WO2020104503A1 - A single nucleotide polymorphism in the heat shock protein 70 constitutive gene for selecting heat-tolerant organisms - Google Patents

A single nucleotide polymorphism in the heat shock protein 70 constitutive gene for selecting heat-tolerant organisms

Info

Publication number
WO2020104503A1
WO2020104503A1 PCT/EP2019/081883 EP2019081883W WO2020104503A1 WO 2020104503 A1 WO2020104503 A1 WO 2020104503A1 EP 2019081883 W EP2019081883 W EP 2019081883W WO 2020104503 A1 WO2020104503 A1 WO 2020104503A1
Authority
WO
WIPO (PCT)
Prior art keywords
protein
amino acid
hsc70
organism
heat
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/EP2019/081883
Other languages
French (fr)
Inventor
Peter Bossier
Wisarut JUNPRUNG
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Universiteit Gent
Original Assignee
Universiteit Gent
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Universiteit Gent filed Critical Universiteit Gent
Publication of WO2020104503A1 publication Critical patent/WO2020104503A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/124Animal traits, i.e. production traits, including athletic performance or the like
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/158Expression markers

Definitions

  • the present invention relates to the field of selecting heat-resistant, and hence disease-resistant individual organisms out of a pool of organisms. More in particular, the present invention discloses a single nucleotide polymorphism (SNP) in the heat shock protein 70 constitutive (HSC70) gene which induces heat-tolerance in an organism and which can thus be used as a genetic marker to select for a disease-resistant organisms.
  • SNP single nucleotide polymorphism
  • SNPs single nucleotide polymorphisms
  • HSPs heath-shock proteins
  • US2003104392 disclosed a specific SNP in de 5'-flanking region of the porcine HSP70.2 gene which is useful for selecting pigs with increased growth performance.
  • Cai et al. (Asian-Aust. J. Anim.
  • HSP70 gene can be used as molecular genetic markers to assist selection for anti-heat stress cows.
  • CN104328116 further discloses specific SNPs in the HSP70 gene of the Japanese flounder (Paralichthys olivaceus) which are useful to screen for heat-resistant fish.
  • Ferreira et al. (Genetics and Molecular Research 2017: 1) could not associate specific polymorphisms in the HSP70 gene of the marine shrimp Litopenaeus vannamei with tolerance to an infection with white spot syndrome virus. Blanck et al.
  • FIG. 1 Sequence and the SNP detection of A. franciscana HSC70.
  • A Nucleotide and deduced amino acid sequences and
  • B cartoon showing a linear representation of HSC70. The ATP-binding domain are highlighted with a grey.
  • Three HSP70 protein family signatures are labelled with bold letters and underlined. The middle region with proteinase sensitive sites is shown in bold. The C-terminal region containing an EEVD-motif is labelled with a grey background.
  • HSC71 isoform 1 Homo sapiens (NP_006588.1); HSC71 Sus scrofa (NP_001230836.1); HSC71 Rattus norvegicus (NP_077327.1); HSC71 Meriones unguiculatus (XP_021498722.1); HSC70 Macrobrachium nipponense (ABG45886.1); HSC70 Metapenaeus ensis (ABF20530.1); HSC70 Penaeus vannamei (ABP01681.1); HSC70 Fenneropenaeus chinensis (AAW71958.1); HSC70 Orius sauteri (AIA61348.1); HSC70 NHaparvata lugens (ADE34170.1); HSC70 Macrocentrus c
  • Fig 4. The variation of the FISC70 deduced amino acid sequence at the polymorphism position with various species.
  • the amino acid position of SNP was showed in black line box indicate with arrow.
  • Fig. Agarose gel electrophoresis of SNP detection.
  • A The PCR product pattern of SNP detection by using C and A primer-3' that represented 3 possible genotypes (CC, CA and AA) in each cyst.
  • B The SNP detection result of eight individual cyst of TF12.
  • FISC70 protein production in each condition was detected by western blot analysis using anti-His tag antibody as primary antibody and secondary H RP conjugated goat anti-mouse IgG.
  • thermotolerance selection at various temperatures. A series of 5-fold serial dilution of FISC70 WT and MUT in both stains were made and spotted on the induction medium agar. The thermotolerance selection was performed with incubation at various temperatures (28 5 C, 34 5 C, 37 5 C and 40 5 C) for 5 days.
  • thermotolerance selection upon LHS A series of 5-fold serial dilution of FISC70 WT and MUT in both stains were made and spotted on the induction medium agar. The agar plates were incubated at LHS (40 5 C) with various time points (lh, 2h, 3h, and 6h). After that, were transferred to 28 5 C incubator for 5 days. Description of invention
  • the current invention discloses such a SNP. Indeed, the present invention discloses that a particular SNP in the ATP binding domain of the HSC70 gene induces heat tolerance in an organism.
  • the present invention discloses that the presence of a particular SNP - i.e. the substitution of a cytosine (C) by an adenosine (A)- in the gene encoding for the heat shock cognate 71 kDa protein (HSC70) results in the substitution of an asparagine (N) by a lysine (K) in the ATP binding domain of the protein encoded by the HSC70 gene, and, that said SNP induces heat tolerance of an organism such as Artemia franciscana.
  • SNP i.e. the substitution of a cytosine (C) by an adenosine (A)- in the gene encoding for the heat shock cognate 71 kDa protein (HSC70) results in the substitution of an asparagine (N) by a lysine (K) in the ATP binding domain of the protein encoded by the HSC70 gene, and, that said SNP induces heat tolerance of an organism such as Artemia franciscana.
  • the present invention relates in first instance to a method for selecting a heat-tolerant organism which comprises the step of identifying a single nucleotide polymorphism in the gene encoding for the heat shock cognate 71 kDa protein (HSC70) of said organism or in the gene encoding for a protein of said organism which has at least 70% sequence identity with the HSC70 protein of Artemia franciscana and which contains the amino acid sequence TERLIGDAAKNQVAMNP wherein the presence of an adenosine at a specified nucleotide position within said gene that results in the substitution of an asparagine (N) by a lysine (K) at amino acid position 11 of the amino acid sequence TERLIGDAAKNQVAMNP within the ATP-binding domain of said protein indicates that said organism is heat-tolerant.
  • HSC70 heat shock cognate 71 kDa protein
  • a protein of said organism which has at least 70% sequence identity with the HSC70 protein of Artemia franciscana
  • the term 'the heat shock cognate 71 kDa protein of said organism' relates to a protein that is also known as 'heat shock 70 kDa protein 8' or 'HSC70' or 'Hsp73'.
  • the protein is a heat shock protein that in humans is encoded by the HSPA8 gene on chromosome 11.
  • Hsp70 protein As a Hsp70 protein, it has a C-terminal protein substrate-binding domain and an N-terminal ATP-binding domain.
  • HSC70 proteins are the HSC70 protein of Artemia franciscana, the HSC70 protein of Metapenaeus ensis, the HSC70 protein of Penaeus vannamei, the HSC70 protein of Fenneropenaeus chinensis and the HSC70 protein of Macrobrachium nipponense.
  • the term 'the gene encoding for a protein of said organism which has at least 70% sequence identity with the HSC70 protein of Artemia franciscana' relates to a gene encoding for a protein having at least 70, 75, 80, 85, 90, 95 or 100% sequence identity with the HSC70 protein of Artemia franciscana'.
  • the percentage of amino acid sequence identity is determined by alignment of the two sequences and identification of the number of positions with identical amino acids divided by the number of amino acids in the shorter of the sequences x 100.
  • the present invention further relates to a method as described above wherein the HSC70 protein of Artemia franciscana has an amino acid sequence as represented by SEQ ID N°l.
  • the A. franciscana HSC70 protein having SEQ ID N° 1 is indicated in the following schematic diagram which, in addition, also shows the full-length open reading frame (having SEQ ID N° 2) encoding the A. franciscana HSC70.
  • the diagram further shows the ATP-binding domain of the HSC70 protein (labeled in grey), the TERLIGDAAKNQVAMNP (SEQ ID N° 11) sequence of the HSC protein (labeled in bold) and the SNP position (labeled in bold) of the invention in the encoding DNA:
  • Non-limiting examples of proteins having at least 70% sequence identity with the amino acid sequence having SEQ I D N° 1 are the HSC70 proteins present in economically important shrimp belonging to the genera Macrobrachium, Penaeus, Metapenaeus or Fenneropenaeus such as:
  • Non-limiting examples of a 'protein of said organism which has at least 70% sequence identity with the HSC70 protein of Artemia franciscana' are the HSP proteins of Scylla paramamosain, Homerus americanus, Eriocheir sinensis, and Macrobrachium rosenbergii .
  • the amino acid sequences of the latter proteins are:
  • substitution of an asparagine (Asn or N) by a lysine (Lys or K) at amino acid position 11 of the amino acid sequence TERLIGDAAKNQVAMNP within the ATP-binding domain of said protein relates to the above-indicated 11 amino acid sequence which is part of the very conserved ATP binding domain within said proteins wherein the N indicated in bold & underlined in the following sequence TERLIGDAAKNQVAMNP is substituted by a K as shown in bold & underlined in the following sequence TERLIGDAAKKQVAMNP (SEQ ID N° 12).
  • identifying a single nucleotide polymorphism in the gene relates to any method known in the art which allows to detect a SNP within a nucleic acid sequence.
  • Non-limiting examples of such methods are allele specific hybridization technologies, primer extension technologies, allele specific oligonucleotide ligation methods and invasive cleavage technologies as are -for example- described by Sobrino et al. (2005, Forensic Science International: 181-184).
  • Such a heat tolerant organism can have the intrinsic capacity to survive that higher ambient temperature "T high” or could have acquired that capacity by being exposed first to a temperature that is lower than " T high".
  • the present invention further relates to a method as described above wherein said organism is a fish or a crustacean.
  • the present invention further relates to a method as described above wherein said crustacean is a shrimp.
  • the present invention relates to a method as described above wherein said shrimp belongs to the genera Macrobrachium, Penaeus, Metapenaeus or Fenneropenaeus.
  • the present invention more specifically relates to a method as described above wherein said protein has the amino acid sequence represented by SEQ ID N° 3, 4, 5, 6, 7, 8, 9 or 10, or, any combination thereof.
  • the present invention further relates to a method as described above wherein said identifying a single nucleotide polymorphism in said gene of said organism involves the steps of genomic DNA extraction and performing a polymerase chain reaction using allele-specific primers.
  • the latter method may thus involve the steps of isolating genomic DNA and performing a PCR reaction with the primers (Forward: TACTCCTGCGTGGGTGTGTTCCAGCATGG (SEQ ID N° 13); Reverse: TGAGAATCGTTGAAGTAGGCAGG (SEQ ID N° 14)) and subsequent sequencing of the PCR fragment to detect if the fragment contains a DNA sequence that would code for the aa sequence TERLIGDAAKNQVAMNP in the wild type or a DNA sequence that would code for the aa sequence TERLIGDAAKKQVAMNP for the alternative allele associated with thermotolerance.
  • the present in invention thus also relates to a method for selecting a heat-tolerant organism which comprises the step of identifying a mutant of the heat shock cognate 71kDa protein or a mutant of a protein which has at least 70% sequence identity with the heat shock cognate 71kDa protein of Artemia franciscana and which contains the amino acid sequence TERLIGDAAKNQVAMNP wherein said mutant is characterized by the substitution of an asparagine (N) by a lysine (K) at amino acid position 11 of the amino acid sequence TERLIGDAAKNQVAMNP within the ATP-binding domain of said heat shock cognate 71kDa protein or of said protein which has at least 70% sequence identity with the heat shock cognate 71kDa protein of Artemia franciscana and which contains the amino acid sequence TERLIGDAAKNQVAMNP.
  • the terms 'identifying a mutant of the heat shock cognate 71kDa protein' relates to any method known in the art which allows to detect a mutant within an amino acid sequence.
  • Non-limiting examples of such methods are mass spectrometry methods and/or amino acid sequencing methods.
  • the present invention also relates to a single nucleotide polymorphism in the gene encoding for the heat shock cognate 71 kDa protein (HSC70) of an organism or in the gene encoding for a protein of said organism which has at least 70% sequence identity with the HSC70 protein of Artemia franciscana and which contains the amino acid sequence TERLIGDAAKNQVAMNP characterized in that an adenosine is present at a specified nucleotide position within said gene that results in the substitution of an asparagine (N) by a lysine (K) at amino acid position 11 of the amino acid sequence TERLIGDAAKNQVAMNP within the ATP-binding domain of said heat shock cognate 71kDa protein or of said protein which has at least 70% sequence identity with the HSC70 protein of Artemia franciscana and which contains the amino acid sequence TERLIGDAAKNQVAMNP.
  • the present invention also relates to the usage of a single nucleotide polymorphism in the gene as described above to select a heat-tolerant organism.
  • the present invention further relates to the usage of a mutant characterized by the substitution of an asparagine (N) by a lysine (K) at amino acid position 11 of the amino acid sequence TERLIGDAAKNQVAMNP within the ATP-binding domain of the heat shock cognate 71 kDa protein or of a protein of said organism which has at least 70% sequence identity with the HSC70 protein of Artemia franciscana and which contains the amino acid sequence TERLIGDAAKNQVAMNP to select a heat- tolerant organism.
  • N asparagine
  • K lysine
  • the decapsulated cysts were abundantly washed with sterile artificial seawater (35 g/L, Aquarium Systems), and were either suspended in 50 ml FalconTM tubes containing 30 ml sterile artificial seawater. Then, the decapsulated cysts were provided with rotation and incubated for 28 h at 28 °C with constant illumination of approximately 27 pE/m2/s. Both decapsulation and hatching procedures were performed under a laminar flow hood and using autoclaved materials (121 °C for 20 min) for preserving axenic conditions.
  • the first strand cDNA was synthesized from 1 pg of total RNA using the RevertAidTMHminus First strand cDNA synthesis kit (Fermentas) and kept at -20°C until used.
  • the partial cDNA of HSC70 was blasted to the A. franciscana transcriptome database.
  • the matching nucleotide sequences was characterized and assembled.
  • the assembled nucleotide sequence was used to design specific primers.
  • the total RNA extraction from 2.1.1 was used as template to be amplified by specific primers, in the total volume of 50 pi, containing 1.25 unit of DreamTaq DNA Polymerase (Thermo Scientific), lx DreamTaq Buffer, 0.2 mM each dNTP, 0.5 mM each primer and thermocycled with an initial denaturation step at 94 °C for 2 min, followed by 30 cycles at 94 °C for 30 s, 55 °C for 30 s and 72 °C for 3 min with the final 72 °C for 10 min.
  • the PCR product was purified by using Wizard ® S V Gel and PCR Clean-Up System (Promega). The purified fragmentswere checked by agarose gel electrophoresis and the concentration was measured with NanoDrop 2000 spectrophotometer. The purified PCR product was ligated into the pGEM cloning vector (Promega), transformed into E. coli competent cells (JM109). The constructed vector was sent for sequencing with an automated sequencer by a commercial service (LGC Genomics).
  • the conserved protein domain was predicted using SMART (a Simple Modular Architecture Research Tool) (http://smart.embl-heidelberg.de/) and identified by using human HSC70 as reference gene.
  • the theoretical isoelectric point and molecular weight were estimated by the ExPASy (https://web.expasy.org/compute_pi/).
  • Sequence alignment were done between full-length HSC70 gene from A. franciscana and full-length gene of HSC70 from other species using Clustal Omega (https://www.ebi.ac.uk/Tools/msa/clustalo/).
  • a phylogenic tree of HSC70 proteins were constructed by the neighbor-joining (NJ) algorithm with the MEGA 7.0 software based on the deduced amino acid sequences of the related genes in typical species. Bootstrap sampling was reiterated 1000 times.
  • A. fran ciscan a from a selective breeding programme, in which surviving animals from a lethal heat shock subsequent to a non-lethal heat shock (TF12) was used to identify the SNP polymorphism, by comparison with the 12th generation of A. franciscana control animal (CF12).
  • TF12 lethal heat shock subsequent to a non-lethal heat shock
  • CF12 A. franciscana control animal
