WO2020096240A1 - Dna aptamer specifically binding to glutathione and use thereof - Google Patents

Dna aptamer specifically binding to glutathione and use thereof Download PDF

Info

Publication number
WO2020096240A1
WO2020096240A1 PCT/KR2019/014051 KR2019014051W WO2020096240A1 WO 2020096240 A1 WO2020096240 A1 WO 2020096240A1 KR 2019014051 W KR2019014051 W KR 2019014051W WO 2020096240 A1 WO2020096240 A1 WO 2020096240A1
Authority
WO
WIPO (PCT)
Prior art keywords
glutathione
aptamer
present
seq
group
Prior art date
Application number
PCT/KR2019/014051
Other languages
French (fr)
Korean (ko)
Inventor
손인식
Original Assignee
주식회사 넥스모스
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 넥스모스 filed Critical 주식회사 넥스모스
Publication of WO2020096240A1 publication Critical patent/WO2020096240A1/en

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L3/00—Preservation of foods or foodstuffs, in general, e.g. pasteurising, sterilising, specially adapted for foods or foodstuffs
    • A23L3/34—Preservation of foods or foodstuffs, in general, e.g. pasteurising, sterilising, specially adapted for foods or foodstuffs by treatment with chemicals
    • A23L3/3454—Preservation of foods or foodstuffs, in general, e.g. pasteurising, sterilising, specially adapted for foods or foodstuffs by treatment with chemicals in the form of liquids or solids
    • A23L3/3463—Organic compounds; Microorganisms; Enzymes
    • A23L3/3571—Microorganisms; Enzymes
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A23L33/17—Amino acids, peptides or proteins
    • A23L33/18—Peptides; Protein hydrolysates
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/04—Peptides having up to 20 amino acids in a fully defined sequence; Derivatives thereof
    • A61K38/06—Tripeptides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/06—Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite
    • A61K47/26—Carbohydrates, e.g. sugar alcohols, amino sugars, nucleic acids, mono-, di- or oligo-saccharides; Derivatives thereof, e.g. polysorbates, sorbitan fatty acid esters or glycyrrhizin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00—Cosmetics or similar toiletry preparations
    • A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/30—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
    • A61K8/60—Sugars; Derivatives thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q19/00—Preparations for care of the skin
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K1/00—General methods for the preparation of peptides, i.e. processes for the organic chemical preparation of peptides or proteins of any length
    • C07K1/107—General methods for the preparation of peptides, i.e. processes for the organic chemical preparation of peptides or proteins of any length by chemical modification of precursor peptides
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K5/00—Peptides containing up to four amino acids in a fully defined sequence; Derivatives thereof
    • C07K5/02—Peptides containing up to four amino acids in a fully defined sequence; Derivatives thereof containing at least one abnormal peptide link
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/115—Aptamers, i.e. nucleic acids binding a target molecule specifically and with high affinity without hybridising therewith ; Nucleic acids binding to non-nucleic acids, e.g. aptamers

Definitions

  • the present invention relates to a DNA aptamer specifically binding to glutathione and its use, and more specifically, a DNA aptamer specifically binding to glutathione and a manufacturing method thereof, a method for stabilizing glutathione using the same, and It relates to a composition for this purpose, and the use.
  • Glutathione is a tripeptide composed of three amino acids, glutamine, cysteine, and cysteine, which prevent damage to important cellular components caused by reactive oxygen species such as free radicals, peroxides, lipid peroxides, and heavy metals. It is known as an anti-oxidant, anti-inflammatory, anti-carcinogen, anti-aging and bionutrient with enhanced immune function.
  • glutathione is easily oxidized to glutathione disulfide (GSSG) as a thiol group of glutathione (GSH) in a general formulation over time. Since glutathione has a very low ability to penetrate the cell membrane, absorption of glutathione into the cell is low, and bioavailability is low due to instability in a neutral or alkaline environment, resulting in low utilization. Therefore, the need for new methods or materials for inhibiting the oxidation of glutathione has long existed.
  • the present invention has been devised by the necessity of the above, and an object of the present invention is to provide a method for preventing and stabilizing oxidation of glutathione.
  • Another object of the present invention is to provide a substance having an anti-oxidative action of glutathione.
  • Another object of the present invention is to provide a substance that stabilizes glutathione.
  • Another object of the present invention is to provide a use as a cosmetic, health functional food by using a substance that prevents oxidation and stabilizes glutathione.
  • Another object of the present invention is to provide a substance that maintains the reduced state of glutathione and maintains its function for a long time through stabilization.
