CN101974517B - Amplification primers for large yellow croaker IFNG (Interferon-Gamma Gene) and design method thereof - Google Patents
Amplification primers for large yellow croaker IFNG (Interferon-Gamma Gene) and design method thereof Download PDFInfo
- Publication number
- CN101974517B CN101974517B CN 201010517705 CN201010517705A CN101974517B CN 101974517 B CN101974517 B CN 101974517B CN 201010517705 CN201010517705 CN 201010517705 CN 201010517705 A CN201010517705 A CN 201010517705A CN 101974517 B CN101974517 B CN 101974517B
- Authority
- CN
- China
- Prior art keywords
- intron
- yellow croaker
- large yellow
- sequence
- exon
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses amplification primers for a large yellow croaker IFNG (Interferon-Gamma Gene) and a design method thereof, relating to a pair of primers IF (Interferon) and IR (Infrared). The invention provides amplification primers of a first intron SSR (Simple Sequence Repeat) sequence of the large yellow croaker IFNG and a design method thereof. The amplification primers comprise two single-chain oligonucleotides. The design method comprises the following steps of: registering Genebank to search the conservation region of a teleostean IFNG, carrying out homologous comparison to obtain a pair of amplification primers, obtaining a fragment of the large yellow croaker IFNG by using a PCR (Polymerase Chain Reaction) method, and sequencing; and comparing the obtained sequence by using homologous comparison software BLAST, finding out the sequence of the first intron of the large yellow croaker IFNG and the position of the SSR sequence in the first intron, and designing the amplification primers capable of being used for amplifying the first intron SSR sequence of the large yellow croaker IFNG.
Description
Technical field
The present invention relates to pair of primers IF and IR, especially relate to amplimer and the method for design thereof of a pair of large yellow croaker IFNG gene First Intron SSR sequence that can efficiently increase.
Background technology
Large yellow croaker is one of most important marine products economic fish of China.In Zhejiang and Fujian, the aquaculture of large yellow croaker is in large scale, has very high economic and social benefit.But, because human fishes for and the cultivation activity on a large scale, the germ plasm resource of large yellow croaker is produced very large impact, comprise that the scale of natural population descends, mutually mix between the different geographic populations, extensive disease frequently breaks out, and affected the sound development of the aquaculture of large yellow croaker.
The SSR sequence claims again microsatellite sequence, refers to the strand of dna connection tumor-necrosis factor glycoproteins of 1～6 base, is distributed in the Eukaryotic whole genome, and the variation of the repetition number of SSR own has consisted of the basis of its polymorphism.Wang Deqian etc. ([2] Wang Deqian, Lu Lizhi. the progress of microsatellite DNA. Zhejiang Agriculture science, 2005, (1): 1-4) can design the primer pair genomic dna according to specific sequence and carry out pcr amplification.Thereby detect the genetic diversity of species on dna level.Be widely used ([3] Liu Zhiyi at evaluation, specific gene location and clone, population genetic construction analysis, heredopathia and the linkage analysis in production traits site of animal sibship, the aspects such as structure of genetic linkage map, Xiang Jianhai. the application of Microsatellite DNA molecular marker in the marine animal genetic analysis. ocean science, 2001,25 (6): 11-13).
