer in remission, recurrent pancreatic cancer, pancreatic cancer in an adjuvant setting, or pancreatic cancer in a neoadjuvant setting. In some embodiments, the pancreatic cancer is locally advanced pancreatic cancer, unresectable pancreatic cancer, or metastatic pancreatic ductal carcinoma. In some embodiments, the pancreatic cancer is resistant to the gemcitabine-based therapy. In some embodiments, the pancreatic cancer is refractory to the gemcitabine-based therapy.

The disease or disorder treated by the present composition and method may be ovarian cancer. Ovarian cancer is classified according to the histology of the tumor. Surface epithelial- stromal tumor, also known as ovarian epithelial carcinoma, is the most common type of ovarian cancer. It includes serous tumor (including serous papillary

cystadenocarcinoma), endometrioid tumor and mucinous cystadenocarcinoma. The methods described herein can be used to treat various stages of ovarian cancer, e.g., stage I, stage II, stage III or stage W. Staging can be performed, e.g., when the ovarian cancer is removed. In some embodiments, the ovarian cancer is resistant to one or more chemotherapeutic agent. In some embodiments, the ovarian cancer is refractory to the one or more chemotherapeutic agent.

Other cancers that can be treated with the present composition and method include, e.g., brain cancer, bladder cancer, breast cancer, cervical cancer, colorectal cancer, liver cancer, kidney cancer, lymphoma, leukemia, lung cancer (e.g., lung adenocarcinoma), melanoma, metastatic melanoma, mesothelioma, neuroblastoma, ovarian cancer, prostate cancer, pancreatic cancer, renal cancer, skin cancer, thymoma, sarcoma, non-Hodgkin's lymphoma, Hodgkin's lymphoma, uterine cancer, and any combination thereof.

The present disclosure provides methods for inhibiting the proliferation or reducing a tumor cell population, the methods comprising contacting a population of cells comprising a mucin expressing cell with the present composition. In a specific embodiment, the disclosure provides methods for inhibiting the proliferation or reducing the population of cancer cells expressing a mucin, the methods comprising contacting the cancer cell population with the present composition. In another embodiment, the invention provides methods for inhibiting the proliferation or reducing the population of cancer cells expressing a mucin, the methods comprising contacting the cancer cell population with the present composition. In certain embodiments, the mesothelin CAR-expressing cell of the invention reduces the quantity, number, amount or percentage of cells and/or cancer cells by at least 25%, at least 30%, at least 40%, at least 50%, at least 65%, at least 75%, at least 85%, at least 95%, or at least 99% in a subject with or animal model of cancer relative to a negative control. In one aspect, the subject is a human.

In some embodiments, the subject is a human subject having a hematopoietic malignancy. As used herein a hematopoietic malignancy refers to a malignant abnormality involving hematopoietic cells (e.g., blood cells, including progenitor and stem cells).

Examples of hematopoietic malignancies include, without limitation, Hodgkin’ s lymphoma, non-Hodgkin’s lymphoma, leukemia, or multiple myeloma. Leukemias include acute myeloid leukaemia, acute lymphoid leukemia, chronic myelogenous leukaemia, acute lymphoblastic leukemia or chronic lymphoblastic leukemia, and chronic lymphoid leukemia.

In some embodiments, the leukemia is acute myeloid leukaemia (AML).

Alternatively or in addition, the methods described herein may be used to treat non- hematopoietic cancers, including without limitation, lung cancer, ear, nose and throat cancer, colon cancer, melanoma, pancreatic cancer, mammary cancer, prostate cancer, breast cancer, ovarian cancer, basal cell carcinoma, biliary tract cancer; bladder cancer; bone cancer; breast cancer; cervical cancer; choriocarcinoma; colon and rectum cancer; connective tissue cancer; cancer of the digestive system; endometrial cancer; esophageal cancer; eye cancer; cancer of the head and neck; gastric cancer; intra-epithelial neoplasm; kidney cancer; larynx cancer; liver cancer; fibroma, neuroblastoma; oral cavity cancer (e.g., lip, tongue, mouth, and pharynx); ovarian cancer; pancreatic cancer; prostate cancer; retinoblastoma; rhabdomyosarcoma; rectal cancer; renal cancer; cancer of the respiratory system; sarcoma; skin cancer; stomach cancer; testicular cancer; thyroid cancer; uterine cancer; cancer of the urinary system, as well as other carcinomas and sarcomas.

Carcinomas are cancers of epithelial origin. Carcinomas intended for treatment with the methods of the present disclosure include, but are not limited to, acinar carcinoma, acinous carcinoma, alveolar adenocarcinoma (also called adenocystic carcinoma, adenomyoepithelioina, cribriform carcinoma and cylindroma), carcinoma adenomatosum, adenocarcinoma, carcinoma of adrenal cortex, alveolar carcinoma, alveolar cell carcinoma (also called bronchiolar carcinoma, alveolar cell tumor and pulmonary adenomatosis), basal cell carcinoma, carcinoma basocellulare (also called basaloma, or basiloma, and hair matrix carcinoma), basaloid carcinoma, basosquamous cell carcinoma, breast carcinoma, bronchioalveolar carcinoma, bronchiolar carcinoma, bronchogenic carcinoma, cerebriform carcinoma, cholangiocellular carcinoma (also called cholangioma and cholangiocarcinoma), chorionic carcinoma, colloid carcinoma, comedo carcinoma, corpus carcinoma, cribriform carcinoma, carcinoma en cuirasse, carcinoma cutaneum, cylindrical carcinoma, cylindrical cell carcinoma, duct carcinoma, carcinoma durum, embryonal carcinoma, encephaloid carcinoma, epibulbar carcinoma, epidermoid carcinoma, carcinoma epitheliale adenoides, carcinoma exulcere, carcinoma fibrosum, gelatiniform carcinoma, gelatinous carcinoma, giant cell carcinoma, gigantocellulare, glandular carcinoma, granulosa cell carcinoma, hair- matrix carcinoma, hematoid carcinoma, hepatocellular carcinoma (also called hepatoma, malignant hepatoma and hepatocarcinoma), Huirthle cell carcinoma, hyaline carcinoma, hypemephroid carcinoma, infantile embryonal carcinoma, carcinoma in situ, intraepidermal carcinoma, intraepithelial carcinoma, Krompecher's carcinoma, Kulchitzky-cell carcinoma, lenticular carcinoma, carcinoma lenticulare, lipomatous carcinoma, lymphoepithelial carcinoma, carcinoma mastitoides, carcinoma medullare, medullary carcinoma, carcinoma melanodes, melanotic carcinoma, mucinous carcinoma, carcinoma muciparum, carcinoma mucocellulare, mucoepidermoid carcinoma, carcinoma mucosum, mucous carcinoma, carcinoma myxomatodes, nasopharyngeal carcinoma, carcinoma nigrum, oat cell carcinoma, carcinoma ossificans, osteoid carcinoma, ovarian carcinoma, papillary carcinoma, periportal carcinoma, preinvasive carcinoma, prostate carcinoma, renal cell carcinoma of kidney (also called adenocarcinoma of kidney and hypemephoroid carcinoma), reserve cell carcinoma, carcinoma sarcomatodes, scheinderian carcinoma, scirrhous carcinoma, carcinoma scroti, signet-ring cell carcinoma, carcinoma simplex, small-cell carcinoma, solanoid carcinoma, spheroidal cell carcinoma, spindle cell carcinoma, carcinoma spongiosum, squamous carcinoma, squamous cell carcinoma, string carcinoma, carcinoma telangiectaticum, carcinoma telangiectodes, transitional cell carcinoma, carcinoma tuberosum, tuberous carcinoma, verrucous carcinoma, carcinoma vilosum. In preferred embodiments, the methods of the present disclosure are used to treat subjects having cancer of the breast, cervix, ovary, prostate, lung, colon and rectum, pancreas, stomach or kidney.

Sarcomas are mesenchymal neoplasms that arise in bone and soft tissues. Different types of sarcomas are recognized and these include: liposarcomas (including myxoid liposarcomas and pleiomorphic liposarcomas), leiomyosarcomas, rhabdomyosarcomas, malignant peripheral nerve sheath tumors (also called malignant schwannomas,

neurofibrosarcomas, or neurogenic sarcomas), Ewing's tumors (including Ewing's sarcoma of bone, extraskeletal (i.e., non-bone) Ewing's sarcoma, and primitive neuroectodermal tumor [PNET]), synovial sarcoma, angiosarcomas, hemangiosarcomas, lymphangiosarcomas, Kaposi's sarcoma, hemangioendothelioma, fibrosarcoma, desmoid tumor (also called aggressive fibromatosis), dermatofibrosarcoma protuberans (DFSP), malignant fibrous histiocytoma (MFH), hemangiopericytoma, malignant mesenchymoma, alveolar soft-part sarcoma, epithelioid sarcoma, clear cell sarcoma, desmoplastic small cell tumor,

gastrointestinal stromal tumor (GIST) (also known as GI stromal sarcoma), osteosarcoma (also known as osteogenic sarcoma)-skeletal and extraskeletal, and chondrosarcoma.

In some embodiments, the cancer to be treated can be a refractory cancers. A “refractory cancer,” as used herein, is a cancer that is resistant to the standard of care prescribed. These cancers may appear initially responsive to a treatment (and then recur), or they may be completely non-responsive to the treatment. The ordinary standard of care will vary depending upon the cancer type, and the degree of progression in the subject. It may be a chemotherapy, or surgery, or radiation, or a combination thereof. Those of ordinary skill in the art are aware of such standards of care. Subjects being treated according to the present disclosure for a refractory cancer therefore may have already been exposed to another treatment for their cancer. Alternatively, if the cancer is likely to be refractory (e.g., given an analysis of the cancer cells or history of the subject), then the subject may not have already been exposed to another treatment. Examples of refractory cancers include, but are not limited to, leukemia, melanomas, renal cell carcinomas, colon cancer, liver (hepatic) cancers, pancreatic cancer, Non-Hodgkin's lymphoma and lung cancer. Any of the immune cells expressing chimeric receptors described herein may be administered in a pharmaceutically acceptable carrier or excipient as a pharmaceutical composition.

The phrase“pharmaceutically acceptable,” as used in connection with compositions and/or cells of the present disclosure, refers to molecular entities and other ingredients of such compositions that are physiologically tolerable and do not typically produce untoward reactions when administered to a mammal (e.g., a human). Preferably, as used herein, the term“pharmaceutically acceptable” means approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in mammals, and more particularly in humans.“Acceptable” means that the carrier is compatible with the active ingredient of the composition (e.g., the nucleic acids, vectors, cells, or therapeutic antibodies) and does not negatively affect the subject to which the composition(s) are administered. Any of the pharmaceutical compositions and/or cells to be used in the present methods can comprise pharmaceutically acceptable carriers, excipients, or stabilizers in the form of lyophilized formations or aqueous solutions.

Pharmaceutically acceptable carriers, including buffers, are well known in the art, and may comprise phosphate, citrate, and other organic acids; antioxidants including ascorbic acid and methionine; preservatives; low molecular weight polypeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; amino acids; hydrophobic polymers;

monosaccharides; disaccharides; and other carbohydrates; metal complexes; and/or non-ionic surfactants. See, e.g. Remington: The Science and Practice of Pharmacy 20th Ed. (2000) Lippincott Williams and Wilkins, Ed. K. E. Hoover.

Kits for Therapeutic Uses

Also within the scope of the present disclosure are kits for use of the agents targeting cell-surface mucins. Such kits may include one or more containers comprising a

pharmaceutical composition that comprises any agent comprising an antigen-binding fragment that binds a cell-surface mucin (e.g. , immune cells expressing chimeric receptors described herein), and a pharmaceutically acceptable carrier.

In some embodiments, the kit can comprise instructions for use in any of the methods described herein. The included instructions can comprise a description of administration of the pharmaceutical compositions to a subject to achieve the intended activity in a subject.

The kit may further comprise a description of selecting a subject suitable for treatment based on identifying whether the subject is in need of the treatment. In some embodiments, the instructions comprise a description of administering the pharmaceutical compositions to a subject who is in need of the treatment.

The instructions relating to the use of the agents targeting cell-surface mucins and the first and second pharmaceutical compositions described herein generally include information as to dosage, dosing schedule, and route of administration for the intended treatment. The containers may be unit doses, bulk packages (e.g., multi-dose packages) or sub-unit doses. Instructions supplied in the kits of the disclosure are typically written instructions on a label or package insert. The label or package insert indicates that the pharmaceutical compositions are used for treating, delaying the onset, and/or alleviating a disease or disorder in a subject.