  • Another object of the present invention is to manufacture cosmetics, health functional foods and foods through a method of maintaining the reduced state of glutathione and stabilizing the antioxidant function for a long time.
  • the present invention provides a method for preventing glutathione from oxidation by treating glutathione with aptamer.
  • the aptamer is preferably composed of one nucleotide sequence selected from the group consisting of the nucleotide sequences set forth in SEQ ID NOs: 1 to 23, but in addition to the aptamer, it has been demonstrated through examples of the present invention, etc. All aptamers having different sequences as described above and achieving the desired effect of the present invention are included in the protection scope of the present invention.
  • the present invention provides a method for stabilizing glutathione by treating glutathione with aptamer.
  • the aptamer in the case of the glutathione, preferably inhibits the oxidation of the thiol group of glutathione, but is not limited thereto.
  • the present invention provides an aptamer that prevents or stabilizes antioxidants.
  • the antioxidant is glutathione, vitamin C, vitamin A, retinol, vitamin E, astaxanthin, resveratinol, polyphenol, coenzyme Q10, a material selected from the group consisting of peptides and oils It is preferred, but is not limited thereto.
  • the present invention provides a cosmetic composition comprising the aptamer of the present invention as an active ingredient.
  • the present invention provides a food composition comprising the aptamer of the present invention as an active ingredient.
  • the food is preferably a food selected from the group consisting of beverages, confectionery, candy, dairy products, gums, berries, breads, and ice cream, but is not limited thereto.
  • the present invention provides a pharmaceutical composition comprising the aptamer of the present invention as an active ingredient.
  • aptamine is defined as an aptamer that protects antioxidants.
  • aptamine G is a DNA aptamer that specifically binds glutathione, meaning an aptamer that prevents and stabilizes glutathione oxidation.
  • the present invention provides aptamine G, a DNA aptamer that specifically binds glutathione.
  • the present invention provides aptamine G, an aptamer that prevents and stabilizes glutathione oxidation.
  • the present invention provides a cosmetic containing aptamine G.
  • the cosmetic product containing the aptamine G is preferably, but not limited to, a feature that has anti-aging, wrinkle removal, whitening, and moisturizing effects.
  • the present invention provides a cosmetic product containing aptamine G prepared by the method of the present invention.
  • a specific component is attached to the end of the aptamine G, and the specific component is preferably characterized by a component having anti-aging, wrinkle removal, whitening, and moisturizing effects.
  • the specific component is preferably characterized by a component having anti-aging, wrinkle removal, whitening, and moisturizing effects.
  • it is not limited to this.
  • the characteristic components of the present invention can use any raw material used in cosmetics regardless of any kind of extract or active substance.
  • the present invention provides a cosmetic composition comprising the aptamine G of the present invention.
  • the present invention summarizes the use of cosmetic raw materials / materials containing aptamine G of the present invention as follows.
  • glutathione is a very unstable substance used as the main material for functional cosmetics. When exposed to air, it is easily combined with oxygen and decomposed, and its function is quickly lost. It helps capture these substances through aptamine G, thereby inhibiting the binding of the substances to oxygen, thereby maintaining the substances as stable as possible.
  • aptasensing is a method that can detect various conditions of the skin first and release substances necessary for the skin in accordance with the condition, and can be used in various fields such as beauty and treatment. It is possible to implement a system that senses ATP secreted at different concentrations according to the temperature of the skin, or secretes skin active ingredients accordingly after the aptamer detects cytokines secreted according to the condition of the skin. Accordingly, it can be designed to control the duration or reduce unnecessary overload on the skin by secreting an appropriate amount of anti-aging material.
  • Aptamers are a method of detecting a specific substance using a three-dimensional structure of single strand DNA or RNA, similar to an antigen-antibody reaction, but the size of the substance is much smaller, and its activity can be regulated in various ways. This is an easy advantage.
  • it is possible to synthesize aptamers that bind to very small chemicals (glutathione), etc., and it is easy to maintain its efficacy constant because it is produced by chemical synthesis.
  • Glutathione is a tripeptide composed of three amino acids, glutamine, cysteine, and cysteine, and the reduced form and thiol group are glutathione disulfide (GSSG), which are oxidized.
  • the reduced state of glutathione is maintained through the thiol group of glutathione and the base constituting the aptamer of the present invention (FIG. 1).
  • Glutathione which is in a reduced state in combination with aptamine G of the present invention, can be used in skin-like compositions and health functional foods of various formulations of cream type or hydrogel type including collagen, elastin, hyaluronic acid, and the like.