IFNG is exactly interferon-gamma, is again II type Interferon, rabbit, can viral interference copy, the immune response of activating cells mediation, the sterilizing function of activating macrophage, be an important cytokine in the vertebrate immune system.At present, IFNG has been applied to the aspect such as diagnosis, treatment, immunological adjuvant of disease.Simultaneously, the genotype of IFNG, especially the polymorphism of its First Intron SSR sequence ([4] Kate Schroder closely related with resistance against diseases especially, Pa μ l J.Hertzog, Timothy Ravasi, David A.H μ Me.Interferon-gamma:an overview of signals, mechanisms and functions[J] Journal of Leukocyte Biology, 2004,75 (2): 163-189; [5] Vera Pravica, Chris Perrey, Adam Stevens, Jar-How Lee, Ian V.Hutchinson.A single nucleotide polymorphism in the first intron of the h μ Man IFN-γ gene:Absolute correlation with a polymorphic CA microsatellite marker of high IFN-γ production [J] .H μ Man Immunology, 2000,61 (9): 863-866; [6] Mohammed Awad, Vera Pravica, Chris Perrey, Ahmed El Gamel, Nizar Yonan, Pa μ l J.Sinnott, Ian V.Hutchinson.CA repeat allele polymorphism in the first intron of the h μ Man interferon-γ gene is associated with lung allograft fibrosis[J] H μ Man Immunology, 1999,60 (4): 343-346).
Therefore, the exploitation of the amplimer of large yellow croaker IFNG gene First Intron SSR sequence, not only can be applied to the discriminating of the geographical population of large yellow croaker, the assessment of germ plasm resource, and can be used as a dna marker chain with disease, serve the large yellow croaker breeding for disease resistance the production practice activity ([7] Wang Wenwen, Chang Yumei, Liang Liqun. little satellite is analyzed the genetic diversity of four large yellow croaker colonies. the Fisheries Science magazine, 2009,22 (2): 6-11).
Summary of the invention
The object of the present invention is to provide amplimer and the method for design thereof of large yellow croaker IFNG gene First Intron SSR sequence.
The amplimer of large yellow croaker IFNG gene First Intron SSR sequence of the present invention is comprised of two single strain oligonucleotides, wherein upstream primer IF has 20 base: TACAAGCCCTGTTTCCTCCT, and downstream primer IR has 20 base: TCTGCTGTAACTGTTGTGAG.
The method of design of the amplimer of large yellow croaker IFNG gene First Intron SSR sequence of the present invention may further comprise the steps:
1) log in the conserved regions that Genebank searches for teleostei IFNG gene, through the homology comparison, obtain the pair for amplification primer, wherein upstream primer EF is: 5 '-ATGAACAAAACCATCCAGAGC-3 '; Downstream primer ER is: 5 '-TTTCTTCAGAATGTAGTTCAG-3 ', and the amplification scope of this primer comprises IFNG gene First Exon, First Intron, Second Exon, intron 2 and the 3rd exon sequence;
In step 1) in, the clip size of described amplification is about 2700bps.
2) amplimer employing step 1), obtain the fragment of large yellow croaker IFNG gene by long PCR method amplification, comprise First Exon, First Intron, Second Exon, intron 2 and the 3rd exon sequence, the amplified production of gained is connected in the pMD19-T carrier, transform e. coli jm109, picking list bacterium colony checks order;
In step 2) in, the concrete steps of described long PCR method are:
(1) configuration PCR reaction solution.With Taq enzyme 0.75 unit, 10 * PCR buffer, 2.5 μ l, dNTP (dATP, dTTP, dGTP, each 2.5mM of dCTP) each 1 μ l of 2 μ l, large yellow croaker DNA 50ng, primer EF (10 μ M) and ER (10 μ M) adds 200 μ l centrifuge tubes, add water to 25 μ l, mixing drips 1 in mineral oil and avoids evaporating.
(2) above-mentioned PCR reaction solution is carried out the PCR circulation.
The first step: 94 ℃ of sex change 5min; Second step: 94 ℃ of sex change 1min, 48～53 ℃ of annealing 0.5～1.5min, 72 ℃ are extended 1～3.5min; Second step repeats 30～35 times; The 3rd step: 72 ℃ are extended 10min; The 4th step: keep 4 ℃ of time-outs.
Because the product fragment that increases is longer, and the PCR reaction conditions is adjusted.The LA Taq enzyme that comprises the long-chain PCR special use of using the production of TAKARA company replaces general T aq enzyme; Denaturation temperature can drop to 48 ℃ from 53 ℃; The extension time can extend to 3.5min from 1min.Experimental results show that these adjustment all help to improve success ratio and the productive rate of PCR.