The kits provided herein are in suitable packaging. Suitable packaging includes, but is not limited to, vials, bottles, jars, flexible packaging, and the like. Also contemplated are packages for use in combination with a specific device, such as an inhaler, nasal

administration device, or an infusion device. A kit may have a sterile access port (for example, the container may be an intravenous solution bag or a vial having a stopper pierceable by a hypodermic injection needle). The container may also have a sterile access port. At least one active agent in the pharmaceutical composition is a chimeric receptor variants as described herein.

Kits optionally may provide additional components such as buffers and interpretive information. Normally, the kit comprises a container and a label or package insert(s) on or associated with the container. In some embodiment, the disclosure provides articles of manufacture comprising contents of the kits described above.

General techniques

The practice of the present disclosure will employ, unless otherwise indicated, conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry, and immunology, which are within the skill of the art. Such techniques are explained fully in the literature, such as Molecular Cloning: A Laboratory Manual, second edition (Sambrook, et al., 1989) Cold Spring Harbor Press; Oligonucleotide Synthesis (M. J. Gait, ed. 1984); Methods in Molecular Biology, Humana Press; Cell Biology: A Laboratory Notebook (J. E. Cellis, ed., 1989) Academic Press;

Animal Cell Culture (R. I. Freshney, ed. 1987); Introuction to Cell and Tissue Culture (J.

P. Mather and P. E. Roberts, 1998) Plenum Press; Cell and Tissue Culture: Laboratory Procedures (A. Doyle, J. B. Griffiths, and D. G. Newell, eds. 1993-8) J. Wiley and Sons; Methods in Enzymology (Academic Press, Inc.); Handbook of Experimental Immunology (D. M. Weir and C. C. Blackwell, eds.): Gene Transfer Vectors for Mammalian Cells (J.

M. Miller and M. P. Calos, eds., 1987); Current Protocols in Molecular Biology (F. M. Ausubel, et al. eds. 1987); PCR: The Polymerase Chain Reaction, (Mullis, et al., eds.

1994); Current Protocols in Immunology (J. E. Coligan et al., eds., 1991); Short Protocols in Molecular Biology (Wiley and Sons, 1999); Immunobiology (C. A. Janeway and P. Travers, 1997); Antibodies (P. Finch, 1997); Antibodies: a practice approach (D. Catty., ed., IRL Press, 1988-1989); Monoclonal antibodies: a practical approach (P. Shepherd and C. Dean, eds., Oxford University Press, 2000); Using antibodies: a laboratory manual (E. Harlow and D. Lane (Cold Spring Harbor Laboratory Press, 1999); The Antibodies (M. Zanetti and J. D. Capra, eds. Harwood Academic Publishers, 1995); DNA Cloning: A practical Approach, Volumes I and II (D.N. Glover ed. 1985); Nucleic Acid Hybridization (B.D. Hames & S J. Higgins eds. (1985»; Transcription and Translation (B.D. Hames &

S.J. Higgins, eds. (1984»; Animal Cell Culture (R.I. Freshney, ed. (1986»; Immobilized Cells and Enzymes (IRL Press, (1986»; and B. Perbal, A practical Guide To Molecular Cloning (1984); F.M. Ausubel et al. (eds.).

Without further elaboration, it is believed that one skilled in the art can, based on the above description, utilize the present disclosure to its fullest extent. The following specific embodiments are, therefore, to be construed as merely illustrative, and not limitative of the remainder of the disclosure in any way whatsoever. All publications cited herein are incorporated by reference for the purposes or subject matter referenced herein.

In certain embodiments, the agents, such as CAR-T cells, are administered intratumorally.

The agent can be administered via a mechanical delivery device or an implantable delivery system. The construction and use of mechanical delivery devices for the delivery of agents in vivo is well known in the art. For example, the agent can be administered via a pump or other device that releases the agent. In certain embodiments, the agent is administered via a breather pump or a magnetically controlled pump.

The pump may be implanted into the tumor resection cavity and deliver a fixed or variable dose of the agent.

Intratumoral administration may also include the use of chemotherapy wafers, stereotactic injections, as well as convection enhanced delivery. The terms“subject,”“individual,” and“patient” are used interchangeably, and refer to a vertebrate, preferably a mammal such as a human. Mammals include, but are not limited to, human primates, non-human primates or murine, bovine, equine, canine or feline species. In the context of the present disclosure, the term“subject” also encompasses tissues and cells that can be cultured in vitro or ex vivo or manipulated in vivo. The term“subject” can be used interchangeably with the term“organism”.

The terms“polynucleotide”,“nucleotide”,“nucleotide sequence”,“nucleic acid” and “oligonucleotide” are used interchangeably. They refer to a polymeric form of nucleotides of any length, either deoxyribonucleo tides or ribonucleotides, or analogs thereof. Examples of polynucleotides include, but are not limited to, coding or non-coding regions of a gene or gene fragment, exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, short interfering RNA (siRNA), short-hairpin RNA (shRNA), micro-RNA (miRNA), ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, and primers. One or more nucleotides within a polynucleotide can further be modified. The sequence of nucleotides may be interrupted by non-nucleotide components. A polynucleotide may also be modified after polymerization, such as by conjugation with a labeling agent.

The term“hybridization” refers to a reaction in which one or more polynucleotides react to form a complex that is stabilized via hydrogen bonding between the bases of the nucleotide residues. The hydrogen bonding may occur by Watson Crick base pairing, Hoogstein binding, or in any other sequence specific manner. The complex may comprise two strands forming a duplex structure, three or more strands forming a multi-stranded complex, a single self-hybridizing strand, or any combination of these. A hybridization reaction may constitute a step in a more extensive process, such as the initiation of PCR, or the cleavage of a polynucleotide by an enzyme. A sequence capable of hybridizing with a given sequence is referred to as the“complement” of the given sequence.

The term“recombinant expression vector” means a genetically-modified

oligonucleotide or polynucleotide construct that permits the expression of an mRNA, protein, polypeptide, or peptide by a host cell, when the construct comprises a nucleotide sequence encoding the mRNA, protein, polypeptide, or peptide, and the vector is contacted with the cell under conditions sufficient to have the mRNA, protein, polypeptide, or peptide expressed within the cell. The vectors of the present disclosure are not naturally-occurring as a whole. Parts of the vectors can be naturally-occurring. The non-naturally occurring recombinant expression vectors of the present disclosure can comprise any type of nucleotides, including, but not limited to DNA and RNA, which can be single-stranded or double-stranded, synthesized or obtained in part from natural sources, and which can contain natural, non natural or altered nucleotides.

“Transfection,”“transformation,” or“transduction,” as used herein, refer to the introduction of one or more exogenous polynucleotides into a host cell by using physical or chemical methods.

“Antibody,”“fragment of an antibody,”“antibody fragment,”“functional fragment of an antibody,” or“antigen-binding portion” are used interchangeably to mean one or more fragments or portions of an antibody that retain the ability to specifically bind to a specific antigen (Holliger et al., Nat. Biotech. (2005) 23(9): 1126). The present antibodies may be antibodies and/or fragments thereof. Antibody fragments include Fab, F(ab')2, scFv, disulfide linked Fv, Fc, or variants and/or mixtures. The antibodies may be chimeric, humanized, single chain, or bi-specific. All antibody isotypes are encompassed by the present disclosure, including, IgA, IgD, IgE, IgG, and IgM. Suitable IgG subtypes include IgGl, IgG2, IgG3 and IgG4. An antibody light or heavy chain variable region consists of a framework region interrupted by three hypervariable regions, referred to as complementarity determining regions (CDRs). The CDRs of the present antibodies or antigen-binding portions can be from a non-human or a human source. The framework of the present antibodies or antigen-binding portions can be human, humanized, non-human (e.g., a murine framework modified to decrease antigenicity in humans), or a synthetic framework (e.g., a consensus sequence).

The present antibodies or antigen-binding portions can specifically bind with a dissociation constant (KD) of less than about 10^-7 M, less than about 10^-8 M, less than about 10^-9 M, less than about 10^-10 M, less than about 10^-11 M, or less than about 10^-12 M. Affinities of the antibodies according to the present disclosure can be readily determined using conventional techniques (see, e.g., Scatchard et al., Ann. N. Y. Acad. Sci. (1949) 51:660; and U.S. Patent Nos. 5,283,173, 5,468,614, or the equivalent).

The terms“chimeric receptor,”“Chimeric Antigen Receptor,” or alternatively a “CAR” are used interchangeably throughout and refer to a recombinant polypeptide construct comprising at least an extracellular antigen binding domain, a transmembrane domain and a cytoplasmic signaling domain (also referred to herein as“an intracellular signaling domain”) comprising a functional signaling domain derived from a stimulatory molecule as defined below. Lee et al., Clin. Cancer Res. (2012) 18(10):2780; Jensen et al., Immunol Rev. (2014) 257(1):127; www.cancer.gov/about-cancer/treatment/research/car-t-cells. In one

embodiment, the stimulatory molecule is the zeta chain associated with the T cell receptor complex. In one aspect, the cytoplasmic signaling domain further comprises one or more functional signaling domains derived from at least one costimulatory molecule as defined below. The costimulatory molecule may also be 4-1BB (i.e., CD137), CD27 and/or CD28 or fragments of those molecules. In another aspect, the CAR comprises a chimeric fusion protein comprising an extracellular antigen recognition domain, a transmembrane domain and an intracellular signaling domain comprising a functional signaling domain derived from a stimulatory molecule. The CAR comprises a chimeric fusion protein comprising an extracellular antigen recognition domain, a transmembrane domain and an intracellular signaling domain comprising a functional signaling domain derived from a co- stimulatory molecule and a functional signaling domain derived from a stimulatory molecule.

Alternatively, the CAR comprises a chimeric fusion protein comprising an extracellular antigen recognition domain, a transmembrane domain and an intracellular signaling domain comprising two functional signaling domains derived from one or more co-stimulatory molecule(s) and a functional signaling domain derived from a stimulatory molecule. The CAR can also comprise a chimeric fusion protein comprising an extracellular antigen recognition domain, a transmembrane domain and an intracellular signaling domain comprising at least two functional signaling domains derived from one or more co stimulatory molecule(s) and a functional signaling domain derived from a stimulatory molecule. The antigen recognition moiety of the CAR encoded by the nucleic acid sequence can contain any lineage specific, antigen-binding antibody fragment. The antibody fragment can comprise one or more CDRs, the variable region (or portions thereof), the constant region (or portions thereof), or combinations of any of the foregoing.

The term“signaling domain” refers to the functional portion of a protein which acts by transmitting information within the cell to regulate cellular activity via defined signaling pathways by generating second messengers or functioning as effectors by responding to such messengers.

The term“zeta” or alternatively“zeta chain”,“CD3-zeta” or“TCR-zeta” is defined as the protein provided as GenBank accession numbers NP_932170, NP_000725, or

XP_011508447; or the equivalent residues from a non-human species, e.g., mouse, rodent, monkey, ape and the like, and a“zeta stimulatory domain” or alternatively a“CD3-zeta stimulatory domain” or a“TCR-zeta stimulatory domain” is defined as the amino acid residues from the cytoplasmic domain of the zeta chain that are sufficient to functionally transmit an initial signal necessary for T cell activation.

The term“genetically engineered” or“genetically modified” refers to cells being manipulated by genetic engineering, for example by genome editing. That is, the cells contain a heterologous sequence which does not naturally occur in said cells. Typically, the heterologous sequence is introduced via a vector system or other means for introducing nucleic acid molecules into cells including liposomes. The heterologous nucleic acid molecule may be integrated into the genome of the cells or may be present extra- chromosomally, e.g., in the form of plasmids. The term also includes embodiments of introducing genetically engineered, isolated CAR polypeptides into the cell.

The term“autologous” refers to any material derived from the same individual to whom it is later to be re-introduced into the same individual.

The term“allogeneic” refers to any material derived from a different animal of the same species as the individual to whom the material is introduced. Two or more individuals are said to be allogeneic to one another when the genes at one or more loci are not identical.