  • the present invention also includes a method of gradually releasing glutathione according to various conditions of the skin (aptasensing) through an aptamer that reacts differently according to the condition of the skin or external stimulation (for example, ultraviolet or skin temperature or acidity). For example, when the structure of the aptamer changes according to ultraviolet irradiation of the skin, the combined glutathione is released, or when the ATP amount changes according to the change in the temperature or acidity of the skin, the structure of the aptamer G binding to it changes to release glutathione. And how to do it.
  • the present invention includes the use of cosmetics of various formulations (serum, gel, lotion, cream, toner, mask pack, etc.) containing the aptamer G and glutathione of the present invention as active ingredients.
  • the cosmetic composition is preferably further comprising one or more of collagen, elastin, hyaluronic acid and peptides, but is not limited thereto.
  • the present invention provides a health functional food composition comprising the aptamine G and glutathione complex of the present invention or aptamine G alone as an active ingredient.
  • glutathione suitable for the dietary supplement of the present invention are glutathione, vitamin A, vitamin C, vitamin D, vitamin E, vitamin K, vitamin B 6, vitamin B 12, thiamine, riboflavin, biotin, folic acid, niacin, pantothenic acid, these Mixtures, etc.
  • suitable mineral nutrients to be included in the dietary supplement composition include sodium, potassium, calcium, magnesium, phosphorus, sulfur, chlorine, iron, copper, iodine, zinc, selenium, manganese, chromium, molybdenum, fluorine, cobalt, and compounds thereof. Those that have more than one element selected.
  • herbs can also be used as health functional food.
  • herbs are selected from those with various medicinal or dietary supplement properties.
  • herbs are aromatic plants or parts of plants that can be used for medicinal or flavoring purposes.
  • the present invention provides a method of delaying the oxidation rate by binding glutamine to glutathione to maintain a reduced state of an antioxidant containing glutathione.
  • vitamin C like glutathione, vitamin C, vitamin A (Retinol), vitamin E, astaxanthin, resveratinol, polyphenol, coenzyme Q10, Peptide, Oil, etc.
  • vitamin C like glutathione, vitamin C, vitamin A (Retinol), vitamin E, astaxanthin, resveratinol, polyphenol, coenzyme Q10, Peptide, Oil, etc.
  • the present invention provides an aptamer and an antioxidant component complex developed for its antioxidant component, or separately provides an active aptamer and an antioxidant component.
  • the antioxidant substance including glutathione is vitamin C, vitamin A, retinol, vitamin E, astaxanthin, resveratrol, 4'-acetoxy resveratrol, catechin, various polyphenols, Epigallocatechin gallate, coenzyme Q10, ubiquinol, ubiquinone, omega 3, and is preferably a material selected from the group consisting of oil, but is not limited thereto.
  • the present invention provides a beverage composition comprising aptamine G and aptamine G and a glutathione complex of the present invention as an active ingredient or aptamine G alone in a beverage.
  • the composition is preferably, but is not limited to, further comprising at least one of collagen, elastin, hyaluronic acid, and peptide.
  • the present invention provides a food composition comprising the aptamer and / or antioxidant of the present invention as an active ingredient.
  • the food composition is preferably one or more of collagen, elastin, hyaluronic acid, and peptide, but is not limited thereto.
  • the food composition is preferably, but not limited to, confectionery, candy, dairy, gum, or berry, bread, or ice cream.
  • the present invention provides a method for preparing food by adding aptamine G of the present invention to the food.
  • the food and beverage composition is absorbed into the body, and when the structure of aptamine G is changed, the bound glutathione is released, or when the amount of ATP changes according to the environmental change in the body, aptamine binds to it.
  • the structure of G is changed, it is preferable to release glutathione, but it is not limited thereto.
  • preventing and stabilizing the oxidation of glutathione using an aptamer is a safe and innovative new concept approach compared to the existing method, and it can be manufactured to maximize the effect by applying it to various industries.
  • composition of the present invention is a pharmaceutical composition
  • it can be used in an application that shows the pharmacological effect of glutathione mentioned in the background art.
  • a pharmaceutically acceptable carrier, excipient, or diluent may be included in addition to the active ingredients described above.
  • the carrier, excipients and diluents include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, Polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil.
  • the pharmaceutical composition of the present invention can be formulated and used in the form of an oral dosage form such as a powder, granule, tablet, capsule, suspension, emulsion, syrup, aerosol, external preparation, suppository, or sterile injectable solution, respectively, according to a conventional method.
  • an oral dosage form such as a powder, granule, tablet, capsule, suspension, emulsion, syrup, aerosol, external preparation, suppository, or sterile injectable solution, respectively, according to a conventional method.