(3) amplified production with gained is connected in the pMD19-T carrier, transform e. coli jm109, picking list bacterium colony checks order, and actual sequencing result has 2720bps, comprises First Exon, First Intron, Second Exon, intron 2, the 3rd exon sequence.
Described long PCR method refers to the LATaq enzyme by reducing denaturation temperature, prolonging the extension time and use TAKARA company to produce; Described reduction denaturation temperature is to drop to 48 ℃ from 53 ℃, and the described prolongation extension time is to extend to 3.5min, the LATaq enzyme that described LATaq enzyme can adopt TAKARA company to produce.
3) use homology comparison software BLAST that large yellow croaker IFNG gene order and other teleostei IFNG gene orders of gained are compared, find out the sequence of First Intron in the large yellow croaker IFNG gene, and the position of the SSR sequence in the First Intron, according to this sequences Design go out can be used for to increase amplimer IF:TACAAGCCCTGTTTCCTCCT and the IR:TCTGCTGTAACTGTTGTGAG of large yellow croaker IFNG gene First Intron SSR sequence, the amplified fragments size is between 350～450bps.
The amplimer IF of large yellow croaker IFNG gene First Intron SSR sequence of the present invention and IR carry out pcr amplification to the large yellow croaker of different population, all can obtain the specific amplification products of clip size between 350～450bps.Through order-checking and with the comparison of large yellow croaker IFNG gene order, turn out to be the amplified production of IFNG gene First Intron, and all contain the SSR sequence.Thereby for discriminating, the assessment of germ plasm resource, the molecular mark of the geographical population of large yellow croaker provides a strong instrument.
Embodiment
The amplimer of large yellow croaker IFNG gene First Intron SSR sequence of the present invention is comprised of two single strain oligonucleotides, wherein upstream primer IF has 20 base: TACAAGCCCTGTTTCCTCCT, and downstream primer IR has 20 base: TCTGCTGTAACTGTTGTGAG.
The large yellow croaker of above-mentioned primer pair different population carries out pcr amplification, all can obtain the specific amplification products of clip size between 350～450bps.Through order-checking and with the comparison of large yellow croaker IFNG gene order, turn out to be the amplified production of IFNG gene First Intron, and all contain the SSR sequence.Thereby for discriminating, the assessment of germ plasm resource, the molecular mark of the geographical population of large yellow croaker provides a strong instrument.
High variation zone amplication primer of rockfish mitochondrial genome of the present invention adopts the following methods design:
1) log in Genebank, (network address is
Http:// www.ncbi.nlm.nih.govFull name is National Center for Biotechnology Information, all published gene orders in the world today are included in this website) conserved regions of search teleostei IFNG gene, compare through homology, obtain the pair for amplification primer, wherein upstream primer EF is: 5 '-ATGAACAAAACCATCCAGAGC-3 '; Downstream primer ER is: 5 '-TTTCTTCAGAATGTAGTTCAG-3 ', the amplification scope of this primer comprises IFNG gene First Exon, First Intron, Second Exon, intron 2, the 3rd exon sequence, and the amplified fragments size is about 2700bps.
The IFNG gene First Intron that its main use of above-mentioned amplimer is to increase and comprises the SSR sequence is for the design of the SSR aligning primer of amplification IFNG gene First Intron lays the foundation.
2) amplimer employing step 1) is by the purpose fragment of long PCR method amplification acquisition large yellow croaker.Because the product fragment that increases is longer, and the PCR reaction conditions is adjusted.The amplified production of gained is connected in the pMD19-T carrier, transforms e. coli jm109, picking list bacterium colony checks order, and the result comprises First Exon, First Intron, Second Exon, intron 2, the 3rd exon sequence.