The term“inhibition” when used in reference to gene expression or function of a lineage specific antigen refers to a decrease in the level of gene expression or function of the lineage specific antigen, where the inhibition is a result of interference with gene expression or function. The inhibition may be complete, in which case there is no detectable expression or function, or it may be partial. Partial inhibition can range from near complete inhibition to a near absence of inhibition. By eliminating particular target cells, CAR T cells may effectively inhibit the overall expression of particular cell lineage.

Cells such as hematopoietic cells that are“deficient in a mucin” refers to cells having a substantially reduced expression level of the mucin as compared with their naturally- occurring counterpart, e.g., endogenous hematopoietic cells of the same type, or cells that do not express the mucin, i.e., not detectable by a routine assay such as FACS. In some instances, the express level of a mucin of cells that are“deficient in the antigen” can be lower than about 40% (e.g., 30%, 20%, 15%, 10%, 5% or lower) of the expression level of the same mucin of the naturally-occurring counterpart. As used herein, the term“about” refers to a particular value +/- 5%. For example, an expression level of about 40% may include any amount of expression between 35%-45%. Example 1

In order to develop a CAR-T cell, we obtained the cDNA clone for a monoclonal antibody (MAb 8G7) that was strongly reactive against the MUC4 peptide and with native MUC4 from human tissues or pancreatic cancer cells as shown by Western blotting, immunohistochemistry, and confocal analysis (Moniaux et al., Generation and

characterization of anti-MUC4 monoclonal antibodies reactive with normal and cancer cells in humans, J Histochem Cytochem. 2004; 52:253-61). The construct was obtained which contained the nucleotide sequences of MAb 8G7 VL and Vh regions cloned into PCR2.1. These VL, L and VH regions were then cloned into a 3^rd generation CAR-T vector (pHIV- Zsgreen, 7678 bp) which contained two co- stimulatory molecules downstream, which were the CD28 domain and the CD3x domain. The MUC4 CART construct was generated and confirmed by PCR, restriction digest and sequencing.

The construct was then packaged into lentivirus in A293T cells.

We will use the lentivirus to infect T cells, and then show in co-culture with pancreatic cancer cell lines (BXPC3) the ability of the MUC4 CART construct to activate T cell proliferation and gamma- IFN and inhibit growth of the cancer cells.

We will also demonstrate efficacy in xenograft cancer models. For example, T cells having the lentiviral vectors encoding the anti-MUC4 CAR will be injected IV/IT to NSG mice with cells expressing MUC4.

Example 2 Synthetic construct FMC63-28Z receptor protein gene, complete cds

ACCESSION HM852952

VERSION HM852952.1 GL305690546

KEYWORDS

• SOURCE synthetic construct

• ORGANISM synthetic construct

other sequences; artificial sequences.

REFERENCE 1 (bases 1 to 1470)

• AUTHORS KochenderferJ.N., Feldman, S.A., Zhao,Y., Xu,H., Black, M.A.,

Morgan, R.A., Wilson, W.H. and Rosenberg, S.A.

• TITLE Construction and preclinical evaluation of an anti-CD 19 chimeric antigen receptor

• JOURNAL J. Immunother. 32 (7), 689-702 (2009) • PUBMED 19561539

Example 3 Infusion of MUC4 CAR-T cells into patients

Prior to the i.v. infusion of the MUC4 CAR-T cells into the patient, cells will be washed with phosphate buffered saline and concentrated. A cell processor such as a Haemonetics CellSaver (Haemonetics Corporation, Braintree, Mass.), which provides a closed and sterile system, will be used for the washing and concentration steps before formulation. The T cells expressing the anti-MUC4 chimeric receptors will be formulated into 100 ml of sterile normal saline supplemented with human serum albumin. Finally, patients will be infused with 1-10X10⁷ T cells/kg over a period of 1-3 days (Maude et al., NEJM (2014) 371(16): 1507). The number of T cells expressing anti-MUC4 Chimeric receptors infused will depend on numerous factors such as the state of the cancer patient, patent's age, prior treatment, etc.

OTHER EMBODIMENTS

All of the features disclosed in this specification may be combined in any combination. Each feature disclosed in this specification may be replaced by an alternative feature serving the same, equivalent, or similar purpose. Thus, unless expressly stated otherwise, each feature disclosed is only an example of a generic series of equivalent or similar features.

From the above description, one of skill in the art can easily ascertain the essential characteristics of the present disclosure, and without departing from the spirit and scope thereof, can make various changes and modifications of the disclosure to adapt it to various usages and conditions. Thus, other embodiments are also within the claims.

EQUIVALENTS

While several inventive embodiments have been described and illustrated herein, those of ordinary skill in the art will readily envision a variety of other means and/or structures for performing the function and/or obtaining the results and/or one or more of the advantages described herein, and each of such variations and/or modifications is deemed to be within the scope of the inventive embodiments described herein. More generally, those skilled in the art will readily appreciate that all parameters, dimensions, materials, and configurations described herein are meant to be exemplary and that the actual parameters, dimensions, materials, and/or configurations will depend upon the specific application or applications for which the inventive teachings is/are used. Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific inventive embodiments described herein. It is, therefore, to be understood that the foregoing embodiments are presented by way of example only and that, within the scope of the appended claims and equivalents thereto, inventive embodiments may be practiced otherwise than as specifically described and claimed. Inventive embodiments of the present disclosure are directed to each individual feature, system, article, material, kit, and/or method described herein. In addition, any combination of two or more such features, systems, articles, materials, kits, and/or methods, if such features, systems, articles, materials, kits, and/or methods are not mutually inconsistent, is included within the inventive scope of the present disclosure.

All definitions, as defined and used herein, should be understood to control over dictionary definitions, definitions in documents incorporated by reference, and/or ordinary meanings of the defined terms.

All references, patents and patent applications disclosed herein are incorporated by reference with respect to the subject matter for which each is cited, which in some cases may encompass the entirety of the document.

The indefinite articles“a” and“an,” as used herein in the specification and in the claims, unless clearly indicated to the contrary, should be understood to mean“at least one.”

The phrase“and/or,” as used herein in the specification and in the claims, should be understood to mean“either or both” of the elements so conjoined, i.e., elements that are conjunctively present in some cases and disjunctively present in other cases. Multiple elements listed with“and/or” should be construed in the same fashion, i.e.,“one or more” of the elements so conjoined. Other elements may optionally be present other than the elements specifically identified by the“and/or” clause, whether related or unrelated to those elements specifically identified. Thus, as a non-limiting example, a reference to“A and/or B”, when used in conjunction with open-ended language such as“comprising” can refer, in one embodiment, to A only (optionally including elements other than B); in another embodiment, to B only (optionally including elements other than A); in yet another embodiment, to both A and B (optionally including other elements); etc. As used herein in the specification and in the claims,“or” should be understood to have the same meaning as“and/or” as defined above. For example, when separating items in a list,“or” or“and/or” shall be interpreted as being inclusive, i.e., the inclusion of at least one, but also including more than one, of a number or list of elements, and, optionally, additional unlisted items. Only terms clearly indicated to the contrary, such as“only one of’ or“exactly one of,” or, when used in the claims,“consisting of,” will refer to the inclusion of exactly one element of a number or list of elements. In general, the term“or” as used herein shall only be interpreted as indicating exclusive alternatives (i.e.“one or the other but not both”) when preceded by terms of exclusivity, such as“either,”“one of,”“only one of,” or “exactly one of.”“Consisting essentially of,” when used in the claims, shall have its ordinary meaning as used in the field of patent law.

As used herein in the specification and in the claims, the phrase“at least one,” in reference to a list of one or more elements, should be understood to mean at least one element selected from any one or more of the elements in the list of elements, but not necessarily including at least one of each and every element specifically listed within the list of elements and not excluding any combinations of elements in the list of elements. This definition also allows that elements may optionally be present other than the elements specifically identified within the list of elements to which the phrase“at least one” refers, whether related or unrelated to those elements specifically identified. Thus, as a non-limiting example,“at least one of A and B” (or, equivalently,“at least one of A or B,” or, equivalently“at least one of A and/or B”) can refer, in one embodiment, to at least one, optionally including more than one, A, with no B present (and optionally including elements other than B); in another embodiment, to at least one, optionally including more than one, B, with no A present (and optionally including elements other than A); in yet another embodiment, to at least one, optionally including more than one, A, and at least one, optionally including more than one,

B (and optionally including other elements); etc.

It should also be understood that, unless clearly indicated to the contrary, in any methods claimed herein that include more than one step or act, the order of the steps or acts of the method is not necessarily limited to the order in which the steps or acts of the method are recited.

Complete pHIVzsGreen Muc4 cd28 Sequence

>pHIV-Zsgreen (SEQ ID NO: 14) gtcgacggatcgggagatctcccgatcccctatggtgcactctcagtacaatctgctctgatgccgcatagtt aagccagtatctgctccctgcttgtgtgttggaggtcgctgagtagtgcgcgagcaaaatttaagctacaaca aggcaaggcttgaccgacaattgcatgaagaatctgcttagggttaggcgttttgcgctgcttcgcgatgtac gggccagatatacgcgttgacattgattattgactagttattaatagtaatcaattacggggtcattagttcatag cccatatatggagttccgcgttacataacttacggtaaatggcccgcctggctgaccgcccaacgaccccc gcccattgacgtcaataatgacgtatgttcccatagtaacgccaatagggactttccattgacgtcaatgggt ggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaagtacgccccctattgac gtcaatgacggtaaatggcccgcctggcattatgcccagtacatgaccttatgggactttcctacttggcagta catctacgtattagtcatcgctattaccatggtgatgcggttttggcagtacatcaatgggcgtggatagcggttt gactcacggggatttccaagtctccaccccattgacgtcaatgggagtttgttttggcaccaaaatcaacggg actttccaaaatgtcgtaacaactccgccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtct atataagcagcgcgttttgcctgtactgggtctctctggttagaccagatctgagcctgggagctctctggctaa ctagggaacccactgcttaagcctcaataaagcttgccttgagtgcttcaagtagtgtgtgcccgtctgttgtgt gactctggtaactagagatccctcagacccttttagtcagtgtggaaaatctctagcagtggcgcccgaaca gggacttgaaagcgaaagggaaaccagaggagctctctcgacgcaggactcggcttgctgaagcgcgc acggcaagaggcgaggggcggcgactggtgagtacgccaaaaattttgactagcggaggctagaagg agagagatgggtgcgagagcgtcagtattaagcgggggagaattagatcgcgatgggaaaaaattcggt taaggccagggggaaagaaaaaatataaattaaaacatatagtatgggcaagcagggagctagaacg attcgcagttaatcctggcctgttagaaacatcagaaggctgtagacaaatactgggacagctacaaccat cccttcagacaggatcagaagaacttagatcattatataatacagtagcaaccctctattgtgtgcatcaaag gatagagataaaagacaccaaggaagctttagacaagatagaggaagagcaaaacaaaagtaagac caccgcacagcaagcggccggccgcgctgatcttcagacctggaggaggagatatgagggacaattgg agaagtgaattatataaatataaagtagtaaaaattgaaccattaggagtagcacccaccaaggcaaaga gaagagtggtgcagagagaaaaaagagcagtgggaataggagctttgttccttgggttcttgggagcagc aggaagcactatgggcgcagcgtcaatgacgctgacggtacaggccagacaattattgtctggtatagtgc agcagcagaacaatttgctgagggctattgaggcgcaacagcatctgttgcaactcacagtctggggcatc aagcagctccaggcaagaatcctggctgtggaaagatacctaaaggatcaacagctcctggggatttggg gttgctctggaaaactcatttgcaccactgctgtgccttggaatgctagttggagtaataaatctctggaacag atttggaatcacacgacctggatggagtgggacagagaaattaacaattacacaagcttaatacactcctta attgaagaatcgcaaaaccagcaagaaaagaatgaacaagaattattggaattagataaatgggcaagt ttgtggaattggtttaacataacaaattggctgtggtatataaaattattcataatgatagtaggaggcttggtag gtttaagaatagtttttgctgtactttctatagtgaatagagttaggcagggatattcaccattatcgtttcagacc cacctcccaaccccgaggggacccgacaggcccgaaggaatagaagaagaaggtggagagagaga cagagacagatccattcgattagtgaacggatcggcactgcgtgcgccaattctgcagacaaatggcagt attcatccacaattttaaaagaaaaggggggattggggggtacagtgcaggggaaagaatagtagacat aatagcaacagacatacaaactaaagaattacaaaaacaaattacaaaaattcaaaattttcgggtttatta cagggacagcagagatccagtttggttagtaccgggcccgctctagccgtgaggctccggtgcccgtcagt gggcagagcgcacatcgcccacagtccccgagaagttggggggaggggtcggcaattgaaccggtgcc tagagaaggtggcgcggggtaaactgggaaagtgatgtcgtgtactggctccgcctttttcccgagggtggg ggagaaccgtatataagtgcagtagtcgccgtgaacgttctttttcgcaacgggtttgccgccagaacacag gtaagtgccgtgtgtggttcccgcgggcctggcctctttacgggttatggcccttgcgtgccttgaattacttcca cctggctgcagtacgtgattcttgatcccgagcttcgggttggaagtgggtgggagagttcgaggccttgcgc ttaaggagccccttcgcctcgtgcttgagttgaggcctggcctgggcgctggggccgccgcgtgcgaatctg gtggcaccttcgcgcctgtctcgctgctttcgataagtctctagccatttaaaatttttgatgacctgctgcgacg ctttttttctggcaagatagtcttgtaaatgcgggccaagatctgcacactggtatttcggtttttggggccgcgg gcggcgacggggcccgtgcgtcccagcgcacatgttcggcgaggcggggcctgcgagcgcggccacc gagaatcggacgggggtagtctcaagctggccggcctgctctggtgcctggcctcgcgccgccgtgtatcg ccccgccctgggcggcaaggctggcccggtcggcaccagttgcgtgagcggaaagatggccgcttcccg gccctgctgcagggagctcaaaatggaggacgcggcgctcgggagagcgggcgggtgagtcacccac acaaaggaaaagggcctttccgtcctcagccgtcgcttcatgtgactccacggagtaccgggcgccgtcca