  • it may be prepared using diluents or excipients such as fillers, weights, binders, wetting agents, disintegrating agents, surfactants, etc., which are commonly used.
  • Solid preparations for oral administration include, but are not limited to, tablets, pills, powders, granules, capsules, and the like.
  • Such a solid preparation may be prepared by mixing at least one excipient other than the active ingredient, for example, starch, calcium carbonate, sucrose, lactose, gelatin, and the like.
  • excipients such as magnesium stearate and talc may be used in addition to simple excipients.
  • various excipients such as wetting agents, sweeteners, fragrances, and preservatives, can be added.
  • Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations and challenges.
  • Non-aqueous solvents and suspensions may include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate.
  • injectable esters such as ethyl oleate.
  • a base for suppositories witepsol, macrosol, tween 61, cacao butter, laurin butter, and glycerogelatin may be used.
  • the suitable dosage of the pharmaceutical composition of the present invention depends on the patient's condition and body weight, the degree of disease, the drug form, and the time, but may be appropriately selected by a person skilled in the art, and the daily dosage of the composition is preferably It is 0.001 mg / kg body weight to 500 mg / kg body weight, and can be divided and administered once to several times a day as needed.
  • the aptamer of the present invention has an anti-oxidation and stabilizing effect of glutathione, the aptamer of the present invention regulates the release rate of the skin active ingredient, and the specific substances secreted from the skin It is expected to have the function of controlling the release component of the antioxidant according to the amount.
  • the aptamer of the present invention has an antioxidant effect of an antioxidant such as glutathione, and the complex of the present invention alone or the aptamer and glutathione maintains a reduced state of glutathione by using, for example, an aptamer that selectively binds glutathione.
  • an aptamer that selectively binds glutathione By maintaining its antioxidant function for a long time, it can be used for functional cosmetics, health functional foods and foods of various formulations.
  • an aptamer that selectively binds to glutathione even a small amount of glutathione can be expected to continuously and maximize antioxidant and stabilizing effects.
  • the present invention maintains a reduced state of physiologically active ingredients such as glutathione by using an aptamer that selectively binds to glutathione, thereby maintaining its homeostasis and stabilization functions for a long period of time. It can be used for beverages and antioxidant foods.
  • anti-oxidation and stabilization of glutathione using aptamers is a safe and innovative new concept approach compared to existing methods, and it can be manufactured to be effective in various industries.
  • it will be a catalyst that dramatically changes the existing chemical-based cosmetics, health functional food, food, animal, and pharmaceutical markets into a DNA-based market. It is expected that the DNA market will explode in the future and provide innovative solutions.
  • Figure 1 is a picture of maintaining the stabilization state of glutathione through the hydrogen bond of the thiol group of the base and glutathione constituting the aptamer.
  • Figure 2 shows the SELEX process for the production of aptamer specifically binding glutathione.
  • FIG. 3 is a graph showing the glutathione oxidative delay effect of aptamer specifically binding to GSH (glutathione), and as a result of FIG. 3, it was confirmed that GSH was oxidized and decreased from the 15th day, and the remaining GSH on the 30th day The amount of was less than 60%, but on day 30, it was confirmed that more than about 90% of GSH by aptamers G1 and G4 and about 80% by aptamers G10 remained unoxidized,
  • Figure 4 is a graph confirming the effect of maintaining the tyrosinase activity inhibition rate of the aptamer that specifically binds to GSH (glutathione), as seen from the results of Figure 4, on day 0, about 70% of the tyrosinase actvitiy inhibition rate of GSH confirmed 14 On the first day, it was reduced to below 60%. However, in the case of GSH reacting with aptamers G1, G4, and G10, tyrosinase inhibition rate was maintained at about 70% or more on the 14th day.
  • GSH glutasine
  • the buffer compositions used were: 50 mM Sodium Acetate pH 5.5 (Sigma), 1 mM MgCl2 (Sigma), 0.05% Tween 20 (Sigma), 1% BSA (Sigma) and 1 mM glutathione (Sigma).
  • the stringency of the SELEX was changed by reducing the binding time of the aptamer to the target, changing the buffer composition, and decreasing the concentration of the target in free molecular elution (FIG. 2).