Described adjustment PCR reaction conditions refers to the LATaq enzyme by reducing denaturation temperature, prolong the extension time (denaturation temperature can drop to 48 ℃ from 53 ℃, and the extension time can extend to 3.5min) and using TAKARA company to produce.
3) use homology comparison software BLAST that large yellow croaker IFNG gene order and other teleostei IFNG gene orders of gained are compared, find out first the sequence of large yellow croaker IFNG gene First Exon, Second Exon, the 3rd exon, then find out the sequence of two introns according to the sequence of three exons, and in First Intron, find out the SSR sequence.Design amplimer IF:TACAAGCCCTGTTTCCTCCT and the IR:TCTGCTGTAACTGTTGTGAG of the large yellow croaker IFNG gene First Intron SSR sequence that can be used for increasing according to the gene order of this SSR sequence upstream and downstream, the amplified fragments size is between 350～450bps.
Homology comparison software BLAST can use on http://blast.ncbi.nlm.nih.gov online.BLAST carries out the software that sequence homology is compared to nucleic acid and protein sequence.The similarity of different types of intron is very low, can't carry out the BLAST comparison, and the similarity of different types of exon is higher, can carry out the BLAST comparison.Can obtain the sequence of First Exon, Second Exon, the 3rd exon by BLAST comparison, being between First Exon and the Second Exon is exactly First Intron, and being between Second Exon and the 3rd exon is exactly intron 2.Find out the SSR sequence that exists in the First Intron sequence, and design at its upstream primer I F:TACAAGCCCTGTTTCCTCCT, at downstream design primer I R:TCTGCTGTAACTGTTGTGAG, be used for the amplification of this SSR sequence.
Embodiment 1: amplification large yellow croaker IFNG gene is from the sequence between First Exon to the three exons.
Log in Genebank, search obtains the conserved regions of the IFNG gene of bony fish lefteye flounder and filefish, lays respectively at First Exon and the 3rd exon, compares through homology, design pair for amplification primer, wherein upstream primer EF is: 5 '-ATGAACAAAACCATCCAGAGC-3 '; Downstream primer ER is: 5 '-TTTCTTCAGAATGTAGTTCAG-3 ', the amplification scope of this primer comprises IFNG gene First Exon, First Intron, Second Exon, intron 2, the 3rd exon sequence, and the amplified fragments size is estimated between 1300bps～3000bps.
Adopt above-mentioned amplimer EF and ER, obtain the purpose fragment of large yellow croaker by long PCR method amplification.Concrete operations are:
1) configuration PCR reaction solution.With Taq enzyme 0.75 unit, 10 * PCR buffer, 2.5 μ l, dNTP (dATP, dTTP, dGTP, each 2.5mM of dCTP) each 1 μ l of 2 μ l, large yellow croaker DNA 50ng, primer EF (10 μ M) and ER (10 μ M) adds 200 μ l centrifuge tubes, add water to 25 μ l, mixing drips 1 in mineral oil and avoids evaporating.
2) above-mentioned PCR reaction solution is carried out the PCR circulation.
The first step: 94 ℃ of sex change 5min; Second step: 94 ℃ of sex change 1min, 48～53 ℃ of annealing 0.5～1.5min, 72 ℃ are extended 1～3.5min; Second step repeats 30～35 times; The 3rd step: 72 ℃ are extended 10min; The 4th step: keep 4 ℃ of time-outs.
Because the product fragment that increases is longer, and the PCR reaction conditions is adjusted.The LA Taq enzyme that comprises the long-chain PCR special use of using the production of TAKARA company replaces general T aq enzyme; Denaturation temperature can drop to 48 ℃ from 53 ℃; The extension time can extend to 3.5min from 1min.Experimental results show that these adjustment all help to improve success ratio and the productive rate of PCR.
3) amplified production with gained is connected in the pMD19-T carrier, transform e. coli jm109, picking list bacterium colony checks order, and actual sequencing result has 2720bps, comprises First Exon, First Intron, Second Exon, intron 2, the 3rd exon sequence.