  • two larvae population of San Francisco Bay (SFB, batch 1767) A. franciscana were cultured at 28°C and then were exposed 30 min to a non-lethal heat shock (NLHS) of 37°C, and subsequently transferred to 28°C for 5 h for recovery.
  • the N LHS aims at inducing resistance before a subsequent lethal heat shock (LHS).
  • the stored cysts of CF12 and TF12 were hatched under the axenic system as described in 1.1.1 o produce nuapill. After that, total RNA extraction was performed with 100 nauplii of each population. Then the cDNA was synthesized from 1 pg of total RNA. cDNA of TF12 and CF12 were used to amplify the full length ORF primer of FISP70 and FISC70. Next, the PCR product was purified before sending to sequencing. The segments of the cDNA sequencing electropherograms were analysed by using the Chromas DNA sequencing software. The difference genotype of FISP70 and FISC70 in both populations were determined. Then the SNP position was analysed and compared with other species using Clustal Omega.
  • the identified SNP in the coding region were screened in approximate 100 individual cysts of both populations.
  • the stored CT12 and TF12 cysts were washed with sterile distilled water, then each individual cyst was separated into 1.5 micro centrifuge tube, one cyst per tube.
  • DNA was extracted by using the DNA extraction kit (Wizard ® SV Genomic DNA Purification System, Promega) with some modification. In short, the individual cyst was incubated with sterile distilled water at room temperature overnight (16-18 h).
  • nuclei lysis Solution 0.5M EDTA (pH.8.0), proteinase K (20 mg/ml) and RNase A solution
  • digestion solution 0.5M EDTA (pH.8.0), proteinase K (20 mg/ml) and RNase A solution
  • genomic DNA was extracted following the standard protocol (Promega).
  • sequence specific PCR amplification technique was used in this screening by two allele-specific forward primers which difference at the 3'-terminal bases of the primer matched to the wild-type template or mutant template, resulting in allele specific amplification (Table 1).
  • the real-time PCR was developed to identify the target sequence which is preferentially amplified or poorly amplified.
  • Each genomic DNA sample from individual cyst was amplified by using qRT-PCR StepOnePlusTM Real-Time PCR System (Applied Biosystems) using Maxima SYBR Green/ROX qPCR Master Mix (Thermo Scientific) with forward and reverse primers, specific for SNP polymorphism as described above.
  • the cycling parameters started with an initial activation of 95 5 C for 5 min followed by 40 cycles of 95 5 C for 30 s, 60 5 C for 45 s and 72 5 C for 30 s.
  • the fluorescent signal intensities were recorded at the end of each cycle.
  • Melting curve analysis was performed from 55 to 95 5 C with continuous fluorescent reading every 0.5 5 C increments to confirm that the product was amplified. After that the agarose gel electrophoresis was preformed to confirm the amplicon of each primer.
  • the diversity and identity of PCR fragment amplifications from individual cyst both of CF12 and TF12 in with different genotypes were analyzed and calculated the statistic significant (x 2 and p- value) by using IBM SPSS software.
  • A.franciscana HSC70, WT (AAC) and the mutant (AAA) were cloned into a yeast expression vector and cultured at various temperature.
  • a DNA fragment containing the A. franciscana HSC70 ORF was amplified from the cDNA of TF12 pooled 100 samples. Then the amplification was checked by agarose gel electrophoresis before PCR purification was performed. The purified PCR product was cloned into pGEM cloning vector (Promega), transformed into E. coli competent cells (JM109). The Blue/white screening was performed to select for white colonies that contained inserted HSC70 fragment.
  • the DNA fragments was produced and inserted into Notl-Xbal site of Saccharomyces cerevisiae yeast expression vector, which is pYES2/CT (Invitrogen).
  • the resulting vectors were named pYES2-HSC70-WT and pYES2-HSC70-MUT.
  • both the ssalA ssa2A strain (SL314-A1, MATa trpl-1 ura3-l his3-ll,15 leu2Acanl-100 ade2-l ssal::HIS3 ssa2::LEU2) originating from the Susan Lindquist lab and kindly provided by Elizabeth Craig (University of Wisconsin, Madison, Wl) and its isogenic wild type (SL314-A1, MATa leu2-3, 112 trpl-1 ura 3-11, 15 leu2Acanl-100 ade2-l).
  • Colony from the transformation in each condition was collected, and inoculated with a single colony into 15 ml of the appropriate SC selective medium (6.7 g yeast nitrogen base with amino acid (Sigma), 0.1 g leucine (Sigma), 0.1 g lysine (Sigma), 0.1 g urasil (Sigma), 0.1 adenine (Fluka) and 2% glucose (VMR chemicals)) and incubated overnight at 28 5 C with shaking. After that, the O ⁇ eoo of the overnight cultures were determined and adjusted to 0.4 in 50 ml induction medium (SC selective medium without glucose, but containind 2% galactose (Alfa Aesar)).
  • SC selective medium 6.7 g yeast nitrogen base with amino acid (Sigma), 0.1 g leucine (Sigma), 0.1 g lysine (Sigma), 0.1 g urasil (Sigma), 0.1 adenine (Fluka) and 2% glucose (VMR chemicals)
  • A. franciscana showed 88% and 87% overall sequence identity with P. puparumand HSC70 (ACA53150.1) and A. franciscana HSP70 (AAL27404.1), respectively. Sequence alignment using ClustalW revealed a more conserved area at the ATP binding domain, substrate binding domain and a relativity large variation at variable region at the amino acid terminus (Fig. IB).
  • a phylogenetic tree was constructed based on amino acid sequences of HSC70s to identify the evolutionary position and annotate the gene functional. There were generally three main clades in phylogenetic tree which are mammalia, Crustacea and insecta (Fig. 2). Moreover, the phylogenetic tree also showed the separation between HSC70s and HSP70 (Fig. 2).
  • the full-length ORF of HSP70 and HSC70 were sequenced from the 100 pooled samples of nauplii CF12 and TF12 and analysed by the Chromas DNA sequencing software.
  • This difference was not found in the HSP70 nucleotide sequence.
  • the SNP polymorphism found at nucleotide position 177 of HSC70 in TF12 was heterozygous , namely C/A, but, in CF12 was homozygous namely C/C (Fig. 3). This SNP was located in the ATP-binding domain.
  • Fig. 5A Three possible patterns are possible as shown in Fig. 5A. Cyst number 1 was preferentially amplified with forward-C primer, but, showed poorly amplification with the forward-A primer resulting C/C homozygous genotype (Fig. 5A). In contrast, cyst number 3 was preferentially amplified with the forward-A primer, but, showed poor amplification with forward-C primer representing a A/A homozygous genotype (Fig. 5A).
  • cyst number 2 was preferentially amplified with both of C and A primers representing C/A heterozygous genotype (Fig. 5A).
  • An agarose gel electrophoresis is shown in Fig. 5B, representing eight individual cysts showing the 3 possible genotypes.
  • the PCR product patterns could be divided into three genotypes: C/C, C/A and A/A.
  • the frequencies of different genotypes in CF12 population were C/C: 72.8%, C/A: 19.4% and A:A: 7.80%.
  • the frequencies of the different genotypes were C/C: 27.5%, C/A: 67.4% and A/A: 4.10% (Table 2).
  • Table 2 Allele frequencies for 177 positions at cDNA HSC70 in CF12 and TF12 populations breeding.
  • yeast strains expressing wild-type HSC70 or N59K mutant of HSC70 protein in both of WT S. cerevisiae and ssalA ssa2A S. cerevisiae Each strain was then serially diluted onto selective medium agar containing galactose for induction (Fig 6) and the plates were incubated at 28 5 C, 34 5 C, 37 5 C and 40 5 C for 5 days ( Fig. 7).
  • the mutant N59K of HSC70 enhanced yeast cell growth at 37 5 C compared with WT HSC70 and control. The enhancement was observed in both of yeast strains (WT or ssalA ssa2A).
  • yeast strains were exposed to 40°C for different periods and then allowed to form colonies at 28°C (Fig 8). Especially after 3 or 6 h exposure to 40°C , yeast could still form colonies when it harbored the N59K allele.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Analytical Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present invention relates to the field of selecting heat-resistant, and hence disease-resistant individual organisms out of a pool of organisms. More in particular, the present invention discloses a single nucleotide polymorphism (SNP) in the heat shock protein 70 constitutive (HSC70) gene which induces heat-tolerance in an organism and which can thus be used as a genetic marker to select for a disease-resistant organisms.

