WO2020117002A1 - 식도편평상피암의 예후를 예측하는 방법 - Google Patents
식도편평상피암의 예후를 예측하는 방법 Download PDFInfo
- Publication number
- WO2020117002A1 WO2020117002A1 PCT/KR2019/017213 KR2019017213W WO2020117002A1 WO 2020117002 A1 WO2020117002 A1 WO 2020117002A1 KR 2019017213 W KR2019017213 W KR 2019017213W WO 2020117002 A1 WO2020117002 A1 WO 2020117002A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- genes
- expression
- gene
- protein
- cell carcinoma
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/118—Prognosis of disease development
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Definitions
- the present invention relates to a method for predicting the prognosis of esophageal squamous cell carcinoma.
- ncRNAs non-coding RNAs
- PLR Protein Kinase R
- Dicer Dicer
- Another feature of nc886 is that it is transcribed by RNA polymerase III, which is very different from most regulatory ncRNA transcribed by RNA polymerase II. nc886 began to receive attention after the dysregulation was found in various malignant tumors.
- nc886 is expressed in most normal tissues, but its expression is epigenetically silent in many malignancies such as gastric cancer and acute myeloid leukemia.
- a prominent phenotypic result that appears when expression of nc886 changes is cell proliferation. Therefore, it was assumed that nc886 was a tumor suppressor, and the silence of nc886 was expected to promote cell proliferation. Nevertheless, when nc886 was treated with anti-sense oligonucleotides in some nc886 + cell lines derived from the esophagus, stomach, etc., the expression of nc886 was rapidly reduced and cell proliferation was reduced.
- nc886 is a molecular function that inhibits PKR.
- PKR is a procytic protein (a protein that induces apoptosis) that is typically activated by viral infection. The rapid decrease in nc886 is sufficient to activate PKR without viral infection. When PKR is activated, it phosphorylates elF2 ⁇ , thereby stopping the translation of the entire protein and inducing cell death.
- nc886 silencing and PKR activation (and thereby apoptosis) in vivo is thought to act as a boundary for removing pre-cancerous cells, such as PKR activation removing virus-infected cells.
- nc886 silencing confers growth benefits on cells at certain stages of cancer development.
- nc886 In a situation where nc886 is silenced, it is thought that the growth promoting effect in addition to the PKR-eIF2 ⁇ cell death pathway also occurs, and these two are separate pathways.
- PKR-eIF2 ⁇ cell death pathway When experimentally inducing the silence of nc886, cell death according to the PKR pathway occurs first, so it is not easy to observe the cell growth promoting phenotype due to the silence of nc886.
- AKT cyclin-dependent kinase
- E2F activity is inhibited by AKT, and some CDK inhibitors (such as CDKN2A and CDKN2C) have been reported to be transcriptionally activated by E2F. Therefore, AKT inhibits E2F, thereby weakening the transcription of the CDK inhibitor gene. In addition, crosstalk between AKT and SKP2 has been reported.
- SKP2 a regulatory component of the SKP1:CUL1:F-box protein complex (SCF), is overexpressed in malignant tumors and instructs to break down CDK inhibitory proteins through SCF E3 ubiquitinase. do.
- Esophageal cancer is a generic term for cancer that occurs in the esophagus, and is not one of the most common cancers in Korea. Therefore, measuring a patient's prognosis prediction is one of the most important studies.
- Korean Patent No. 10-1657033 discloses a method of predicting the survival rate and prognosis of esophageal cancer patients by measuring the protein expression level of V-ATPase subunit V1E1, and Korean Patent Publication No. 10-2008-0007659
- the disclosure discloses compositions and methods for the diagnosis of esophageal cancer and esophageal cancer metastasis by detecting specific genes.
- Esophageal cancer is largely divided into esophageal squamous cell carcinoma and esophageal adenocarcinoma.
- esophageal squamous cell carcinoma is a cancer originating from flat cells, which are the main cells that make up the esophagus.
- the present inventors conducted a study on the importance of suppressing nc886 in esophageal squamous cell carcinoma, and propose a method to more accurately predict the prognosis of esophageal squamous cell carcinoma patients.
- the present inventors studied the importance of inhibiting nc886 in esophageal squamous cell carcinoma, and confirmed that low expression of nc886 in esophageal squamous cell carcinoma promotes the proliferation of cancer cells. Furthermore, nc886 expression delays the cell cycle, and the cell cycle It was confirmed that the gene was regulated and the target genes of AKT were changed. It is confirmed that the prognosis of esophageal squamous cell carcinoma patients can be predicted by measuring the expression of nc886 in patients with esophageal squamous cell carcinoma, the increase or decrease in the target gene expression of AKT, and the increase or decrease in the expression of genes related to the existing TNM stage and cell cycle. Thus completed the present invention.
- the present invention comprises: a) measuring the expression level of nc886 from a biological sample isolated from a patient with esophageal squamous cell carcinoma; b) measuring the expression level of any one or more of genes whose expression changes according to an increase in nc886 among AKT target genes and genes whose expression changes according to an increase in nc886 among genes related to cell cycle; To provide a method for providing information for predicting the prognosis of patients with esophageal squamous cell carcinoma.
- nc886 When the expression level of nc886 is low; b-1) the target gene of AKT has a "expression level of a gene or protein reduced by increasing expression of nc886" higher than a normal control sample; Or “The level of a gene or protein increased by increased expression of nc886” is lower than a normal control sample; And/or b-2) among the genes associated with the cell cycle, "the expression level of a gene or protein reduced by an increase in expression of nc886" is higher than a normal control sample; Alternatively, if the expression level of the gene or protein thereof increased by increasing the expression of nc886 among the genes associated with the cell cycle is lower than the control sample, the prognosis of the esophageal squamous cell carcinoma patient may be determined to be poor.
- collecting the information classified according to TNM for the esophageal squamous cell carcinoma may further include.
- the classification score is calculated from 0 to 4, and if the score is 0, it can be judged to be very good if it is 0, good if it is 1, good if it is 2, bad when it is 3, and very bad if it is 4. .
- the present invention in one preferred embodiment, can provide a method for providing information necessary for predicting the prognosis of esophageal squamous cell carcinoma comprising the following steps.
- nc886 If the expression level of nc886 is higher than the normal control sample, 0 point is given; if it is lower than the normal sample control, 1 point is given,
- the expression level of a gene or its protein that decreases due to an increase in expression of nc886 is higher than a normal control sample, or a gene or its protein level that increases by an increase in expression of nc886” 1 point is given if it is lower than the normal control sample;
- the expression level of a gene or its protein that decreases due to increased expression of nc886” is lower than the normal control sample, or a gene or its protein level that increases by increased expression of nc886” is higher than a normal control sample. If it's high, give it 0,
- the expression level of a gene or its protein that decreases by increasing the expression of nc886 among genes related to the cell cycle is higher than a normal control sample, or increased by an increase in expression of nc886 among genes related to the cell cycle. If the level of expression of a gene or a protein thereof” is lower than a normal control sample, 1 point is given; The expression level of a gene or its protein that decreases due to an increase in expression of nc886 among genes related to the cell cycle is lower than a normal control sample, or a gene or its increase that increases by an increase in expression of nc886 among genes related to the cell cycle. If the level of protein expression” is higher than the normal control sample, 0 point is given,
- TNM step is 1 or 2, giving 0 points, and if it is 3 or 4, giving 1 point;
- genes that decrease by increasing expression of nc886 are ACLY, BTK, CD14, CDC42, CDKN1A, CDKN1B, DPYSL2, DPYSL3, EIF4E, FOS, FOXO1, FOXO3, FOXO4, GJA1, GRB10, Any gene selected from the group consisting of GRB2, HSPB1, JUN, MAP3K5, MAPT, MYC, NFKBIA, PABPC1, PAK1, PALLD, PIK3R1, PPP2R1B, PRKAA1, PRKCA, PRKCZ, SHC1, SREBF1, SRF and YWHAH, Genes increased by increased expression of nc886 include ATG4B, BCL2L11, CSNK2A1, CTPS, EIF2AK2, FKBP1A, GADD45A, HRAS, MAPK1, MAPKAP1, MTCP1, PCK2, PPP2CB, PPP2R2A,
- genes increased by increased expression of nc886 are CDKN2A, RBL1, PPP2R1B, CDKN1A or CDKN2C
- genes decreased by increased expression of nc886 are SKP2, CDKN1B, PPP2CB, UBA52, CDK4, It may be RPS27A, PPP2CA, PPP2R2A or CUL1.
- the biological sample isolated from the esophageal squamous cell carcinoma patient may be a formalin-fixed paraffin-embedded (FFPE) sample, fresh tissue or frozen tissue of tissue containing cancer cells of the patient, , but is not limited to this.
- FFPE formalin-fixed paraffin-embedded
- the level of the gene is polymerase reaction (PCR), reverse transcriptase reaction (RT-PCR), competitive reverse transcriptase reaction (Competitive RT-PCR), real-time reverse transcriptase reaction (Realtime RT) -PCR), RNase protection assay (RPA; RNase protection assay), Northern blotting, next-generation sequencing (NGS) and DNA microarray analysis Can be measured by PCR, reverse transcriptase reaction (RT-PCR), competitive reverse transcriptase reaction (Competitive RT-PCR), real-time reverse transcriptase reaction (Realtime RT) -PCR), RNase protection assay (RPA; RNase protection assay), Northern blotting, next-generation sequencing (NGS) and DNA microarray analysis Can be measured by
- the expression level of the protein is Western blot, ELISA (enzyme linked immunosorbent asay), immunostaining, radioimmunoassay (RIA), radioimmunodiffusion, oruktero
- ELISA enzyme linked immunosorbent asay
- RIA radioimmunoassay
- the present invention also provides nc886; And ACLY, BTK, CD14, CDC42, CDKN1A, CDKN1B, DPYSL2, DPYSL3, EIF4E, FOS, FOXO1, FOXO3, FOXO4, GJA1, GRB10, GRB2, HSPB1, JUN, MAP3K5, MAPT, MYC, NFKBA, PANKBD , PIK3R1, PPP2R1B, PRKAA1, PRKCA, PRKCZ, SHC1, SREBF1, SRF, YWHAH, ATG4B, BCL2L11, CSNK2A1, CTPS, EIF2AK2, FKBP1A, GADD45A, HRAS, MAPK1, MAPK2, PAPCPP , THEM4, YWHAE, YWHAG, CDKN2A, CDKN2C, SKP2, UBA52, CDK4, RPS27A, PPP2CA, RBL1 or CUL1 gene, or a
- the present invention also provides nc886; And ACLY, BTK, CD14, CDC42, CDKN1A, CDKN1B, DPYSL2, DPYSL3, EIF4E, FOS, FOXO1, FOXO3, FOXO4, GJA1, GRB10, GRB2, HSPB1, JUN, MAP3K5, MAPT, MYC, NFKBA, PANKBD , PIK3R1, PPP2R1B, PRKAA1, PRKCA, PRKCZ, SHC1, SREBF1, SRF, YWHAH, ATG4B, BCL2L11, CSNK2A1, CTPS, EIF2AK2, FKBP1A, GADD45A, HRAS, MAPK1, MAPK2, PAPCPP , THEM4, YWHAE, YWHAG, CDKN2A, CDKN2C, SKP2, UBA52, CDK4, RPS27A, PPP2CA, RBL1 or CUL1 gene, or a
- the present invention can also provide a biomarker composition for predicting resistance or sensitivity to the anticancer agent palbociclib in esophageal squamous cell carcinoma comprising an agent measuring the mRNA or protein level of the nc886, AKT, CDK4, CDKN2A and CKN2C genes. .
- the present invention can also provide a kit for predicting the resistance or sensitivity to the anticancer agent palbociclib in esophageal squamous cell carcinoma comprising the above-described composition.
- the present invention can also provide a method for providing information for predicting resistance or sensitivity to the anticancer agent palbociclib in esophageal squamous cell carcinoma comprising the following steps.
- nc886, CDKN2A and CKN2C gene mRNA or its protein level is lower than the control
- AKT and CDK4 gene mRNA or its protein level is higher than the control group
- esophageal squamous cell carcinoma susceptibility to anticancer agent palbociclib If it is judged that there is, and the mRNA level of the nc886, CDKN2A and CKN2C genes or its protein level is higher than the control group, and the mRNA level of the AKT and CDK4 genes or the protein level thereof is lower than the control group, the anticancer agent in the esophageal squamous cell carcinoma is used as an anticancer agent Determining that there is resistance to.
- the biological sample of step a) is a formalin-fixed paraffin-embedded (FFPE) sample of tissue containing cancer cells of a patient with esophageal squamous cell carcinoma, fresh tissue, and It may be one or more selected from the group consisting of frozen tissue.
- FFPE formalin-fixed paraffin-embedded
- the mRNA levels of step (a) are polymerase reaction (PCR), reverse transcriptase reaction (RT-PCR), competitive reverse transcriptase reaction (Competitive RT-PCR), real-time reverse transcriptase reaction (Realtime RT-PCR), RNase protection assay (RPA), Northern blotting, next-generation sequencing (NGS), and DNA microarray analysis.
- PCR polymerase reaction
- RT-PCR reverse transcriptase reaction
- Competitive RT-PCR competitive reverse transcriptase reaction
- Realtime RT-PCR real-time reverse transcriptase reaction
- RNase protection assay RNase protection assay
- NGS next-generation sequencing
- the protein level of step (a) is western blotting, ELISA (enzyme linked immunosorbent assay), radioimmunoassay, radioimmunodiffusion, ouchterlony immunodiffusion, rocket (Rocket) from the group consisting of immunoelectrophoresis, tissue immunostaining, immunoprecipitation assay, complete fixation assay, flow cytometry (FACS) and protein chip assay It may be measured by one or more methods selected.
- the present invention measures the expression of genes related to AKT target genes and cell cycles regulated by nc886 and nc886 in patients with esophageal squamous cell carcinoma, and comprehensively scores them by summing the existing TNM stages, thereby accurately predicting the prognosis of patients with esophageal squamous cell carcinoma. It has a predictable effect.
- by measuring the mRNA or protein level of the nc886, AKT, CDK4, CDKN2A and CKN2C genes there is an effect that can predict the resistance or sensitivity to the anticancer agent palbosilib in esophageal squamous cell carcinoma.
- A is a schematic diagram of the plasmid used in the present invention
- B is a RT-PCR result confirming the expression of nc886 in a cell line stably inserted with the plasmid
- C is a result showing the proliferation of the cell number of the cells used in the present invention
- D is a schematic diagram showing a cell mixing experiment
- EF is the result of measuring FACS GFP negative and positive cell number.
- a and B are the results of confirming the cell cycle after staining DNA with propidium iodide (PI).
- FIG. 3 shows the results of analyzing the nc886-EXP and nc886-KD array data in an integrated MSigDB (Molecular Signature Database).
- A shows the Z-scores for the 674 Reactome gene set nc886-EXP (x-axis) and nc886-KD. Schematically plotted between (y-axis) to show the correlation, B is the result of showing the Z-score for 615 TFT (TF target gene set) as a scatterplot as described in panel A, and CD is the Reactome gene A bar graph showing the significantly enhanced TFT Z-scores (>3, based on nc886-EXP) in the set and TFT gene sets.
- FIG. 4 shows the results showing that nc886 regulates the expression of cell cycle genes
- A is the Venn diagram results of cell cycle genes (40 genes) and genes altered by nc886, and B is 108 ESCC patients Volcano map of 19 nc886/G1-related genes showing statistical correlation with nc886 expression in the cohort
- C is the correlation between nc886 expression and a representative cell cycle gene in 108 ESCC patient cohorts
- D Is the qRT-PCR result of the gene.
- A is a heat map result showing RPPA data from nc886-KD of ES1, an ESCC cell line
- B is a Western blot result measuring the expression levels of phosphorylated AKT and total AKT.
- C is a GSEA result demonstrating whether the AKT gene set a priori defined in nc886 KD shows statistical agreement in ESCC patients according to nc886 expression.
- A is a result showing that the combination of nc886, AKT signature score, cell cycle signature score, and TNM stage is the strongest predictor of relapse and survival
- b TNM stage stage I and II (0)/stage III and IV (1)
- degree of nc886 expression high (0)/low (1) as median
- AKT signature score low (0)/ as median
- cell cycle scores low (0)/high (1) by median values
- C is a summary of this study.
- FIG. 7 shows the prognostic and predictive values of nc886,
- A shows that a number of genes including CDK4 are upregulated in Cluster 2 as a result of the undirected cluster of AKT and cell cycle genes in the ESCC cohort
- B is the result of confirming the expression of nc886 in Cluster 1 and Cluster 2
- C is the result of confirming the expression of nc886 in the esophageal cell line using qRT-PCR
- D is the weak sensitivity of the 30 EC cell line to Palbosiclip
- F is the result of analyzing apoptosis of the esophageal cell line showing the inverse correlation of the expression level of nc886 to the sensitivity to Palbociclib.
- Esophageal cancer is a generic term for cancer that occurs in the esophagus. Esophageal cancer is not one of the most common cancers in Korea, but prognosis is one of the most dangerous cancers. Therefore, measuring a patient's prognosis prediction is one of the most important studies. In the present invention, it was confirmed that low expression of nc886 in esophageal squamous cell carcinoma promotes the proliferation of cancer cells. It was confirmed that the expression of nc886 delayed the cell cycle, regulated the cell cycle gene, and changed the target genes of AKT.
- the prognosis of esophageal squamous cell carcinoma patients can be predicted by measuring the expression of nc886 in patients with esophageal squamous cell carcinoma, increasing or decreasing the target gene expression of AKT, and increasing or decreasing the expression of genes related to the existing TNM stage and/or cell cycle.
- the present invention was completed by confirming that.
- the present invention comprises the steps of measuring the expression level of nc886 from a biological sample isolated from a patient with esophageal squamous cell carcinoma; b) measuring the expression level of any one or more of genes whose expression changes according to an increase in nc886 among AKT target genes and genes whose expression changes according to an increase in nc886 among genes related to cell cycle; It can provide a method for providing information for predicting the prognosis of patients with esophageal squamous cell carcinoma.
- the expression of the measured or collected nc886, the increase or decrease of the target gene expression of AKT, the increase or decrease of the expression of the gene associated with the existing TNM stage and/or cell cycle is scored, and can be determined by summing it The weight of each expression level and stage can be used to more accurately predict the prognosis of patients with esophageal squamous cell carcinoma.
- the expression level of a gene or its protein that decreases by increasing expression of nc886 among the target genes of AKT is higher than a normal control sample;
- the level of a gene or protein increased by an increase in expression of nc886 is lower than a normal control sample;
- the expression level of a gene or its protein that decreases by increasing the expression of nc886 among genes related to the cell cycle is higher than a normal control sample; Or if the expression level of the gene or its protein increased by increasing the expression of nc886 among genes related to the cell cycle is lower than the control sample as expected; it can be determined that the prognosis of patients with esophageal squamous cell carcinoma is poor.
- collecting the information classified according to TNM for the esophageal squamous cell carcinoma may further include.
- the stage of the TNM is 3 or 4; it can be determined that the prognosis of the esophageal squamous cell carcinoma patient is poor. Poor prognosis may mean that the disease-specific survival year, recurrence free survival, or overall survival is lower than the good prognosis group.
- the TNM may refer to the standard of the 7th revision of AJCC as a criterion for dividing the stage of esophageal squamous squamous cancer, but is not limited thereto.
- the score is calculated from 0 to 4, and if the score is 0, it can be judged as very good, 1 is good, 2 is normal, 3 is bad, and 4 is very bad.
- the present invention can also provide a method for providing information necessary for predicting the prognosis of esophageal squamous cell carcinoma comprising the following steps.