gcatcttgaagggcgacgtgagcatgtacctgctgctgaaggacggtggccgcttgcgctgccagttcgac accgtgtacaaggccaagtccgtgccccgcaagatgcccgactggcacttcatccagcacaagctgacc cgcgaggaccgcagcgacgccaagaaccagaagtggcacctgaccgagcacgccatcgcctccggct ccgccttgccctaaggatcgcatcgataccgtcgacctcgatcgagacctagaaaaacatggagcaatca caagtagcaatacagcagctaccaatgctgattgtgcctggctagaagcacaagaggaggaggaggtgg gttttccagtcacacctcaggtacctttaagaccaatgacttacaaggcagctgtagatcttagccactttttaa aagaaaaggggggactggaagggctaattcactcccaacgaagacaagatatccttgatctgtggatcta ccacacacaaggctacttccctgattggcagaactacacaccagggccagggatcagatatccactgacc tttggatggtgctacaagctagtaccagttgagcaagagaaggtagaagaagccaatgaaggagagaac acccgcttgttacaccctgtgagcctgcatgggatggatgacccggagagagaagtattagagtggaggttt gacagccgcctagcatttcatcacatggcccgagagctgcatccggactgtactgggtctctctggttagacc agatctgagcctgggagctctctggctaactagggaacccactgcttaagcctcaataaagcttgccttgagt gcttcaagtagtgtgtgcccgtctgttgtgtgactctggtaactagagatccctcagacccttttagtcagtgtgg aaaatctctagcagcatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgct ggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcga aacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgacc ctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtagg tatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgct gcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagcca ctggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactac ggctacactagaagaacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggta gctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcag aaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacg ttaagggattttggtcatgagattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaat caatctaaagtatatatgagtaaacttggtctgacagttaccaatgcttaatcagtgaggcacctatctcagcg atctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagataactacgatacgggagggcttaccat ctggccccagtgctgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataaacca gccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttg ccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgttgttgccattgctacaggcatcgtg gtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaacgatcaaggcgagttacatgatccccc atgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtcagaagtaagttggccgcagtgttatc actcatggttatggcagcactgcataattctcttactgtcatgccatccgtaagatgcttttctgtgactggtgagt actcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggata ataccgcgccacatagcagaactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaactctcaa ggatcttaccgctgttgagatccagttcgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttc accagcgtttctgggtgagcaaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacac ggaaatgttgaatactcatactcttcctttttcaatattattgaagcatttatcagggttattgtctcatgagcggat acatatttgaatgtatttagaaaaataaacaaataggggttccgcgcacatttccccgaaaagtgccacctg ac

Hinge-CD28/ICOS - CD3z Notl restriction enzyme recognition sites are shown in capitalization. The translational stop site is in boldface. The BamHI restriction cleavage site is shown in underline.

CD28 costimulatory domain (SEQ ID NO: 10) GCGGCCGCAattgaagttatgtatcct cctccttacctagacaatgagaagagcaatgga accat tat ccatgtgaaagggaaacacctttgtccaagt cccctatttcccggaccttct aagccct tttgggt get ggtggtggttggtggagt cctggcttgctatagcttgctagta acagtggcctttattattttctgggtgaggagtaagaggagcaggct cctgcacagtgac tacatgaacatgact ccccgccgccccgggcccAcccgcaagcattaccagccctatgcc ccaccacgcgacttcgcagcctatcgctccagagtgaagttcagcaggagcgcagacgcc cccgcgtaccagcagggccagaaccagct etataaegaget caat etaggaegaagagag gagtacgatgttttggacaagagacgtggccgggaccctgagatggggggaaagccgaga aggaagaaccctcaggaaggcctgtacaatgaactgcagaaagataagatggcggaggcc tacagtgagattgggatgaaaggcgagcgccggaggggcaaggggcacgatggcctttac cagggtctcagtacagccaccaaggacacctacgacgcccttcacatgcaggccctgccc cctcgcTAAcgcccctctccctcccccccccctaa

ICOS costimulatory domain (SEQ ID NO: 11)

GCGGCCGCActatcaatttttgatcct cctccttttaaagtaactcttacaggaggatat ttgcatatttatgaatcacaactttgttgccagctgaagttctggttacccataggatgt gcagcctttgttgtagtctgcattttgggatgcatacttatttgttggcttacaaaaaag aagtatt cat ccagtgtgcacga ccctaacggtgaat acatgt teat gagagcagtgaac acagccaaaaaatctagactcacagatgtgaccctaagagtgaagtt cagcaggagcgca gacgcccccgcgtaccagcagggccagaaccagct etataaegaget caat etaggaega agagaggagtacgatgttttggacaagagacgtggccgggaccctgagatggggggaaag ccgagaaggaagaaccctcaggaaggcctgtacaatgaactgcagaaagataagatggcg gaggcctacagtgagattgggatgaaaggcgagcgccggaggggcaaggggcacgatggc ctttaccagggtctcagtacagccaccaaggacacctacgacgcccttcacatgcaggcc ctgccccctcgcTAAcgcccctctccctcccccccccctaa

Fusion (hybrid) CD28 and ICOS costimulatory domain (SEQ ID NO: 12)

GCGGCCGCAattgaagttatgtatcct cctccttacctagacaatgagaagagcaatgga accattatccatgtgaaagggaaacacctttgtccaagt cccctatttcccggaccttct aagcccttttgggtgctggtggtggttggtggagt cctggcttgctatagcttgctagta acagtggcctttattattttctgggtgaggagtaagaggagcaggct cctgcacagtgac tacatgttcatgagagcagtgaacacagccaaaaaatctagactcacagatgtgacccta agagtgaagtt cagcaggagcgcagacgcccccgcgtaccagcagggccagaaccagct c tataaegaget caat ctaggacgaagagaggagtacgatgttttggacaagagacgtggc cgggaccctgagatggggggaaagccgagaaggaagaaccctcaggaaggcctgtacaat gaactgcagaaagataagatggcggaggcctacagtgagattgggatgaaaggcgagcgc cggaggggcaaggggcacgatggcctttaccagggtctcagtacagccaccaaggacacc tacgacgcccttcacatgcaggccctgccccctcgcTAAcgcccctctccctcccccccc cctaa MUC4 CAR-T CELLS FOR TREATING CANCER

Field of the Invention

Background of Disclosure

Summary

In one embodiment, the CAR comprises two costimulatory domains.

The immune cell may be a T cell.

The CAR may comprise a cytoplasmic signaling domain, which is from CD3z.

The CAR may comprise a hinge domain, which is from CD8a or CD28a.

The transmembrane domain may be from CD8, CD28, or ICOS.

Brief Description of the Drawings

Figure 2. Background, and MUC4 CD28z CAR-T Design.

Figure 3. Amino acid sequence and DNA sequence of the CAR insert.

Figures 7A-7B. Sequencing/alignment using primers EFla-FWD and TC017.

Figure 10. Structures of secretory mucins and transmembrane mucins.

Figure 11. Muc4 human cell line expression.

Figure 13. Expression of O-Glycan Mucins in human pancreatic cancer cell lines.

Detailed Description of Disclosure

The immune cell may be a T cell.

In certain embodiments, the CAR may be of any generation. First generation CARs are composed of an extracellular binding domain, a hinge region, a transmembrane domain, and one or more intracellular signaling domains. Extracellular binding domain may contain single-chain variable fragments (scFvs) derived from tumor antigen-reactive antibodies and usually have high specificity to tumor antigen. The CARs may harbor the CD3z chain domain as the intracellular signaling domain, which is the primary transmitter of signals. Second generation CARs also contain co-stimulatory domains, like CD28 and/or 4- IBB. The involvement of these intracellular signaling domains improve T cell proliferation, cytokine secretion, resistance to apoptosis, and in vivo persistence. Besides co-stimulatory domains, the third-generation CARs combine multiple signaling domains, such as CD3z-CD28-41BB or CD3z-CD28-OX40, to augment T cell activity. Recently, the fourth-generation CARs (also known as TRUCKS or armored CARs), combine the expression of a second-generation CAR with factors that enhance anti-tumor activity (e.g., cytokines, co-stimulatory ligands).

MUC4

Other Tumor Antigens

Management. Curr. Oncol. Rep. 16(6):389 (20140.

Antigen-Binding Fragment

immunoglobulin variable (V) domain gene repertoires from unimmunized donors.

Nucleotide sequence of anti-MUC4 Mab 8G7 Light Chain Variable Region (VL) (SEQ

ID NO: 1)

GATGTTTTGATGACCCAAACTCCACTCACTTTGTCGGTTGCCATTGGACAACCAG

CCTCCATCTCTTGCAAGTCAAGTCAGAGTCTCTTAGATAAGAGTGGAAAGACATA

TTTGAATTGGTTGTTACAGAGGCCAGGCCAGTCTCCGAAGCGCCTAATCTATCTG

GTGTCTAAACTGGACTCTGGAGTCCCTGACAGGTTCACTGGCAGTGGATCAGGGA

CAGATTTCACACTGAAAATCAGCAGAGTGGAGGCTGAGGATTTGGGAGTTTATT

ATTGCTGGCAAGGTACACATTTTCCGCTCACGTTCGGTGCTGGGACCAAGCTGGA

AATAAAACGG

GAGGTGCAGCTGCAGCAGTCAGGACCTGAACTGGTAAAGCCTGGGGCTTCAGTG

AAGATGTCCTGCAAGGCTTCTGGATACACATTCAGTAGCTATGTTATGCACTGGG

TGAAGCAGAAGCCTGGGCAGGGCCTTGAGTGGATTGGATATATTATTCCTTACAA

TGATGATATTAAGTACAGTGAGAAGCTTAAAGGCAAGGCCACACTGACTTCAGA

CAAATCCTCCAACACAGCCTACGTGGAGCTCAGCAGCCTGACCTCTGAGGACTCT

GGGGTCTATTACTGTGCAATTTTTGGTAACTACGTGAGTTATTGGGGCCAAGGGA

CCACGGTCACCGTCTCCTCA

Immune Cells Expressing Chimeric Receptors

As used herein, a chimeric receptor refers to a non-naturally occurring molecule that can be expressed on the surface of a host cell and comprises an antigen-binding fragment that binds to a cell-surface mucin. In general, chimeric receptors comprise at least two domains that are derived from different molecules. In addition to the antigen-binding fragment described herein, the chimeric receptor may further comprise one or more of a hinge domain, a transmembrane domain, at least one co-stimulatory domain, and a cytoplasmic signaling domain. In some embodiments, the chimeric receptor comprises from N terminus to C terminus, an antigen-binding fragment that binds to a cell-surface mucin, a hinge domain, a transmembrane domain, and a cytoplasmic signaling domain. In some embodiments, the chimeric receptor further comprises at least one co-stimulatory domain. In some embodiments, the chimeric receptors described herein comprise a hinge domain, which may be located between the antigen-binding fragment and a

transmembrane domain. A hinge domain is an amino acid segment that is generally found between two domains of a protein and may allow for flexibility of the protein and movement of one or both of the domains relative to one another. Any amino acid sequence that provides such flexibility and movement of the antigen-binding fragment relative to another domain of the chimeric receptor can be used.