  • Sequence number Selected sequence Sequence size (bp) SEQ ID NO: 1 GACCAACGGAAGCGCGGCACCACAACGGTG 30 SEQ ID NO: 2 CGAACAGCATGGAGGCGCCCGTTGTGCCGTGCGCGGGAT 43 SEQ ID NO: 3 GGCACGCAGTGTGACGCGCCTCGTCGTTCACTCGGCGCGGGAT 43 SEQ ID NO: 4 GCACGGCACAACGGGCGCGCCTCCATGCTGTTCGGCGCGGGAT 43 SEQ ID NO: 5 CGAGTGAACGACGAGGCGCGTCACACTGCGTGCCGCGCGGGAT 43 SEQ ID NO: 6 CGAGTCAGTGCGAGGCGCTCCCCTGTCGGTGCGCGCGGGAT 41 SEQ ID NO: 7 GCACCGACAGGGGAGCGCCTCGCACTGACTCGGCGCGGGAT 41 SEQ ID NO: 8 ACGCATGCCGGGCGCGCTCCCTGTCGTCCGCGCGGGAT 38 SEQ ID NO: 9 CGACTACGAGGAGGCGCACCACACGTT 29 SEQ ID NO
  • the aptamer that specifically reacts with GSH obtained through SELEX was dissolved in folding buffer (1 mM MgCl 2 in PBS), boiled at 95 ° C. for 5 minutes, and then slowly lowered to room temperature to prepare a tertiary structure.
  • the prepared aptamer of 125 ⁇ M GSH and 1.25 ⁇ M (molar concentration 1: 100) was stored at room temperature for a period of time to obtain samples on the 15th and 30th days. After reacting each prepared sample with DTNB (5,5'-Dithio-bis (2-nitrobenzoic acid)), the GSH remaining in the sample was measured by measuring 405 nm absorbance.
  • DTNB 5,5'-Dithio-bis (2-nitrobenzoic acid
  • the tyrosinase actvitiy inhibition rate of GSH which was confirmed to be about 70% on day 0, was reduced to less than 60% on day 14.
  • tyrosinase inhibition rate was maintained at about 70% or more on the 14th day.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Organic Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Biochemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biophysics (AREA)
  • Biomedical Technology (AREA)
  • Microbiology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Epidemiology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • Food Science & Technology (AREA)
  • Nutrition Science (AREA)
  • Pharmacology & Pharmacy (AREA)
  • General Engineering & Computer Science (AREA)
  • Polymers & Plastics (AREA)
  • Wood Science & Technology (AREA)
  • Plant Pathology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Immunology (AREA)
  • Oil, Petroleum & Natural Gas (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Birds (AREA)
  • Mycology (AREA)
  • Dermatology (AREA)
  • Cosmetics (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

The present invention relates to: a method for stabilizing and preventing oxidation of glutathione which is an antioxidant; an aptamer having such activity; and applications of the aptamer to various fields, such as medicine, cosmetics, and food. The aptamer of the present invention can be applied to various fields, such as medicines, cosmetics, and food requiring oxidation resistance and stability of glutathione.

Description

글루타치온에 특이적으로 결합하는 DNA 압타머 및 그의 용도DNA aptamer specifically binding glutathione and use thereof
본 발명은 글루타치온 (glutathione)에 특이적으로 결합하는 DNA 압타머 및 이의 용도에 관한 것으로, 보다 상세하게는 글루타치온에 특이적으로 결합하는 DNA 압타머 및 이의 제조방법, 이를 이용한 글루타치온 안정화를 위한 방법 및 이를 위한 조성물, 및 용도 등에 관한 것이다.The present invention relates to a DNA aptamer specifically binding to glutathione and its use, and more specifically, a DNA aptamer specifically binding to glutathione and a manufacturing method thereof, a method for stabilizing glutathione using the same, and It relates to a composition for this purpose, and the use.
글루타치온 (glutathione, GSH)은 글루타민, 시스테인, 시스테인 세 가지 아미노산으로 구성된 트리펩타이드로, 자유 카디칼, 과산화물, 지질 과산화물 및 중금속과 같은 반응성 산소 종에 의해 원인이 되는 중요한 세포 성분에 대한 손상을 예방하는 항산화제 (anti-oxidant), 항염 (anti-inflammatory), 항암제 (anti-carcinogen), 항노화 (anti-aging) 및 면역기능 증강을 가진 생체 영양소로 알려져 있다.Glutathione (GSH) is a tripeptide composed of three amino acids, glutamine, cysteine, and cysteine, which prevent damage to important cellular components caused by reactive oxygen species such as free radicals, peroxides, lipid peroxides, and heavy metals. It is known as an anti-oxidant, anti-inflammatory, anti-carcinogen, anti-aging and bionutrient with enhanced immune function.