- nc886 If the expression level of nc886 is higher than the normal control sample, 0 point is given; if it is lower than the normal sample control, 1 point is given,
- the expression level of a gene or its protein that decreases due to an increase in expression of nc886 is higher than a normal control sample, or a gene or its protein level that increases by an increase in expression of nc886” 1 point is given if it is lower than the normal control sample;
- the expression level of a gene or its protein that decreases due to increased expression of nc886” is lower than the normal control sample, or a gene or its protein level that increases by increased expression of nc886” is higher than a normal control sample. If it's high, give it 0,
- the expression level of a gene or its protein that decreases by increasing the expression of nc886 among genes related to the cell cycle is higher than a normal control sample, or increased by an increase in expression of nc886 among genes related to the cell cycle. If the level of expression of a gene or a protein thereof” is lower than a control sample as expected, 1 point is given; The expression level of a gene or its protein that decreases due to an increase in expression of nc886 among genes related to the cell cycle is lower than a normal control sample, or a gene or its increase that increases by an increase in expression of nc886 among genes related to the cell cycle. If the level of protein expression” is higher than the control sample as expected, give a score of 0,
- TNM step is 1 or 2, giving 0 points, and if it is 3 or 4, giving 1 point;
- the score is a score for statistical convenience, and it is clear that it can be calculated by adding weights to items to be measured according to the patient's condition and expression level.
- the weight is, for example, divided by the number (n)/1 of the number of genes or proteins reduced by the increase in expression of nc886 among the target genes of AKT, scores are added for each gene, and the scores are added to obtain the total weight. Can be added.
- nc886 + cells may be extended due to the delay in a specific stage of the cell cycle, not due to the death of cells.
- the cell cycle was analyzed by measuring the DNA content by flow cytometry. Upon nocodazole treatment, cells were synchronized and released from G2/M phase after 6 hours to progress to G1 phase. However, after 12 hours, nc886 ⁇ cells were further advanced into the S phase, whereas in the case of the nc886 + cells, it was confirmed that the progress toward the S phase was delayed (FIGS. 2A and B ).
- nc886 delays the transition from G1 to S, but does not affect the conversion from G2/M to G1.
- the G1 extended period of nc886 + cells of nc886 + cells nc886 - indicates that the reason for the slower growth than cells.
- the present inventors investigated the gene expression pattern to find out why the cells of nc886 + have longer G1 groups than the nc886 - cells.
- anti-nc886 oligonucleotide that targets and inhibits nc886
- the same experiment was performed in a non-specific anti-oligo (anti-control) to nc886, which was used as a control (the value of anti-nc886/anti-control is expressed as nc886-KD).
- nc886 + and original 293T (nc886 - phosphorus) cells the value of nc886 + /nc886 - is denoted by nc886-EXP.
- Z-scores for 674 pathways were obtained from nc886-EXP and nc886-KD, and a significant negative correlation was observed when plotted as a scatter plot (FIG. 3A).
- the nc886-EXP and nc886-KD TFT (transcription factors target gene sets; TFT) Z scores also showed a negative correlation (Fig. 3B).
- nc886/G1-related genes FIG. 4A
- the genes were analyzed in a population of 108 ESCC patients with nc886 qRT-PCR values and mRNA sequence data available.
- the majority of nc886/G1-related genes obtained from cellular data (14 of 19) were found to be significantly associated with nc886 in patient data ( Figure 4B).
- the researchers selected CDKN2A and CDKN2C.
- nc886 As a result of investigating the expression level in 108 patients with ESCC, CDKN2A and CDKN2C showed changes in the same direction as nc886 (FIG. 4C ). Since SKP2 and CUL1 are known to promote G1-S metastasis by degrading CDK inhibitors, SKP2 and CUL1 were investigated. Expression of these two genes was negatively correlated with nc886 in patient and cell line data ( Figure 4B-D). When the above data were comprehensively judged, nc886 regulates the cell cycle gene to delay G1-S metastasis.
- nc886 was shown to inhibit PKR and Dicer, we investigated whether delayed G1 in nc886-EXP can be explained by both proteins.
- PKR is a protein involved in cell proliferation, and its representative downstream phenomenon is activation of NF- ⁇ B. Therefore, NF- ⁇ B was examined in the MSigDB TFT set. PKR induces apoptosis when activated, so it must remain latent in naturally proliferating cells. In this situation, when nc886 was expressed (in nc886-EXP), the additional inhibitory role of nc886 against PKR was hardly observed.
- PKR is activated by nc886-KD, but the cell cycle phenotype of nc886-EXP could not be explained.
- MSigDB MIR miRNA target genes
- AKT1S1 is phosphorylated directly by AKT.
- AKT phosphorylation was measured in nc886-EXP, which observed the cell phenotype (slow cell proliferation due to delay in G1).
- Western blot results showed that AKT1 was less phosphorylated in Ser473 than 293T-U6 at 293T-U6:nc886 at 6 and 12 hours after release from the nocodazole suspension (Figure 5B).
- Figure 5B Western blot results showed that AKT1 was less phosphorylated in Ser473 than 293T-U6 at 293T-U6:nc886 at 6 and 12 hours after release from the nocodazole suspension.
- Figure 5B Western blot results showed that AKT1 was less phosphorylated in Ser473 than 293T-U6 at 293T-U6:nc886 at 6 and 12 hours after release from the nocodazole suspension
- nc886-KD 34 increased genes and 19 reduced genes were selected from nc886-KD to apply to the array data for 108 ESCC patients (Table 2 and Table 3).
- 34 and 19 genes were positively correlated positively with nc886 at statistically significant levels (FIG. 5C ).
- Concordance of nc886/AKT related genes between nc886-KD data and patient data suggests that nc886 also inhibits the AKT pathway in the tumor formation process in vivo.
- nc886, AKT and cell cycle genes are a predictor of survival in ESCC patients.
- the role of nc886 in inhibiting AKT pathway and cell cycle progression was revealed and nc886 related gene characteristics were identified (34 and 19 nc886/AKT-related genes (FIG. 5); 9 and 5 nc886/G1 related genes (FIG. 4B)) .
- the prognostic usefulness of these genes was tested in 108 ESCC patients.
- the AKT signature score was generated by the difference in geometric mean between 34 genes up-regulated and 19 genes down-regulated in nc886-KD.
- the cell cycle signature score was calculated similarly from 9 genes and 5 genes, each negatively correlated with nc886. Cohorts with this score were differentiated according to each median.
- Stratification into 5 subgroups by prognostic score showed distinct DSS, RFS and OS curves in the 108 ESCC patient population (FIG. 6B ).
- genes reduced by nc886 are ACLY, BTK, CD14, CDC42, CDKN1A, CDKN1B, DPYSL2, DPYSL3, EIF4E, FOS, FOXO1, FOXO3, FOXO4, GJA1, GRB10, GRB2, HSPB1, JUN, MUN , MAPT, MYC, NFKBIA, PABPC1, PAK1, PALLD, PIK3R1, PPP2R1B, PRKAA1, PRKCA, PRKCZ, SHC1, SREBF1, SRF and YWHAH are any one of the genes selected, and the gene increased by nc886 ATG4B, BCL2L11, CSNK2A1, CTPS, EIF2AK2, FKBP1A, GADD45A, HRAS, MAPK1, MAPKAP1, MTCP1, PCK2, PPP2CB, PPP2R2A, PRKAA2, PTEN, THEM4, YWHAE
- genes increased by increased expression of nc886 are CDKN2A, RBL1, PPP2R1B, CDKN1A, or CDKN2C
- genes decreased by increased expression of nc886 are SKP2, CDKN1B, PPP2CB, UBA52, CDK4, RPS27A, SKP2, PPP2CA, PPP2R2A or CUL1.
- the sample may be at least one selected from the group consisting of formalin-fixed paraffin-embedded (FFPE) samples, fresh tissue, and frozen tissue of tissue containing cancer cells of patients with esophageal squamous cell carcinoma.
- FFPE formalin-fixed paraffin-embedded
- PCR polymerase reaction
- RT-PCR reverse transcriptase reaction
- Competitive RT-PCR competitive reverse transcriptase reaction
- Realtime RT-PCR real-time reverse transcriptase reaction
- RPA RNase protection assay
- Northern blotting next-generation sequencing (NGS)
- DNA microarray analysis PCR, reverse transcriptase reaction (RT-PCR), competitive reverse transcriptase reaction (Competitive RT-PCR), real-time reverse transcriptase reaction (Realtime RT-PCR), RNase protection assay ( RPA; RNase protection assay), Northern blotting, next-generation sequencing (NGS), and DNA microarray analysis.
- the expression level of the protein is Western blot, ELISA (enzyme linked immunosorbent asay), immunostaining, radioimmunoassay (RIA), radioimmunodiffusion, Ouchterlony immune diffusion method, low It may be measured by one or more methods selected from the group consisting of rocket immunoelectrophoresis, tissue immunostaining, immunoprecipitation assay, complement fixation assay, FACS, and protein chip.
- prognosis of the present invention means a prediction for a medical ear (eg, long-term viability, disease-free survival, etc.) and includes a positive prognosis (positive prognosis) or a negative prognosis (negative prognosis), wherein the negative prognosis Disease progression or mortality such as recurrence, tumor growth, metastasis, and drug resistance, and a positive prognosis is disease remission, such as no disease, and improvement or stabilization of diseases such as tumor regression It includes.
- the poor prognosis in esophageal squamous cell carcinoma in the present invention means that the disease-specific survival year, recurrence free survival or overall survival is low (invention) Figure 6B).
- prediction of the present invention means to guess in advance about the medical ear, and the course of the disease (no disease survival rate, no recurrence survival rate or overall survival period) of a patient diagnosed with esophageal squamous cell carcinoma for the purposes of the present invention. It means guessing in advance.
- the present invention also provides nc886; And ACLY, BTK, CD14, CDC42, CDKN1A, CDKN1B, DPYSL2, DPYSL3, EIF4E, FOS, FOXO1, FOXO3, FOXO4, GJA1, GRB10, GRB2, HSPB1, JUN, MAP3K5, MAPT, MYC, NFKBA, PANKBD , PIK3R1, PPP2R1B, PRKAA1, PRKCA, PRKCZ, SHC1, SREBF1, SRF, YWHAH, ATG4B, BCL2L11, CSNK2A1, CTPS, EIF2AK2, FKBP1A, GADD45A, HRAS, MAPK1, MAPK2, PAPCPP , THEM4, YWHAE, YWHAG, CDKN2A, CDKN2C, SKP2, UBA52, CDK4, RPS27A, PPP2CA, RBL1 and/or CUL1 genes, or
- the present invention also provides nc886; And ACLY, BTK, CD14, CDC42, CDKN1A, CDKN1B, DPYSL2, DPYSL3, EIF4E, FOS, FOXO1, FOXO3, FOXO4, GJA1, GRB10, GRB2, HSPB1, JUN, MAP3K5, MAPT, MYC, NFKBA, PANKBD , PIK3R1, PPP2R1B, PRKAA1, PRKCA, PRKCZ, SHC1, SREBF1, SRF, YWHAH, ATG4B, BCL2L11, CSNK2A1, CTPS, EIF2AK2, FKBP1A, GADD45A, HRAS, MAPK1, MAPK2, PAPCPP , THEM4, YWHAE, YWHAG, CDKN2A, CDKN2C, SKP2, UBA52, CDK4, RPS27A, PPP2CA, RBL1 and/or CUL1 genes, or
- the detectable agent is an antibody, antibody fragment, or aptamer that specifically recognizes the nucleic acid sequence of the gene, its complementary nucleic acid sequence, a fragment of the nucleic acid sequences, or a protein encoded by the nucleic acid sequence. , Avidity (avidity multimer) and / or peptidomimetics (peptidomimetics).
- the present invention can also provide a biomarker composition for predicting resistance or sensitivity to the anticancer agent palbociclib in esophageal squamous cell carcinoma comprising an agent measuring the mRNA or protein level of the nc886, AKT, CDK4, CDKN2A and CKN2C genes. .
- Cluster 2 showed the expression of most genes, including CDK4. Increased (FIG. 7A) and low expression of nc886 (FIG. 7B) was confirmed.
- Palbosiclip is an FDA approved CDK4/6 inhibitor.
- nc886 associated with CDK4 can predict the response of ESCC cells to Palbociclib.
- Sensitivity to Palvosilib was investigated in the drug sensitivity genomics ( www.cancerRxgene.org) of the cancer database, the largest public resource providing information on the sensitivity of 1,000 cancer cell lines to over 100 compounds. It was confirmed that nc886 had the lowest IC 50 value suggesting that the silenced ESCC cell line TT (FIG. 7C) was a sensitive drug possessed by Palvosiclip (FIG. 7D).
- Apoptosis analysis for palbociclib treatment confirmed that TT cells had a higher rate of apoptosis than the nc886 expressing esophageal cell line (FIG. 7E ).
- nc886 and related genes were confirmed through the above results, it was confirmed that the prognosis of treatment for palbosiclip in patients with esophageal squamous cell carcinoma can be predicted.
- the present invention can also provide a kit for predicting resistance or sensitivity to the anti-cancer agent Palbosiclip in esophageal squamous cell carcinoma comprising the composition of the above-described composition.
- the present invention can also provide a method for providing information for predicting resistance or sensitivity to the anticancer agent palbociclib in esophageal squamous cell carcinoma comprising the following steps.
- nc886, CDKN2A and CKN2C gene mRNA or its protein level is lower than the control
- AKT and CDK4 gene mRNA or its protein level is higher than the control group
- esophageal squamous cell carcinoma susceptibility to anticancer agent palbociclib If it is judged that there is, and the mRNA level of the nc886, CDKN2A and CKN2C genes or its protein level is higher than the control group, and the mRNA level of the AKT and CDK4 genes or the protein level thereof is lower than the control group, the anticancer agent in the esophageal squamous cell carcinoma is used as an anticancer agent Determining that there is resistance to.
- the biological sample is one selected from the group consisting of formalin-fixed paraffin-embedded (FFPE) samples, fresh tissue, and frozen tissue of tissue containing cancer cells of patients with esophageal squamous cell carcinoma. It may be abnormal.
- the fresh tissue can be tissue, whole blood, serum or plasma.
- the mRNA levels of step (a) are polymerase reaction (PCR), reverse transcriptase reaction (RT-PCR), competitive reverse transcriptase reaction (Competitive RT-PCR), real-time reverse transcriptase reaction (Realtime RT-PCR), RNase protection assay (RPA), Northern blotting, next-generation sequencing (NGS), and DNA microarray analysis. have.
- the protein level of step (a) is western blotting, ELISA (enzyme linked immunosorbent assay), radioimmunoassay, radioimmunodiffusion, ouchterlony immunodiffusion, rocket (Rocket) from the group consisting of immunoelectrophoresis, tissue immunostaining, immunoprecipitation assay, complete fixation assay, flow cytometry (FACS) and protein chip assay It may be measured by one or more methods selected.
- HEK-293T cells (American Type Culture Collection) were cultured at 5% CO 2 and 37° C. using DMEM medium containing 10% fetal bovine serum and 1% Antibiotic-Antimycotic.
- the plasmid "pLPCX-U6” was created by inserting the U6 promoter in the pLPCX vector, and the "pCAGGS-GFP” was made by subcloning the green fluorescent protein (GFP) gene into the pCAGGS vector.
- nc886 expression plasmids (“pLPCX-U6-pre-886” and “pCAGGS-GFP/nc886”) were inserted into the vectors (“pLPCX-U6” and “pCAGGS-GFP”) (length as simulated in FIG. 1A) (101nt-649nt).
- Clones isolated by standard plasmid protocol were transformed into HEK-293T cells with LipofectamineTM 2000 reagent and nc886 + or nc886 ⁇ cell lines were established.
- Antibodies to phosphorylation-AKT (Ser 473), AKT and GAPDH were purchased from Cell Signaling Technology (Beverly, MA).
- Example 2 Measurement of cell proliferation, cell synchronization and cell cycle analysis
- RNA from 293T-derived nc886 + or control cells was isolated using Trizol reagent (Life Technologies) according to the manufacturer's instructions. DNA was synthesized with amfiRivert kit (GenDEPOT). nc886 was amplified by AccuPower Taq PCR PreMix (BIONEER) and the PCR product was visualized on an agarose gel. MRNAs for CDKN2A, CDKN2C, CUL1 and SKP2 were quantified with qRT-PCR using AccuPower GreenStarTM qPCR MasterMix (BIONEER) and ExicyclerTM 96 Real-Time Quantitative Thermal Block (BIONEER). The primers used for this are shown in Table 1 below.
- PET-CT Positron emission tomography-CT
- esophageal dystrophy were performed annually or more often, if necessary, depending on clinical history and clinical findings. All human specimens were collected with informed patient consent and the study protocol was approved by the Institutional Ethics Committee. After obtaining frozen tissue, total RNA was extracted using the mirVanaTM miRNA Isolation Kit (Ambion, Inc., Austin, TX) according to the manufacturer's instructions.
- RNA of 293T-U6 and 293T-U6:nc886 cells was treated with Affymetrix Human Genome U133 Array (Affymetrix, Santa Clara, CA).
- Affymetrix Human Genome U133 Array Affymetrix, Santa Clara, CA.
- 750 ng of total RNA was labeled with the Total Prep RNA Amplification Kit (Illumina) and hybridized.
- the micro-array data was normalized through quantile normalization, and the normalized values were algebraically converted to base 2 scale with R-script.
- the microarray data is stored in the Gene Expression Omnibus database of the National Center for Biotechnology Information (GSE55856 for ESCC samples and GSE51732 for Het-1A).
- RPPA data was performed at the Department of System Biology at the MD Anderson Cancer Center.
- RPPA lysis buffer 1% Triton X-100, 50mM HEPES (pH 7.4), 150mM NaCl, 1.5mM MgCl2, 1mM EGTA, 100mM NaF, 10mM Na pyrophosphate, 1mM Na3VO4, 10% glycerol, 1mM phenylmethylsulfonyl fluoride and 10 ⁇ g/ml aprotinin
- Cell lysates were initially adjusted to 1 ⁇ g/ ⁇ l and diluted 5 fold in lysis buffer to continuously print on nitrocellulose coated slides (Grace Bio-Labs, Bend, OR).
- Palbosiclip (PD0332991) HCl (catalog no. S116) was purchased from Selleckchem. 10 6 cells from each cancer cell line were plated in 6-well plates and cultured overnight. Cells were treated with 5 ⁇ M of Palboshi Clip and then incubated for 24 hours. Cell suicide analysis was performed by flow cytometry using nnexin V-FITC and 7-AAD (BioLegend. Catalog No. 640922).
- DSS Disease specific surviva
- RFS recurrence-free survival
- OS overall survival
- Univariable Cox regression analysis was used to determine if the variable was related to survival.
- c886 expression, gene marker and TNM (tumor-node-metastasis) stage were used as variables.
- C statistics from the R language and software environment http://www.r-project.org) were used to calculate the coincidence index between variables and survival. When p ⁇ 0.05, it was judged that there was statistical significance, and all tests were conducted in two-tailed. All statistical analyzes were performed with SPSS 24.0 (released at IBM Corp. 2016, IBM SPSS Statistics for Windows version 24.0, Armonk, NY).
- nc886 was a tumor suppressor in ESCC patient data.
- Het-1A a non-malignant esophageal cell line expressing nc886, was subjected to nc886 knockdown (KD) to obtain Het-1A with nc886 knockdown.
- KD nc886 knockdown
- nc886 Het-1A would be more tumorigenic (eg increased cell growth).
- nc886 knockdown-Het-1A expressed several tumor genes.
- nc886 KD results in the activation of PKR and the resulting apoptosis, which is consistent with previous studies that nc886 acted as an inhibitor of the pro-apoptotic protein PKR.
- PKR-mediated apoptosis surpasses all of the other effects of nc886-KD (tumor promoting gene expression) on Het-1A cells, making all further experiments to observe cell phenotype impossible. Therefore, when nc886 was deficient, it was judged that it was not easy to observe the phenotype of the cell, and when nc886 was expressed (gain-of function), it was switched to an approach for observing cells.
- nc886 is epigenetally silent in ESCC cells (nc886 - cells), and by expressing nc886 from several ESCC cell lines, an attempt was made to create an ESCC cell line with the same genetic background as the original cell line except for nc886 expression. .