Hinge domains of antibodies, such as an IgG, IgA, IgM, IgE, or IgD antibody, are also compatible for use in the chimeric receptors described herein. In some embodiments, the hinge domain is the hinge domain that joins the constant domains CHI and CH2 of an antibody. In some embodiments, the hinge domain is of an antibody and comprises the hinge domain of the antibody and one or more constant regions of the antibody. In some embodiments, the hinge domain comprises the hinge domain of an antibody and the CH3 constant region of the antibody. In some embodiments, the hinge domain comprises the hinge domain of an antibody and the CH2 and CH3 constant regions of the antibody. In some embodiments, the antibody is an IgG, IgA, IgM, IgE, or IgD antibody. In some embodiments, the antibody is an IgG antibody. In some embodiments, the antibody is an IgGl, IgG2, IgG3, or IgG4 antibody. In some embodiments, the hinge region comprises the hinge region and the CH2 and CH3 constant regions of an IgGl antibody. In some embodiments, the hinge region comprises the hinge region and the CH3 constant region of an IgGl antibody.

Also within the scope of the present disclosure are chimeric receptors comprising a hinge domain that is a non-naturally occurring peptide. In some embodiments, the hinge domain between the C-terminus of the extracellular ligand-binding domain of an Fc receptor and the N-terminus of the transmembrane domain is a peptide linker, such as a (GlyxSer)n linker, wherein x and n, independently can be an integer between 3 and 12, including 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or more.

transmembrane domain is a single-pass transmembrane domain. In some embodiments, the transmembrane domain is a single-pass transmembrane domain that orients the N terminus of the chimeric receptor to the extracellular side of the cell and the C terminus of the chimeric receptor to the intracellular side of the cell. In some embodiments, the transmembrane domain is obtained from a single pass transmembrane protein. In some embodiments, the transmembrane domain is of CD8a. In some embodiments, the transmembrane domain is of CD28. In some embodiments, the transmembrane domain is of ICOS. In some embodiments, the chimeric receptors described herein comprise one or more costimulatory signaling domains. The term“co-stimulatory signaling domain,” as used herein, refers to at least a portion of a protein that mediates signal transduction within a cell to induce an immune response, such as an effector function. The co-stimulatory signaling domain of the chimeric receptor described herein can be a cytoplasmic signaling domain from a co-stimulatory protein, which transduces a signal and modulates responses mediated by immune cells, such as T cells, NK cells, macrophages, neutrophils, or eosinophils.

In some embodiments, the chimeric receptor comprises more than one (at least 2,

In general, many immune cells require co- stimulation, in addition to stimulation of an antigen-specific signal, to promote cell proliferation, differentiation and survival, and to activate effector functions of the cell. Activation of a co-stimulatory signaling domain in a host cell (e.g. , an immune cell) may induce the cell to increase or decrease the production and secretion of cytokines, phagocytic properties, proliferation, differentiation, survival, and/or cytotoxicity. The co-stimulatory signaling domain of any co-stimulatory protein may be compatible for use in the chimeric receptors described herein. The type(s) of co stimulatory signaling domain is selected based on factors such as the type of the immune cells in which the chimeric receptors would be expressed (e.g., primary T cells, T cell lines, NK cell lines) and the desired immune effector function (e.g. , cytotoxicity).

Exemplary chimeric receptors are provided in Tables 1 and 2 below.

Table 1: Exemplary components of a chimeric receptor

CD28 intracellular signaling domain-DNA-Human (SEQ ID NO: 3)

AT T GAAG T T AT GT AT CCTCCTCCT T AC C T AG AC AAT GAG AAGAGC AAT GGAAC CAT TAT C C A TGTGAAAGGGAAACACCTTTGTCCAAGTCCCCTATTTCCCGGACCTTCTAAGCCCTTTTGGG TGCTGGTGGTGGTTGGTGGAGTCCTGGCTTGCTATAGCTTGCTAGTAACAGTGGCCTTTATT ATTTTCTGGGTGAGGAGTAAGAGGAGCAGGCTCCTGCACAGTGACTACATGAACATGACTCC CCGCCGCCCCGGGCCCACCCGCAAGCATTACCAGCCCTATGCCCCACCACGCGACTTCGCAG CCTATCGCTCCAGAGTGAAGTTCAGCAGGAGCGCAGACGCCCCCGCGTACCAGCAGGGCCAG AACCAGCTCTATAACGAGCTCAATCTAGGACGAAGAGAGGAGTACGATGTTTTGGACAAGAG ACGTGGCCGGGACCCTGAGATGGGGGGAAAGCCGAGAAGGAAGAACCCTCAGGAAGGCCTGT ACAATGAACTGCAGAAAGATAAGATGGCGGAGGCCTACAGTGAGATTGGGATGAAAGGCGAG CGCCGGAGGGGCAAGGGGCACGATGGCCTTTACCAGGGTCTCAGTACAGCCACCAAGGACAC CTACGACGCCCTTCACATGCAGGCCCTGCCCCCTCGC

ICOS intracellular signaling domain-DNA-Human (SEQ ID NO: 4)

CTATCAATTTTTGATCCTCCTCCTTTTAAAGTAACTCTTACAGGAGGATATTTGCATATTTA

TGAATCACAACTTTGTTGCCAGCTGAAGTTCTGGTTACCCATAGGATGTGCAGCCTTTGTTG

TAGTCTGCATTTTGGGATGCATACTTATTTGTTGGCTTACAAAAAAGAAGTATTCATCCAGT

GTGCACGACCCTAACGGTGAATACATGTTCATGAGAGCAGTGAACACAGCCAAAAAATCTAG

ACTCACAGATGTGACCCTAAGAGTGAAGTTCAGCAGGAGCGCAGACGCCCCCGCGTACCAGC

AGGGCCAGAACCAGCTCTATAACGAGCTCAATCTAGGACGAAGAGAGGAGTACGATGTTTTG

GACAAGAGACGTGGCCGGGACCCTGAGATGGGGGGAAAGCCGAGAAGGAAGAACCCTCAGGA

AGGCCTGTACAATGAACTGCAGAAAGATAAGATGGCGGAGGCCTACAGTGAGATTGGGATGA

AAGGCGAGCGCCGGAGGGGCAAGGGGCACGATGGCCTTTACCAGGGTCTCAGTACAGCCACC

AAGGACACCTACGACGCCCTTCACATGCAGGCCCTGCCCCCTCGC

CD28/ICOS COSTIMULATORY SIGNALING REGION-DNA-Human (SEQ ID NO: 5)

AT T GAAG T T AT GT AT CCTCCTCCT T AC C TAG AC AAT GAG AAGAGC AAT GGAAC CAT TAT C C A TGTGAAAGGGAAACACCTTTGTCCAAGTCCCCTATTTCCCGGACCTTCTAAGCCCTTTTGGG TGCTGGTGGTGGTTGGTGGAGTCCTGGCTTGCTATAGCTTGCTAGTAACAGTGGCCTTTATT ATTTTCTGGGTGAGGAGTAAGAGGAGCAGGCTCCTGCACAGTGACTACATGTTCATGAGAGC AGT GAAC AC AG C CAAAAAATC TAGAC T C AC AGAT G T GAC C C TAAGAG T GAAGTT CAGCAGGA GCGCAGACGCCCCCGCGTACCAGCAGGGCCAGAACCAGCTCTATAACGAGCTCAATCTAGGA CGAAGAGAGGAGTACGATGTTTTGGACAAGAGACGTGGCCGGGACCCTGAGATGGGGGGAAA G C C G AG AAG G AAG AAC C C T C AG G AAG G C C T G T AC AAT GAAC T G C AG AAAG AT AAG AT G G C G G AGGCCTACAGTGAGATTGGGATGAAAGGCGAGCGCCGGAGGGGCAAGGGGCACGATGGCCTT TACCAGGGTCTCAGTACAGCCACCAAGGACACCTACGACGCCCTTCACATGCAGGCCCTGCC CCCTCGC

In some embodiments, the nucleic acid sequence encodes an antigen binding fragment that binds to MUC4 and comprises a heavy chain variable region which has the same CDRs as the CDRs in SEQ ID NO: 2 and a light chain variable region which has the same CDRs as the CDRs in SEQ ID NO: 1. In some embodiments, the antigen-binding fragment comprises a heavy chain variable region as provided by SEQ ID NO: 2 and a light chain variable region as provided by SEQ ID NO: 1. In some embodiments, the chimeric receptor further comprises at least a transmembrane domain and a cytoplasmic signaling domain. In some embodiments, the chimeric receptor further comprises a hinge domain and/or a co-stimulatory signaling domain.

Table 2: Exemplary chimeric receptors

A variety of promoters can be used for expression of the chimeric receptors described herein, including, without limitation, cytomegalovirus (CMV) intermediate early promoter, a viral LTR such as the Rous sarcoma virus LTR, HIV-LTR, HTLV-1 LTR, Maloney murine leukemia virus (MMLV) LTR, myeoloproliferative sarcoma virus (MPSV) LTR, spleen focus-forming virus (SFFV) LTR, the simian virus 40 (SV40) early promoter, herpes simplex tk vims promoter, elongation factor 1 -alpha (EFl-a) promoter with or without the EFl-a intron. Additional promoters for expression of the chimeric receptors include any constitutively active promoter in an immune cell. Alternatively, any regulatable promoter may be used, such that its expression can be modulated within an immune cell.

93/25234; WO 93/11230; WO 93/10218; WO 91/02805; U.S. Pat. Nos. 5,219,740 and 4,777,127; GB Patent No. 2,200,651; and EP Patent No. 0 345 242), alphavirus-based vectors, and adeno-associated virus (AAV) vectors (see, e.g., PCT Publication Nos. WO 94/12649, WO 93/03769; WO 93/19191; WO 94/28938; WO 95/11984 and WO 95/00655). In some embodiments, the vectors for expression of the chimeric receptors are retroviruses. In some embodiments, the vectors for expression of the chimeric receptors are lentiviruses.

In some embodiments, the agent is an antibody-drug conjugate. In some

embodiments, the antibody-drug conjugate comprises an antigen-binding fragment and a toxin or drug that induces cytotoxicity in a target cell. In some embodiments, the antibody- drug conjugate targets MUC4.

In some embodiments, the antigen-bind fragment of the antibody-drug conjugate has the same heavy chain CDRs as the heavy chain variable region provided by SEQ ID NO: 2 and the same light chain CDRS as the light chain variable region provided by SEQ ID NO: 1. In some embodiments, the antigen-bind fragment of the antibody-drug conjugate has the heavy chain variable region provided by SEQ ID NO: 2 and the same light chain variable region provided by SEQ ID NO: 1.

Combined Therapy

In some embodiments, a second treatment is administered prior to the agent comprising an antigen-binding fragment that binds a cell-surface mucin (e.g., immune cells expressing a chimeric receptor as described herein). In some embodiments, a second treatment is administered at least about 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 9 weeks, 10 weeks, 11 weeks, 12 weeks, 3 months, 4 months, 5 months, 6 months or more prior to administration of the agent comprising an antigen-binding fragment that binds to the cell-surface mucin.

Also within the scope of the present disclosure are multiple administrations (e.g. , doses) of the agents. In some embodiments, the agents are administered to the subject once. In some embodiments, the agents are administered to the subject more than once (e.g., at least 2, 3, 4, 5, or more times). In some embodiments, the agents are administered to the subject at a regular interval, e.g. , every six months.