Embodiment 2: the amplimer of designing the large yellow croaker IFNG gene First Intron SSR sequence that can be used for increasing.Use homology comparison software BLAST that the large yellow croaker IFNG gene order of gained and the IFNG gene order of other bony fish lefteye flounders and filefish are compared.Learn that in the sequencing result of above-mentioned large yellow croaker IFNG gene fragment, 1～36bps is First Exon, 716～787bps is Second Exon, and 2544～2720bps is the sequence of the 3rd exon.Sequence between First Exon and the Second Exon, 37～715bps is exactly First Intron, the sequence between same Second Exon and the 3rd exon, 788～2543bps is exactly intron 2.Simultaneously find out the SSR sequence in the First Intron sequence, be positioned at 195～264bps, CA repeats 35 times.At SSR sequence upstream design primer I F:TACAAGCCCTGTTTCCTCCT, at SSR sequence downstream design primer I R:TCTGCTGTAACTGTTGTGAG, be used for amplification large yellow croaker IFNG gene First Intron SSR sequence.
Embodiment 3: be used for the checking of the amplimer of amplification large yellow croaker IFNG gene First Intron SSR sequence.Concrete operations are:
1) gets each 5 of Zhejiang, ALONG COASTAL FUJIAN large yellow croakers, 10 parts of DNA of extracting.
2) configuration PCR reaction solution.With Taq enzyme 0.75 unit, 10 * PCR buffer, 2.5 μ l, dNTP (dATP, dTTP, dGTP, each 2.5mM of dCTP) each 1 μ l of 1.6 μ l, 1 part of DNA 50ng, primer I F (10 μ M) and IR (10 μ M) adds 200 μ l centrifuge tubes, add water to 25 μ l, mixing drips 1 in mineral oil and avoids evaporating.
3) above-mentioned PCR reaction solution is carried out the PCR circulation.
The first step: 94 ℃ of sex change 5min; Second step: 94 ℃ of sex change 0.5～1min, 50～53 ℃ of annealing 0.5～1min, 72 ℃ are extended 0.5～1min; Second step repeats 30～35 times; The 3rd step: 72 ℃ are extended 10min; The 4th step: keep 4 ℃ of time-outs.
4) electrophoresis detection, 10 parts of PCR product sizes all between 350～450bps, have 1～2 band.
5) reclaim the order-checking of PCR product, sequencing result by with the comparison of large yellow croaker IFNG gene order, turn out to be the amplified production of IFNG gene First Intron, and all contain the SSR sequence.
Claims (3)
1. the amplimer of large yellow croaker IFNG gene First Intron SSR sequence, it is characterized in that being formed by two single strain oligonucleotides, wherein upstream primer IF has 20 base: TACAAGCCCTGTTTCCTCCT, and downstream primer IR has 20 base: TCTGCTGTAACTGTTGTGAG.
2. the method for design of the amplimer of large yellow croaker IFNG gene First Intron SSR sequence as claimed in claim 1 is characterized in that may further comprise the steps:
1) log in the conserved regions that Genebank searches for teleostei IFNG gene, through the homology comparison, obtain the pair for amplification primer, wherein upstream primer EF is: 5 '-ATGAACAAAACCATCCAGAGC-3 '; Downstream primer ER is: 5 '-TTTCTTCAGAATGTAGTTCAG-3 ', and the amplification scope of this primer comprises IFNG gene First Exon, First Intron, Second Exon, intron 2 and the 3rd exon sequence;
2) adopt amplimer described in the step 1), obtain the fragment of large yellow croaker IFNG gene by long PCR method amplification, comprise First Exon, First Intron, Second Exon, intron 2 and the 3rd exon sequence, the amplified production of gained is connected in the pMD19-T carrier, transform e. coli jm109, picking list bacterium colony checks order;
3) use homology comparison software BLAST that large yellow croaker IFNG gene order and other teleostei IFNG gene orders of gained are compared, find out the sequence of First Intron in the large yellow croaker IFNG gene, and the position of the SSR sequence in the First Intron, according to this sequences Design go out can be used for to increase amplimer IF:TACAAGCCCTGTTTCCTCCT and the IR:TCTGCTGTAACTGTTGTGAG of large yellow croaker IFNG gene First Intron SSR sequence, the amplified fragments size is between 350～450bps.