- nc886 clone could not be isolated. It was assumed that these ESCC cells should be in the nc886 - phosphorus state, so that cell proliferation was possible, and thus did not proliferate when artificially produced nc886+ ESCC. Therefore, the human embryonic kidney cell line HEK-293T transformed with the SV40 T antigen (hereinafter referred to as "293T") was used. The use of 293T was chosen as an alternative, but it is a reasonable alternative because the effect of nc886 on gene expression is similar between 293T and Het-1A cells. Two versions of the nc886 293T cell line and corresponding vector control lines (see FIG.
- GFP + / GFP - cells in 293T-GFP / nc886 or 293T-GFP cells the original 293T cells that do not express GFP (GFP) - expressing GFP to monitor the rate of Were traced (Figure 1D).
- GFP cells were depleted as the co-culture continued, and importantly, the depletion was 293T-GFP/nc886 more severe than 293T-GFP (FIGS. 1E-F). When the above data were comprehensively judged, it was confirmed that the cells of nc886 proliferated slowly.
- nc886 + cells have a longer G1 duration than nc886 - cells
- nc886 + cells have a longer G1 duration than nc886 - cells. It was hypothesized that the delayed growth of nc886 + cells was due to delays at certain stages of the cell cycle.
- cells growing asynchronously were treated with microtubule inhibitor nocodazole and then profiled with a cell cycle using flow cytometry (FIG. 2A ).
- flow cytometry flow cytometry
- cells growing asynchronously were treated with microtubule inhibitor nocodazole and then profiled with a cell cycle using flow cytometry (FIG. 2A ). Upon nocodazole treatment, cells were synchronized at the G2/M step as identified by a single peak at a DNA content of 2n. After 6 hours of nocodazole removal, another peak appeared at the 1n position, and the above results indicate that the cells were released from G2/M and entered the G1 phase.
- nc886 + and nc886 ⁇ cells showed almost the same pattern at this point. However, after 12 hours, it was confirmed that nc886 ⁇ cells further progressed to S (S phage), whereas progression to the S phase was delayed in the case of nc886 + cells (FIGS. 2A and B ).
- S phage S phage
- progression to the S phase was delayed in the case of nc886 + cells
- the above data indicate that nc886 reverses the transition from G1 to S, but does not affect the conversion from G2/M to G1.
- the extension of the G1 period nc886 + cell is a cell of nc886 + nc886 - indicates whether more slowly than cell proliferation.
- nc886 has a gene regulation function
- the gene expression pattern was examined to find out why the cells of nc886 + have a longer G1 phase than nc886 - cells.
- Microarrays were performed on the pair of cell lines used in Figures 1 and 2 ("nc886-EXP" compared to 293T-U6, relative values of 293T-U6:nc886). A significant proportion of the genes altered in nc886-EXP would be secondary outcomes. This is because these cells have been maintained for several months until the microarray experiment. Therefore, nc886-EXP data was supplemented with nc886 KD data (“anti-nc886 value compared to control).
- nc886-KD was constructed by transiently transfecting Het-1A cells with anti-nc886 (oligonucleotides targeting and inhibiting nc886) for a few days. Therefore, the nc886-KD data showed that The direct results are better represented: Array data was analyzed for the Molecular Signature Database (MSigDB: http://software.broadinstitute.org/gsea/msigdb) as array data.MSigDB has several sequences based on sequence motifs, pathways, etc. There is a gene collection, for example, a TFT is a collection of target genes for transcription factors (TF), there are 615 sets of TFTs, each set has dozens to hundreds of binding sites for that TF in the promoter region.
- MSigDB Molecular Signature Database
- Another example is a set of 674 Reactome sets defined by the Reactome pathway database
- the overall enrichment or depletion of the set is calculated from the array values of the genes in the set.
- 674 Z- scores were obtained from nc886-EXP and nc886-KD, and a significant negative correlation was observed compared to the scatterplot (FIG.
- the TFT Z scores of nc886-EXP and nc886-KD also showed a negative correlation (Fig.
- nc886 was similar to the cellular pathway of the esophageal cell line Het-1A in the gene expression and cell pathway of 293T cells. It suggests that it has no effect, suggesting that 293T is suitable for investigating the role of the tumor suppressor factor of nc886 in ESCC
- Individual genes were examined to see the pathway or TF most affected by nc886. 9 paths in EXP (Z-score Score was cut off >3) was significantly activated (blue bar in FIG. 3). Note that most of the 9 pathways (8 of 9) are somehow related to the cell cycle, and 3 are directly related to the G1/S phase (FIG. 3C, shown in red brackets).
- CDKN2A aka, p16INK4a or p14ARF
- CDKN2C CDKN2C for further experiments. This is because it has been reported that inhibiting CDK4/CDK6 restricts cells in G1 and is activated by E2F.
- CDKN2A and CDKN2C showed a positive response with nc886 (FIG. 4C ).
- CDKN2A and CDKN2C in 293T-U6:nc886 cells increased in line with the long-term persistence of G1 (Figure 2A-B) and enrichment of E2F target genes (Figure 3D) compared to 293T-U6 cells.
- SKP2 and CUL1 are known to promote G1-S metastasis by degrading CDK inhibitors, so SKP2 and CUL1 were investigated.
- These two genes were negatively correlated with nc886 in patient and cell line data ( Figure 4B-D). When the above data were comprehensively judged, nc886 regulates the cell cycle gene to delay G1-S metastasis.
- nc886 was shown to inhibit PKR and Dicer, we investigated whether delayed G1 in nc886-EXP could be explained by these two proteins.
- PKR is a protein involved in cell proliferation and its representative downstream phenomenon is activation of NF- ⁇ B. Therefore, NF- ⁇ B was examined in the MSigDB TFT set. As described above, PKR induces cell death when activated, so it must remain latent in naturally proliferating cells. In this situation, the inhibitory role of nc886 on PKR has little effect. Although activated by nc886-KD, PKR was unable to explain the cell cycle phenotype of nc886-EXP.
- the major enzyme of miRNA biogenesis, Dicer was studied to investigate the set of miRNA target gene, MSigDB MIR. No inhibitory effect of nc886 on miRNA pathway was observed in nc886-EXP.
- nc886 inhibits the AKT pathway.
- RPPA proteome repertoire was measured using a high-efficiency platform called RPPA.
- cell lysates were arranged on nitrocellulose coated slides containing 172 antibodies, and the corresponding protein was comprehensively measured.
- the antibody contained a protein and its phosphorylated form in a well-known route.
- RPPA was run on nc886-KD. This is because, as described above, when identifying the direct effect of nc886, short-term KD cells are more advantageous than nc886-EXP.
- Expression values of 72 proteins were obtained and 23 were found to change at statistically significant levels (FIG. 5A ). When the 23 proteins were examined, it was confirmed that there was a change in the protein in the AKT pathway.
- the AKT protein consists of three isoforms with strong homology (AKT1, AKT2 and AKT3), and their phosphorylation is active.
- phosphorylation of AKT1 in Thr308 and Ser473 increased, and total AKT1 remained relatively unchanged (FIG. 5A ).
- nc886-KD increased phosphorylation of substrate 1 (AKT1S1, a.k.a., PRAS40) of AKT1 and Ribosomal Protein S6 (RPS6).
- AKT1S1 is phosphorylated directly by AKT.
- RPS6 is phosphorylated by AKT-promoted Ribosomal Protein S6 Kinase B1 (RPS6KB1, a.k.a., S6K).
- RPS6KB1 AKT-promoted Ribosomal Protein S6 Kinase B1
- AKT phosphorylation was measured in nc886-EXP, which observed the cell phenotype (slow cell proliferation due to delay in G1).
- Western blot results showed that AKT1 was less phosphorylated in Ser473 than 293T-U6 at 293T-U6:nc886 at 6 and 12 hours after release from the nocodazole suspension (FIG. 5B ).
- the data demonstrated the suppression of AKT by nc886.
- AKT activation leads to changes in gene expression. Therefore, the effect of nc886 on AKT was further evaluated in gene expression data. Collection of recent review articles and public databases including Reactome and Biocarta gene sets (http://software.broadinstitute.org/gsea/msigdb/) and RGD (Rat Genome Database; https://rgd.mcw.edu/) A list of 184 AKT downstream genes was selected. Some of these genes are down-regulated while others are down-regulated when AKT is activated. To apply to the array data for 108 ESCC patients, 34 increased genes (Table 2) and 19 reduced genes were selected from nc886-KD among 184 genes (Table 3).
- Example 13 Association between nc886, AKT and cell cycle genes is a predictor of survival in ESCC patients.
- nc886, AKT and cell cycle genes are a predictor of survival in ESCC patients.
- the role of nc886 in inhibiting AKT pathway and cell cycle progression was revealed and nc886 related gene characteristics were identified (34 and 19 nc886/AKT-related genes (FIG. 5); 9 and 5 nc886/G1 related genes (FIG. 4B)) .
- the prognostic usefulness of these genes was tested in 108 ESCC patients.
- the AKT signature score was generated by the difference in geometric mean between 34 genes up-regulated and 19 genes down-regulated in nc886-KD.
- the cell cycle signature score was calculated similarly from 9 genes and 5 genes, each negatively correlated with nc886.
- TNM staging and nc886 expression were independent prognostic factors for RFS. According to C-statistics, the combination of the four factors (expression level of nc886, AKT signature score, cell cycle signature score and TNM stage) was the strongest combination that could predict disease recurrence and patient survival (FIG. 6A ).
- Stratification into 5 subgroups by prognostic score showed distinct DSS, RFS and OS curves in the 108 ESCC patient population (FIG. 6B ). In all three curves, the higher the prognosis score is, the shorter the survival time is. Patients with a score of 4 (TNM Stage III and IV, low nc886, high AKT signature score and high cell cycle score) had the worst survival, but those with a score of 0 had the best survival. AKT downstream genes and cell cycle genes better predicted patient survival when combined with nc886 and TNM staging. To demonstrate how nc886 acts as a tumor suppressor in ESCC, the inhibitory role of nc886 in cell proliferation was demonstrated by identifying AKT and cell cycle genes as downstream events (FIG. 6C ).
- Example 14 Therapeutic application to ESCC with undesirable prognosis.
- nc886 As an inverse approach to demonstrating the association of nc886 with the AKT target gene and cell cycle gene, unsupervised clustering of 108 patients with the gene was performed to identify two distinct clusters named "Cluster1" and "Cluster2" (Fig. 7A). Cluster2 enriched most of the genes, including low expression of CDK4 ( Figure 7A) and nc886 ( Figure 7B). Some cancer drugs target cell cycle genes.
- the FDA-approved small molecule CDK4/6 inhibitor, Palbociclib has been extensively investigated in preclinical studies and clinical trials of a series of human malignancies, including EC. The investigation of nc886, AKT and cell cycle further investigated whether treatment decisions were further improved based on the gene expression profile of the tumor.
- nc886 and related genes were confirmed through the above results, it was confirmed that the prognosis of treatment for palbosiclip in patients with esophageal squamous cell carcinoma can be predicted. It was confirmed that the nc886, CDKN2A and CKN2C gene levels were lower than the control group, and the AKT and CDK4 gene levels were higher than the control group.
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Pathology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Hospice & Palliative Care (AREA)
- Biophysics (AREA)
- Oncology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
본 발명은 식도편평상피암의 예후를 예측하는 방법에 관한 것이다.
Description
본 발명은 식도편평상피암의 예후를 예측하는 방법에 관한 것이다.
지난 20년 동안 non-coding RNAs (ncRNAs)의 역할은 광범위하게 연구되고 있다. 최근 본 발명의 주 저자에 의해 발견된 nc886은 유전자 발현 패턴에 영향을 미치는 조절 ncRNA 중에 하나이다. nc886은 표적 단백질에 결합하고, 이의 활성을 조절한다. 지금까지 알려진 nc886의 표적 단백질은 Protein Kinase R(PKR)과 Dicer이다. nc886의 또다른 특징은 RNA 중합 효소 Ⅲ에 의해 전사된다는 점으로 이는 RNA 중합 효소 Ⅱ에 의해 전사되는 대부분의 조절 ncRNA와 매우 다른 점이다. nc886은 여러 가지 악성 종양에서 조절 장애가 발견된 이후 주목을 받기 시작하였다. nc886은 대부분의 정상적인 조직에서 발현되지만, 위암, 급성 골수성 백혈병과 같은 다수의 악성 종양에서는 이의 발현이 후성 유전학적으로 침묵하고 있다. nc886의 발현이 변화되면 나타타는 현저한 표현형 결과는 세포 증식이다. 따라서 nc886이 종양 억제인자라고 추측하였고, nc886의 침묵은 세포 증식을 촉진할 것으로 예상하였다. 그럼에도 불구하고 nc886이 식도, 위 등에서 유래한 몇몇 nc886+ 셀라인에서 역배열-올리고-핵산염(anti-sense oligonucleotides)을 처리하면, nc886의 발현이 급격하게 감소하게 되고 세포증식이 감소하였다. 상기의 결과는 nc886이 PKR을 억제하는 분자적 기능으로 다음과 같이 잘 설명될 수 있다. PKR은 전형적으로 바이러스 감염에 의해 활성화되는 전세포사멸 단백질 (세포사멸을 유도하는 단백질)이다. nc886의 급격한 감소는 바이러스 감염 없이 PKR을 활성화시키기에 충분하다. PKR이 활성화 되면 elF2α를 인산화 시키고, 이로써 전체적인 단백질의 번역을 중단시키고, 세포 사멸을 유도한다. 생체내에서 nc886 침묵 (silencing)과 PKR 활성화 (그에 의한 세포사멸)의 의의는 PKR 활성화가 바이러스 감염 세포를 제거하는 것과 같이 전암 세포를 제거하기 위한 경계 역할을 하리라고 생각된다.
그럼에도 불구하고 임상적으로 검출 가능한 또는 시험 관내에서 분리된 nc886이 발현되지 않는 세포가 존재하고, 이들은 nc886/PKR 매개 세포 사멸 경로를 우회한 세포들이다. nc886의 발현이 줄어든 암 환자의 예후가 좋지 않다는 사실에 근거하여, nc886이 침묵된 암세포가 더 증식하는 것으로 추측하였다. 이것을 뒷받침하는 실험결과로 ESCC(esophageal squamous cell carcinoma) 및 GC (Gastric Cancer) 세포에서 nc886의 일시적인 발현이 세포 증식을 억제 된다는 관찰결과가 있다. 이러한 모든 데이터를 통해 암 발생의 특정 단계에서 nc886 침묵이 세포에 성장 이점을 부여한다는 가설을 세웠다. nc886이 침묵된 상황에서, PKR-eIF2α 세포 사멸 경로와 더불어 성장 촉진 효과도 같이 일어난다고 생각되며 이 두 가지는 별개의 경로이다. 실험적으로 nc886의 침묵을 인위적으로 유도하면 PKR 경로에 따른 세포사멸이 먼저 일어나며, 따라서 nc886의 침묵에 의한 세포 성장 촉진 표현형을 관찰하기란 쉽지 않다.
종양 형성 과정에서의 세포주기 진행/정지의 조절 장애는 세포 증식, 생존 및 신진 대사를 비롯한 다양한 세포 기능에 관여하는 AKT 경로와 같은 여러 신호 전달 경로의 오작동에 기인한다. 암에서 AKT는 여러 메커니즘을 통해 G1-S 전이를 촉진한다. 주된 메커니즘은 cyclin-dependent kinase (CDK) 억제 단백질을 직접 인산화하여 불활성하게 만드는 것이지만, 또 다른 가능한 메커니즘은 E2F 통하여 CDK 억제 단백질의 전사를 조절한다거나, 유비퀴틴-프로테아좀 시스템을 통하여 CDK 억제 단백질의 안정성을 간접적으로 조절하는 것 등이다. E2F 활성은 AKT에 의해 억제되며, 일부 CDK 억제제 (CDKN2A 및 CDKN2C와 같은)가 E2F에 의해 전사 활성화되는 것으로 보고되었다. 따라서 AKT가 E2F를 억제함으로서 CDK 억제제 유전자의 전사를 약화시킬 수 있다는 것이다. 또한, AKT와 SKP2 사이의 크로스 토크가 보고되었는데, SKP1:CUL1:F-box 단백질 복합체 (SCF)의 조절 성분인 SKP2는 악성 종양에서 과발현 되고 SCF E3 유비퀴틴리가제를 통해 CDK 억제 단백질을 분해하도록 지시한다.
식도암은 식도에서 생기는 암의 총칭으로, 우리나라에서는 그리 흔한 암에 속하지는 않지만, 예후가 그리 좋은 편은 아닌, 위험한 암 중에 하나이다. 따라서 환자의 예후 예측을 측정하는 것이 매우 중요한 연구 중에 하나이다. 예를 들어 한국등록특허번호 제10-1657033호에서는 V-ATPase subunit V1E1의 단백질 발현 수준을 측정하여 식도암 환자의 생존율과 예후를 예측하는 방법이 개시되어 있고, 한국 공개특허번호 제10-2008-0007659호에는 특정 유전자를 검출하여 식도암 및 식도암 전이 진단을 위한 조성물 및 방법이 개시되어 있다. 식도암은 크게 식도편평상피암 및 식도선암으로 구분된다. 그 중 식도편평상피암은 식도를 이루는 주 세포인 평편 세포에서 기인한 암으로써, 우리나라에서는 선암보다 더 흔하다.
본 발명자들은 식도편평상피암에서의 nc886 억제의 중요성에 대해 연구를 수행하여, 보다 정밀하게 식도편평상피암 환자의 예후를 예측할 수 있는 방법을 제안한다.
본 발명자들은 식도편평상피암에서의 nc886 억제의 중요성에 대해 연구한 결과, 식도편평상피암에서 nc886의 발현 낮으면 암세포의 증식을 촉진한다는 것을 확인하였고, 나아가 nc886이 발현이 세포주기를 지연시키고, 세포주기 유전자를 조절하며, AKT의 타겟 유전자들을 변화시키는 것을 확인하였다. 식도편평상피암 환자에서 nc886의 발현, AKT의 타겟 유전자 발현의 증가 또는 감소, 기존의 TNM 단계 및 세포주기와 관련된 유전자의 발현의 증가 또는 감소를 측정하여 식도편평상피암 환자의 예후를 예측할 수 있는 것을 확인하여 본 발명을 완성하였다.
상기와 같이, 본 발명은 식도편평상피암 환자로부터 분리된 생물학적 시료로부터 a) nc886의 발현 수준을 측정하는 단계; b) AKT 표적 유전자 중 nc886의 증가에 따라 발현이 변화하는 유전자들 및 세포주기와 관련된 유전자 중 nc886의 증가에 따라 발현이 변화하는 유전자들 중 어느 하나 이상의 유전자의 발현 수준을 측정하는 단계;를 포함하는, 식도편평상피암 환자의 예후 예측을 위한 정보제공방법을 제공할 수 있다.
본 발명의 일 구체예에서는,
a-1) 상기 nc886의 발현 수준이 낮은 경우; b-1) 상기 AKT의 표적 유전자 중 "nc886의 발현 증가에 의해 감소하는 유전자 또는 이의 단백질의 발현 수준"이 정상 대조군 시료보다 높거나; 또는 "nc886의 발현 증가에 의해 증가하는 유전자 또는 이의 단백질 수준"이 정상 대조군 시료보다 낮은 경우; 및/또는 b-2) 상기 세포주기와 관련된 유전자 중 "nc886의 발현 증가에 의해 감소하는 유전자 또는 이의 단백질의 발현 수준"이 정상 대조군 시료보다 높거나; 또는 상기 세포주기와 관련된 유전자 중 "nc886의 발현 증가에 의해 증가하는 유전자 또는 이의 단백질의 발현 수준"이 예정상 대조군 시료보다 낮은 경우;에 식도편평상피암 환자의 예후가 불량한 것으로 판단할 수 있다.