그런데, 글루타치온은 일반 제형에서 시간의 경과에 따라 글루타치온 (GSH)의 티올 (thiol)기가 글루타티온 이황화물 (glutathione disulfide, GSSG)로 쉽게 산화되면서 안정성이 저해된다. 글루타치온은 세포막을 투과하는 능력이 매우 낮기 때문에 세포 내로 글루타티온의 흡수가 낮고, 중성이나 알칼리성 환경에서의 불안정성으로 인해 생체 이용률이 낮기 때문에 활용도가 낮은 문제점이 있다. 따라서, 글루타치온의 산화를 억제하는 새로운 방법 내지는 물질에 대한 필요성은 오랫동안 존재하여 오고 있다.However, glutathione is easily oxidized to glutathione disulfide (GSSG) as a thiol group of glutathione (GSH) in a general formulation over time. Since glutathione has a very low ability to penetrate the cell membrane, absorption of glutathione into the cell is low, and bioavailability is low due to instability in a neutral or alkaline environment, resulting in low utilization. Therefore, the need for new methods or materials for inhibiting the oxidation of glutathione has long existed.
[선행 특허 문헌][Previous patent document]
대한민국 특허공개번호 제10-2018-0054508호Republic of Korea Patent Publication No. 10-2018-0054508
본 발명은 상기의 필요성에 의하여 안출 된 것으로서 본 발명의 목적은 글루타치온의 산화를 방지하고 안정화하는 방법을 제공하는 것이다.The present invention has been devised by the necessity of the above, and an object of the present invention is to provide a method for preventing and stabilizing oxidation of glutathione.
본 발명의 다른 목적은 글루타치온의 산화 방지 작용을 하는 물질을 제공하는 것이다.Another object of the present invention is to provide a substance having an anti-oxidative action of glutathione.
본 발명의 또 다른 목적은 글루타치온의 안정화 작용을 하는 물질을 제공하는 것이다.Another object of the present invention is to provide a substance that stabilizes glutathione.
본 발명의 또 다른 목적은 글루타치온의 산화를 방지하고 안정화 작용을 하는 물질을 이용하여 화장품, 건강기능식품으로써 용도를 제공하는 것이다.Another object of the present invention is to provide a use as a cosmetic, health functional food by using a substance that prevents oxidation and stabilizes glutathione.
본 발명의 또 다른 목적은 글루타치온의 환원 상태를 유지하고 안정화를 통해 그 기능을 장기간 유지하게 하는 물질을 제공하는 것이다.Another object of the present invention is to provide a substance that maintains the reduced state of glutathione and maintains its function for a long time through stabilization.
본 발명의 또 다른 목적은 글루타치온의 환원 상태를 유지하고 안정화를 통해 그 항산화 기능을 장기간 유지하게 하는 방법을 통해 화장품, 건강기능식품 및 식품을 제조하는 것이다.Another object of the present invention is to manufacture cosmetics, health functional foods and foods through a method of maintaining the reduced state of glutathione and stabilizing the antioxidant function for a long time.
상기의 목적을 달성하기 위하여 본 발명은 글루타치온에 압타머를 처리하여 글루타치온의 산화 방지 방법을 제공한다.In order to achieve the above object, the present invention provides a method for preventing glutathione from oxidation by treating glutathione with aptamer.
본 발명의 일 구현예에 있어서, 상기 압타머는 서열번호 1 내지 23에 기재된 염기서열로 이루어진 군으로부터 선택된 하나의 염기서열로 이루어진 것이 바람직하나, 상기 압타머 이외에도 본 발명의 실시예 등을 통하여 입증된 것과 같이 다른 서열을 가지며 본 발명의 목적하고자 하는 효과를 달성하는 모든 압타머는 본 발명의 보호범위에 포함된다.In one embodiment of the present invention, the aptamer is preferably composed of one nucleotide sequence selected from the group consisting of the nucleotide sequences set forth in SEQ ID NOs: 1 to 23, but in addition to the aptamer, it has been demonstrated through examples of the present invention, etc. All aptamers having different sequences as described above and achieving the desired effect of the present invention are included in the protection scope of the present invention.
또 본 발명은 글루타치온에 압타머를 처리하여 글루타치온의 안정화 방법을 제공한다.In addition, the present invention provides a method for stabilizing glutathione by treating glutathione with aptamer.
본 발명의 일 구현예에 있어서, 상기 글루타치온의 경우에 상기 압타머는 글루타치온의 ㅌ티올(thiol)기의 산화를 억제하는 것이 바람직하나 이에 한정되지 아니한다.In one embodiment of the present invention, in the case of the glutathione, the aptamer preferably inhibits the oxidation of the thiol group of glutathione, but is not limited thereto.