3. the method for design of the amplimer of large yellow croaker IFNG gene First Intron SSR sequence as claimed in claim 2 is characterized in that in step 2) in, the concrete steps of described long PCR method are:
1) preparation PCR reaction solution: Taq enzyme 0.75 unit, 10 * PCR buffer, 2.5 μ l, dNTP 2 μ l, large yellow croaker DNA 50ng, primer EF 1 μ l and primer ER 1 μ l are added 200 μ l centrifuge tubes, add water to 25 μ l, mixing drips 1 in mineral oil and avoids evaporating; Described dNTP is comprised of dATP, dTTP, dGTP and dCTP, and the concentration of described dATP, dTTP, dGTP and dCTP is 2.5mM; The concentration of the concentration of described primer EF and primer ER is 10 μ M;
2) above-mentioned PCR reaction solution is carried out the PCR circulation;
The first step: 94 ℃ of sex change 5min; Second step: 94 ℃ of sex change 1min, 48～53 ℃ of annealing 0.5～1.5min, 72 ℃ are extended 1～3.5min; Second step repeats 30～35 times; The 3rd step: 72 ℃ are extended 10min; The 4th step: keep 4 ℃ of time-outs;
3) amplified production with gained is connected in the pMD19-T carrier, transform e. coli jm109, picking list bacterium colony checks order, and actual sequencing result has 2720bps, comprises First Exon, First Intron, Second Exon, intron 2, the 3rd exon sequence.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201010517705 CN101974517B (en) | 2010-10-22 | 2010-10-22 | Amplification primers for large yellow croaker IFNG (Interferon-Gamma Gene) and design method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201010517705 CN101974517B (en) | 2010-10-22 | 2010-10-22 | Amplification primers for large yellow croaker IFNG (Interferon-Gamma Gene) and design method thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101974517A CN101974517A (en) | 2011-02-16 |
| CN101974517B true CN101974517B (en) | 2013-01-02 |
Family
ID=43574425
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201010517705 Expired - Fee Related CN101974517B (en) | 2010-10-22 | 2010-10-22 | Amplification primers for large yellow croaker IFNG (Interferon-Gamma Gene) and design method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101974517B (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1587419A (en) * | 2004-06-28 | 2005-03-02 | 厦门大学 | Large yellow croaker mitochondrial molecule mark and its use in identification for cultivated population and wild population |
| CN1966723A (en) * | 2006-11-28 | 2007-05-23 | 厦门大学 | Determination primer and method for yellow croaker in different population |
-
2010
- 2010-10-22 CN CN 201010517705 patent/CN101974517B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1587419A (en) * | 2004-06-28 | 2005-03-02 | 厦门大学 | Large yellow croaker mitochondrial molecule mark and its use in identification for cultivated population and wild population |
| CN1966723A (en) * | 2006-11-28 | 2007-05-23 | 厦门大学 | Determination primer and method for yellow croaker in different population |
Non-Patent Citations (4)
| Title |
|---|
| Cui-Luan Yao 等.Molecular cloning and expression of IRF1 in large yellow croaker,.《Fish & Shellfish Immunology》.2010,第28卷654-660页. * |
| Cui-LuanYao等.MolecularcloningandexpressionofIRF1inlargeyellowcroaker .《Fish & Shellfish Immunology》.2010 |
| Wenbiao Zheng 等.Cloning and expression analysis of interferon- inducible-lysosomal thiol reductase gene in large yellow croaker (Pseudosciaena crocea).《Molecular Immunology》.2006,第43卷2135-2141页. * |
| 郝君 等.大黄鱼微卫星标记的富集与筛选.《中国水产科学》.2006,第13卷(第5期),762-766页. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101974517A (en) | 2011-02-16 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Kayang et al. | Microsatellite loci in Japanese quail and cross-species amplification in chicken and guinea fowl | |