본 발명에 있어서, 상기 b) 단계 이후, 상기 식도편평상피암을 TNM에 따라 분류되는 정보를 수집하는 단계;를 추가로 포함할 수 있다. 상기 TNM에 따라 분류 점수를 0 점 내지 4점으로 계산하며, 상기 점수가 0점이면 매우 양호, 1점이면 양호, 2점이면 보통, 3점이면 나쁨, 4점이면 매우 나쁨으로 판단할 수 있다.
본 발명은 바람직한 일 구체예에서는, 하기의 단계를 포함하는 식도편평상피암의 예후 예측에 필요한 정보를 제공하는 방법을 제공할 수 있다.
i) 식도편평상피암 환자로부터 분리된 생물학적 시료로부터 nc886의 발현 수준, AKT의 표적 유전자의 발현 수준, 세포주기와 관련된 유전자의 발현 수준 및 TNM에 따라 분류되는 정보를 수집하는 단계;
ii) a-1) 상기 nc886의 발현 수준이 정상 대조군 시료보다 높으면 0점을 주고, 정상 시료 대조군보다 낮으면 1점을 주며,
a-2) 상기 AKT의 표적 유전자 중 nc886의 발현 증가에 의해 감소하는 유전자 또는 이의 단백질의 발현 수준”이 정상 대조군 시료보다 높거나, 또는 nc886의 발현 증가에 의해 증가하는 유전자 또는 이의 단백질 수준”이 정상 대조군 시료보다 낮으면 1점을 주고; 상기 AKT의 표적 유전자 중 nc886의 발현 증가에 의해 감소하는 유전자 또는 이의 단백질의 발현 수준”이 정상 대조군 시료보다 낮거나, 또는 nc886의 발현 증가에 의해 증가하는 유전자 또는 이의 단백질 수준”이 정상 대조군 시료보다 높으면 0점을 주고,
a-3) 상기 세포주기와 관련된 유전자 중 nc886의 발현 증가에 의해 감소하는 유전자 또는 이의 단백질의 발현 수준”이 정상 대조군 시료보다 높거나, 또는 상기 세포주기와 관련된 유전자 중 nc886의 발현 증가에 의해 증가하는 유전자 또는 이의 단백질의 발현 수준”이 정상 대조군 시료보다 낮으면 1점을 주고; 상기 세포주기와 관련된 유전자 중 nc886의 발현 증가에 의해 감소하는 유전자 또는 이의 단백질의 발현 수준”이 정상 대조군 시료보다 낮거나, 또는 상기 세포주기와 관련된 유전자 중 nc886의 발현 증가에 의해 증가하는 유전자 또는 이의 단백질의 발현 수준”이 정상 대조군 시료보다 높으면 0점을 주고,
상기 TNM 단계가 1 또는 2단계면 0점을 주며 3 또는 4단계면 1점을 주는 단계; 및
iii) 상기 ii)단계의 점수를 계산하는 단계.
본 발명에서, 상기 AKT의 표적 유전자 중 nc886의 발현 증가에 의해 감소하는 유전자는 ACLY, BTK,CD14, CDC42, CDKN1A, CDKN1B, DPYSL2, DPYSL3, EIF4E, FOS, FOXO1, FOXO3, FOXO4, GJA1, GRB10, GRB2, HSPB1, JUN, MAP3K5, MAPT, MYC, NFKBIA, PABPC1, PAK1, PALLD, PIK3R1, PPP2R1B, PRKAA1, PRKCA, PRKCZ, SHC1, SREBF1, SRF 및 YWHAH으로 이루어진 군으로 부터 선택되는 어느 하나의 유전자이고, nc886의 발현 증가에 의해 증가하는 유전자는 ATG4B, BCL2L11, CSNK2A1, CTPS, EIF2AK2, FKBP1A, GADD45A, HRAS, MAPK1, MAPKAP1, MTCP1, PCK2, PPP2CB, PPP2R2A, PRKAA2, PTEN, THEM4, YWHAE 및 YWHAG으로 이루어진 군으로부터 선택되는 어느 하나의 유전자일 수 있다.
또한, 상기 세포주기와 관련된 유전자 중 nc886의 발현 증가에 의해 증가하는 유전자는 CDKN2A, RBL1, PPP2R1B, CDKN1A 또는 CDKN2C이고, nc886의 발현 증가에 의해 감소하는 유전자는 SKP2, CDKN1B, PPP2CB, UBA52, CDK4, RPS27A, PPP2CA, PPP2R2A 또는 CUL1일 수 있다.
본 발명에서, 식도편평상피암 환자로부터 분리된 생물학적 시료는 환자의 암세포를 포함하는 조직의 포르말린 고정 파라핀 포매(formalin-fixed paraffin-embedded, FFPE) 시료, 신선한 조직(fresh tissue) 또는 동결 조직일 수 있으며, 이에 한정되지 않는다.
본 발명의 일 구체예에서, 상기 유전자의 수준은 중합효소반응(PCR), 역전사 중합효소반응(RT-PCR), 경쟁적 역전사 중합효소반응(Competitive RT-PCR), 실시간 역전사 중합효소반응(Realtime RT-PCR), RNase 보호 분석법(RPA; RNase protection assay), 노던 블랏팅(Northern blotting), 차세대 염기서열분석(next-generation sequencing, NGS) 및 DNA 마이크로어레이 분석법으로 이루어진 군으로부터 선택된 1종 이상의 방법에 의해 측정할 수 있다.
본 발명의 일 구체예에서, 상기 단백질의 발현 수준은웨스턴 블랏, ELISA (enzyme linked immunosorbent asay), 면역염색법 (immunostaining), 방사선면역분석(Radioimmunoassay; RIA), 방사면역확산법(radioimmunodiffusion), 오우크테로니(Ouchterlony) 면역 확산법, 로케이트(rocket) 면역전기영동, 조직면역염색, 면역침전 분석법(Immunoprecipitation assay), 보체고정분석법(Complement Fixation Assay), FACS 및 단백질 칩으로 이루어진 군으로부터 선택된 1종 이상의 방법에 의해 측정할 수 있다.
본 발명은 또한 nc886; 및 ACLY, BTK,CD14, CDC42, CDKN1A, CDKN1B, DPYSL2, DPYSL3, EIF4E, FOS, FOXO1, FOXO3, FOXO4, GJA1, GRB10, GRB2, HSPB1, JUN, MAP3K5, MAPT, MYC, NFKBIA, PABPC1, PAK1, PALLD, PIK3R1, PPP2R1B, PRKAA1, PRKCA, PRKCZ, SHC1, SREBF1, SRF, YWHAH, ATG4B, BCL2L11, CSNK2A1, CTPS, EIF2AK2, FKBP1A, GADD45A, HRAS, MAPK1, MAPKAP1, MTCP1, PCK2, PPP2CB, PPP2R2A, PRKAA2, PTEN, THEM4, YWHAE, YWHAG, CDKN2A, CDKN2C, SKP2, UBA52, CDK4, RPS27A, PPP2CA, RBL1 또는 CUL1 유전자, 또는 상기 유전자로 엔코딩된 단백질을 검출할 수 있는 제제를 포함하는 식도편평상피암 예후 예측용 조성물을 제공할 수 있다.
본 발명은 또한 nc886; 및 ACLY, BTK,CD14, CDC42, CDKN1A, CDKN1B, DPYSL2, DPYSL3, EIF4E, FOS, FOXO1, FOXO3, FOXO4, GJA1, GRB10, GRB2, HSPB1, JUN, MAP3K5, MAPT, MYC, NFKBIA, PABPC1, PAK1, PALLD, PIK3R1, PPP2R1B, PRKAA1, PRKCA, PRKCZ, SHC1, SREBF1, SRF, YWHAH, ATG4B, BCL2L11, CSNK2A1, CTPS, EIF2AK2, FKBP1A, GADD45A, HRAS, MAPK1, MAPKAP1, MTCP1, PCK2, PPP2CB, PPP2R2A, PRKAA2, PTEN, THEM4, YWHAE, YWHAG, CDKN2A, CDKN2C, SKP2, UBA52, CDK4, RPS27A, PPP2CA, RBL1 또는 CUL1 유전자, 또는 상기 유전자로 엔코딩된 단백질을 검출할 수 있는 제제를 포함하는 식도편평상피암 예후 예측용 키트를 제공할 수 있다.
본 발명은 또한 nc886, AKT, CDK4, CDKN2A 및 CKN2C 유전자의 mRNA 또는 이의 단백질 수준을 측정하는 제제를 포함하는 식도편평상피암에서 항암제 팔보시클립에 대한 저항성 또는 민감성 예측용 바이오마커 조성물을 제공할 수 있다.
본 발명은 또한 상기 서술한 조성물을 포함하는 식도편평상피암에서 항암제 팔보시클립에 대한 저항성 또는 민감성 예측용 키트를 제공할 수 있다.
본 발명은 또한 하기의 단계를 포함하는 식도편평상피암에서 항암제 팔보시클립에 대한 저항성 또는 민감성 예측을 위한 정보제공방법을 제공할 수 있다.
a) 생물학적 시료에서 nc886, AKT, CDK4, CDKN2A 및 CKN2C 유전자의 mRNA 또는 이의 단백질 수준을 측정하는 단계; 및
(b) 상기 nc886, CDKN2A 및 CKN2C 유전자의 mRNA 또는 이의 단백질 수준이 대조군에 비해 낮고, AKT 및 CDK4 유전자의 mRNA 또는 이의 단백질 수준이 대조군에 비해 높은 경우에 식도편평상피암에서 항암제 팔보시클립에 대한 민감성이 있는 것으로 판단하고, nc886, CDKN2A 및 CKN2C 유전자의 mRNA 또는 이의 단백질 수준이 대조군에 비해 높고, AKT 및 CDK4 유전자의 mRNA 또는 이의 단백질 수준이 대조군에 비해 낮은 경우에 식도편평상피암에서 항암제 팔보시클립에 대한 저항성이 있는 것으로 판단하는 단계.
본 발명의 일 구체예에서, 상기 a) 단계의 생물학적 시료는 식도편평상피암 환자의 암세포를 포함하는 조직의 포르말린 고정 파라핀 포매(formalin-fixed paraffin-embedded, FFPE) 시료, 신선한 조직(fresh tissue) 및 동결 조직으로 이루어진 군으로부터 선택된 1종 이상일 수 있다. 상기 (a) 단계의 mRNA 수준은 중합효소반응(PCR), 역전사 중합효소반응(RT-PCR), 경쟁적 역전사 중합효소반응(Competitive RT-PCR), 실시간 역전사 중합효소반응(Realtime RT-PCR), RNase 보호 분석법(RPA; RNase protection assay), 노던 블랏팅(Northern blotting), 차세대 염기서열분석(next-generation sequencing, NGS) 및 DNA 마이크로어레이 분석법으로 이루어진 군으로부터 선택된 1종 이상의 방법에 의해 측정될 수 있다. 상기 (a) 단계의 단백질 수준은 웨스턴 블랏팅(western blotting), ELISA(enzyme linked immunosorbent assay), 방사선면역분석법(Radioimmunoassay), 방사면역 확산법(Radioimmunodiffusion), 오우크테로니(Ouchterlony) 면역 확산법, 로케트(Rocket) 면역전기영동, 조직면역염색법, 면역 침전분석법(immunoprecipitation assay), 보체 고정 분석법(complete fixation assay), 유세포분석법(Fluorescence Activated Cell Sorter, FACS) 및 단백질 칩(protein chip) 분석법으로 이루어진 군으로부터 선택된 1종 이상의 방법에 의해 측정될 수 있다.
본 발명은 식도편평상피암의 환자에서 nc886, nc886에 의해 조절되는 AKT 타겟 유전자 및 세포 주기와 관련된 유전자의 발현을 측정하고 기존의 TNM 단계를 합산함으로써 종합적으로 점수화하여, 식도편평상피암 환자의 예후를 정밀하게 예측할 수 있는 효과가 있다. 또한 nc886, AKT, CDK4, CDKN2A 및 CKN2C 유전자의 mRNA 또는 이의 단백질 수준을 측정하여 식도편평상피암에서 항암제 팔보시클립에 대한 저항성 또는 민감성을 예측할 수 있는 효과가 있다.
도 1은 nc886이 293T 세포의 성장을 억제한다는 것을 보여주는 결과로써, A는 본 발명에서 사용한 플라즈미드의 모식도이고, B는 상기 플라즈미드가 안정적으로 삽입된 세포주에서 nc886의 발현을 확인한 RT-PCR결과이며, C는 본원 발명의 사용된 세포의 세포수의 증식을 보여주는 결과이며, D는 세포 혼합실험을 보여주는 모식도이며, E-F는 GFP 음성 및 양성 세포수를 FACS를 측정한 결과이다.
도 2는 nc886이 세포주기를 늦춘다는 것을 보여주는 결과로써, A 및 B는 DNA을 프로피디움 요오드화물 (propidium iodide; PI) 염색한 뒤, 세포주기를 확인한 결과이다.
도 3은 nc886-EXP 및 nc886-KD 어레이 데이터를 통합된 MSigDB (Molecular Signature Database)에서 분석한 결과로서, A는 674 Reactome 유전자 세트에 대한 Z-점수들을 nc886-EXP (x 축)와 nc886-KD (y 축) 사이에서 산점도로 도식화 하여 그 상관관계를 보여주며, B는 615 TFT (TF 표적 유전자 세트)에 대한 Z- 점수를 패널 A에 기술된바와 같이 산점도로 보인 결과이고, C-D는 Reactome 유전자 세트 및 TFT 유전자 세트에서 현저하게 강화 된 TFT Z-점수 (> 3, nc886-EXP를 기준으로)를 보여주는 막대그래프이다.
도 4는 nc886이 세포주기 유전자의 발현을 조절한다는 것을 보여주는 결과로서, A는 세포주기 유전자 (40 genes)의 및 nc886에 의해 바뀐 유전자의 (6563 genes) 벤 다이어그램 결과이고, B는 108명의 ESCC 환자 코호트에서 nc886 발현과의 통계적 상관관계를 보여주는 19 개의 nc886/G1 관련 유전자의 Volcano map 결과이고, C는 nc886 발현과 대표적인 세포주기 유전자 사이의 상관관계를 108명의 ESCC 환자 코호트에서 분석한 결과이고, D는 상기 유전자의 qRT-PCR 결과이다.
도 5는 nc886이 AKT 경로를 보여주는 결과로써, A는 ESCC 세포주인 TE1의 nc886-KD에서 나온 RPPA 데이터를 보여주는 히트맵 결과이고, B는 인산화 AKT 및 총 AKT의 발현 수준을 측정한 웨스턴 블랏 결과이며, C는 nc886 KD에서 선험적으로 정의된 AKT 유전자 세트가 nc886 발현에 따라 ESCC 환자에서 통계적 일치를 나타내는지 여부를 보여주는 GSEA 결과이다.
도 6은 nc886, AKT 및 세포주기 유전자의 예후를 예측한 결과로써, A는 nc886, AKT 시그니처 스코어, 세포주기 시그니처 스코어, TNM 병기의 조합이 재발 및 생존의 가장 강력한 예측 인자임을 보여주는 결과이고, b는 TNM 병기 (병기 I 및 II (0)/병기 III 및 IV (1)), nc886 발현 정도 (중앙값으로 높음 (0)/낮음 (1)), AKT 서명 스코어 (중앙값에 의해 낮은 (0)/높은 (1)), 및 세포주기 점수 (중간 값에 의해 낮은 (0)/높은 (1))의 계산한 합이 예후 점수에 층화가 ESCC 환자 코호트에서 뚜렷한 DSS, RFS 및 OS를 보여주는 결과이며, C는 이 연구를 요약한 결과이다.
도 7은 nc886의 예후 및 예측 값을 나타내는 결과로써, A는 ESCC 코호트에서 AKT 및 세포주기 유전자의 감독되지 않는 클러스리의 결과로서 CDK4를 포함한 다수의 유전자는 Cluster 2에서 상향조절 되는 것임을 보여주고, B는 Cluster 1과 Cluster 2의 nc886의 발현을 확인한 결과이고, C는 qRT-PCR을 이용하여 식도 세포주에서 nc886의 발현을 확인한 결과이고, D는 팔보시클립에 대한 30 EC 세포주의 약묵 민감성을 확인한 결과이며, F는 팔보시클립에 대한 민감도에 대한 nc886 발현 수준의 역상관성을 보여주는 식도 세포주의 세포자살을 분석한 결과이다.
도 8은 본 발명을 요약한 모식도이다.
이하, 본 발명을 보다 구체적으로 설명한다.
식도암은 식도에서 생기는 암의 총칭이다. 식도암은 우리나라에서는 그리 흔한 암에 속하지는 않지만 예후가 그리 좋은 편은 아닌 위험한 암 중에 하나이다. 따라서 환자의 예후 예측을 측정하는 것이 매우 중요한 연구 중에 하나이다. 본 발명에서는 식도편평상피암에서 nc886의 발현 낮으면 암세포의 증식을 촉진한다는 것을 확인하였다. nc886의 발현이 세포주기를 지연시키고, 세포주기 유전자를 조절하며, AKT의 타겟 유전자들을 변화시키는 것을 확인하였다. 식도편평상피암환자에서 nc886의 발현, AKT의 타겟 유전자 발현의 증가 또는 감소, 기존의 TNM 단계 및/또는 세포주기와 관련된 유전자의 발현의 증가 또는 감소를 측정하여 식도편평상피암환자의 예후를 예측할 수 있는 것을 확인함으로써 본 발명을 완성하였다.
본 발명은 식도편평상피암 환자로부터 분리된 생물학적 시료로부터 a) nc886의 발현 수준을 측정하는 단계; b) AKT 표적 유전자 중 nc886의 증가에 따라 발현이 변화하는 유전자들 및 세포주기와 관련된 유전자 중 nc886의 증가에 따라 발현이 변화하는 유전자들 중 어느 하나 이상의 유전자의 발현 수준을 측정하는 단계;를 포함하는 식도편평상피암 환자의 예후 예측을 위한 정보제공방법을 제공할 수 있다.
본 발명에서는 측정되거나 수집된 nc886의 발현, AKT의 타겟 유전자 발현의 증가 또는 감소, 기존의 TNM 단계 및/또는 세포주기와 관련된 유전자의 발현의 증가 또는 감소 수준을 점수화하여, 이를 합산하여 판단할 수 있고 각각의 발현 수준 및 단계 별로 가중치를 부여하여 보다 정확하게 식도편평상피암환자의 예후를 예측할 수 있다.
a-1) 상기 nc886의 발현 수준이 낮은 경우;
b-1) 상기 AKT의 표적 유전자 중 nc886의 발현 증가에 의해 감소하는 유전자 또는 이의 단백질의 발현 수준”이 정상 대조군 시료보다 높거나; 또는 nc886의 발현 증가에 의해 증가하는 유전자 또는 이의 단백질 수준”이 정상 대조군 시료보다 낮은 경우; 및/또는
b-2) 상기 세포주기와 관련된 유전자 중 nc886의 발현 증가에 의해 감소하는 유전자 또는 이의 단백질의 발현 수준”이 정상 대조군 시료보다 높거나; 또는 상기 세포주기와 관련된 유전자 중 nc886의 발현 증가에 의해 증가하는 유전자 또는 이의 단백질의 발현 수준”이 예정상 대조군 시료보다 낮은 경우;에 식도편평상피암 환자의 예후가 불량한 것으로 판단할 수 있다.
본 발명의 일 구체예에 있어서, 상기 b) 단계 이후, 상기 식도편평상피암을 TNM에 따라 분류되는 정보를 수집하는 단계;를 추가로 포함할 수 있다. 상기 TNM의 단계가 3 또는 4단계일 경우;에 식도편평상피암 환자의 예후가 불량한 것으로 판단할 수 있다. 상기 예후가 불량하다는 것은 무병생존률(disease-specific survival year), 재발이 없는 생존률(recurrence free survival) 또는 전체생존기간 (overall survival)이 예후가 양호한 군보다 낮다는 것을 의미할 수 있따. 상기 TNM은 식도팡피편평암의 병기를 나누는 기준으로 AJCC 7차 개정판의 기준을 참고할 수 있지만 이에 한정되는 것은 아니다. 상기 점수는 0 점 내지 4점으로 계산하며, 상기 점수가 0점이면 매우 양호, 1점이면 양호, 2점이면 보통, 3점이면 나쁨, 4점이면 매우 나쁨으로 판단할 수 있다.