The disease or disorder treated by the present composition and method may be pancreatic cancer. Pancreatic cancers that can be treated include, but are not limited to, exocrine pancreatic cancers and endocrine pancreatic cancers. Exocrine pancreatic cancers include, but are not limited to, adenocarcinomas, acinar cell carcinomas, adenosquamous carcinomas, colloid carcinomas, undifferentiated carcinomas with osteoclast-like giant cells, hepatoid carcinomas, intraductal papillary-mucinous neoplasms, mucinous cystic neoplasms, pancreatoblastomas, serous cystadenomas, signet ring cell carcinomas, solid and

Examples of hematopoietic malignancies include, without limitation, Hodgkin’ s lymphoma, non- Hodgkin’s lymphoma, leukemia, or multiple myeloma. Leukemias include acute myeloid leukaemia, acute lymphoid leukemia, chronic myelogenous leukaemia, acute lymphoblastic leukemia or chronic lymphoblastic leukemia, and chronic lymphoid leukemia.

In some embodiments, the leukemia is acute myeloid leukaemia (AML). Alternatively or in addition, the methods described herein may be used to treat non- hematopoietic cancers, including without limitation, lung cancer, ear, nose and throat cancer, colon cancer, melanoma, pancreatic cancer, mammary cancer, prostate cancer, breast cancer, ovarian cancer, basal cell carcinoma, biliary tract cancer; bladder cancer; bone cancer; breast cancer; cervical cancer; choriocarcinoma; colon and rectum cancer; connective tissue cancer; cancer of the digestive system; endometrial cancer; esophageal cancer; eye cancer; cancer of the head and neck; gastric cancer; intra-epithelial neoplasm; kidney cancer; larynx cancer; liver cancer; fibroma, neuroblastoma; oral cavity cancer (e.g., lip, tongue, mouth, and pharynx); ovarian cancer; pancreatic cancer; prostate cancer; retinoblastoma;

rhabdomyosarcoma; rectal cancer; renal cancer; cancer of the respiratory system; sarcoma; skin cancer; stomach cancer; testicular cancer; thyroid cancer; uterine cancer; cancer of the urinary system, as well as other carcinomas and sarcomas.

Carcinomas are cancers of epithelial origin. Carcinomas intended for treatment with the methods of the present disclosure include, but are not limited to, acinar carcinoma, acinous carcinoma, alveolar adenocarcinoma (also called adenocystic carcinoma, adenomyoepithelioina, cribriform carcinoma and cylindroma), carcinoma adenomatosum, adenocarcinoma, carcinoma of adrenal cortex, alveolar carcinoma, alveolar cell carcinoma (also called bronchiolar carcinoma, alveolar cell tumor and pulmonary adenomatosis), basal cell carcinoma, carcinoma basocellulare (also called basaloma, or basiloma, and hair matrix carcinoma), basaloid carcinoma, basosquamous cell carcinoma, breast carcinoma, bronchioalveolar carcinoma, bronchiolar carcinoma, bronchogenic carcinoma, cerebriform carcinoma, cholangiocellular carcinoma (also called cholangioma and cholangiocarcinoma), chorionic carcinoma, colloid carcinoma, comedo carcinoma, corpus carcinoma, cribriform carcinoma, carcinoma en cuirasse, carcinoma cutaneum, cylindrical carcinoma, cylindrical cell carcinoma, duct carcinoma, carcinoma durum, embryonal carcinoma, encephaloid carcinoma, epibulbar carcinoma, epidermoid carcinoma, carcinoma epitheliale adenoides, carcinoma exulcere, carcinoma fibrosum, gelatiniform carcinoma, gelatinous carcinoma, giant cell carcinoma, gigantocellulare, glandular carcinoma, granulosa cell carcinoma, hair- matrix carcinoma, hematoid carcinoma, hepatocellular carcinoma (also called hepatoma, malignant hepatoma and hepatocarcinoma), Huirthle cell carcinoma, hyaline carcinoma, hypernephroid carcinoma, infantile embryonal carcinoma, carcinoma in situ, intraepidermal carcinoma, intraepithelial carcinoma, Krompecher's carcinoma, Kulchitzky-cell carcinoma, lenticular carcinoma, carcinoma lenticulare, lipomatous carcinoma, lymphoepithelial carcinoma, carcinoma mastitoides, carcinoma medullare, medullary carcinoma, carcinoma melanodes, melanotic carcinoma, mucinous carcinoma, carcinoma muciparum, carcinoma mucocellulare, mucoepidermoid carcinoma, carcinoma mucosum, mucous carcinoma, carcinoma myxomatodes, nasopharyngeal carcinoma, carcinoma nigrum, oat cell carcinoma, carcinoma ossificans, osteoid carcinoma, ovarian carcinoma, papillary carcinoma, periportal carcinoma, preinvasive carcinoma, prostate carcinoma, renal cell carcinoma of kidney (also called adenocarcinoma of kidney and hypemephoroid carcinoma), reserve cell carcinoma, carcinoma sarcomatodes, scheinderian carcinoma, scirrhous carcinoma, carcinoma scroti, signet-ring cell carcinoma, carcinoma simplex, small-cell carcinoma, solanoid carcinoma, spheroidal cell carcinoma, spindle cell carcinoma, carcinoma spongiosum, squamous carcinoma, squamous cell carcinoma, string carcinoma, carcinoma telangiectaticum, carcinoma telangiectodes, transitional cell carcinoma, carcinoma tuberosum, tuberous carcinoma, verrucous carcinoma, carcinoma vilosum. In preferred embodiments, the methods of the present disclosure are used to treat subjects having cancer of the breast, cervix, ovary, prostate, lung, colon and rectum, pancreas, stomach or kidney.

In some embodiments, the cancer to be treated can be a refractory cancers. A “refractory cancer,” as used herein, is a cancer that is resistant to the standard of care prescribed. These cancers may appear initially responsive to a treatment (and then recur), or they may be completely non-responsive to the treatment. The ordinary standard of care will vary depending upon the cancer type, and the degree of progression in the subject. It may be a chemotherapy, or surgery, or radiation, or a combination thereof. Those of ordinary skill in the art are aware of such standards of care. Subjects being treated according to the present disclosure for a refractory cancer therefore may have already been exposed to another treatment for their cancer. Alternatively, if the cancer is likely to be refractory (e.g., given an analysis of the cancer cells or history of the subject), then the subject may not have already been exposed to another treatment. Examples of refractory cancers include, but are not limited to, leukemia, melanomas, renal cell carcinomas, colon cancer, liver (hepatic) cancers, pancreatic cancer, Non-Hodgkin's lymphoma and lung cancer.

Any of the immune cells expressing chimeric receptors described herein may be administered in a pharmaceutically acceptable carrier or excipient as a pharmaceutical composition.

Kits for Therapeutic Uses Also within the scope of the present disclosure are kits for use of the agents targeting cell-surface mucins. Such kits may include one or more containers comprising a

General techniques The practice of the present disclosure will employ, unless otherwise indicated, conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry, and immunology, which are within the skill of the art. Such techniques are explained fully in the literature, such as Molecular Cloning: A Laboratory Manual, second edition (Sambrook, et al., 1989) Cold Spring Harbor Press; Oligonucleotide Synthesis (M. J. Gait, ed. 1984); Methods in Molecular Biology, Humana Press; Cell Biology: A Laboratory Notebook (J. E. Cellis, ed., 1989) Academic Press; Animal Cell Culture (R. I. Freshney, ed. 1987); Introuction to Cell and Tissue Culture (J.

P. Mather and P. E. Roberts, 1998) Plenum Press; Cell and Tissue Culture: Laboratory Procedures (A. Doyle, J. B. Griffiths, and D. G. Newell, eds. 1993-8) J. Wiley and Sons; Methods in Enzymology (Academic Press, Inc.); Handbook of Experimental Immunology (D. M. Weir and C. C. Blackwell, eds.): Gene Transfer Vectors for Mammalian Cells (J. M. Miller and M. P. Calos, eds., 1987); Current Protocols in Molecular Biology (F. M. Ausubel, et al. eds. 1987); PCR: The Polymerase Chain Reaction, (Mullis, et al., eds. 1994); Current Protocols in Immunology (J. E. Coligan et al., eds., 1991); Short Protocols in Molecular Biology (Wiley and Sons, 1999); Immunobiology (C. A. Janeway and P. Travers, 1997); Antibodies (P. Finch, 1997); Antibodies: a practice approach (D. Catty., ed., IRL Press, 1988-1989); Monoclonal antibodies: a practical approach (P. Shepherd and C. Dean, eds., Oxford University Press, 2000); Using antibodies: a laboratory manual (E. Harlow and D. Lane (Cold Spring Harbor Laboratory Press, 1999); The Antibodies (M. Zanetti and J. D. Capra, eds. Harwood Academic Publishers, 1995); DNA Cloning: A practical Approach, Volumes I and II (D.N. Glover ed. 1985); Nucleic Acid Hybridization (B.D. Hames & S J. Higgins eds. (1985»; Transcription and Translation (B.D. Hames & S.J. Higgins, eds. (1984»; Animal Cell Culture (R.I. Freshney, ed. (1986»; Immobilized Cells and Enzymes (IRL Press, (1986»; and B. Perbal, A practical Guide To Molecular Cloning (1984); F.M. Ausubel et al. (eds.).

In certain embodiments, the agents, such as CAR-T cells, are administered intratumorally. The agent can be administered via a mechanical delivery device or an implantable delivery system. The construction and use of mechanical delivery devices for the delivery of agents in vivo is well known in the art. For example, the agent can be administered via a pump or other device that releases the agent. In certain embodiments, the agent is administered via a breather pump or a magnetically controlled pump.

Intratumoral administration may also include the use of chemotherapy wafers, stereotactic injections, as well as convection enhanced delivery.

The terms“subject,”“individual,” and“patient” are used interchangeably, and refer to a vertebrate, preferably a mammal such as a human. Mammals include, but are not limited to, human primates, non-human primates or murine, bovine, equine, canine or feline species. In the context of the present disclosure, the term“subject” also encompasses tissues and cells that can be cultured in vitro or ex vivo or manipulated in vivo. The term“subject” can be used interchangeably with the term“organism”.

The term“recombinant expression vector” means a genetically-modified

“Antibody,”“fragment of an antibody,”“antibody fragment,”“functional fragment of an antibody,” or“antigen-binding portion” are used interchangeably to mean one or more fragments or portions of an antibody that retain the ability to specifically bind to a specific antigen (Holliger et al., Nat. Biotech. (2005) 23(9): 1126). The present antibodies may be antibodies and/or fragments thereof. Antibody fragments include Fab, F(ab')2, scFv, disulfide linked Fv, Fc, or variants and/or mixtures. The antibodies may be chimeric, humanized, single chain, or bi-specific. All antibody isotypes are encompassed by the present disclosure, including, IgA, IgD, IgE, IgG, and IgM. Suitable IgG subtypes include IgGl, IgG2, IgG3 and IgG4. An antibody light or heavy chain variable region consists of a framework region interrupted by three hypervariable regions, referred to as complementarity determining regions (CDRs). The CDRs of the present antibodies or antigen-binding portions can be from a non-human or a human source. The framework of the present antibodies or antigen-binding portions can be human, humanized, non-human (e.g., a murine framework modified to decrease antigenicity in humans), or a synthetic framework (e.g. , a consensus sequence). The present antibodies or antigen-binding portions can specifically bind with a dissociation constant (KD) of less than about 10^-7 M, less than about 10^-8 M, less than about 10^-9 M, less than about 10^-10 M, less than about 10^-11 M, or less than about 10^-12 M. Affinities of the antibodies according to the present disclosure can be readily determined using conventional techniques (see, e.g., Scatchard et al., Ann. N. Y. Acad. Sci. (1949) 51:660; and U.S. Patent Nos. 5,283,173, 5,468,614, or the equivalent).

Cells such as hematopoietic cells that are“deficient in a mucin” refers to cells having a substantially reduced expression level of the mucin as compared with their naturally- occurring counterpart, e.g., endogenous hematopoietic cells of the same type, or cells that do not express the mucin, i.e., not detectable by a routine assay such as FACS. In some instances, the express level of a mucin of cells that are“deficient in the antigen” can be lower than about 40% (e.g., 30%, 20%, 15%, 10%, 5% or lower) of the expression level of the same mucin of the naturally-occurring counterpart. As used herein, the term“about” refers to a particular value +/- 5%. For example, an expression level of about 40% may include any amount of expression between 35%-45%.

Example 1

The construct was then packaged into lentivirus in A293T cells.

Example 2 Synthetic construct FMC63-28Z receptor protein gene, complete cds • ACCESSION HM852952

• VERSION HM852952.1 GI:305690546

• KEYWORDS

• SOURCE synthetic construct

• ORGANISM synthetic construct

other sequences; artificial sequences.