또 본 발명은 항산화 물질을 산화 방지 또는 안정화하는 압타머를 제공한다.In addition, the present invention provides an aptamer that prevents or stabilizes antioxidants.
본 발명의 일 구현예에 있어서, 상기 항산화 물질은 글루타치온, 비타민 C, 비타민 A, 레티놀, 비타민 E, 아스타잔틴, 레스베라티놀, 폴리페놀, 코엔자임 Q10, 펩티드 및 오일로 구성된 군으로부터 선택된 물질인 것이 바람직하나 이에 한정되지 아니한다.In one embodiment of the present invention, the antioxidant is glutathione, vitamin C, vitamin A, retinol, vitamin E, astaxanthin, resveratinol, polyphenol, coenzyme Q10, a material selected from the group consisting of peptides and oils It is preferred, but is not limited thereto.
또 본 발명은 상기 본 발명의 압타머를 유효성분으로 포함하는 화장료 조성물를 제공한다.In addition, the present invention provides a cosmetic composition comprising the aptamer of the present invention as an active ingredient.
또한 본 발명은 상기 본 발명의 압타머를 유효성분으로 포함하는 식품 조성물을 제공한다.In addition, the present invention provides a food composition comprising the aptamer of the present invention as an active ingredient.
본 발명의 일 구현예에 있어서, 상기 식품은 음료, 과자류, 캔디류, 유제품, 껌류, 장류, 빵류, 및 아이스크림으로 구성된 군으로부터 선택된 식품인 것이 바람직하나 이에 한정되지 아니한다.In one embodiment of the present invention, the food is preferably a food selected from the group consisting of beverages, confectionery, candy, dairy products, gums, berries, breads, and ice cream, but is not limited thereto.
또한 본 발명은 상기 본 발명의 압타머를 유효성분으로 포함하는 약학 조성물을 제공한다.In addition, the present invention provides a pharmaceutical composition comprising the aptamer of the present invention as an active ingredient.
본 발명에서, 압타민은 항산화 물질을 보호하는 압타머라 정의한다. 예를 들어, 압타민 G는 글루타치온의 특이적으로 결합하는 DNA 압타머로, 글루타치온의 산화를 방지하고 안정화하는 압타머를 의미한다.In the present invention, aptamine is defined as an aptamer that protects antioxidants. For example, aptamine G is a DNA aptamer that specifically binds glutathione, meaning an aptamer that prevents and stabilizes glutathione oxidation.
1. 압타민 G 기반의 화장품 응용 예1.Aptamin G based cosmetic application example
본 발명은 글루타치온의 특이적으로 결합하는 DNA 압타머인 압타민 G를 제공한다.The present invention provides aptamine G, a DNA aptamer that specifically binds glutathione.
본 발명은 글루타치온의 산화를 방지하고 안정화하는 압타머인 압타민 G를 제공한다.The present invention provides aptamine G, an aptamer that prevents and stabilizes glutathione oxidation.
또 본 발명은 압타민 G를 포함된 화장품을 제공한다.In addition, the present invention provides a cosmetic containing aptamine G.
본 발명의 일 구현예에 있어서, 상기 압타민 G를 포함된 화장품은 피부노화방지, 주름제거, 미백, 보습 효과를 가지는 성분을 특징으로 하는 것이 바람직하나 이에 한정되지 아니한다.In one embodiment of the present invention, the cosmetic product containing the aptamine G is preferably, but not limited to, a feature that has anti-aging, wrinkle removal, whitening, and moisturizing effects.
또 본 발명은 상기 본 발명의 방법에 의하여 제조된 압타민 G가 포함된 화장품을 제공한다.In addition, the present invention provides a cosmetic product containing aptamine G prepared by the method of the present invention.
본 발병의 일 구현예에 있어서, 상기 압타민 G의 말단에는 특정 성분이 부착된 것을 특징으로 하고, 상기 특정성분은 피부노화방지, 주름제거, 미백, 보습 효과를 가지는 성분을 특징으로 하는 것이 바람직하나 이에 한정되지 아니한다.In one embodiment of the present invention, it is characterized in that a specific component is attached to the end of the aptamine G, and the specific component is preferably characterized by a component having anti-aging, wrinkle removal, whitening, and moisturizing effects. However, it is not limited to this.