본 발명은 또한 하기의 단계를 포함하는 식도편평상피암의 예후 예측에 필요한 정보를 제공하는 방법을 제공할 수 있다.
i) 식도편평상피암 환자로부터 분리된 생물학적 시료로부터 nc886의 발현 수준, AKT의 표적 유전자의 발현 수준, 세포주기와 관련된 유전자의 발현 수준 및 TNM에 따라 분류되는 정보를 수집하는 단계;
ii) a-1) 상기 nc886의 발현 수준이 정상 대조군 시료보다 높으면 0점을 주고, 정상 시료 대조군보다 낮으면 1점을 주며,
a-2) 상기 AKT의 표적 유전자 중 nc886의 발현 증가에 의해 감소하는 유전자 또는 이의 단백질의 발현 수준”이 정상 대조군 시료보다 높거나, 또는 nc886의 발현 증가에 의해 증가하는 유전자 또는 이의 단백질 수준”이 정상 대조군 시료보다 낮으면 1점을 주고; 상기 AKT의 표적 유전자 중 nc886의 발현 증가에 의해 감소하는 유전자 또는 이의 단백질의 발현 수준”이 정상 대조군 시료보다 낮거나, 또는 nc886의 발현 증가에 의해 증가하는 유전자 또는 이의 단백질 수준”이 정상 대조군 시료보다 높으면 0점을 주고,
a-3) 상기 세포주기와 관련된 유전자 중 nc886의 발현 증가에 의해 감소하는 유전자 또는 이의 단백질의 발현 수준”이 정상 대조군 시료보다 높거나, 또는 상기 세포주기와 관련된 유전자 중 nc886의 발현 증가에 의해 증가하는 유전자 또는 이의 단백질의 발현 수준”이 예정상 대조군 시료보다 낮으면 1점을 주고; 상기 세포주기와 관련된 유전자 중 nc886의 발현 증가에 의해 감소하는 유전자 또는 이의 단백질의 발현 수준”이 정상 대조군 시료보다 낮거나, 또는 상기 세포주기와 관련된 유전자 중 nc886의 발현 증가에 의해 증가하는 유전자 또는 이의 단백질의 발현 수준”이 예정상 대조군 시료보다 높으면 0점을 주고,
상기 TNM 단계가 1 또는 2단계면 0점을 주며 3 또는 4단계면 1점을 주는 단계; 및
iii) 상기 ii)단계의 점수를 계산하는 단계.
상기 점수는 통계상의 편의를 위한 점수이며, 환자의 상태 및 발현 수준에 따라, 측정되는 항목에 가중치를 부여하여, 이를 합산하여 계산할 수 있음은 명확하다. 상기 가중치는 예를 들어, AKT의 표적 유전자 중 nc886의 발현 증가에 의해 감소하는 유전자 또는 이의 단백질의 개수 (n)/1으로 나누어 각각 유전자 마다 점수를 부가하고 이의 점수를 더하여 총합을 구하여, 가중치를 부가할 수 있다.
nc886의 발현 및 침묵에 따른 세포 표현형을 조사한 결과, nc886을 발현하는 세포가 nc886를 발현하지 않은 세포보다 천천히 성장한다는 것을 확인하였다 (도 1C). 상기의 결과를 재확인하기 위해 GFP를 발현하는 세포 (293T-GFP/nc886+ 또는 293T-GFP)를 GFP를 발현하지 않는 원래의 293T 세포와 동일한 수로 혼합 한 다음, GFP+/GFP- 의 비율을 관찰하였다. 그 결과 GFP 세포는 공생 배양(co-culture)이 계속됨에 따라 고갈되었으며, 중요한 것은 상기 고갈이 293T-GFP/nc886+이 293T-GFP보다 더 심하였다 (도 1E-F). nc886+세포가 nc886-세포보다 천천히 증식한다는 것을 확인하였다.
본 연구결과에 따르면 nc886+세포의 지연된 성장은 세포의 사멸로 인한 것이 아닌, 세포 주기의 특정 단계에서의 지연으로 연장될 수 있다고 사료되어, 이를 확인해 보기 위해, 비동기적으로 (asynchronously) 성장하는 세포를 미세소관 억제제인 노코다졸(nocodazole)를 처리한 후 유동세포 계측법으로 DNA 함량을 측정하여 세포주기를 분석하였다. 노코다졸 처리시, 세포는 동기화 되었고, 6 시간 후 G2/M기 에서 방출되어 G1기로 진행되었다. 그러나 12시간 후 nc886- 세포는 S기로 더 진행된 반면에, 상기 nc886+ 세포의 경우 S기로의 진행이 지연되는 것을 확인하였다(도 2A 및 B). 상기의 데이터는 nc886이 G1에서 S 으로의 전이를 지체 시키지만, G2/M에서 G1으로의 전환에는 영향을 미치지 않는다는 것을 나타낸다. nc886+ 세포의 연장된 G1 기간은 nc886+의 세포가 nc886- 세포 보다 더 천천히 증식하는지에 대한 이유를 알려준다.
이에 본 발명자들은 nc886+의 세포가 nc886- 세포보다 더 긴 G1기를 가지는 이유를 알기 위해 유전자 발현 패턴을 조사하였다. 이를 위해 Het-1A 세포에 2,3일 동안 anti-nc886(nc886을 표적으로 하고 억제하는 올리고 뉴클레오티드)를 일시적으로 형질 감염을 수행한 후 유전자 발현을 array로 측정하였다. nc886에 비특이적인 anti-oligo (anti-control) 에서 동일한 실험을 수행하여 이를 대조군으로 사용하였다 (anti-nc886/anti-control의 값을 nc886-KD로 표기). 더불어 293T-nc886+ 및 원래 293T (nc886-인) 세포에서도 동일한 실험을 수행하였다 (nc886+/nc886-의 값을 nc886-EXP로 표기). 그 결과 Reactome 유전자 세트의 경우, nc886-EXP와 nc886-KD에서 674개의 경로에 대한 Z-점수를 얻었으며, 그것을 산점도로 그려보았을 때 유의한 음의 상관관계가 관찰되었다 (도 3A). nc886-EXP와 nc886-KD의 TFT (transcription factors target gene sets; TFT) Z 점수 또한 음의 상관관계를 보였다 (도 3B). 연구자들은 nc886에 의해 가장 영향을 받은 경로 또는 TF(transcription factors)를 보기 위해 개별 유전자를 조사하였다. Reactome 세트에서는 nc886-EXP에서 9 개의 경로가 상당히 활성화되었다 (도 3의 파란색 막대). 주목할 점은 9개의 경로중 대부분 (9개 중 8개)이 세포주기와 관련이 있고, 3개는 G1/S 단계와 직접 관련이 있다 (도 3C, 빨간색 괄호 안에 표시). 상기 nc886-EXP에서 상향 조절된 경로와 관련해서, 8개 경로 모두 nc886-KD에서 유의한 음의 Z 점수(<-3)를 나타냈다. nc886-EXP에서 20개 이상의 TFT-Z 스코어 세트를 선택했을 때, 가장 주목할 만한 것들은 절반 이상 (20개 중 12 개)을 차지하는 E2F 관련 TF 이었다 (도 3D).
Reactome 세트의 G1 단계 하위 집합에서 40개의 유전자를 검색하여 6,563 개의 유전자로 교차시켰고, nc886-KD와 nc886-EXP 모두에서 유의한 변화가 있는 19개의 유전자(nc886/G1 관련 유전자, 도 4A)를 얻었다. 상기 유전자들은 nc886 qRT-PCR 값과 mRNA 배열 데이터가 이용 가능한 108 명의 ESCC 환자 집단에서 분석되었다. 세포 데이터에서 얻은 nc886/G1 관련 유전자의 대다수(19개 중 14개)가 환자 데이터에서도 nc886과 유의한 연관이 있음을 발견하였다 (도 4B). 그 중 본 연구자들은 CDKN2A 및 CDKN2C를 선택하였다. ESCC 환자 108 명에서 발현 수준을 조사한 결과, CDKN2A와 CDKN2C는 nc886과 같은 방향으로 변화하는 양상을 보였다 (도 4C). SKP2 및 CUL1은 CDK 억제제를 분해하여 G1-S 전이를 촉진시키는 것으로 알려져 있기 때문에 SKP2 및 CUL1을 조사 하였다. 이 두 유전자의 발현은 환자 및 세포주 데이터에서 nc886과 음의 상관관계가 있었다 (도 4B-D). 상기의 데이터를 종합적으로 판단하였을 때, nc886은 세포주기 유전자를 조절하여 G1-S 전이를 지연시킨다.
nc886이 PKR과 Dicer를 억제하는 것으로 나타났으므로 nc886-EXP에서 지연된 G1이 두 단백질에 의해 설명 될 수 있는지 여부를 조사하였다. PKR은 세포 증식에 관여하는 단백질이며 그 대표적인 하류 현상은 NF-κB의 활성화다. 따라서 MSigDB TFT 세트에서 NF-κB를 검사하였다. PKR은 활성화되면 세포 사멸을 유도하므로 자연 증식하는 세포에서 잠복 상태를 유지해야한다. 이 상황에서는 (nc886-EXP에서는) nc886을 발현시켜주어도 PKR에 대한 nc886의 부가적인 억제 역할은 거의 관찰되지 않았다. 따라서 PKR은 nc886-KD에 의해 활성화되지만, nc886-EXP의 세포주기 표현형을 설명 할 수 없었다. 또한 miRNA biogenesis의 주요 효소인 Dicer를 연구하여 miRNA 표적 유전자 모음 인 MSigDB MIR 세트를 조사하였다. nc886-EXP에서 miRNA 경로에 대한 nc886의 억제 효과를 볼 수 없었다.
nc886의 또 다른 단백질 표적을 확인하려고 시도했다. 상기의 과제를 해결하기 위해, RPPA라는 고효율 플랫폼을 사용하여 프로테옴 레퍼토리를 측정하였다. 172 개의 단백질의 발현 값을 얻었고 23 개가 통계적으로 유의미한 수준에서 변화한다는 것을 발견하였다 (도 5A). 상기 23 개의 단백질을 조사했을 때, AKT 경로에서 단백질 활성의 변화가 있음을 확인하였다. hr308 및 Ser473에서의 AKT1의 인산화는 증가하였고, 총 AKT1은 상대적으로 변하지 않았다 (도 5A). nc886-KD는 AKT1의 기질 1 (AKT1S1, a.k.a., PRAS40) 및 Ribosomal Protein S6 (RPS6)의 인산화를 증가 시켰다. AKT1S1은 AKT에 의해 직접 인산화 된다. RPPA 데이터를 검증하기 위해, 세포 표현형 (G1에서의 지연으로 인한 느린 세포 증식)을 관찰한 nc886-EXP에서 AKT 인산화를 측정하였다. 웨스턴 블랏 결과는 노코다졸 정지로부터 방출된 후 6시간 및 12시간대에 AKT1은 293T-U6:nc886에서 293T-U6보다 Ser473에서 덜 인산화 되었음을 보여 주었다 (도 5B). 총체적으로, 상기 데이터는 nc886에 의한 AKT의 억압을 증명하였다. AKT 활성화는 유전자 발현의 변화로 이어진다. 따라서 nc886이 AKT에 미치는 영향은 유전자 발현 데이터에서 더 평가되었다. ESCC 환자 108 명에 대한 배열 데이터에 적용하기 위해 184 개의 유전자 중 nc886-KD에서 34 개의 증가된 유전자와 19 개의 감소 된 유전자를 선택하였다 (표 2 및 표 3). GSEA 플롯에서, 34 및 19 유전자는 통계적으로 유의 수준에서 nc886과 부정적으로 양의 상관관계를 보였다 (도 5C). nc886-KD 데이터와 환자 데이터 사이의 nc886/AKT 관련 유전자의 일치는 nc886이 생체 내 종양 형성 과정에서도 AKT 경로를 억제함을 시사한다.
nc886, AKT 및 세포주기 유전자 간의 연관성은 ESCC 환자의 생존 예측 인자이다. AKT 경로와 세포주기 진행을 억제하는 nc886의 역할을 밝혀내고 nc886 관련 유전자 특성을 확인하였다 (34 및 19 nc886/AKT-관련 유전자 (도 5); 9 및 5 nc886/G1 관련 유전자 (도 4B)). 108 명의 ESCC 환자에서 이들 유전자의 예후 유용성을 시험하였다. AKT signature score는 nc886-KD에서 상향 조절된 34 유전자와 하향 조절된 19개 유전자 사이의 기하 평균의 차이에 의해 생성되었다. 세포 주기 signature score는 nc886과 각각 음의 상관관계가 있는 9 개의 유전자와 5 개의 유전자로부터 유사하게 계산되었다. 이 점수를 갖는 코호트는 각 중간 값에 따라 2 분화되었다.
C-통계에 따르면 4 가지 요소 (nc886의 발현량, AKT signature score, 세포주기 signature score 및 TNM 병기)의 조합이 병의 재발 및 환자의 생존을 예측할 수 있는 가장 강력한 조합이였다 (도 6A). TNM 병기 [병기 I 및 II=0; 병기 III 및 IV=1], nc886 발현정도 [중간 값으로 높음=0; 낮음=1], AKT signature score [중간 값으로 낮음=0; 높음=1], 세포주기 점수 [중간 값으로 낮은=0; 높은=1 ]을 연속적으로 합산하여 예후 점수를 계산하였다. 예후 점수에 의한 5 개의 소그룹으로의 층화는 108 명의 ESCC 환자 집단에서 별개의 DSS, RFS 및 OS 곡선을 보였다 (도 6B). 가지 곡선 모두에서, 더 높은 예후 점수는 생존 기간이 짧을수록 비례한다. 점수가 4(TNM 병기 III 및 IV, 낮은 nc886, 높은 AKT signature score 및 높은 세포주기 점수)를 가진 환자는 최악의 생존율을 보였으나 점수가 0 인 사람은 가장 좋은 생존률을 보였다. AKT 다운 스트림 유전자 및 세포주기 유전자는 nc886 및 TNM 병기와 결합 될 때 환자의 생존을 더 잘 예측하는 것을 확인하였다.
상기 AKT의 표적 유전자 중 nc886에 의해 감소하는 유전자는 ACLY, BTK,CD14, CDC42, CDKN1A, CDKN1B, DPYSL2, DPYSL3, EIF4E, FOS, FOXO1, FOXO3, FOXO4, GJA1, GRB10, GRB2, HSPB1, JUN, MAP3K5, MAPT, MYC, NFKBIA, PABPC1, PAK1, PALLD, PIK3R1, PPP2R1B, PRKAA1, PRKCA, PRKCZ, SHC1, SREBF1, SRF 및 YWHAH으로 이루어진 군으로 부터 선택되는 어느 하나의 유전자이고, nc886에 의해 증가하는 유전자는 ATG4B, BCL2L11, CSNK2A1, CTPS, EIF2AK2, FKBP1A, GADD45A, HRAS, MAPK1, MAPKAP1, MTCP1, PCK2, PPP2CB, PPP2R2A, PRKAA2, PTEN, THEM4, YWHAE 및 YWHAG으로 이루어진 군으로부터 선택되는 어느 하나의 유전자일 수 있다.
상기 세포주기와 관련된 유전자 중 nc886의 발현 증가에 의해 증가하는 유전자는 CDKN2A, RBL1, PPP2R1B, CDKN1A 또는 CDKN2C이고, nc886의 발현 증가에 의해 감소하는 유전자는 SKP2, CDKN1B, PPP2CB, UBA52, CDK4, RPS27A, SKP2, PPP2CA, PPP2R2A 또는 CUL1일 수 있다.
상기 시료는 식도편평상피암 환자의 암세포를 포함하는 조직의 포르말린 고정 파라핀 포매(formalin-fixed paraffin-embedded, FFPE) 시료, 신선한 조직(fresh tissue) 및 동결 조직으로 이루어진 군으로부터 선택된 1종 이상일 수 있다.
상기 유전자의 수준은 중합효소반응(PCR), 역전사 중합효소반응(RT-PCR), 경쟁적 역전사 중합효소반응(Competitive RT-PCR), 실시간 역전사 중합효소반응(Realtime RT-PCR), RNase 보호 분석법(RPA; RNase protection assay), 노던 블랏팅(Northern blotting), 차세대 염기서열분석(next-generation sequencing, NGS) 및 DNA 마이크로어레이 분석법으로 이루어진 군으로부터 선택된 1종 이상의 방법에 의해 측정될 수 있다.
상기 단백질의 발현 수준은 웨스턴 블랏, ELISA (enzyme linked immunosorbent asay), 면역염색법 (immunostaining), 방사선면역분석(Radioimmunoassay; RIA), 방사면역확산법(radioimmunodiffusion), 오우크테로니(Ouchterlony) 면역 확산법, 로케이트(rocket) 면역전기영동, 조직면역염색, 면역침전 분석법(Immunoprecipitation assay), 보체고정분석법(Complement Fixation Assay), FACS 및 단백질 칩으로 이루어진 군으로부터 선택된 1종 이상의 방법에 의해 측정될 수 있다.
본 발명의 용어 "예후"는 의학적 귀추(예컨대, 장기 생존 가능성, 무병생존율 등)에 대한 예상을 의미하여, 양성적 예후(긍정적 예후) 또는 음성적 예후(부정적 예후)를 포함하며, 상기 음성적 예후는 재발, 종양 성장, 전이, 약물저항성 등의 병의 진행 또는 치명성(mortality)을 포함하고, 양성적 예후는 질병이 없는 상태 등의 질병의 차도, 종양 퇴행 등의 질병의 개선 또는 안정화(stabilization)를 포함한다. 특히, 본 발명에서 식도편평상피암에서 예후가 불량하다는 것은 무병생존률(disease-specific survival year), 재발이 없는 생존률(recurrence free survival) 또는 전체생존기간 (overall survival)이 낮다는 것을 의미 한다(본 발명 도 6B).
본 발명의 용어 "예측"은 의학적 귀추에 대하여 미리 헤아려 짐작하는 것을 의미하며, 본 발명의 목적상 식도편평상피암으로 진단받은 환자의 병의 경과(무병생존률, 재발이 없는 생존률 또는 전체 생존기간)를 미리 짐작하는 것을 의미한다.
본 발명은 또한 nc886; 및 ACLY, BTK,CD14, CDC42, CDKN1A, CDKN1B, DPYSL2, DPYSL3, EIF4E, FOS, FOXO1, FOXO3, FOXO4, GJA1, GRB10, GRB2, HSPB1, JUN, MAP3K5, MAPT, MYC, NFKBIA, PABPC1, PAK1, PALLD, PIK3R1, PPP2R1B, PRKAA1, PRKCA, PRKCZ, SHC1, SREBF1, SRF, YWHAH, ATG4B, BCL2L11, CSNK2A1, CTPS, EIF2AK2, FKBP1A, GADD45A, HRAS, MAPK1, MAPKAP1, MTCP1, PCK2, PPP2CB, PPP2R2A, PRKAA2, PTEN, THEM4, YWHAE, YWHAG, CDKN2A, CDKN2C, SKP2, UBA52, CDK4, RPS27A, PPP2CA, RBL1 및/또는 CUL1 유전자, 또는 상기 유전자로 엔코딩된 단백질을 검출할 수 있는 제제를 포함하는 식도편평상피암 예후 예측용 조성물을 제공할 수 있다.