• REFERENCE 1 (bases 1 to 1470)

• AUTHORS Kochenderfer,J.N., Feldman, S.A., Zhao,Y., Xu, H., Black, M.A.,

Morgan, R.A., Wilson, W.H. and Rosenberg, S.A.

• JOURNAL J. Immunother. 32 (7), 689-702 (2009)

• PUBMED 19561539

Example 3 Infusion of MUC4 CAR-T cells into patients

OTHER EMBODIMENTS

All of the features disclosed in this specification may be combined in any combination. Each feature disclosed in this specification may be replaced by an alternative feature serving the same, equivalent, or similar purpose. Thus, unless expressly stated otherwise, each feature disclosed is only an example of a generic series of equivalent or similar features. From the above description, one of skill in the art can easily ascertain the essential characteristics of the present disclosure, and without departing from the spirit and scope thereof, can make various changes and modifications of the disclosure to adapt it to various usages and conditions. Thus, other embodiments are also within the claims.

EQUIVALENTS

The indefinite articles“a” and“an,” as used herein in the specification and in the claims, unless clearly indicated to the contrary, should be understood to mean“at least one.” The phrase“and/or,” as used herein in the specification and in the claims, should be understood to mean“either or both” of the elements so conjoined, i.e., elements that are conjunctively present in some cases and disjunctively present in other cases. Multiple elements listed with“and/or” should be construed in the same fashion, i.e.,“one or more” of the elements so conjoined. Other elements may optionally be present other than the elements specifically identified by the“and/or” clause, whether related or unrelated to those elements specifically identified. Thus, as a non-limiting example, a reference to“A and/or B”, when used in conjunction with open-ended language such as“comprising” can refer, in one embodiment, to A only (optionally including elements other than B); in another embodiment, to B only (optionally including elements other than A); in yet another embodiment, to both A and B (optionally including other elements); etc.

As used herein in the specification and in the claims,“or” should be understood to have the same meaning as“and/or” as defined above. For example, when separating items in a list,“or” or“and/or” shall be interpreted as being inclusive, i.e., the inclusion of at least one, but also including more than one, of a number or list of elements, and, optionally, additional unlisted items. Only terms clearly indicated to the contrary, such as“only one of’ or“exactly one of,” or, when used in the claims,“consisting of,” will refer to the inclusion of exactly one element of a number or list of elements. In general, the term“or” as used herein shall only be interpreted as indicating exclusive alternatives (i.e.“one or the other but not both”) when preceded by terms of exclusivity, such as“either,”“one of,”“only one of,” or “exactly one of.”“Consisting essentially of,” when used in the claims, shall have its ordinary meaning as used in the field of patent law.

As used herein in the specification and in the claims, the phrase“at least one,” in reference to a list of one or more elements, should be understood to mean at least one element selected from any one or more of the elements in the list of elements, but not necessarily including at least one of each and every element specifically listed within the list of elements and not excluding any combinations of elements in the list of elements. This definition also allows that elements may optionally be present other than the elements specifically identified within the list of elements to which the phrase“at least one” refers, whether related or unrelated to those elements specifically identified. Thus, as a non-limiting example,“at least one of A and B” (or, equivalently,“at least one of A or B,” or, equivalently“at least one of A and/or B”) can refer, in one embodiment, to at least one, optionally including more than one, A, with no B present (and optionally including elements other than B); in another embodiment, to at least one, optionally including more than one, B, with no A present (and optionally including elements other than A); in yet another embodiment, to at least one, optionally including more than one, A, and at least one, optionally including more than one, B (and optionally including other elements); etc.

Complete pHIVzsGreen Muc4 cd28 Sequence

>pHIV-Zsgreen (SEQ ID NO: 14)

gtcgacggatcgggagatctcccgatcccctatggtgcactctcagtacaatctgctctgatgccgcatagtt aagccagtatctgctccctgcttgtgtgttggaggtcgctgagtagtgcgcgagcaaaatttaagctacaaca aggcaaggcttgaccgacaattgcatgaagaatctgcttagggttaggcgttttgcgctgcttcgcgatgtac gggccagatatacgcgttgacattgattattgactagttattaatagtaatcaattacggggtcattagttcatag cccatatatggagttccgcgttacataacttacggtaaatggcccgcctggctgaccgcccaacgaccccc gcccattgacgtcaataatgacgtatgttcccatagtaacgccaatagggactttccattgacgtcaatgggt ggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaagtacgccccctattgac gtcaatgacggtaaatggcccgcctggcattatgcccagtacatgaccttatgggactttcctacttggcagta catctacgtattagtcatcgctattaccatggtgatgcggttttggcagtacatcaatgggcgtggatagcggttt gactcacggggatttccaagtctccaccccattgacgtcaatgggagtttgttttggcaccaaaatcaacggg actttccaaaatgtcgtaacaactccgccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtct atataagcagcgcgttttgcctgtactgggtctctctggttagaccagatctgagcctgggagctctctggctaa ctagggaacccactgcttaagcctcaataaagcttgccttgagtgcttcaagtagtgtgtgcccgtctgttgtgt gactctggtaactagagatccctcagacccttttagtcagtgtggaaaatctctagcagtggcgcccgaaca gggacttgaaagcgaaagggaaaccagaggagctctctcgacgcaggactcggcttgctgaagcgcgc acggcaagaggcgaggggcggcgactggtgagtacgccaaaaattttgactagcggaggctagaagg agagagatgggtgcgagagcgtcagtattaagcgggggagaattagatcgcgatgggaaaaaattcggt taaggccagggggaaagaaaaaatataaattaaaacatatagtatgggcaagcagggagctagaacg attcgcagttaatcctggcctgttagaaacatcagaaggctgtagacaaatactgggacagctacaaccat cccttcagacaggatcagaagaacttagatcattatataatacagtagcaaccctctattgtgtgcatcaaag gatagagataaaagacaccaaggaagctttagacaagatagaggaagagcaaaacaaaagtaagac caccgcacagcaagcggccggccgcgctgatcttcagacctggaggaggagatatgagggacaattgg agaagtgaattatataaatataaagtagtaaaaattgaaccattaggagtagcacccaccaaggcaaaga gaagagtggtgcagagagaaaaaagagcagtgggaataggagctttgttccttgggttcttgggagcagc aggaagcactatgggcgcagcgtcaatgacgctgacggtacaggccagacaattattgtctggtatagtgc agcagcagaacaatttgctgagggctattgaggcgcaacagcatctgttgcaactcacagtctggggcatc aagcagctccaggcaagaatcctggctgtggaaagatacctaaaggatcaacagctcctggggatttggg gttgctctggaaaactcatttgcaccactgctgtgccttggaatgctagttggagtaataaatctctggaacag atttggaatcacacgacctggatggagtgggacagagaaattaacaattacacaagcttaatacactcctta attgaagaatcgcaaaaccagcaagaaaagaatgaacaagaattattggaattagataaatgggcaagt ttgtggaattggtttaacataacaaattggctgtggtatataaaattattcataatgatagtaggaggcttggtag gtttaagaatagtttttgctgtactttctatagtgaatagagttaggcagggatattcaccattatcgtttcagacc cacctcccaaccccgaggggacccgacaggcccgaaggaatagaagaagaaggtggagagagaga cagagacagatccattcgattagtgaacggatcggcactgcgtgcgccaattctgcagacaaatggcagt attcatccacaattttaaaagaaaaggggggattggggggtacagtgcaggggaaagaatagtagacat aatagcaacagacatacaaactaaagaattacaaaaacaaattacaaaaattcaaaattttcgggtttatta cagggacagcagagatccagtttggttagtaccgggcccgctctagccgtgaggctccggtgcccgtcagt gggcagagcgcacatcgcccacagtccccgagaagttggggggaggggtcggcaattgaaccggtgcc tagagaaggtggcgcggggtaaactgggaaagtgatgtcgtgtactggctccgcctttttcccgagggtggg ggagaaccgtatataagtgcagtagtcgccgtgaacgttctttttcgcaacgggtttgccgccagaacacag gtaagtgccgtgtgtggttcccgcgggcctggcctctttacgggttatggcccttgcgtgccttgaattacttcca cctggctgcagtacgtgattcttgatcccgagcttcgggttggaagtgggtgggagagttcgaggccttgcgc ttaaggagccccttcgcctcgtgcttgagttgaggcctggcctgggcgctggggccgccgcgtgcgaatctg gtggcaccttcgcgcctgtctcgctgctttcgataagtctctagccatttaaaatttttgatgacctgctgcgacg ctttttttctggcaagatagtcttgtaaatgcgggccaagatctgcacactggtatttcggtttttggggccgcgg gcggcgacggggcccgtgcgtcccagcgcacatgttcggcgaggcggggcctgcgagcgcggccacc gagaatcggacgggggtagtctcaagctggccggcctgctctggtgcctggcctcgcgccgccgtgtatcg ccccgccctgggcggcaaggctggcccggtcggcaccagttgcgtgagcggaaagatggccgcttcccg gccctgctgcagggagctcaaaatggaggacgcggcgctcgggagagcgggcgggtgagtcacccac acaaaggaaaagggcctttccgtcctcagccgtcgcttcatgtgactccacggagtaccgggcgccgtcca ggcacctcgattagttctcgagcttttggagtacgtcgtctttaggttggggggaggggttttatgcgatggagtt tccccacactgagtgggtggagactgaagttaggccagcttggcacttgatgtaattctccttggaatttgccct ttttgagtttggatcttggttcattctcaagcctcagacagtggttcaaagtttttttcttccatttcaggtgtcgtgag cGGCCGCTGAACTGGCCACCATGtggctgcagtctctgctgctgctgggcaccgtggcctgt agcatcaGcGATGTTTTGATGACCCAAACTCCACTCACTTTGTCGGTTGCCA