Description

A single nucleotide polymorphism in the heat shock protein 70 constitutive gene for selecting heat-tolerant organisms
Technical field of invention
The present invention relates to the field of selecting heat-resistant, and hence disease-resistant individual organisms out of a pool of organisms. More in particular, the present invention discloses a single nucleotide polymorphism (SNP) in the heat shock protein 70 constitutive (HSC70) gene which induces heat-tolerance in an organism and which can thus be used as a genetic marker to select for a disease-resistant organisms.
Background art
Molecular markers such as single nucleotide polymorphisms (SNPs) are useful to evaluate the genetic status of populations. For example, SNP's in heath-shock proteins (HSPs) -which are known to be produced by cells upon exposure to stressful conditions- can be linked to heath resistance, resistance to infection and other traits. In this regard, US2003104392 disclosed a specific SNP in de 5'-flanking region of the porcine HSP70.2 gene which is useful for selecting pigs with increased growth performance. Similarly, Cai et al. (Asian-Aust. J. Anim. Sci 2005: 734) indicated that polymorphisms at the 5'-flanking region of the HSP70 gene can be used as molecular genetic markers to assist selection for anti-heat stress cows. CN104328116 further discloses specific SNPs in the HSP70 gene of the Japanese flounder (Paralichthys olivaceus) which are useful to screen for heat-resistant fish. On the other hand, Ferreira et al. (Genetics and Molecular Research 2017: 1) could not associate specific polymorphisms in the HSP70 gene of the marine shrimp Litopenaeus vannamei with tolerance to an infection with white spot syndrome virus. Blanck et al. (Pan-American Journal of Aquatic Sciences 2016: 210) showed that SNPs within the HSC70 gene -which encodes for a constitutive form of the HSP family- of the prawn Macrobrachium amazonicum could be positively associated with particular growth traits of this prawn.
However, there are no SNP's known in the HSC70 gene that induce or are responsible for resistance or tolerance against heat.
Brief description of figures
Fig 1. Sequence and the SNP detection of A. franciscana HSC70. (A) Nucleotide and deduced amino acid sequences and (B) cartoon showing a linear representation of HSC70. The ATP-binding domain are highlighted with a grey. Three HSP70 protein family signatures are labelled with bold letters and underlined. The middle region with proteinase sensitive sites is shown in bold. The C-terminal region containing an EEVD-motif is labelled with a grey background.
Fig 2. Phylogenetic trees of HSC70. The alignment of amino acid sequences was constructed by the ClustalW using the MEGA 7.0 program. HSC70 was indicated with black rhombus. The following protein sequences were used: HSC71 isoform 1 Homo sapiens (NP_006588.1); HSC71 Sus scrofa (NP_001230836.1); HSC71 Rattus norvegicus (NP_077327.1); HSC71 Meriones unguiculatus (XP_021498722.1); HSC70 Macrobrachium nipponense (ABG45886.1); HSC70 Metapenaeus ensis (ABF20530.1); HSC70 Penaeus vannamei (ABP01681.1); HSC70 Fenneropenaeus chinensis (AAW71958.1); HSC70 Orius sauteri (AIA61348.1); HSC70 NHaparvata lugens (ADE34170.1); HSC70 Macrocentrus cingulum (ACD84943.1); HSC70 Polyrhachis vicina (AGF33487.1); FISC70 Pteromalus puparum (ACA53150.1) and FISP70 Artemia franciscana (AAL27404.1)
Fig 3. Segments of the genomic DNA sequence electropherograms. Two peaks were observed in the electropherograms on TF12 sample demonstrated heterozygotes as showed in the box. Genotype are labelled on electropherograms.
Fig 4. The variation of the FISC70 deduced amino acid sequence at the polymorphism position with various species. The amino acid position of SNP was showed in black line box indicate with arrow.
Fig 5. Agarose gel electrophoresis of SNP detection. (A) The PCR product pattern of SNP detection by using C and A primer-3' that represented 3 possible genotypes (CC, CA and AA) in each cyst. (B) The SNP detection result of eight individual cyst of TF12.
Fig 6. Western blot detection of rFISC70 production. FISC70 protein production in each condition was detected by western blot analysis using anti-His tag antibody as primary antibody and secondary H RP conjugated goat anti-mouse IgG.
Fig 7. The thermotolerance selection at various temperatures. A series of 5-fold serial dilution of FISC70 WT and MUT in both stains were made and spotted on the induction medium agar. The thermotolerance selection was performed with incubation at various temperatures (28 5C, 34 5C, 37 5C and 40 5C) for 5 days.
Fig 8. The thermotolerance selection upon LHS. A series of 5-fold serial dilution of FISC70 WT and MUT in both stains were made and spotted on the induction medium agar. The agar plates were incubated at LHS (40 5C) with various time points (lh, 2h, 3h, and 6h). After that, were transferred to 28 5C incubator for 5 days. Description of invention
As indicated above, there are no SNP's known in the HSC70 gene that induce or are responsible for resistance or tolerance against heat.
The current invention discloses such a SNP. Indeed, the present invention discloses that a particular SNP in the ATP binding domain of the HSC70 gene induces heat tolerance in an organism.
More specifically, the present invention discloses that the presence of a particular SNP - i.e. the substitution of a cytosine (C) by an adenosine (A)- in the gene encoding for the heat shock cognate 71 kDa protein (HSC70) results in the substitution of an asparagine (N) by a lysine (K) in the ATP binding domain of the protein encoded by the HSC70 gene, and, that said SNP induces heat tolerance of an organism such as Artemia franciscana.
Hence, the present invention relates in first instance to a method for selecting a heat-tolerant organism which comprises the step of identifying a single nucleotide polymorphism in the gene encoding for the heat shock cognate 71 kDa protein (HSC70) of said organism or in the gene encoding for a protein of said organism which has at least 70% sequence identity with the HSC70 protein of Artemia franciscana and which contains the amino acid sequence TERLIGDAAKNQVAMNP wherein the presence of an adenosine at a specified nucleotide position within said gene that results in the substitution of an asparagine (N) by a lysine (K) at amino acid position 11 of the amino acid sequence TERLIGDAAKNQVAMNP within the ATP-binding domain of said protein indicates that said organism is heat-tolerant.
The term 'the heat shock cognate 71 kDa protein of said organism' relates to a protein that is also known as 'heat shock 70 kDa protein 8' or 'HSC70' or 'Hsp73'. The protein is a heat shock protein that in humans is encoded by the HSPA8 gene on chromosome 11. As a member of the heat shock protein 70 family and a chaperone protein, it facilitates the proper folding of newly translated and misfolded proteins, as well as stabilize or degrade mutant proteins. Its functions contribute to biological processes including signal transduction, apoptosis, autophagy, protein homeostasis, and cell growth and differentiation. As a Hsp70 protein, it has a C-terminal protein substrate-binding domain and an N-terminal ATP-binding domain. Non-limiting examples of such HSC70 proteins are the HSC70 protein of Artemia franciscana, the HSC70 protein of Metapenaeus ensis, the HSC70 protein of Penaeus vannamei, the HSC70 protein of Fenneropenaeus chinensis and the HSC70 protein of Macrobrachium nipponense.
The term 'the gene encoding for a protein of said organism which has at least 70% sequence identity with the HSC70 protein of Artemia franciscana' relates to a gene encoding for a protein having at least 70, 75, 80, 85, 90, 95 or 100% sequence identity with the HSC70 protein of Artemia franciscana'. The percentage of amino acid sequence identity is determined by alignment of the two sequences and identification of the number of positions with identical amino acids divided by the number of amino acids in the shorter of the sequences x 100.
The present invention further relates to a method as described above wherein the HSC70 protein of Artemia franciscana has an amino acid sequence as represented by SEQ ID N°l. The A. franciscana HSC70 protein having SEQ ID N° 1 is indicated in the following schematic diagram which, in addition, also shows the full-length open reading frame (having SEQ ID N° 2) encoding the A. franciscana HSC70. The diagram further shows the ATP-binding domain of the HSC70 protein (labeled in grey), the TERLIGDAAKNQVAMNP (SEQ ID N° 11) sequence of the HSC protein (labeled in bold) and the SNP position (labeled in bold) of the invention in the encoding DNA:
Figure imgf000005_0001
Figure imgf000006_0001
Non-limiting examples of proteins having at least 70% sequence identity with the amino acid sequence having SEQ I D N° 1 are the HSC70 proteins present in economically important shrimp belonging to the genera Macrobrachium, Penaeus, Metapenaeus or Fenneropenaeus such as:
-The Metapenaeus ensis HSC70 protein having SEQ ID N° 3 (and showing the TERLIGDAAKNQVAMN P sequence underlined):
Figure imgf000006_0002
-the Penaeus vannamei FISC70 protein having SEQ ID N° 4 (and showing the TERLIGDAAKNQVAMN P sequence underlined):
Figure imgf000007_0001
KVPEEDRN KIMEACNDAI KWLDTNQLGEKEEYEH KLKEI EQICNPI ITKMYQAAGGAPPGGM PGGFPGAP
GAGAAPGGGSSGPTIEEVD.
Non-limiting examples of a 'protein of said organism which has at least 70% sequence identity with the HSC70 protein of Artemia franciscana' are the HSP proteins of Scylla paramamosain, Homerus americanus, Eriocheir sinensis, and Macrobrachium rosenbergii .The amino acid sequences of the latter proteins are:
-The Scylla paramamosain HSP70 protein having SEQ I D N° 7 (and showing the
TERLIGDAAKNQVAMN P sequence underlined):
Figure imgf000008_0001
-The Homerus americanus HSP70 protein having SEQ I D N° 8 (and showing the
TERLIGDAAKNQVAMN P sequence underlined):
Figure imgf000008_0002
-The Eriocheir sinensis HSP70 protein having SEQ I D N° 9 (and showing the TERLIGDAAKNQVAMN P sequence underlined):
Figure imgf000008_0003
Figure imgf000009_0001
-The Macrobrachium rosenbergii HSP70 protein having SEQ ID N° 10 (and showing the
TERLIGDAAKNQVAMNP sequence underlined):
Figure imgf000009_0002
The terms "the substitution of an asparagine (Asn or N) by a lysine (Lys or K) at amino acid position 11 of the amino acid sequence TERLIGDAAKNQVAMNP within the ATP-binding domain of said protein" relates to the above-indicated 11 amino acid sequence which is part of the very conserved ATP binding domain within said proteins wherein the N indicated in bold & underlined in the following sequence TERLIGDAAKNQVAMNP is substituted by a K as shown in bold & underlined in the following sequence TERLIGDAAKKQVAMNP (SEQ ID N° 12).