본 발명은 또한 nc886; 및 ACLY, BTK,CD14, CDC42, CDKN1A, CDKN1B, DPYSL2, DPYSL3, EIF4E, FOS, FOXO1, FOXO3, FOXO4, GJA1, GRB10, GRB2, HSPB1, JUN, MAP3K5, MAPT, MYC, NFKBIA, PABPC1, PAK1, PALLD, PIK3R1, PPP2R1B, PRKAA1, PRKCA, PRKCZ, SHC1, SREBF1, SRF, YWHAH, ATG4B, BCL2L11, CSNK2A1, CTPS, EIF2AK2, FKBP1A, GADD45A, HRAS, MAPK1, MAPKAP1, MTCP1, PCK2, PPP2CB, PPP2R2A, PRKAA2, PTEN, THEM4, YWHAE, YWHAG, CDKN2A, CDKN2C, SKP2, UBA52, CDK4, RPS27A, PPP2CA, RBL1 및/또는 CUL1 유전자, 또는 상기 유전자로 엔코딩된 단백질을 검출할 수 있는 제제를 포함하는 식도편평상피암 예후 예측용 키트를 제공할 수 있다.
상기 검출할 수 있는 제제는 상기 유전자의 핵산서열, 이의 상보적인 핵산서열, 상기 핵산서열들의 단편, 또는 상기 핵산서열에 의해 코딩되는 단백질을 특이적으로 인식하는 항체, 항체 단편, 앱타머(aptamer), 아비머(avidity multimer) 및/또는 펩티도모방체(peptidomimetics)를 포함하는 것일 수 있다.
본 발명은 또한 nc886, AKT, CDK4, CDKN2A 및 CKN2C 유전자의 mRNA 또는 이의 단백질 수준을 측정하는 제제를 포함하는 식도편평상피암에서 항암제 팔보시클립에 대한 저항성 또는 민감성 예측용 바이오 마커 조성물을 제공할 수 있다.
본 발명자들은“1" 및 "Cluster 2"의 두 개 클러스터를 식별하기 위해 해당 유전자를 가진 108명의 환자에 대해 감독되지 않은 클러스터링을 수행하였다. "Cluster 2"에는 CDK4를 포함한 대부분의 유전자의 발현이 증가되었음과 (도 7A) nc886(도 7B)의 낮은 발현을 확인하였다.
팔보시클립은 FDA 승인된 CDK4/6 억제제이다. CDK4와 관련된 nc886 발현이 팔보시클립에 대한 ESCC 세포의 반응을 예측할 수 있는지를 조사하였다. 100여 종의 화합물에 대한 1,000 개의 암 세포주 민감도에 대한 정보를 제공하는 가장 큰 공공 자원인 암 데이터베이스의 약물 민감도 유전체학 (www.cancerRxgene.org)에서 팔보시클립에 대한 민감성을 조사하였다. nc886이 침묵된 ESCC 세포주 TT (도 7C)가 팔보시클립에 갖는 민감한 약물임을 암시하는 가장 낮은 IC50 값을 가지는 것을 확인하였다 (도 7D). 팔보시클립 처리에 대한 세포자살 분석은 TT 세포가 nc886 발현 식도 세포주보다 더 높은 세포 자살 비율을 가지는 것을 확인하였다 (도 7E). 상기 결과를 통해 nc886 및 이와 관련된 유전자를 확인하면, 식도편평상피암 환자에서 팔보시클립에 대한 치료의 예후 예측을 할 수 있는 것으로 확인 되었다.
본 발명은 또한 상기 서술한 조성물의 조성물을 포함하는 식도편평상피암에서 항암제 팔보시클립에 대한 저항성 또는 민감성 예측용 키트를 제공할 수 있다.
본 발명은 또한 하기의 단계를 포함하는 식도편평상피암에서 항암제 팔보시클립에 대한 저항성 또는 민감성 예측을 위한 정보제공방법을 제공할 수 있다.
a) 생물학적 시료에서 nc886, AKT, CDK4, CDKN2A 및 CKN2C 유전자의 mRNA 또는 이의 단백질 수준을 측정하는 단계; 및
(b) 상기 nc886, CDKN2A 및 CKN2C 유전자의 mRNA 또는 이의 단백질 수준이 대조군에 비해 낮고, AKT 및 CDK4 유전자의 mRNA 또는 이의 단백질 수준이 대조군에 비해 높은 경우에 식도편평상피암에서 항암제 팔보시클립에 대한 민감성이 있는 것으로 판단하고, nc886, CDKN2A 및 CKN2C 유전자의 mRNA 또는 이의 단백질 수준이 대조군에 비해 높고, AKT 및 CDK4 유전자의 mRNA 또는 이의 단백질 수준이 대조군에 비해 낮은 경우에 식도편평상피암에서 항암제 팔보시클립에 대한 저항성이 있는 것으로 판단하는 단계.
본 발명에 있어서 생물학적 시료는 식도편평상피암 환자의 암세포를 포함하는 조직의 포르말린 고정 파라핀 포매(formalin-fixed paraffin-embedded, FFPE) 시료, 신선한 조직(fresh tissue) 및 동결 조직으로 이루어진 군으로부터 선택된 1종 이상일 수 있다. 상기 신선한 조직는 조직, 전혈, 혈청 또는 혈장일 수 있다. 상기 (a) 단계의 mRNA 수준은 중합효소반응(PCR), 역전사 중합효소반응(RT-PCR), 경쟁적 역전사 중합효소반응(Competitive RT-PCR), 실시간 역전사 중합효소반응(Realtime RT-PCR), RNase 보호 분석법(RPA; RNase protection assay), 노던 블랏팅(Northern blotting), 차세대 염기서열분석(next-generation sequencing, NGS) 및 DNA 마이크로어레이 분석법으로 이루어진 군으로부터 선택된 1종 이상의 방법에 의해 측정될 수 있다. 상기 (a) 단계의 단백질 수준은 웨스턴 블랏팅(western blotting), ELISA(enzyme linked immunosorbent assay), 방사선면역분석법(Radioimmunoassay), 방사면역 확산법(Radioimmunodiffusion), 오우크테로니(Ouchterlony) 면역 확산법, 로케트(Rocket) 면역전기영동, 조직면역염색법, 면역 침전분석법(immunoprecipitation assay), 보체 고정 분석법(complete fixation assay), 유세포분석법(Fluorescence Activated Cell Sorter, FACS) 및 단백질 칩(protein chip) 분석법으로 이루어진 군으로부터 선택된 1종 이상의 방법에 의해 측정될 수 있다.
이하, 본 발명의 이해를 돕기 위하여 실시예를 들어 상세하게 설명하기로 한다. 다만 하기의 실시예는 본 발명의 내용을 예시하는 것일 뿐 본 발명의 범위가 하기 실시예에 한정되는 것은 아니다. 본 발명의 실시예는 당업계에서 평균적인 지식을 가진 자에게 본 발명을 보다 완전하게 설명하기 위해 제공되는 것이다.
실시예 1. 재료
HEK-293T 세포 (American Type Culture Collection)를 10% 소 태아 혈청 및 1% Antibiotic-Antimycotic을 포함하는 DMEM 배지을 이용하여 5% CO2 및 37℃에서 배양하였다. pLPCX 벡터에서 U6 프로모터를 삽입하여 플라스미드 "pLPCX-U6"을 만들고, 녹색 형광 단백질 (GFP) 유전자를 pCAGGS 벡터에 서브 클로닝하여 "pCAGGS-GFP"를 만들었다. nc886 발현 플라스미드("pLPCX-U6-pre-886" 및 "pCAGGS-GFP/nc886")를 상기 벡터 ("pLPCX-U6" 및 "pCAGGS-GFP")에 삽입하였다 (도 1A에 모사된 바와 같이 길이가 101nt-649nt). 표준 플라스미드 프로토콜에 의해 분리된 클론을 Lipofectamine™ 2000 시약으로 HEK-293T 세포에 형질 전환하고, nc886+ 또는 nc886- 세포 라인을 확립하였다. 인산화-AKT (Ser 473), AKT 및 GAPDH에 대한 항체는 Cell Signaling Technology (Beverly, MA)에서 구입하였다.
실시예 2. 세포 증식, 세포 동기화 와 세포 주기 분석 측정
세포 수는 현미경 또는 유동 세포계측법(FACSC™ II, BD Biosciences)을 이용하여 혈구 계수기에서 직접 계수하였다. G2/M 단계에서의 세포 동기화를 위해, 18 시간 동안 100 ng/ml 노코다졸 (nocodazole ; Sigma-Aldrich)를 처리하였다. 18 시간 후 노코다졸이 없는 배지로 교체 하였다. 그 후에 세포를 0, 6 및 12 시간에 수집하여 DNA 함량을 측정 하였다. 세포를 70% 에탄올로 고정시키고 DNA를 propidium iodide로 염색하고 DNA 함량을 FACSC™ II를 사용하여 분석 하였다. FACS 데이터는 FACS Diva 7 소프트웨어 (BD bioscience; San Jose, CA)을 이용하여 분석하였다.
실시예 3. RNA 분리 및 측정
293T 유래 nc886+ 또는 대조군 세포의 총 RNA를 Trizol 시약 (Life Technologies)를 사용하여 제조사의 지시에 따라 분리하였다. DNA는 amfiRivert kit (GenDEPOT)로 합성 하였다. nc886을 AccuPower Taq PCR PreMix (BIONEER)에 의해 증폭시키고, PCR 산물을 아가로오스 겔상에서 시각화 하였다. AccuPower GreenStar ™ qPCR MasterMix (BIONEER) 및 ExicyclerTM 96 Real-Time Quantitative Thermal Block (BIONEER)을 사용한 qRT-PCR로 CDKN2A, CDKN2C, CUL1 및 SKP2에 대한 mRNA를 정량화하였다. 이에 사용한 프라이머는 하기 표 1과 같다.
| 유전자 | 방향 | 염기서열 |
| GAPDH | Forward | "ggccaaggtcatccatgacaactt" |
| Backward | "tagaggcagggatgatgttctgga" | |
| nc886 | Forward | "cgggtcggagttagctcaagcgg" |
| Backward | "aagggtcagtaagcacccgcg" | |
| CDKN2A | Forward | "ggcagtaaccatgcccgcatagat" |
| Backward | "catgcctgcttctacaaacccaca" | |
| CDKN2C | Forward | "aatggatttggaaggactgcgctg" |
| Backward | "aaagtgtccaggaaacctgctctg" | |
| CUL1 | Forward | "actcagctgtcctccaggttcaaa" |
| Backward | "tgtccttttcaccatccactcgct" | |
| SKP2 | Forward | "cctatcactcagtcggtgctatga" |
| Backward | "aacagttgaagggtaccatctggc" |
실시예 4. ESCC 환자
(1) 조직학적으로 흉부에 국한된 ESCC로 확진되었거나, (2) 적절한 림프절 절제와 함께 완전 식도 절제술을 받았고 수술 전 화학 요법이나 방사선 요법을 받지 않았고, (3) 종양 은행에서 쌍을 이루는 종양과 인접한 정상 조직을 이용할 수 있었고 (4) 완전하게 추적 관찰되었다. 다음과 같은 환자를 제외시켰다; (1) 재발의 확인을 제외한 모든 기간에 수술 전 화학 요법 및/또는 방사선 요법을 받았고, (2) 이전의 암 진단이 있었고, (3) 이중 원발성 동시 암, (4) 자궁 경부 식도암이 있거나 (5) 완전히 모니터링 도지 않았다. 정기적인 추적 관찰은 4 월과 10 월에 전화 또는 우편으로 연 2회 실시되었다. 퇴원 후 첫 번째 추적 관찰 중에 흉부 전산화 단층 촬영 (CT) 검사가 일상적으로 수행되었다. 또한 모든 환자는 첫 2년간 3 개월마다 정기적인 혈액 검사, 흉부 엑스레이 검사, 가슴 CT 검사 등 정기적인 평가를 받았다. 이후 모든 환자를 매년 모니터링 하였다. 양전자 방출 단층 촬영-CT (Positron Emission Tomography-CT; PET-CT) 및 식도 이영증낭 검사는 임상 병력 및 임상 검사 소견에 따라 필요하다면 매년 또는 더 자주 수행 되었다. 모든 인체 표본은 정보에 입각한 환자의 동의하에 수집되었으며 연구 프로토콜은 기관 윤리위원회의 승인을 받았다. 냉동 조직을 얻은 후 mirVanaTM miRNA Isolation Kit (Ambion, Inc., Austin, TX)를 사용하여 제조사의 지시에 따라 총 RNA를 추출하였다.
실시예 5. mRNA 발현 프로파일링 (mRNA array)
293T-U6 및 293T-U6:nc886 세포의 총 RNA를 Affymetrix Human Genome U133 Array (Affymetrix, Santa Clara, CA)에 처리하였다. Het-1A 세포와 ESCC 환자의 nc886 KD에 대해, 마이크로 어레이 실험은 HumanHT-12 v4 Expression Beadchip Kit (Illumina, San Diego, CA)로 수행되었다. 제조사의 프로토콜에 따라 총 RNA 750ng을 Total Prep RNA Amplification Kit (Illumina)로 표지하고 하이브리드화 하였다. Bead chips를 Bead Array Reader (Illumina)로 스캔한 후, micro-array 데이터를 quantile normalization을 통해 정규화 하였고, 정규화 된 값을 R-script로 base 2 scale로 대수적으로 변환하였다. 마이크로 어레이 데이터는 국립 생명 공학 정보 센터 (National Center for Biotechnology Information)의 Gene Expression Omnibus 데이터베이스 (ESCC 샘플 용 GSE55856 및 Het-1A 용 GSE51732)에 저장되어 있다.
실시예 6. 역상 단백질 배열 (Reverse phase protein arrays; RPPA)
RPPA 데이터는 MD Anderson Cancer Center의 시스템 생물학과에서 수행되었다. RPPA 용해 완충액 (1 % 트리톤 X-100, 50mM HEPES (pH 7.4), 150mM NaCl, 1.5mM MgCl2, 1mM EGTA, 100mM NaF, 10mM Na 피로포스페이트, 1mM Na3VO4, 10% glycerol, 1mM phenylmethylsulfonyl fluoride 및 10μg/ml aprotinin)을 사용하였다. 세포 용해액은 처음에 1 μg/μl로 조정하고 용해 완충액에서 5 배 희석하여 연속적으로 니트로셀룰로오스 코팅 슬라이드 (Grace Bio-Labs, Bend, OR)에 인쇄하였다. 슬라이드는 172 개의 유효 항원 항체와 이에 상응하는 2 차 항체 (염소 항 -토끼 IgG, 염소 항-마우스 IgG 또는 토끼 항-염소 IgG)로 조사하였다. 시그널은 디아 미노 벤지딘 비색계 반응을 사용하여 검출되었고, 적합 곡선 (supercurve) 접근법을 사용하여 표준화 되었다.
실시예 7. 약물 처리 시 세포 자살 어세이 (apoptosis assay)
팔보시클립 (PD0332991) HCl (catalog no. S116)은 Selleckchem에서 구입하였다. 각 암세포주로부터의 106 개의 세포를 6-웰 플레이트에 플레이팅하고 밤새 배양하였다. 세포를 5μM의 팔보시 클립으로 처리한 후 24시간 동안 배양하였다. nnexin V-FITC 및 7-AAD (BioLegend. 카탈로그 번호 640922)를 사용하여 유세포 분석법으로 세포 자살 분석을 수행하였다.
실시예 8. 통계 분석
세포 카운팅 및 qRT-PCR과 같은 일상적인 생물학적 검정의 경우, 실험을 평균값과 표준 오차를 계산 한 세 쌍으로 수행하였다. Student's T-test (one-tailed)를 사용하여 p value를 계산하였다. Enrichment p-values은 Fisher 's exact test에 의해 계산되었다. 사전 정의 된 유전자 세트가 nc886 발현에 따라 통계적 일치를 나타내는지를 결정하기 위해 유전자 세트 농축 분석 (GSEA : http://software.broadinstitute.org/gsea/index.jsp)을 수행하였다. nc886 발현과 마이크로 어레이 데이터 사이의 상관관계를 피어슨 상관 계수로 분석하였다. 생존 곡선은 Kaplan-Meier 's 방법으로 생성하였고, 그룹 간 비교는 log-rank test로 수행 하였다. 질병 특이적 생존률 (Disease specific surviva; DSS)은 식도암과 관련된 수술에서 사망까지의 시간으로 정의되며, 무재발 생존률 (recurrence-free survival; RFS)은 수술에서부터 확진된 첫 번째 재발까지의 시간 및 사망에 이르는 시간으로 정의하였으며, 전체 생존률 (overall survival; OS)은 수술에서 사망까지의 시간으로 정의하였다. Univariable Cox regression analysis는 변수가 생존과 관련이 있는지를 결정하는데 사용되었다. c886 발현, 유전자 표지 및 TNM (tumor-node-metastasis) 병기를 변수로 사용 하였다. R 언어 및 소프트웨어 환경 (http://www.r-project.org)의 C 통계는 변수와 생존 간의 일치 색인을 계산하는 데 사용되었다. p <0.05 일 때 통계적 유의성이 있다고 판단하였고, 모든 검사는 two-tailed로 진행하였다. 모든 통계 분석은 SPSS 24.0 (IBM Corp. 2016 년 출시, IBM SPSS Statistics for Windows 버전 24.0, Armonk, NY)으로 수행되었다.
실시예 9. nc886은 세포 증식을 억제한다
이전 연구에서 nc886은 ESCC 환자 데이터에서 종양 억제 인자였다. nc886을 발현하는 비악성 식도세포주인 Het-1A에서 nc886 knockdown (KD)을 수행하여 nc886 knockdown이 된 Het-1A를 얻었다. nc886 Het-1A가 좀 더 종양화 됨을 (예: 증가된 세포 성장)을 기대하였다. 상기의 예상과 같이, nc886 knockdown-Het-1A은 여러 종양 유전자를 발현하였다. 하지만 동시에 nc886 KD은 PKR의 활성화와 이로 인한 세포 자멸사(apoptosis)를 초래하며, 이 결과는 nc886이 pro-apoptotic protein (전세포사멸 단백질)인 PKR의 저해제로 작용했다는 이전 연구와 일치하였다. PKR 매개 세포 자멸사는 Het-1A 세포에서 nc886-KD의 다른 효과 (종양 촉진 유전자 발현)를 모두 뛰어 넘으므로, 세포의 표현형을 관찰하고자 하는 모든 추가 실험을 불가능하게 만든다. 따라서 nc886을 결핍시킬 때, 세포의 표현형을 관찰하는 것은 쉽지 않다고 판단하여, nc886을 발현시켜주었을 때 (gain-of function) 세포를 관찰하는 접근 방법으로 전환하였다. nc886은 ESCC 세포(nc886- cells)에서 후성 유전적(epigenetally)으로 침묵하고 있으며, 몇몇 ESCC 세포주들로부터 nc886을 발현시켜 nc886 발현을 제외하면 원래 세포주와 유전적 배경이 같은 ESCC 세포주를 만들려고 시도하였다. 그럼에도 불구하고 nc886 클론을 분리 할 수 없었다. 이들 ESCC 세포가 nc886-인 상태이어야 세포증식이 가능할 것이라고, 따라서 인위적으로 nc886+ ESCC을 만들었을 때 증식하지 않았을 것이라고 추정하였다. 따라서 SV40 T 항원으로 형질 전환 된 인간 배아 신장 세포주인 HEK-293T(이후"293T"으로 기재)를 사용하였다. 293T의 사용은 대체 수단으로 선택되었지만, nc886이 유전자 발현에 미치는 영향이 293T와 Het-1A 세포 사이에서 유사하기 때문에 합리적인 대안이다. 두 가지 버전의 nc886 293T 세포주와 이에 상응하는 벡터 제어주(각각의 명명법에 대해 도 1A 참조)를 만들고, RT-PCR을 측정하여 nc886 발현을 확인 하였다 (도 1B). 이 세포를 배양하는 동안 293T-U6:nc886 및 293T-GFP/nc886 세포가 각각 293T-U6 및 293T-GFP 세포보다 천천히 성장한다는 것을 확인하였다. 세포의 증식능력의 증가는 종양화에서 중요한 현상이기 때문에 이후의 연구에서는 세포의 증식능력에 초점을 맞추었다. 같은 세포 수가 처음으로 배양 되고 4일 뒤, 293T-U6 세포의 수는 293T-U6:nc886 세포보다 1.5 배 이상 많았다 (도 1C). 또한 293T-GFP/nc886 세포에서 GFP 발현을 이용하여 세포 혼합 실험을 수행하였다. GFP를 발현하는 세포(GFP+)인 293T-GFP/nc886 또는 293T-GFP세포를 GFP를 발현하지 않는 원래의 293T 세포(GFP-)와 동일한 수로 혼합한 뒤, GFP+/GFP-의 비율을 모니터링하여 추적하였다 (도 1D). GFP 세포는 공생 배양(co-culture)이 계속됨에 따라 고갈되었으며, 중요한 것은 상기 고갈이 293T-GFP/nc886이 293T-GFP보다 더 심하였다 (도 1E-F). 상기의 데이터를 종합적으로 판단하였을 때 nc886의 세포가 천천히 증식한다는 것을 확인하였다.