TTG G AC A ACC AG CCTCC AT CTCTTG C A AG T C A AG T C AG AGTCTCTT AG AT

A AG AG TG G AAAG AC AT ATTT G A ATT G G TTG TT AC AG AG G CC AG G CC AGT

CTCCGAAGCGCCTAATCTATCTGGTGTCTAAACTGGACTCTGGAGTCCCT

G AC AG GTTCACTGGCAGTGGAT C AG G G AC AG ATTT C AC ACT G AAA AT C A

GCAGAGTGGAGGCTGAGGATTTGGGAGTTTATTATTGCTGGCAAGGTAC

ACATTTTCCGCTCACGTTCGGTGCTGGGACCAAGCTGGAAATAAAACGG

GGCAGCACAAGCGGCAGCGGAAAGCCTGGATCTGGCGAGGGCTCTACC

A AG G G AG AG G TG C AG CT G C AG C AG T C AG G ACCT G A ACT G GT AA AG CCT

G G G G CTT C AG T G AAG ATG TCCTG C AAG G CTTCTG G AT AC AC ATT C AG TA

GCTATGTTATGCACTGGGTGAAGCAGAAGCCTGGGCAGGGCCTTGAGT

G G ATT G GAT AT ATT ATT CCTT AC AAT G ATG AT ATT AAGTAC AGT GAG AAG C

TT AAAG GC AAG GCC AC ACT G ACTT C AG ACAAAT CCTCC AAC AC AG CCT AC

GTGGAGCTCAGCAGCCTGACCTCTGAGGACTCTGGGGTCTATTACTGTG

CAATTTTTGGTAACTACGTGAGTTATTGGGGCCAAGGGACCACGGTCAC

CGTCTCCTCAGCCCTGAGCAACAGCATCATGTACTTCAGCCACTTCGTG

CCCGTGTTTCTGCCCGCCAAGCCTACCACAACCCCTGCCCCTAGACCTC

CTACCCCAGCCCCTACAATCGCCAGCCAGCCTCTGTCTCTGAGGCCCGA

GGCTTCTAGACCAGCTGCTGGCGGAGCCGTGCACACCAGAGGACTGGA

CAAGCCCTTCTGGGTGCTGGTGGTCGTGGGCGGAGTGCTGGCCTGTTA

C AGCCT G CT CGTG AC AGTG G CCTT CAT CAT CTTTT G G GT G CGC AG CAAG

CGGTCTAGACTGCTGCACAGCGACTACATGAACATGACCCCCAGAAGGC

CAGGCCCCACCCGGAAGCACTATCAGCCTTACGCCCCTCCCAGAGACTT

CGCCGCCTACCGGTCCAGAGTGAAGTTCAGCAGAAGCGCCGACGCCCC

TGCCTATCAGCAGGGCCAGAACCAGCTGTACAACGAGCTGAACCTGGG

CAGACGGGAAGAGTACGACGTGCTGGACAAGAGAAGAGGCCGGGACCC

TGAGATGGGCGGCAAGCCCAGACGGAAGAACCCTCAGGAAGGCCTGTA T AACG AACT G C AG AAAG AC AAG AT G G CCG AG G CCT ACTCCG AG AT CG G C

ATGAAGGGCGAACGGCGGAGAGGCAAGGGACACGATGGACTGTACCAG

GGCCTGAGCACCGCCACCAAGGACACCTATGACGCCCTGCACATGCAG

GCCCTGCCCCCCAGAtgaAATTCATCGACGTTaactattctagagtacccgggctagg atccgcccctctccctcccccccccctaacgttactggccgaagccgcttggaataaggccggtgtgcgtttg tctatatgttattttccaccatattgccgtcttttggcaatgtgagggcccggaaacctggccctgtcttcttgacg agcattcctaggggtctttcccctctcgccaaaggaatgcaaggtctgttgaatgtcgtgaaggaagcagttc ctctggaagcttcttgaagacaaacaacgtctgtagcgaccctttgcaggcagcggaaccccccacctggc gacaggtgcctctgcggccaaaagccacgtgtataagatacacctgcaaaggcggcacaaccccagtg ccacgttgtgagttggatagttgtggaaagagtcaaatggctctcctcaagcgtattcaacaaggggctgaa ggatgcccagaaggtaccccattgtatgggatctgatctggggcctcggtgcacatgctttacatgtgtttagt cgaggttaaaaaaacgtctaggccccccgaaccacggggacgtggttttcctttgaaaaacacgatgata atatggccacaaccatggcccagtccaagcacggcctgaccaaggagatgaccatgaagtaccgcatg gagggctgcgtggacggccacaagttcgtgatcaccggcgagggcatcggctaccccttcaagggcaag caggccatcaacctgtgcgtggtggagggcggccccttgcccttcgccgaggacatcttgtccgccgccttc atgtacggcaaccgcgtgttcaccgagtacccccaggacatcgtcgactacttcaagaactcctgccccgc cggctacacctgggaccgctccttcctgttcgaggacggcgccgtgtgcatctgcaacgccgacatcaccg tgagcgtggaggagaactgcatgtaccacgagtccaagttctacggcgtgaacttccccgccgacggccc cgtgatgaagaagatgaccgacaactgggagccctcctgcgagaagatcatccccgtgcccaagcagg gcatcttgaagggcgacgtgagcatgtacctgctgctgaaggacggtggccgcttgcgctgccagttcgac accgtgtacaaggccaagtccgtgccccgcaagatgcccgactggcacttcatccagcacaagctgacc cgcgaggaccgcagcgacgccaagaaccagaagtggcacctgaccgagcacgccatcgcctccggct ccgccttgccctaaggatcgcatcgataccgtcgacctcgatcgagacctagaaaaacatggagcaatca caagtagcaatacagcagctaccaatgctgattgtgcctggctagaagcacaagaggaggaggaggtgg gttttccagtcacacctcaggtacctttaagaccaatgacttacaaggcagctgtagatcttagccactttttaa aagaaaaggggggactggaagggctaattcactcccaacgaagacaagatatccttgatctgtggatcta ccacacacaaggctacttccctgattggcagaactacacaccagggccagggatcagatatccactgacc tttggatggtgctacaagctagtaccagttgagcaagagaaggtagaagaagccaatgaaggagagaac acccgcttgttacaccctgtgagcctgcatgggatggatgacccggagagagaagtattagagtggaggttt gacagccgcctagcatttcatcacatggcccgagagctgcatccggactgtactgggtctctctggttagacc agatctgagcctgggagctctctggctaactagggaacccactgcttaagcctcaataaagcttgccttgagt gcttcaagtagtgtgtgcccgtctgttgtgtgactctggtaactagagatccctcagacccttttagtcagtgtgg aaaatctctagcagcatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgct ggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcga aacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgacc ctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtagg tatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgct gcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagcca ctggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactac ggctacactagaagaacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggta gctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcag aaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacg ttaagggattttggtcatgagattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaat caatctaaagtatatatgagtaaacttggtctgacagttaccaatgcttaatcagtgaggcacctatctcagcg atctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagataactacgatacgggagggcttaccat ctggccccagtgctgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataaacca gccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttg ccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgttgttgccattgctacaggcatcgtg gtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaacgatcaaggcgagttacatgatccccc atgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtcagaagtaagttggccgcagtgttatc actcatggttatggcagcactgcataattctcttactgtcatgccatccgtaagatgcttttctgtgactggtgagt actcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggata ataccgcgccacatagcagaactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaactctcaa ggatcttaccgctgttgagatccagttcgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttc accagcgtttctgggtgagcaaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacac ggaaatgttgaatactcatactcttcctttttcaatattattgaagcatttatcagggttattgtctcatgagcggat acatatttgaatgtatttagaaaaataaacaaataggggttccgcgcacatttccccgaaaagtgccacctg ac

Hinge-CD28/ICOS -CD3z Notl restriction enzyme recognition sites are shown in capitalization. The translational stop site is in boldface. The BamHI restriction cleavage site is shown in underline.

CD28 costimulatory domain (SEQ ID NO: 10)

GCGGCCGCAattgaagttatgtatcctcctccttacctagacaatgagaagagcaatgga accattatccatgtgaaagggaaacacctttgtccaagtcccctatttcccggaccttct aagcccttttgggtgctggtggtggttggtggagtcctggcttgctatagcttgctagta acagtggcctttattattttctgggtgaggagtaagaggagcaggctcctgcacagtgac tacatgaacatgactccccgccgccccgggcccAcccgcaagcattaccagccctatgcc ccaccacgcgacttcgcagcctatcgctccagagtgaagttcagcaggagcgcagacgcc cccgcgtaccagcagggccagaaccagctctataacgagctcaatctaggacgaagagag gagtacgatgttttggacaagagacgtggccgggaccctgagatggggggaaagccgaga aggaagaaccctcaggaaggcctgtacaatgaactgcagaaagataagatggcggaggcc tacagtgagattgggatgaaaggcgagcgccggaggggcaaggggcacgatggcctttac cagggtctcagtacagccaccaaggacacctacgacgcccttcacatgcaggccctgccc cctcgcTAAcgcccctctccctcccccccccctaa

ICOS costimulatory domain (SEQ ID NO: 11)

GCGGCCGCActatcaatttttgatcctcctccttttaaagtaactcttacaggaggatat ttgcatatttatgaatcacaactttgttgccagctgaagttctggttacccataggatgt gcagcctttgttgtagtctgcattttgggatgcatacttatttgttggcttacaaaaaag aagtattcatccagtgtgcacgaccctaacggtgaatacatgttcatgagagcagtgaac acagccaaaaaatctagactcacagatgtgaccctaagagtgaagttcagcaggagcgca gacgcccccgcgtaccagcagggccagaaccagctctataacgagctcaatctaggacga agagaggagtacgatgttttggacaagagacgtggccgggaccctgagatggggggaaag ccgagaaggaagaaccctcaggaaggcctgtacaatgaactgcagaaagataagatggcg gaggcctacagtgagattgggatgaaaggcgagcgccggaggggcaaggggcacgatggc ctttaccagggtctcagtacagccaccaaggacacctacgacgcccttcacatgcaggcc ctgccccctcgcTAAcgcccctctccctcccccccccctaa

Fusion (hybrid) CD28 and ICOS costimulatory domain (SEQ ID NO: 12)

GCGGCCGCAattgaagttatgtatcctcctccttacctagacaatgagaagagcaatgga accattatccatgtgaaagggaaacacctttgtccaagtcccctatttcccggaccttct aagcccttttgggtgctggtggtggttggtggagtcctggcttgctatagcttgctagta acagtggcctttattattttctgggtgaggagtaagaggagcaggctcctgcacagtgac tacatgttcatgagagcagtgaacacagccaaaaaatctagactcacagatgtgacccta agagtgaagttcagcaggagcgcagacgcccccgcgtaccagcagggccagaaccagctc tataacgagctcaatctaggacgaagagaggagtacgatgttttggacaagagacgtggc cgggaccctgagatggggggaaagccgagaaggaagaaccctcaggaaggcctgtacaat gaactgcagaaagataagatggcggaggcctacagtgagattgggatgaaaggcgagcgc cggaggggcaaggggcacgatggcctttaccagggtctcagtacagccaccaaggacacc tacgacgcccttcacatgcaggccctgccccctcgcTAAcgcccctctccctcccccccc cctaa

Claims

What is claimed is:

1. An immune cell expressing a chimeric antigen receptor (CAR), wherein the CAR comprises: i) an antigen-binding fragment that binds MUC4, ii) a transmembrane domain, and iii) an intracellular signaling domain comprising at least one costimulatory domain.

2. The immune cell of claim 1, wherein the CAR comprises two costimulatory domains.

3. The immune cell of claim 1, wherein the MUC4 is a glycoform of MUC4.

4. The immune cell of claim 3, wherein the glycoform of MUC4 is a Tn (GalNAcal-O- Ser/Thr) glycoform of MUC4, or a sialyl-Tn (STn) (NeuAca2-6-GalNAcal-0-Ser/Thr) glycoform of MUC4.

5. The immune cell of claim 1, wherein the antigen-binding fragment is a single-chain antibody fragment (scFv) that specifically binds MUC4.

6. The immune cell of claim 5, wherein the scFv binds to human MUC4.

7. The immune cell of claim 1, wherein the immune cell is a T cell.

8. The immune cell of claim 1, wherein the CAR further comprises:

(a) a hinge domain,

(b) a cytoplasmic signaling domain, or

(c) a combination thereof.

9. The immune cell of claim 1, wherein the at least one costimulatory domain is derived from a co- stimulatory receptor selected from the group consisting of CD28, 4-1BB, and ICOS.

10. The immune cell of claim 1, wherein the at least one costimulatory domain comprises a signaling domain of CD28 and a signaling domain of ICOS.

11. The immune cell of claim 1, wherein the CAR comprises a cytoplasmic signaling domain, which is from CD3z.

12. The immune cell of claim 1, wherein the CAR comprises a hinge domain, which is from CD8a or CD28a.

13. The immune cell of claim 1, wherein the transmembrane domain is from CD8, CD28, or ICOS.

14. The immune cell of claim 1, wherein the CAR comprises: (i) a scFv that binds to MUC4, (ii) a hinge domain from CD8a, (iii) a transmembrane domain from CD8 or CD28, (iv) a costimulatory domain from CD28 or 4- IBB, or a combination thereof, and (v) a cytoplasmic signaling domain from CD3z.

15. A nucleic acid molecule encoding a chimeric antigen receptor (CAR), wherein the CAR comprises: i) an antigen-binding fragment that binds MUC4, ii) a transmembrane domain, and iii) an intracellular signaling domain comprising at least one costimulatory domain.

16. A method of inhibiting tumor cell growth, and/or increasing tumor cell death, the method comprising administering to tumor cells the immune cell of claim 1 or the nucleic acid molecule of claim 15.

17. A method of treating cancer in a subject, the method comprising administering to the subject the immune cell of claim 1 or the nucleic acid molecule of claim 15.

18. The method of claim 17, where in the cancer is pancreatic cancer, esophageal

adenocarcinoma, colon cancer, or gall bladder cancer.

19. The method of claim 18, where in the pancreatic cancer is pancreatic ductal

adenocarcinoma (PD AC). What is claimed is:

3. The immune cell of claim 1, wherein the MUC4 is a glycoform of MUC4.

6. The immune cell of claim 5, wherein the scFv binds to human MUC4.

7. The immune cell of claim 1, wherein the immune cell is a T cell.

8. The immune cell of claim 1, wherein the CAR further comprises:

(a) a hinge domain,

(b) a cytoplasmic signaling domain, or

(c) a combination thereof.

9. The immune cell of claim 1 , wherein the at least one costimulatory domain is derived from a co- stimulatory receptor selected from the group consisting of CD28, 4-1BB, and ICOS.

adenocarcinoma, colon cancer, or gall bladder cancer.

19. The method of claim 18, where in the pancreatic cancer is pancreatic ductal

adenocarcinoma (PD AC).