| Panigrahi et al. | Molecular characterization and expression profile of partial TLR4 gene in association to mastitis in crossbred cattle | |
| Horbańczuk et al. | A search for sequence similarity between chicken (Gallus domesticus) and ostrich (Struthio camelus) microsatellite markers | |
| Liu et al. | A microsatellite linkage map of striped bass (Morone saxatilis) reveals conserved synteny with the three-spined stickleback (Gasterosteus aculeatus) | |
| Chi et al. | High genetic diversities between isolates of the fish parasite Cryptocaryon irritans (Ciliophora) suggest multiple cryptic species | |
| Dehnavi et al. | Association between yearling weight and calpastatin and calpain loci polymorphism in Iranian Zel sheep | |
| Maitra et al. | Fecundity gene SNPs as informative markers for assessment of Indian goat genetic architecture | |
| CN101974517B (en) | Amplification primers for large yellow croaker IFNG (Interferon-Gamma Gene) and design method thereof | |
| Kale et al. | Genetic diversity among Indian Gir, Deoni and Kankrej cattle breeds based on microsatellite markers | |
| Nadeem et al. | Genetic and genomic dissection of Prolactin revealed potential association with milk production traits in riverine buffalo | |
| Ma et al. | Isolation and characterization of polymorphic microsatellite loci from a dinucleotide-enriched genomic library of obscure puffer (Takifugu obscurus) and cross-species amplification | |
| Li et al. | Microsatellites within genes and ESTs of the Pacific oyster Crassostrea gigas and their transferability in five other Crassostrea species | |
| Greyling et al. | Development of a high-throughput microsatellite typing approach for forensic and population genetic analysis of wild and domestic African Bovini. | |
| Zhu et al. | High genetic diversity and differentiation in three red tilapia stocks revealed by microsatellite DNA marker analysis | |
| CN106591298A (en) | Amplification primer and amplification method of complete mitochondrial genome sequence of nibea miichthioides chu | |
| Xu et al. | Expressed sequence tag-simple sequence repeat-based molecular variance in two Salicornia (Amaranthaceae) populations | |
| Xing et al. | Isolation and characterization of polymorphic microsatellite loci from a dinucleotide-enriched genomic library of spotted maigre (Nibea albiflora) | |
| Sun et al. | Fourteen polymorphic microsatellite markers isolated from big-head croaker (Collichthys lucidus) | |
| Ma et al. | Development of 40 microsatellite markers in spotted halibut (Verasper variegatus) and the cross-species amplification in barfin flounder (Verasper moseri). | |
| Chen et al. | Evolutionary relationship of three mitten crabs (Eriocheir sp) revealed by mitogenome and 5S ribosomal DNA analysis | |
| Kim et al. | Development and validation of single nucleotide polymorphism (SNP) markers from an expressed sequence tag (EST) database in olive flounder (Paralichthys olivaceus) | |
| Zhang et al. | Identification and characterization of polymorphic microsatellite loci in the red-crowned crane | |
| Qi et al. | Development of new polymorphic microsatellite markers in topmouth culter (Culter alburnus) and determination of their applicability in Culter mongolicus | |
| Fan et al. | Development and characterization of 20 microsatellite markers in spotted sea bass (Lateolabrax maculatus) and cross-amplification in related species | |
| Karsli | Assessment of genetic diversity and conservation priorities in some Turkish indigenous Hair goat populations by microsatellite loci |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20130102 Termination date: 20151022 |
|
| EXPY | Termination of patent right or utility model |