The terms "identifying a single nucleotide polymorphism in the gene" relates to any method known in the art which allows to detect a SNP within a nucleic acid sequence. Non-limiting examples of such methods are allele specific hybridization technologies, primer extension technologies, allele specific oligonucleotide ligation methods and invasive cleavage technologies as are -for example- described by Sobrino et al. (2005, Forensic Science International: 181-184).
The term 'heat tolerant organism' refers to an organism which is still alive -at thus still metabolizes- at higher ambient temperatures (= T high) whereas a normal or a 'non-heat tolerant' organism would die -and would thus stop metabolizing- at the latter higher ambient temperatures. Such a heat tolerant organism can have the intrinsic capacity to survive that higher ambient temperature "T high" or could have acquired that capacity by being exposed first to a temperature that is lower than " T high".
The present invention further relates to a method as described above wherein said organism is a fish or a crustacean.
The present invention further relates to a method as described above wherein said crustacean is a shrimp.
The present invention relates to a method as described above wherein said shrimp belongs to the genera Macrobrachium, Penaeus, Metapenaeus or Fenneropenaeus.
The present invention more specifically relates to a method as described above wherein said protein has the amino acid sequence represented by SEQ ID N° 3, 4, 5, 6, 7, 8, 9 or 10, or, any combination thereof.
The present invention further relates to a method as described above wherein said identifying a single nucleotide polymorphism in said gene of said organism involves the steps of genomic DNA extraction and performing a polymerase chain reaction using allele-specific primers. The latter method may thus involve the steps of isolating genomic DNA and performing a PCR reaction with the primers (Forward: TACTCCTGCGTGGGTGTGTTCCAGCATGG (SEQ ID N° 13); Reverse: TGAGAATCGTTGAAGTAGGCAGG (SEQ ID N° 14)) and subsequent sequencing of the PCR fragment to detect if the fragment contains a DNA sequence that would code for the aa sequence TERLIGDAAKNQVAMNP in the wild type or a DNA sequence that would code for the aa sequence TERLIGDAAKKQVAMNP for the alternative allele associated with thermotolerance.
The present in invention thus also relates to a method for selecting a heat-tolerant organism which comprises the step of identifying a mutant of the heat shock cognate 71kDa protein or a mutant of a protein which has at least 70% sequence identity with the heat shock cognate 71kDa protein of Artemia franciscana and which contains the amino acid sequence TERLIGDAAKNQVAMNP wherein said mutant is characterized by the substitution of an asparagine (N) by a lysine (K) at amino acid position 11 of the amino acid sequence TERLIGDAAKNQVAMNP within the ATP-binding domain of said heat shock cognate 71kDa protein or of said protein which has at least 70% sequence identity with the heat shock cognate 71kDa protein of Artemia franciscana and which contains the amino acid sequence TERLIGDAAKNQVAMNP.
The terms 'identifying a mutant of the heat shock cognate 71kDa protein' relates to any method known in the art which allows to detect a mutant within an amino acid sequence. Non-limiting examples of such methods are mass spectrometry methods and/or amino acid sequencing methods. The present invention also relates to a single nucleotide polymorphism in the gene encoding for the heat shock cognate 71 kDa protein (HSC70) of an organism or in the gene encoding for a protein of said organism which has at least 70% sequence identity with the HSC70 protein of Artemia franciscana and which contains the amino acid sequence TERLIGDAAKNQVAMNP characterized in that an adenosine is present at a specified nucleotide position within said gene that results in the substitution of an asparagine (N) by a lysine (K) at amino acid position 11 of the amino acid sequence TERLIGDAAKNQVAMNP within the ATP-binding domain of said heat shock cognate 71kDa protein or of said protein which has at least 70% sequence identity with the HSC70 protein of Artemia franciscana and which contains the amino acid sequence TERLIGDAAKNQVAMNP.
The present invention also relates to the usage of a single nucleotide polymorphism in the gene as described above to select a heat-tolerant organism.
The present invention further relates to the usage of a mutant characterized by the substitution of an asparagine (N) by a lysine (K) at amino acid position 11 of the amino acid sequence TERLIGDAAKNQVAMNP within the ATP-binding domain of the heat shock cognate 71 kDa protein or of a protein of said organism which has at least 70% sequence identity with the HSC70 protein of Artemia franciscana and which contains the amino acid sequence TERLIGDAAKNQVAMNP to select a heat- tolerant organism.
Examples
1. Materials and Methods
1.1 HSC70 A. franciscana gene organization
1.1.1 Experimental animal preparation and total RNA extraction
To identify the complete gene of HSC70 in A. franciscana, the Artemia cysts originating from the San Francisco Bay (SFB, batch 1768) were hatched under the axenic system starting with the decapsulation step (Norouzitallab et al., FISH & SHELLFISH IMMUNOLOGY 42.2 (2015): 426-429). Briefly, the cysts were hydrated in sterile distilled water for lh with O2 generator continuous mixture. After that, cysts were decapsulated by adding NaOH (32%) and NaOCI (50%). The decapsulation step was stopped by adding autoclaved Na2S203 (lOg/L). Then, the decapsulated cysts were abundantly washed with sterile artificial seawater (35 g/L, Aquarium Systems), and were either suspended in 50 ml Falcon™ tubes containing 30 ml sterile artificial seawater. Then, the decapsulated cysts were provided with rotation and incubated for 28 h at 28 °C with constant illumination of approximately 27 pE/m2/s. Both decapsulation and hatching procedures were performed under a laminar flow hood and using autoclaved materials (121 °C for 20 min) for preserving axenic conditions. After 28 h, swimming nauplii were selected, and transfered to the new 50 ml Falcon™ tubes containing 30 ml sterile artificial seawater and cultured under the same hatching condition for 2 days. 100 animals were collected in 1.5 microcentrifuge tube. Then the total RNA was extracted using RNeasy Plus Mini Kit (Qiagen). The purity and quantity of the RNA were determined by NanoDrop 2000 spectrophotometer and 2 % agarose gel electrophoresis (Thermo Scientific), respectively. The first strand cDNA was synthesized from 1 pg of total RNA using the RevertAid™Hminus First strand cDNA synthesis kit (Fermentas) and kept at -20°C until used.
1.1.2 Bioinformatic analysis and PCR amplification of HSC70 complete gene
The partial cDNA of HSC70 was blasted to the A. franciscana transcriptome database. The matching nucleotide sequences was characterized and assembled. The assembled nucleotide sequence was used to design specific primers. The total RNA extraction from 2.1.1 was used as template to be amplified by specific primers, in the total volume of 50 pi, containing 1.25 unit of DreamTaq DNA Polymerase (Thermo Scientific), lx DreamTaq Buffer, 0.2 mM each dNTP, 0.5 mM each primer and thermocycled with an initial denaturation step at 94 °C for 2 min, followed by 30 cycles at 94 °C for 30 s, 55 °C for 30 s and 72 °C for 3 min with the final 72 °C for 10 min. The PCR product was purified by using Wizard® S V Gel and PCR Clean-Up System (Promega). The purified fragmentswere checked by agarose gel electrophoresis and the concentration was measured with NanoDrop 2000 spectrophotometer. The purified PCR product was ligated into the pGEM cloning vector (Promega), transformed into E. coli competent cells (JM109). The constructed vector was sent for sequencing with an automated sequencer by a commercial service (LGC Genomics).
1.1.3 Gene characterization and phylogenetic analysis of FISC70
The full-length cDNA sequences of FISC70 in A. franciscana were analyzed using the National Center of Biotechnology Information (NCBI) BLAST program (https://blast.ncbi.nlm.nih.gov/Blast.cgi). The amino acid sequence for HSC70 protein was deduced by the Open Reading Frame (ORF) Finder application (https://www.ncbi.nlm.nih.gov/orffinder/) and the signal peptide was predicted by SignalP4.1 (http://www.cbs.dtu.dk/services/SignalP/). The conserved protein domain was predicted using SMART (a Simple Modular Architecture Research Tool) (http://smart.embl-heidelberg.de/) and identified by using human HSC70 as reference gene. The theoretical isoelectric point and molecular weight were estimated by the ExPASy (https://web.expasy.org/compute_pi/). Sequence alignment were done between full-length HSC70 gene from A. franciscana and full-length gene of HSC70 from other species using Clustal Omega (https://www.ebi.ac.uk/Tools/msa/clustalo/). A phylogenic tree of HSC70 proteins were constructed by the neighbor-joining (NJ) algorithm with the MEGA 7.0 software based on the deduced amino acid sequences of the related genes in typical species. Bootstrap sampling was reiterated 1000 times.
1.2 Single nucleotide polymorphism (SNP) analysis
1.2.1 Experimental animal
The 12th generation of A. fran ciscan a from a selective breeding programme, in which surviving animals from a lethal heat shock subsequent to a non-lethal heat shock (TF12) was used to identify the SNP polymorphism, by comparison with the 12th generation of A. franciscana control animal (CF12). In short, two larvae population of San Francisco Bay (SFB, batch 1767) A. franciscana were cultured at 28°C and then were exposed 30 min to a non-lethal heat shock (NLHS) of 37°C, and subsequently transferred to 28°C for 5 h for recovery. The N LHS aims at inducing resistance before a subsequent lethal heat shock (LHS). After 5 h recovery from the initial stress, a 10 min LHS at 41°C was applied as selective pressure, followed by a transfer back to 28°C. Surviving animals were used to grow the next generation. (TF population). Survivors were cultured during 4 weeks to produce the next generation. They were treated with N LHS and followed with a more severe LHS (ranging from 41°C to 41.5°C) and/or increased exposure time (ranging from 10 to 35 min) to keep the selection pressure at ~1%. In parallel, permissive conditions were applied to the second larvae population as a control (CF population). Cysts produced by every generation were stored.
1.2.2 Identification and analysis of SNP polymorphism in the full-length ORF of A. franciscana FISP70 and HSC70