실시예 10. nc886+ 세포는 nc886- 세포 보다 G1 지속 시간이 길다
nc886+ 세포는 nc886- 세포 보다 G1 지속 시간이 길다. nc886+ 세포의 지연된 성장이 세포주기의 특정 단계에서의 지연으로 인한 것이라고 가설을 세웠다. 상기의 가설을 확인하기 위해, 비동기적으로 (asynchronously) 성장하는 세포를 미세소관 억제제인 노코다졸(nocodazole)를 처리한 후 유동세포 계측법을 사용하여 세포주기를 프로파일 하였다 (도 2A). 노코다졸 처리 시, 세포는 2n의 DNA 함량에서 단일 피크에 의해 확인된 바와 같이 G2/M 단계에서 동기화되었다. 노코다졸 제거 6 시간 후, 1n 위치에서 다른 피크가 나타났으며, 상기의 결과는 세포가 G2/M에서 방출되어 G1기로 들어갔다는 것을 나타낸다. nc886+ 및 nc886- 세포는 이 시점에서 거의 동일한 패턴을 나타냈다. 그러나 12 시간 후, nc886- 세포는 S 으로 (S phage) 더 진행된 반면에, 상기 S 상으로의 진행은 nc886+ 세포의 경우 지연되는 것을 확인하였다 (도 2A 및 B). 상기의 데이터는 nc886이 G1에서 S 으로의 전이를 전향 시키지만, G2/M에서 G1으로의 전환에는 영향을 미치지 않는다는 것을 나타낸다. nc886+ 세포의 연장된 G1 기간은 nc886+의 세포가 nc886- 세포 보다 더 천천히 증식하는지를 알려준다.
실시예 11. nc886은 세포주기 유전자를 조절한다
nc886은 유전자 조절 기능을 가지고 있기 때문에, nc886+의 세포가 nc886- 세포보다 더 긴 G1기를 가지는 이유를 알기 위해 유전자 발현 패턴을 조사하였다. 도 1 및 2에 사용된 한 쌍의 세포주에서 마이크로 어레이를 수행하였다 (293T-U6에 비한 "nc886-EXP", 293T-U6:nc886 상대 값). nc886-EXP에서 변경된 유전자의 상당 부분이 이차적인 결과일 것이다. 왜냐하면 이들 세포가 마이크로 어레이 실험까지 수 개월 동안 유지되었기 때문이다. 그러므로 nc886-EXP 데이터를 nc886 KD 데이터로 보완하였다 (대조군에 비해 “anti-nc886 값). "nc886-KD는 Het-1A 세포에 2,3일 동안 anti-nc886(nc886을 표적으로 하고 억제하는 올리고 뉴클레오티드)를 일시적으로 형질 감염하여 제작하였다. 따라서 nc886-KD 데이터는 nc886-EXP보다 nc886의 직접적인 결과를 더 잘 나타낸다. 어레이 데이터로 Molecular Signature Database (MSigDB : http://software.broadinstitute.org/gsea/msigdb)에 대한 배열 데이터를 분석하였다. MSigDB에는 서열 모티프, 경로 등을 기반으로 하는 여러 유전자 모음이 있다. 예를 들어, TFT는 전사인자 (transcription factors; TF)에 대한 표적 유전자의 모음이다. 615 개의 TFT 세트가 있으며 각 세트에는 프로모터 영역에서 해당 TF에 대한 결합 사이트가 있는 수십에서 수백 개의 유전자가 들어 있다. 또 다른 예는 Reactome 경로 데이터베이스에 의해 정의된 674 개의 유전자 (674 Reactome sets) 세트이다. 상기 세트의 전체적인 농축(enrichment) 또는 고갈 (depletion)은 세트의 유전자의 어레이 값으로부터 계산되면 양성 또는 음성 z-score로 표현하였다. Reactome 유전자 세트의 경우, nc886-EXP와 nc886-KD에서 674 Z- 점수를 얻었으며, 산점도와 비교하여 유의한 음의 상관관계가 관찰되다 (도 3A). nc886-EXP와 nc886-KD의 TFT Z 점수 또한 음의 상관관계를 보였다 (도 3B). 상기의 결과는 nc886이 293T 세포의 유전자 발현 및 세포 경로에 식도 세포주 Het-1A의 세포 경로와 유사하게 영향을 미침을 시사하며, 293T가 ESCC에서 nc886의 종양 억제 인자 역할을 조사하는데 적합하다는 것을 시사한다. nc886에 의해 가장 영향을 받은 경로 또는 TF를 보기위해 개별 유전자를 조사하였다. Reactome 세트에서는 nc886-EXP에서 9 개의 경로(Z-score 점수가 cut off >3임)가 상당히 활성화되었다 (도 3의 파란색 막대). 주목할 점은 9개의 경로중 대부분(9개 중 8개)이 세포주기와 어떻게든 관련이 있고, 3개는 G1/S 단계와 직접 관련이 있다 (도 3C, 빨간색 괄호 안에 표시). 상기 nc886-EXP에서 상향 조절된 경로와 관련해서, 8개 경로 모두 nc886-KD에서 유의한 음의 Z 점수(<-3)를 나타냈다. nc886-EXP에서 20개 이상의 TFT-Z 스코어 세트를 선택했을 때, 가장 주목할만한 것들은 절반 이상 (20개 중 12 개)을 차지하는 E2F 관련 TF였다 (도 3D). E2F 계열 TF는 G1 대 S 세포주기의 진행을 유도하는 유전자를 조절한다. Reactome 에서처럼 12 개의 TFT 세트 모두 nc886-KD에서 nc886-EXP와 반대로 음의 Z- 점수를 보였다. 다음으로 nc86에 의해 통제된 개별적인 세포주기 유전자를 조사하였다. 이를 위해 Reactome 세트의 G1 단계 하위 집합에서 40개의 유전자를 검색하여 6,563 개의 유전자로 교차시켰고, nc886-KD와 nc886-EXP 모두에서 유의한 (p <0.05) 변화가 있었는19개의 유전자(nc886/G1 관련 유전자, 도 4A)를 얻었다. 상기 유전자들은 nc886 qRT-PCR 값과 mRNA 배열 데이터가 이용 가능한 108 명의 ESCC 환자 집단에서 분석되었다. 세포 데이터에서 얻은 nc886/G1 관련 유전자의 대다수(19개 중 14개)가 환자 데이터에서도 nc886과 유의한 연관이 있음을 발견하였다 (도 4B). 상기 14개의 유전자를 면밀히 조사한 결과, 우리는 추가 실험을 위해 CDKN2A (a.k.a., p16INK4a 또는 p14ARF) 및 CDKN2C을 선택하였다. 왜냐하면 CDK4/CDK6를 억제함으로써 G1에서 세포를 제한하고 E2F에 의해 활성화되는 것으로 보고 되었기 때문이다. ESCC 환자 108 명에서 발현 수준을 조사한 결과, CDKN2A와 CDKN2C는 nc886과 양성 반응을 보였다 (도 4C). 293T-U6:nc886 세포에서 CDKN2A 및 CDKN2C의 발현은 293T-U6 세포와 비교하여 G1 (도 2A-B) 의 장기 지속 및 E2F 표적 유전자의 농축 (도 3D)과 일치하여 증가 하였다. 또한, SKP2 및 CUL1은 CDK 억제제를 분해하여 G1-S 전이를 촉진시키는 것으로 알려져 있기 때문에 SKP2 및 CUL1을 조사 하였다. 이 두 유전자는 환자 및 세포주 데이터에서 nc886과 음의 상관관계가 있었다 (도 4B-D). 상기의 데이터를 종합적으로 판단하였을 때, nc886은 세포주기 유전자를 조절하여 G1-S 전이를 지연시킨다. nc886이 PKR과 Dicer를 억제하는 것으로 나타 났으므로 nc886-EXP에서 지연된 G1이이 두 단백질에 의해 설명 될 수 있는지 여부를 조사하였다. PKR은 세포 증식에 관여하는 단백질이며 그 대표적인 하류 현상은 NF-κB의 활성화다. 따라서 MSigDB TFT 세트에서 NF-κB를 검사하였다. 앞에서 설명한 바와 같이, PKR은 활성화되면 세포 사멸을 유도하므로 자연 증식하는 세포에서 잠복 상태를 유지해야한다. 이 상황에서 PKR에 대한 nc886의 억제 역할은 거의 영향을 미치지 않는다. nc886-KD에 의해 활성화되었지만, PKR은 nc886-EXP의 세포주기 표현형을 설명 할 수 없었다. 또한 miRNA biogenesis의 주요 효소 인 Dicer를 연구하여 miRNA 표적 유전자 모음 인 MSigDB MIR 세트를 조사하였다. nc886-EXP에서 miRNA 경로에 대한 nc886의 억제 효과를 볼 수 없었다.
실시예 12. nc886은 AKT 경로를 억제한다.
앞서의 분석에서 PKR과 Dicer는 세포주기 진행에서 nc886의 역할을 설명 할 수 없었다. 따라서 nc886의 또 다른 단백질 표적을 확인하려고 시도했다. 상기의 과제를 해결하기 위해, RPPA라는 고효율 플랫폼을 사용하여 프로테옴 레퍼토리를 측정하였다. 상기 실험에서 172개 항체가 있는 니트로셀룰로오스 코팅 슬라이드에 세포 용해물을 배열하여 해당 단백질을 종합적으로 측정하였다. 상기 항체는 잘 알려진 경로에서 단백질 및 이의 인산화 형태를 포함하였다. nc886-KD에서 RPPA를 실행하였다. 왜냐하면 전술 한 바와 같이 nc886의 직접효과를 식별할 때 단기간 KD한 세포가 nc886-EXP보다 유리하기 때문이다. 72 개의 단백질의 발현 값을 얻었고 23 개가 통계적으로 유의미한 수준에서 변화한다는 것을 발견하였다 (도 5A). 상기 23 개의 단백질을 조사했을 때, AKT 경로에서 단백질의 변화가 있음을 확인하였다. AKT 단백질은 상동성이 강한 3개의 이소형 (AKT1, AKT2 및 AKT3)으로 구성되며, 이들의 인산화는 활성 상태를 나타낸다. RPPA 데이터에서, Thr308 및 Ser473에서의 AKT1의 인산화는 증가하였고, 총 AKT1은 상대적으로 변하지 않았다 (도 5A). 또한 nc886-KD는 AKT1의 기질 1 (AKT1S1, a.k.a., PRAS40) 및 Ribosomal Protein S6 (RPS6)의 인산화를 증가 시켰다. AKT1S1은 AKT에 의해 직접 인산화 된다. RPS6은 AKT에 의해 촉진되는 Ribosomal Protein S6 Kinase B1 (RPS6KB1, a.k.a., S6K)에 의해 인산화 된다. RPPA 데이터를 검증하기 위해, 세포 표현형 (G1에서의 지연으로 인한 느린 세포 증식)을 관찰한 nc886-EXP에서 AKT 인산화를 측정하였다. 웨스턴 블랏 결과는 노코다졸 정지로부터 방출된 후 6시간 및 12시간대에, AKT1은 293T-U6:nc886에서 293T-U6보다 Ser473에서 덜 인산화 되었음을 보여 주었다 (도 5B). 총체적으로, 상기 데이터는 nc886에 의한 AKT의 억압을 증명하였다. AKT 활성화는 유전자 발현의 변화로 이어진다. 따라서 nc886이 AKT에 미치는 영향은 유전자 발현 데이터에서 더 평가되었다. 최근 리뷰 기사와 Reactome 및 Biocarta 유전자 세트 (http://software.broadinstitute.org/gsea/msigdb/) 및 RGD (Rat Genome Database; https://rgd.mcw.edu/)를 포함한 공개 데이터베이스에서 수집된 184 개의 AKT 다운 스트림 유전자 목록을 선별하였다. 상기 유전자 중에 일부는 AKT가 활성화 될 때 다른 것이 하향 조절 되는 것으로, 상향 조절된다. ESCC 환자 108 명에 대한 배열 데이터에 적용하기 위해 184 개의 유전자 중 nc886-KD에서 34 개의 증가된 유전자 (표 2)와 19 개의 감소 된 유전자를 선택하였다 (표 3). GSEA 플롯에서, 34 및 19 유전자는 통계적으로 유의 수준에서 nc886과 부정적으로 양의 상관관계를 보였다 (도 5C). nc886-KD 데이터와 환자 데이터 사이의 nc886/AKT 관련 유전자의 일치는 nc886이 생체 내 종양 형성 과정에서도 AKT 경로를 억제함을 시사한다.
실시예 13. nc886, AKT 및 세포주기 유전자 간의 연관성은 ESCC 환자의 생존 예측 인자이다.
nc886, AKT 및 세포주기 유전자 간의 연관성은 ESCC 환자의 생존 예측 인자이다. AKT 경로와 세포주기 진행을 억제하는 nc886의 역할을 밝혀내고 nc886 관련 유전자 특성을 확인하였다 (34 및 19 nc886/AKT-관련 유전자 (도 5); 9 및 5 nc886/G1 관련 유전자 (도 4B)). 108 명의 ESCC 환자에서 이들 유전자의 예후 유용성을 시험하였다. AKT signature score는 nc886-KD에서 상향 조절된 34 유전자와 하향 조절된 19개 유전자 사이의 기하 평균의 차이에 의해 생성되었다. 세포 주기 signature score는 nc886과 각각 음의 상관관계가 있는 9 개의 유전자와 5 개의 유전자로부터 유사하게 계산되었다. 이 점수를 갖는 코호트는 각 중간 값에 따라 2 분화되었다. TNM 병기와 nc886 발현은 RFS에 대한 독립적인 예후 인자였다. C-통계에 따르면 4 가지 요소 (nc886의 발현량, AKT signature score, 세포주기 signature score 및 TNM 병기)의 조합이 병의 재발 및 환자의 생존을 예측할 수 있는 가장 강력한 조합이었다 (도 6A). TNM 병기 [병기 I 및 II=0; 병기 III 및 IV=1], nc886 발현량 [중간 값으로 높음=0; 낮음=1], AKT signature score [중간 값으로 낮음=0; 높음=1], 세포주기 점수 [중간 값으로 낮은=0; 높은=1 ]을 연속적으로 합산하여 예후 점수를 계산하였다. 예후 점수에 의한 5 개의 소그룹으로의 층화는 108 명의 ESCC 환자 집단에서 별개의 DSS, RFS 및 OS 곡선을 보였다 (도 6B). 세 가지 곡선 모두에서, 더 높은 예후 점수는 생존 기간이 짧을수록 비례한다. 점수가 4(TNM 병기 III 및 IV, 낮은 nc886, 높은 AKT signature score 및 높은 세포주기 점수)를 가진 환자는 최악의 생존율을 보였으나 점수가 0 인 사람은 가장 좋은 생존률을 보였다. AKT 다운 스트림 유전자 및 세포주기 유전자는 nc886 및 TNM 병기와 결합 될 때 환자의 생존을 더 잘 예측했다. ESCC에서 nc886이 종양 억제 인자로서 어떻게 작용 하는지를 설명하기 위해 AKT와 세포주기 유전자를 하류 사건으로 확인함으로써 세포 증식에 있어서 nc886의 억제 역할을 입증했다 (도 6C).
실시예 14. 바람직하지 않은 예후를 가진 ESCC에 대한 치료적 적용.
nc886과 AKT 표적 유전자 및 세포주기 유전자의 연관성을 입증하기 위한 역 접근 접근법으로서, 상기 유전자를 갖는 108 명의 환자의 unsupervised 클러스터링을 수행하여 "Cluster1" 및 "Cluster2"로 명명된 2 개의 별개의 클러스터를 확인하였다 (도 7A). Cluster2는 CDK4 (도 7A) 및 nc886(도 7B)의 낮은 발현을 포함하여 대부분의 유전자를 풍부하게 하였다. 일부 암 약물은 세포 주기 유전자를 표적으로 하였다. FDA 승인 소분자 CDK4/6 억제제인 팔보시클립은 EC을 포함한 일련의 인간 악성 종양에 대한 전임상 연구 및 임상시험에서 광범위하게 조사되고 있다. nc886, AKT 및 세포주기에 대한 조사는 종양의 유전자 발현 프로파일에 기초하여 치료 결정을 추가로 개선되는지 추가로 조사하였다. CDK4와 관련된 nc886 발현 팔보시클립에 대한 ESCC 세포의 반응을 예측할 수 있는지 확인하였다. 100여 종의 화합물에 대한 거의 1,000개의 암 세포주 민감도에 대한 정보를 제공하는 가장 큰 공공 자원인 암 데이터 베이스의 약물 민감도 유전체학(www.cancerRxgene.org)에서 팔보시크립 민감성을 조사하였다. nc886이 침묵된 ESCC 세포주 TT (도 7C)가 팔보시클립에 갖는 민감한 약물임을 암시하는 가장 낮은 IC50 값을 가지는 것을 확인하였다 (도 7D). 팔보시클립 처리에 대한 세포자살 분석은 TT 세포가 nc886 발현 식도 세포주보다 더 높은 세포 자살 비율을 가지는 것을 확인하였다 (도 7E). 상기 결과를 통해 nc886 및 이와 관련된 유전자를 확인하면, 식도편평상피암 환자에서 팔보시클립에 대한 치료의 예후 예측을 할 수 있는 것으로 확인 되었다. nc886, CDKN2A 및 CKN2C 유전자 수준이 대조군에 비해 낮고, AKT 및 CDK4 유전자 수준이 대조군에 비해 높은 경우에 식도편평상피암에서 항암제 팔보시클립에 대한 민감성이 있는 것으로 확인되었다 (도 8).
Claims (19)
- a) 식도편평상피암 환자로부터 분리된 생물학적 시료로부터 nc886의 발현 수준을 측정하는 단계; 및 b) AKT 표적 유전자 중 nc886의 증가에 따라 발현이 변화하는 유전자들 및 세포주기와 관련된 유전자 중 nc886의 증가에 따라 발현이 변화하는 유전자들 중 어느 하나 이상의 유전자의 발현 수준을 측정하는 단계;를 포함하는, 식도편평상피암 환자의 예후 예측을 위한 정보제공방법.
- 제1항에 있어서, 상기 a-1) 상기 nc886의 발현 수준이 낮은 경우;b-1) 상기 AKT의 표적 유전자 중 "nc886의 발현 증가에 의해 감소하는 유전자 또는 이의 단백질의 발현 수준"이 정상 대조군 시료보다 높거나; 또는 "nc886의 발현 증가에 의해 증가하는 유전자 또는 이의 단백질 수준"이 정상 대조군 시료보다 낮은 경우; 및/또는b-2) 상기 세포주기와 관련된 유전자 중 "nc886의 발현 증가에 의해 감소하는 유전자 또는 이의 단백질의 발현 수준"이 정상 대조군 시료보다 높거나; 또는 상기 세포주기와 관련된 유전자 중 "nc886의 발현 증가에 의해 증가하는 유전자 또는 이의 단백질의 발현 수준"이 예정상 대조군 시료보다 낮은 경우;에 식도편평상피암 환자의 예후가 불량한 것으로 판단하는, 식도편평상피암 환자의 예후 예측을 위한 정보제공방법.