The stored cysts of CF12 and TF12 were hatched under the axenic system as described in 1.1.1 o produce nuapill. After that, total RNA extraction was performed with 100 nauplii of each population. Then the cDNA was synthesized from 1 pg of total RNA. cDNA of TF12 and CF12 were used to amplify the full length ORF primer of FISP70 and FISC70. Next, the PCR product was purified before sending to sequencing. The segments of the cDNA sequencing electropherograms were analysed by using the Chromas DNA sequencing software. The difference genotype of FISP70 and FISC70 in both populations were determined. Then the SNP position was analysed and compared with other species using Clustal Omega.
1.2.3 Screening of SNP polymorphisms in two A. franciscana populations with differential heat tolerance
The identified SNP in the coding region were screened in approximate 100 individual cysts of both populations. The stored CT12 and TF12 cysts were washed with sterile distilled water, then each individual cyst was separated into 1.5 micro centrifuge tube, one cyst per tube. DNA was extracted by using the DNA extraction kit (Wizard® SV Genomic DNA Purification System, Promega) with some modification. In short, the individual cyst was incubated with sterile distilled water at room temperature overnight (16-18 h). After that, water was removed and the digestion solution (nuclei lysis Solution, 0.5M EDTA (pH.8.0), proteinase K (20 mg/ml) and RNase A solution) was added and incubated overnight in a 55°C water bath (Grant Insruments). Next Day, genomic DNA was extracted following the standard protocol (Promega). The sequence specific PCR amplification technique was used in this screening by two allele-specific forward primers which difference at the 3'-terminal bases of the primer matched to the wild-type template or mutant template, resulting in allele specific amplification (Table 1). The real-time PCR was developed to identify the target sequence which is preferentially amplified or poorly amplified. Each genomic DNA sample from individual cyst was amplified by using qRT-PCR StepOnePlus™ Real-Time PCR System (Applied Biosystems) using Maxima SYBR Green/ROX qPCR Master Mix (Thermo Scientific) with forward and reverse primers, specific for SNP polymorphism as described above. The cycling parameters started with an initial activation of 955C for 5 min followed by 40 cycles of 955C for 30 s, 60 5C for 45 s and 725C for 30 s. The fluorescent signal intensities were recorded at the end of each cycle. Melting curve analysis was performed from 55 to 955C with continuous fluorescent reading every 0.55C increments to confirm that the product was amplified. After that the agarose gel electrophoresis was preformed to confirm the amplicon of each primer. The diversity and identity of PCR fragment amplifications from individual cyst both of CF12 and TF12 in with different genotypes were analyzed and calculated the statistic significant (x2 and p- value) by using IBM SPSS software.
Table 1: Nucleotide sequence of the primers used
Figure imgf000014_0001
1.3 Phenotype analysis by yeast cell growth and thermotolerance selection
1.3.1 Vector construction
Two allelic variaties of A.franciscana HSC70, WT (AAC) and the mutant (AAA), were cloned into a yeast expression vector and cultured at various temperature. A DNA fragment containing the A. franciscana HSC70 ORF was amplified from the cDNA of TF12 pooled 100 samples. Then the amplification was checked by agarose gel electrophoresis before PCR purification was performed. The purified PCR product was cloned into pGEM cloning vector (Promega), transformed into E. coli competent cells (JM109). The Blue/white screening was performed to select for white colonies that contained inserted HSC70 fragment. To separate the WT and the mutant HSC70 genotype, colony PCR was performed. All white colonies were picked and dissolved in sterile distilled water and used as the PCR template. Each genotype was verified with two allele-specific forward primers (Table 1) as described in 2.2.2. After that, both of WT and mutant FISC70 PCR products were purified and then send for sequencing to confirm the SNP polymorphism. Next, the DNA fragments containing the FISC70 ORF both of WT and mutant allele were amplified with the full-length ORF primer conjugated to restriction enzyme site (Notl-F and R-Xbal). The DNA fragments was produced and inserted into Notl-Xbal site of Saccharomyces cerevisiae yeast expression vector, which is pYES2/CT (Invitrogen). The resulting vectors were named pYES2-HSC70-WT and pYES2-HSC70-MUT.
1.3.2 Protein expression and thermotolerance selection
The constructed vectors were again sequenced to confirm the different sequences .After that, pYES2-FISC70-WT, pYES2-FISC70-MUT and the control (empty vector of pTES2/CT) were transformed, using the S.c. EasyComp™ Transformation kit (Invitrogen) into S. cerevisiae , both the ssalA ssa2A strain (SL314-A1, MATa trpl-1 ura3-l his3-ll,15 leu2Acanl-100 ade2-l ssal::HIS3 ssa2::LEU2) originating from the Susan Lindquist lab and kindly provided by Elizabeth Craig (University of Wisconsin, Madison, Wl) and its isogenic wild type (SL314-A1, MATa leu2-3, 112 trpl-1 ura 3-11, 15 leu2Acanl-100 ade2-l). Colony from the transformation in each condition was collected, and inoculated with a single colony into 15 ml of the appropriate SC selective medium (6.7 g yeast nitrogen base with amino acid (Sigma), 0.1 g leucine (Sigma), 0.1 g lysine (Sigma), 0.1 g urasil (Sigma), 0.1 adenine (Fluka) and 2% glucose (VMR chemicals)) and incubated overnight at 28 5C with shaking. After that, the the Oϋeoo of the overnight cultures were determined and adjusted to 0.4 in 50 ml induction medium (SC selective medium without glucose, but containind 2% galactose (Alfa Aesar)). The adjustment overnight cultures were pelleted and resuspended in 50 ml induction medium and cultured 24 h at 28 5C with shaking. A series of 5-fold serial dilution were made and spotted on the induction medium agar and incubated at various temperatures (28 5C, 34 5C, 37 5C and 40 5C) for 5 days. 2. Results
2.1 cDNA of A. franciscana HSC70 and sequence analysis
The Assembly result of the partial sequence HSC70 from the transcriptome database of A. franciscana was confirmed by PCR and sequencing technique. Then the sequence was annotated by using BlastX in NCBI database to identify the gene functionality. The full-length cDNA of HSC70 had predicted ORF of 1953 bp in length which encodes a polypeptide of 650 amino acid (Fig. 1A). Sequence analysis using the SignalP program revealed that HSC70 did not have a signaling peptide, resulting in a 650 residues mature protein with a calculated molecular mass of 70.89 kDa and predicted pi of 5.38.
The deduced amino acid sequence of A. franciscana showed 88% and 87% overall sequence identity with P. puparumand HSC70 (ACA53150.1) and A. franciscana HSP70 (AAL27404.1), respectively. Sequence alignment using ClustalW revealed a more conserved area at the ATP binding domain, substrate binding domain and a relativity large variation at variable region at the amino acid terminus (Fig. IB). A phylogenetic tree was constructed based on amino acid sequences of HSC70s to identify the evolutionary position and annotate the gene functional. There were generally three main clades in phylogenetic tree which are mammalia, Crustacea and insecta (Fig. 2). Moreover, the phylogenetic tree also showed the separation between HSC70s and HSP70 (Fig. 2).
2.2 SNP identification of HSP70 and HSC70
The full-length ORF of HSP70 and HSC70were sequenced from the 100 pooled samples of nauplii CF12 and TF12 and analysed by the Chromas DNA sequencing software. We found double peaks in the TF12 pool of HSC70 as compared to CF12 that showed only one clearly peak (Fig. 3) However, this difference was not found in the HSP70 nucleotide sequence. The SNP polymorphism found at nucleotide position 177 of HSC70 in TF12 was heterozygous , namely C/A, but, in CF12 was homozygous namely C/C (Fig. 3). This SNP was located in the ATP-binding domain. After SNP analysis, the result showed that this SNP was a synonymous polymorphism that changed Asparagine (AAC) to Lysine (AAA). Moreover, the group of amino acid was changed from polar side chain to electrically charged side chain (negative charged). Fifteen species including A. franciscana were compared by using Clustal tool. The result showed that all species share a similar amino acid in the SNP position, namely Asparagine (N) (Fig. 4).
2.3 SNP identification of HSC70 and the association with thermotolerant of A. franciscana
The individual cysts of each population were used to identify the allelic status of the HSC70. After genomic DNA extraction, real-time PCR was used to identify using two allele-specific forward primers. The size of PCR product was approximately 100 bp. Three possible patterns are possible as shown in Fig. 5A. Cyst number 1 was preferentially amplified with forward-C primer, but, showed poorly amplification with the forward-A primer resulting C/C homozygous genotype (Fig. 5A). In contrast, cyst number 3 was preferentially amplified with the forward-A primer, but, showed poor amplification with forward-C primer representing a A/A homozygous genotype (Fig. 5A). Moreover, cyst number 2 was preferentially amplified with both of C and A primers representing C/A heterozygous genotype (Fig. 5A). An agarose gel electrophoresis is shown in Fig. 5B, representing eight individual cysts showing the 3 possible genotypes. The PCR product patterns could be divided into three genotypes: C/C, C/A and A/A. The frequencies of different genotypes in CF12 population were C/C: 72.8%, C/A: 19.4% and A:A: 7.80%. On the other hand, the frequencies of the different genotypes were C/C: 27.5%, C/A: 67.4% and A/A: 4.10% (Table 2). c2 test showed significant difference for this mutation site between CF12 and TF12 population (c2 =49.2) and P value also showed significant difference: P= 0.000 (P<0.01) (Table 2).
Table 2: Allele frequencies for 177 positions at cDNA HSC70 in CF12 and TF12 populations breeding.
Figure imgf000017_0001
Statistically significant (p<0.01)
To determine the effect of the SNP (C177A; N59K) on yeast cell growth, we constructed yeast strains expressing wild-type HSC70 or N59K mutant of HSC70 protein in both of WT S. cerevisiae and ssalA ssa2A S. cerevisiae. Each strain was then serially diluted onto selective medium agar containing galactose for induction (Fig 6) and the plates were incubated at 28 5C, 34 5C, 37 5C and 40 5C for 5 days ( Fig. 7). The mutant N59K of HSC70 enhanced yeast cell growth at 37 5C compared with WT HSC70 and control. The enhancement was observed in both of yeast strains (WT or ssalA ssa2A). On the other hand, the significant difference of yeast cell growth was not observed at 28 5C in both yeast stain. Whereas, at 40 5C, none of the yeast strains can survive. In an alternative experiment, the yeast strains were exposed to 40°C for different periods and then allowed to form colonies at 28°C (Fig 8). Especially after 3 or 6 h exposure to 40°C , yeast could still form colonies when it harbored the N59K allele.