- 제 1항에 있어서, 상기 a) 및 b) 단계에서 측정된 각각의 발현 수준에 가중치를 부여하고 이를 합산하여 판단하는, 식도편평상피암 환자의 예후 예측을 위한 정보제공방법.
- 제 1항에 있어서, 상기 b) 단계에 c) 상기 식도편평상피암을 TNM에 따라 분류되는 정보를 수집하는 단계;를 추가로 포함하는, 식도편평상피암 환자의 예후 예측을 위한 정보제공방법.
- 제 4항에 있어서, 상기 TNM에 따라 분류 점수를 0 점 내지 4점으로 계산하며, 상기 점수가 0점이면 매우 양호, 1점이면 양호, 2점이면 보통, 3점이면 나쁨, 4점이면 매우 나쁨으로 판단하는, 식도편평상피암의 예후 예측에 필요한 정보를 제공하는 방법.
- i) 식도편평상피암 환자로부터 분리된 생물학적 시료로부터 nc886의 발현 수준, AKT의 표적 유전자의 발현 수준, 세포주기와 관련된 유전자의 발현 수준 및 TNM에 따라 분류되는 정보를 수집하는 단계;ii) a-1) 상기 nc886의 발현 수준이 정상 대조군 시료보다 높으면 0점을 주고, 정상 시료 대조군보다 낮으면 1점을 주며,a-2) 상기 AKT의 표적 유전자 중 "nc886의 발현 증가에 의해 감소하는 유전자 또는 이의 단백질의 발현 수준"이 정상 대조군 시료보다 높거나, 또는 "nc886의 발현 증가에 의해 증가하는 유전자 또는 이의 단백질 수준"이 정상 대조군 시료보다 낮으면 1점을 주고; 상기 AKT의 표적 유전자 중 "nc886의 발현 증가에 의해 감소하는 유전자 또는 이의 단백질의 발현 수준"이 정상 대조군 시료보다 낮거나, 또는 "nc886의 발현 증가에 의해 증가하는 유전자 또는 이의 단백질 수준"이 정상 대조군 시료보다 높으면 0점을 주고;a-3) 상기 세포주기와 관련된 유전자 중 "nc886의 발현 증가에 의해 감소하는 유전자 또는 이의 단백질의 발현 수준"이 정상 대조군 시료보다 높거나, 또는 상기 세포주기와 관련된 유전자 중 "nc886의 발현 증가에 의해 증가하는 유전자 또는 이의 단백질의 발현 수준"이 예정상 대조군 시료보다 낮으면 1점을 주고; 상기 세포주기와 관련된 유전자 중 "nc886의 발현 증가에 의해 감소하는 유전자 또는 이의 단백질의 발현 수준"이 정상 대조군 시료보다 낮거나, 또는 상기 세포주기와 관련된 유전자 중 "nc886의 발현 증가에 의해 증가하는 유전자 또는 이의 단백질의 발현 수준"이 예정상 대조군 시료보다 높으면 0점을 주고;상기 TNM 단계가 1 또는 2단계면 0점을 주며 3 또는 4단계면 1점을 주는 단계; 및iii) 상기 ii)단계의 점수를 계산하는 단계;를 포함하는 식도편평상피암 환자의 예후 예측을 위한 정보제공방법.
- 제 1항 또는 제 6항에 있어서, 상기 AKT의 표적 유전자 중 nc886에 의해 감소하는 유전자는 ACLY, BTK,CD14, CDC42, CDKN1A, CDKN1B, DPYSL2, DPYSL3, EIF4E, FOS, FOXO1, FOXO3, FOXO4, GJA1, GRB10, GRB2, HSPB1, JUN, MAP3K5, MAPT, MYC, NFKBIA, PABPC1, PAK1, PALLD, PIK3R1, PPP2R1B, PRKAA1, PRKCA, PRKCZ, SHC1, SREBF1, SRF 및 YWHAH으로 이루어진 군으로 부터 선택되는 어느 하나의 유전자이고, nc886에 의해 증가하는 유전자는 ATG4B, BCL2L11, CSNK2A1, CTPS, EIF2AK2, FKBP1A, GADD45A, HRAS, MAPK1, MAPKAP1, MTCP1, PCK2, PPP2CB, PPP2R2A, PRKAA2, PTEN, THEM4, YWHAE 및 YWHAG으로 이루어진 군으로부터 선택되는 어느 하나의 유전자인, 식도편평상피암 환자의 예후 예측을 위한 정보제공방법.
- 제 1항 또는 제 6항에 있어서, 상기 세포주기와 관련된 유전자 중 nc886의 발현 증가에 의해 증가하는 유전자는 CDKN2A, RBL1, PPP2R1B, CDKN1A 또는 CDKN2C이고, nc886의 발현 증가에 의해 감소하는 유전자는 SKP2, CDKN1B, PPP2CB, UBA52, CDK4, RPS27A, PPP2CA, PPP2R2A 또는 CUL1인, 식도편평상피암 환자의 예후 예측을 위한 정보제공방법.
- 제 1항 또는 제 6항에 있어서, 상기 시료는 식도편평상피암 환자의 암세포를 포함하는 조직의 포르말린 고정 파라핀 포매(formalin-fixed paraffin-embedded, FFPE) 시료, 신선한 조직(fresh tissue) 및 동결 조직으로 이루어진 군으로부터 선택된 1종 이상인, 식도편평상피암의 예후 예측에 필요한 정보를 제공하는 방법.
- 제 1항 또는 제 6항에 있어서, 상기 유전자의 수준은 중합효소반응(PCR), 역전사 중합효소반응(RT-PCR), 경쟁적 역전사 중합효소반응(Competitive RT-PCR), 실시간 역전사 중합효소반응(Realtime RT-PCR), RNase 보호 분석법(RPA; RNase protection assay), 노던 블랏팅(Northern blotting), 차세대 염기서열분석(next-generation sequencing, NGS) 및 DNA 마이크로어레이 분석법으로 이루어진 군으로부터 선택된 1종 이상의 방법에 의해 측정되는, 식도편평상피암의 예후 예측에 필요한 정보를 제공하는 방법.
- 제 1항 또는 제 6항에 있어서, 상기 단백질의 발현 수준은웨스턴 블랏, ELISA (enzyme linked immunosorbent asay), 면역염색법 (immunostaining), 방사선면역분석(Radioimmunoassay; RIA), 방사면역확산법(radioimmunodiffusion), 오우크테로니(Ouchterlony) 면역 확산법, 로케이트(rocket) 면역전기영동, 조직면역염색, 면역침전 분석법(Immunoprecipitation assay), 보체고정분석법(Complement Fixation Assay), FACS 및 단백질 칩으로 이루어진 군으로부터 선택된 1종 이상의 방법에 의해 측정되는, 식도편평상피암의 예후 예측에 필요한 정보를 제공하는 방법.
- nc886; 및ACLY, BTK,CD14, CDC42, CDKN1A, CDKN1B, DPYSL2, DPYSL3, EIF4E, FOS, FOXO1, FOXO3, FOXO4, GJA1, GRB10, GRB2, HSPB1, JUN, MAP3K5, MAPT, MYC, NFKBIA, PABPC1, PAK1, PALLD, PIK3R1, PPP2R1B, PRKAA1, PRKCA, PRKCZ, SHC1, SREBF1, SRF, YWHAH, ATG4B, BCL2L11, CSNK2A1, CTPS, EIF2AK2, FKBP1A, GADD45A, HRAS, MAPK1, MAPKAP1, MTCP1, PCK2, PPP2CB, PPP2R2A, PRKAA2, PTEN, THEM4, YWHAE, YWHAG, CDKN2A, CDKN2C, SKP2, UBA52, CDK4, RPS27A, PPP2CA, RBL1 또는 CUL1 유전자; 또는 상기 유전자로 엔코딩된 단백질을 검출할 수 있는 제제를 포함하는, 식도편평상피암 예후 예측용 조성물.
- nc886 및;ACLY, BTK,CD14, CDC42, CDKN1A, CDKN1B, DPYSL2, DPYSL3, EIF4E, FOS, FOXO1, FOXO3, FOXO4, GJA1, GRB10, GRB2, HSPB1, JUN, MAP3K5, MAPT, MYC, NFKBIA, PABPC1, PAK1, PALLD, PIK3R1, PPP2R1B, PRKAA1, PRKCA, PRKCZ, SHC1, SREBF1, SRF, YWHAH, ATG4B, BCL2L11, CSNK2A1, CTPS, EIF2AK2, FKBP1A, GADD45A, HRAS, MAPK1, MAPKAP1, MTCP1, PCK2, PPP2CB, PPP2R2A, PRKAA2, PTEN, THEM4, YWHAE, YWHAG, CDKN2A, CDKN2C, SKP2, UBA52, CDK4, RPS27A, PPP2CA, RBL1 또는 CUL1 유전자; 또는 상기 유전자로 엔코딩된 단백질을 검출할 수 있는 제제를 포함하는, 식도편평상피암 예후 예측용 키트.
- nc886, AKT, CDK4, CDKN2A 및 CKN2C 유전자의 mRNA 또는 이의 단백질 수준을 측정하는 제제를 포함하는 식도편평상피암에서 항암제 팔보시클립에 대한 저항성 또는 민감성 예측용 바이오마커 조성물.
- 제 14항의 조성물을 포함하는 식도편평상피암에서 항암제 팔보시클립에 대한 저항성 또는 민감성 예측용 키트.
- (a) 생물학적 시료에서 nc886, AKT, CDK4, CDKN2A 및 CKN2C 유전자의 mRNA 또는 이의 단백질 수준을 측정하는 단계; 및(b) 상기 nc886, CDKN2A 및 CKN2C 유전자의 mRNA 또는 이의 단백질 수준이 대조군에 비해 낮고, AKT 및 CDK4 유전자의 mRNA 또는 이의 단백질 수준이 대조군에 비해 높은 경우에 식도편평상피암에서 항암제 팔보시클립에 대한 민감성이 있는 것으로 판단하고, nc886, CDKN2A 및 CKN2C 유전자의 mRNA 또는 이의 단백질 수준이 대조군에 비해 높고, AKT 및 CDK4 유전자의 mRNA 또는 이의 단백질 수준이 대조군에 비해 낮은 경우에 식도편평상피암에서 항암제 팔보시클립에 대한 저항성이 있는 것으로 판단하는 단계를 포함하는, 식도편평상피암에서 항암제 팔보시클립에 대한 저항성 또는 민감성 예측을 위한 정보제공방법.
- 제 16항에 있어서, 상기 a) 단계의 생물학적 시료는 식도편평상피암 환자의 암세포를 포함하는 조직의 포르말린 고정 파라핀 포매(formalin-fixed paraffin-embedded, FFPE) 시료, 신선한 조직(fresh tissue) 및 동결 조직으로 이루어진 군으로부터 선택된 1종 이상인, 식도편평상피암에서 항암제 팔보시클립에 대한 저항성 또는 민감성 예측을 위한 정보제공방법.
- 제 16항에 있어서, 상기 (a) 단계의 mRNA 수준은 중합효소반응(PCR), 역전사 중합효소반응(RT-PCR), 경쟁적 역전사 중합효소반응(Competitive RT-PCR), 실시간 역전사 중합효소반응(Realtime RT-PCR), RNase 보호 분석법(RPA; RNase protection assay), 노던 블랏팅(Northern blotting), 차세대 염기서열분석(next-generation sequencing, NGS) 및 DNA 마이크로어레이 분석법으로 이루어진 군으로부터 선택된 1종 이상의 방법에 의해 측정되는, 식도편평상피암에서 항암제 팔보시클립에 대한 저항성 또는 민감성 예측을 위한 정보제공방법.
- 제 16항에 있어서 상기 (a) 단계의 단백질 수준은 웨스턴 블랏팅(western blotting), ELISA(enzyme linked immunosorbent assay), 방사선면역분석법(Radioimmunoassay), 방사면역 확산법(Radioimmunodiffusion), 오우크테로니(Ouchterlony) 면역 확산법, 로케트(Rocket) 면역전기영동, 조직면역염색법, 면역 침전분석법(immunoprecipitation assay), 보체 고정 분석법(complete fixation assay), 유세포분석법(Fluorescence Activated Cell Sorter, FACS) 및 단백질 칩(protein chip) 분석법으로 이루어진 군으로부터 선택된 1종 이상의 방법에 의해 측정되는, 식도편평상피암에서 항암제 팔보시클립에 대한 저항성 또는 민감성 예측을 위한 정보제공방법.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR10-2018-0156444 | 2018-12-06 | ||
| KR20180156444 | 2018-12-06 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2020117002A1 true WO2020117002A1 (ko) | 2020-06-11 |
Family
ID=70973881
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/KR2019/017213 Ceased WO2020117002A1 (ko) | 2018-12-06 | 2019-12-06 | 식도편평상피암의 예후를 예측하는 방법 |
Country Status (2)
| Country | Link |
|---|---|
| KR (3) | KR102359423B1 (ko) |
| WO (1) | WO2020117002A1 (ko) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113777311A (zh) * | 2021-09-16 | 2021-12-10 | 郑州大学 | 一种用于食管鳞癌辅助诊断的elisa试剂盒 |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20250074650A (ko) * | 2023-11-20 | 2025-05-27 | 주식회사 디시젠 | 암 예후 예측 방법 및 이의 조성물 |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20080096768A1 (en) * | 2000-03-31 | 2008-04-24 | University Of Southern California | Epigenetic sequences for esophageal adenocarcinoma |
| CN103149369A (zh) * | 2013-03-20 | 2013-06-12 | 江苏元化生命科技有限公司 | 一种检测食管鳞癌标志物的蛋白质芯片及其试剂盒 |
| KR20180015587A (ko) * | 2016-08-02 | 2018-02-13 | 국립암센터 | 암 예후 예측용 바이오마커 |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| TWI429910B (zh) * | 2011-10-17 | 2014-03-11 | 高雄醫學大學 | 預測食道癌存活及癒後狀態之方法及其套組及微陣列晶片 |
-
2019
- 2019-12-06 KR KR1020190162038A patent/KR102359423B1/ko active Active
- 2019-12-06 WO PCT/KR2019/017213 patent/WO2020117002A1/ko not_active Ceased
-
2021
- 2021-09-14 KR KR1020210122736A patent/KR102417314B1/ko active Active
- 2021-09-14 KR KR1020210122735A patent/KR102348837B1/ko active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20080096768A1 (en) * | 2000-03-31 | 2008-04-24 | University Of Southern California | Epigenetic sequences for esophageal adenocarcinoma |
| CN103149369A (zh) * | 2013-03-20 | 2013-06-12 | 江苏元化生命科技有限公司 | 一种检测食管鳞癌标志物的蛋白质芯片及其试剂盒 |
| KR20180015587A (ko) * | 2016-08-02 | 2018-02-13 | 국립암센터 | 암 예후 예측용 바이오마커 |
Non-Patent Citations (2)
| Title |
|---|
| LEE, H.-S.: "Epigenetic silencing of the non-coding RNA nc886 provokes on cogenes during human esophageal tumorigenesis", ONCOTARGET, vol. 5, no. 11, 15 June 2014 (2014-06-15), pages 3472 - 3481, XP055716831 * |
| LEE, Y. S.: "A novel type of non-coding RNA, nc886, implicated in tumor sensing and suppression", GENOMICS & INFORMATICS, vol. 13, no. 26, 1 January 2015 (2015-01-01), pages 26 - 30, XP055461430 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113777311A (zh) * | 2021-09-16 | 2021-12-10 | 郑州大学 | 一种用于食管鳞癌辅助诊断的elisa试剂盒 |
| CN113777311B (zh) * | 2021-09-16 | 2023-08-01 | 郑州大学 | 一种用于食管鳞癌辅助诊断的elisa试剂盒 |
Also Published As
| Publication number | Publication date |
|---|---|
| KR102359423B1 (ko) | 2022-02-09 |
| KR20210116403A (ko) | 2021-09-27 |
| KR102417314B1 (ko) | 2022-07-07 |
| KR20210117238A (ko) | 2021-09-28 |
| KR20200069258A (ko) | 2020-06-16 |
| KR102348837B1 (ko) | 2022-01-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Pan et al. | Hsa_circ_0006948 enhances cancer progression and epithelial-mesenchymal transition through the miR-490-3p/HMGA2 axis in esophageal squamous cell carcinoma | |
| Yoshimatsu et al. | Dysregulation of PRMT1 and PRMT6, Type I arginine methyltransferases, is involved in various types of human cancers | |
| Xiong et al. | Roles of STAT3 and ZEB1 proteins in E-cadherin down-regulation and human colorectal cancer epithelial-mesenchymal transition | |
| Nanni et al. | Epithelial-restricted gene profile of primary cultures from human prostate tumors: a molecular approach to predict clinical behavior of prostate cancer | |
| Li et al. | Interferon alpha-inducible protein 27 promotes epithelial–mesenchymal transition and induces ovarian tumorigenicity and stemness | |
| Han et al. | Interleukin 1 up-regulates microRNA 135b to promote inflammation-associated gastric carcinogenesis in mice | |
| Xu et al. | MicroRNA-876-5p inhibits epithelial-mesenchymal transition and metastasis of hepatocellular carcinoma by targeting BCL6 corepressor like 1 | |
| Zhang et al. | Upregulation of miR-572 transcriptionally suppresses SOCS1 and p21 and contributes to human ovarian cancer progression | |
| Liu et al. | Isocitrate dehydrogenase 1–snail axis dysfunction significantly correlates with breast cancer prognosis and regulates cell invasion ability | |
| Nam et al. | Integrative epigenetic and gene expression analysis of renal tumor progression to metastasis | |
| Inaguma et al. | GLI1 interferes with the DNA mismatch repair system in pancreatic cancer through BHLHE41-mediated suppression of MLH1 | |
| Ma et al. | MicroRNA-129-5p inhibits hepatocellular carcinoma cell metastasis and invasion via targeting ETS1 | |
| Hu et al. | miR‐636 represses cell survival by targeting CDK6/Bcl‐2 in cervical cancer | |
| Wang et al. | LHPP suppresses tumorigenesis of intrahepatic cholangiocarcinoma by inhibiting the TGFβ/smad signaling pathway | |
| Wu et al. | ESR1 mediated circ_0004018 suppresses angiogenesis in hepatocellular carcinoma via recruiting FUS and stabilizing TIMP2 expression | |
| Yang et al. | Dicer reprograms stromal fibroblasts to a pro-inflammatory and tumor-promoting phenotype in ovarian cancer | |
| Ma et al. | LINC01585 functions as a regulator of gene expression by the CAMP/CREB signaling pathway in breast cancer | |
| Cao et al. | Targeting lncRNA PSMA3‐AS1, a Prognostic Marker, Suppresses Malignant Progression of Oral Squamous Cell Carcinoma | |
| WO2020117002A1 (ko) | 식도편평상피암의 예후를 예측하는 방법 | |
| WO2018004240A1 (ko) | 뇌종양의 진단 및 치료에서의 nupr1의 용도 | |
| Wang et al. | Prognostic roles of miR-124-3p and its target ANXA7 and their effects on cell migration and invasion in hepatocellular carcinoma | |
| WO2018026190A1 (ko) | 암 예후 예측용 바이오마커 | |
| Pei et al. | CircFOXM1 acts as a ceRNA to upregulate SMAD2 and promote the progression of nasopharyngeal carcinoma | |
| Huang et al. | MCTS1 promotes invasion and metastasis of oral cancer by modifying the EMT process | |
| WO2018174506A1 (ko) | Sulf2 유전자를 이용한 소라페닙 치료에 대한 감수성 예측방법 및 sulf2 저해제를 포함하는 암 치료용 조성물 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 19893850 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 19893850 Country of ref document: EP Kind code of ref document: A1 |