Claims

Claims
1. A method for selecting a heat-tolerant organism which comprises the step of identifying a single nucleotide polymorphism in the gene encoding for the heat shock cognate 71 kDa protein (HSC70) of said organism or in the gene encoding for a protein of said organism which has at least 70% sequence identity with the HSC70 protein of Artemia franciscana and which contains the amino acid sequence TERLIGDAAKNQVAMNP wherein the presence of an adenosine at a specified nucleotide position within said gene that results in the substitution of an asparagine (N) by a lysine (K) at amino acid position 11 of the amino acid sequence TERLIGDAAKNQVAMNP within the ATP-binding domain of said protein indicates that said organism is heat-tolerant.
2. A method according to claim 1 wherein the HSC70 protein of Artemia franciscana has an amino acid sequence as represented by SEQ ID N°l.
3. A method according to any of claims 1-2 wherein said organism is a fish or a crustacean.
4. A method according to claim 3 wherein said crustacean is a shrimp.
5. A method according to claim 4 wherein said shrimp belongs to the genera Macrobrachium, Penaeus, Metapenaeus or Fenneropenaeus.
6. A method according to claims 1 or 2 wherein said protein has the amino acid sequence represented by SEQ ID N° 3, 4, 5, 6, 7, 8, 9 or 10.
7. A method according to claims 1-6 wherein said identifying a single nucleotide polymorphism in said gene of said organism involves the steps of genomic DNA extraction and performing a polymerase chain reaction using allele-specific primers.
8. A method for selecting a heat-tolerant organism which comprises the step of identifying a mutant of the heat shock cognate 71kDa protein or of a protein which has at least 70% sequence identity with the heat shock cognate 71kDa protein of Artemia franciscana wherein said mutant is characterized by the substitution of an asparagine (N) by a lysine (K) at amino acid position 11 of the amino acid sequence TERLIGDAAKNQVAMNP within the ATP-binding domain of said heat shock cognate 71kDa protein or of said protein which has at least 70% sequence identity with the heat shock cognate 71kDa protein of Artemia franciscana and which contains the amino acid sequence TERLIGDAAKNQVAMNP.
9. A single nucleotide polymorphism in the gene encoding for the heat shock cognate 71 kDa protein (HSC70) of an organism or in the gene encoding for a protein of said organism which has at least 70% sequence identity with the HSC70 protein of Artemia franciscana and which contains the amino acid sequence TERLIGDAAKNQVAMNP characterized in that an adenosine is present at a specified nucleotide position within said gene that results in the substitution of an asparagine (N) by a lysine (K) at amino acid position 11 of the amino acid sequence
TERLIGDAAKNQVAMNP within the ATP-binding domain of said heat shock cognate 71kDa protein or of said protein which has at least 70% sequence identity with the HSC70 protein of Artemia franciscana and which contains the amino acid sequence TERLIGDAAKNQVAMNP.
10. Use of a single nucleotide polymorphism in the gene according to claim 9 to select a heat- tolerant organism.
11. Use of a mutant characterized by the substitution of an asparagine (N) by a lysine (K) at amino acid position 11 of the amino acid sequence TERLIGDAAKNQVAMNP within the ATP-binding domain of the heat shock cognate 71 kDa protein or of a protein of said organism which has at least 70% sequence identity with the HSC70 protein of Artemia franciscana and which contains the amino acid sequence TERLIGDAAKNQVAMNP to select a heat-tolerant organism.
PCT/EP2019/081883 2018-11-22 2019-11-20 A single nucleotide polymorphism in the heat shock protein 70 constitutive gene for selecting heat-tolerant organisms Ceased WO2020104503A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP18207679.4 2018-11-22
EP18207679 2018-11-22

Publications (1)

Publication Number Publication Date
WO2020104503A1 true WO2020104503A1 (en) 2020-05-28

Family

ID=64650104

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2019/081883 Ceased WO2020104503A1 (en) 2018-11-22 2019-11-20 A single nucleotide polymorphism in the heat shock protein 70 constitutive gene for selecting heat-tolerant organisms

Country Status (1)

Country Link
WO (1) WO2020104503A1 (en)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN116219026A (en) * 2022-12-15 2023-06-06 华中农业大学 A combination of SNP marker primers and its application to improve the high temperature resistance of Procambarus clarkii
CN118441071A (en) * 2024-06-03 2024-08-06 广西壮族自治区水产科学研究院(广西壮族自治区渔业病害防治环境监测和质量检验中心、广西壮族自治区水生野生动物救护中心) Cold-resistant property related molecular marker of heat shock protein 70 of penaeus vannamei boone and application
CN118957106A (en) * 2024-10-21 2024-11-15 中国水产科学研究院黄海水产研究所 Molecular marker 15W1 for high WSSV resistance of Litopenaeus vannamei and its application
CN118979115A (en) * 2024-10-22 2024-11-19 中国水产科学研究院黄海水产研究所 A molecular marker 15W6 for WSSV resistance of Litopenaeus vannamei and its primers and applications
CN119372328A (en) * 2024-10-25 2025-01-28 首都医科大学 A combination of SNP molecular markers for gerbils and its application

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030104392A1 (en) 2001-11-27 2003-06-05 En-Chung Lin Detection of growth performance of pigs
CN101948832A (en) * 2010-09-16 2011-01-19 华南农业大学 Heat resistance associated molecular marker on chicken heat stress protein 70 gene and acquiring method and application thereof
CN104328116A (en) 2014-11-06 2015-02-04 中国海洋大学 SNP (single-nucleotide polymorphism) locus related to heat resistance of Paralichthys olivaceus and application thereof

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030104392A1 (en) 2001-11-27 2003-06-05 En-Chung Lin Detection of growth performance of pigs
CN101948832A (en) * 2010-09-16 2011-01-19 华南农业大学 Heat resistance associated molecular marker on chicken heat stress protein 70 gene and acquiring method and application thereof
CN104328116A (en) 2014-11-06 2015-02-04 中国海洋大学 SNP (single-nucleotide polymorphism) locus related to heat resistance of Paralichthys olivaceus and application thereof

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
BLANCK ET AL., PAN-AMERICAN JOURNAL OF AQUATIC SCIENCES, 2016, pages 210
CAI ET AL., ASIAN-AUST. J. ANIM. SCI, vol. 734, 2005
FERREIRA ET AL., GENETICS AND MOLECULAR RESEARCH, 2017, pages 1
JIE QI ET AL: "Molecular characterization of heat shock protein 70 (HSP 70) promoter in Japanese flounder (Paralichthys olivaceus), and the association of Pohsp70 SNPs with heat-resistant trait", FISH AND SHELLFISH IMMUNOLOGY, vol. 39, no. 2, 9 June 2014 (2014-06-09), GB, pages 503 - 511, XP055546806, ISSN: 1050-4648, DOI: 10.1016/j.fsi.2014.05.038 *
NOROUZITALLAB ET AL., FISH & SHELLFISH IMMUNOLOGY, vol. 42.2, 2015, pages 426 - 429
SOBRINO ET AL., FORENSIC SCIENCE INTERNATIONAL, 2005, pages 181 - 184

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN116219026A (en) * 2022-12-15 2023-06-06 华中农业大学 A combination of SNP marker primers and its application to improve the high temperature resistance of Procambarus clarkii
CN118441071A (en) * 2024-06-03 2024-08-06 广西壮族自治区水产科学研究院(广西壮族自治区渔业病害防治环境监测和质量检验中心、广西壮族自治区水生野生动物救护中心) Cold-resistant property related molecular marker of heat shock protein 70 of penaeus vannamei boone and application
CN118957106A (en) * 2024-10-21 2024-11-15 中国水产科学研究院黄海水产研究所 Molecular marker 15W1 for high WSSV resistance of Litopenaeus vannamei and its application
CN118957106B (en) * 2024-10-21 2025-04-08 中国水产科学研究院黄海水产研究所 Molecular marker 15W1 for high WSSV resistance of Litopenaeus vannamei and its application
CN118979115A (en) * 2024-10-22 2024-11-19 中国水产科学研究院黄海水产研究所 A molecular marker 15W6 for WSSV resistance of Litopenaeus vannamei and its primers and applications
CN119372328A (en) * 2024-10-25 2025-01-28 首都医科大学 A combination of SNP molecular markers for gerbils and its application

Similar Documents

Publication Publication Date Title
AU2007242752B2 (en) A sex-specific marker for shrimps and prawns
CN111850133B (en) A low temperature-tolerance-associated SNP molecular marker, detection primer and application of Litopenaeus vannamei
CN109628613B (en) A molecular marker related to laying and egg quality traits of laying ducks and its application
WO2016101859A1 (en) Rice blast resistant gene pi50, preparation methods therefor, and applications thereof
CN113005204A (en) Vibrio-resistant related EST-STR marker of litopenaeus vannamei, specific primer and detection method thereof
CN104328116A (en) SNP (single-nucleotide polymorphism) locus related to heat resistance of Paralichthys olivaceus and application thereof
CN104450729B (en) Pig flesh characters is correlated with the clone of WNT10B gene molecule marker and application
CN108315444A (en) A kind of multiple PCR primer and discrimination method differentiating layer of green-shell egg genotype
WO2019160136A1 (en) Method for determining sex of yellowtails
CN114891896A (en) An EST-SSR marker for identification of specific disease-resistant strains of Litopenaeus vannamei and its application
KR101508689B1 (en) Markers for origin discrimination of the northern mauxia shrimp(Acetes chinensis)
KR101437383B1 (en) Method for origin verification of snow crab
CN103525822A (en) Detection method and application of molecular marker about resistance of piglet diarrhea
CN102010868A (en) Garrupa MHC (Major Histocompatibility Complex) IIB gene as well as cloning method and application thereof
Junprung et al. Balancing selection at the ATP binding site of heat shock cognate 70 (HSC70) contributes to increased thermotolerance in Artemia franciscana
Abdullah et al. Genetic diversity for three populations of Rainbow Trout (Oncorhynchus mykiss) based on sequencing of mtDNA genes
Nanekarani et al. Genotypic frequency of calpastatin gene in Atabi sheep by PBR method
KR101437381B1 (en) Method for triploid verification of Pacific oyster
Chaves et al. Survey of a cDNA library from the turkey (Meleagris gallopavo)
CN105462995A (en) Barnea dilatata mitochondrial COI gene amplification primer
CN105112425A (en) Molecular cloning and application of pork quality character related gene Myo6 (Myosin 6)
Sadr et al. DNA polymorphism of butyrophilin gene by PCR-RFLP technique
KR101499693B1 (en) Single Nucleotide Polymorphic DNA markers for discriminating habitat of the Korean striped bitterling, Acheilognathus yamatsutae and a method using the same
CN101974517B (en) Amplification primers for large yellow croaker IFNG (Interferon-Gamma Gene) and design method thereof
Yuan et al. Isolation and characterization of new microsatellite markers in red tail prawn, Fenneropenaeus penicillatus, an endangered species in China

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 19805305

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 19805305

Country of ref document: EP

Kind code of ref document: A1