또한 본 발명의 특성 성분은 어떠한 종류의 추출물, 활성물질에 상관없이 화장품에서 사용되는 모든 원료를 사용할 수 있다. 그 예로 미백에 좋은 녹차추출물, 감초추출물, 닥나무추출물, 상백피추출물, 황금추출물, 푸에리라리아추출물, 홍삼추출물과 노화예방에 좋은 살구추출물, 오일추출물, 오렌지추출물, 레몬추출물, 대나무추출물, 구아바추출물, 로즈마리추출물, 산수유추출물, 영지추출물, 은행추출물, 서시옥욕산추출물, 자음단추출물, 보습에 좋은 모과추출물, 백련초추출물, 파프리카추출물, 알로에추출물, 수세미추출물, 해초추출물, 항산화 효과가 있는 당근추출물, 대두추출물, 자몽씨추출물, 포도씨추출물, 마치현추출물, 주름개선에 도움이 되는 캐비어, 석류, 인삼추출물, 피부재생에 도움이 되는 복숭아추출물, 천궁추출물, 아토피에 좋은 병풀추출물, 캐모마일추출물, 자초근추출물, 고삼추출물, 당귀추출물, 여드름에 좋은 박하추출물, 삼백초추출물, 어성초추출물, 작약추출물, 항염 및 항균에 좋은 목초액, 민들레추출물, 카렌듈라추출물, 황백피추출물, 탱자추출물, 황금추출물, 회향추출물, 컴푸리추출물, 모공수축에 도움을 주는 율피추출물, 녹차추출물, 보습기능을 하는 글리세린, 판테놀, 히아루론산, 세라마이드, 베타글루칸, 미백효과가 있는 알부틴, 비타민 C, 화이텐스, 레티놀, 아스타잔틴, 레스베라티놀, 폴리페놀, 탄력에 좋은 엘라스킨, 콜라겐, 코엔자임 Q10, 이펙틴, EGF, 항염증 항균제인 프로폴리스, 알란토인, 피토스탄, 인프라산, 항산화제 비타민 E (천연토코페롤), ROE (로즈마리오일추출물), 자몽씨추출물 등 다양한 추출물이 적용된다.In addition, the characteristic components of the present invention can use any raw material used in cosmetics regardless of any kind of extract or active substance. For example, green tea extract, licorice extract, mulberry extract, henna extract, pueraria extract, red ginseng extract, apricot extract, oil extract, orange extract, lemon extract, bamboo extract, guava extract , Rosemary extract, Cornus officinalis, Ganoderma extract, Ginkgo extract, Seosi okoksan extract, Consonant extract, Moisturizing quince extract, Baengnyeoncho extract, Paprika extract, Aloe extract, Scrub extract, Seaweed extract, Carrot extract with antioxidant effect, Soybean extract , Grapefruit Seed Extract, Grape Seed Extract, Machihyeon Extract, Caviar, Pomegranate, Ginseng Extract, Peach Extract to Help Skin Renewal, Peach Extract to Help Skin Rejuvenation, Celadon Extract, Chamomile Extract, Chamomile Extract, Autonomous Root Extract, High Ginseng Extract , Angelica extract, peppermint extract that is good for acne, Sambaekcho extract, Eoseongcho Extracts, peony extracts, anti-inflammatory and anti-bacterial herbaceous extracts, dandelion extracts, calendula extracts, hwangbaekpi extracts, tangja extracts, golden extracts, fennel extracts, potpourri extracts, yulpi extracts to help pores shrink, green tea extracts, moisturizing function Glycerin, Panthenol, Hyaluronic Acid, Ceramide, Beta Glucan, Whitening Effect Arbutin, Vitamin C, Whitens, Retinol, Astaxanthin, Resveratinol, Polyphenol, Elastic Elaskin, Collagen, Coenzyme Q10, Effectin, Various extracts such as EGF, anti-inflammatory antibacterial agents, propolis, allantoin, phytostan, infra acid, antioxidant vitamin E (natural tocopherol), ROE (rose marioyl extract), grapefruit seed extract are applied.
또 본 발명은 본 발명의 압타민 G를 포함하는 화장료 조성물을 제공한다.In addition, the present invention provides a cosmetic composition comprising the aptamine G of the present invention.
또 본 발명은 본 발명의 압타민 G를 포함하는 화장품 원료/재료의 용도는 다음과 같이 요약된다.In addition, the present invention summarizes the use of cosmetic raw materials / materials containing aptamine G of the present invention as follows.
널리 알려진 바와 같이, 글루타치온은 기능성 화장품의 주요 재료로 사용되는 매우 불안정한 물질로 공기 중에 노출될 경우 쉽게 산소와 결합 및 분해되면 그 기능을 빠르게 상실하게 된다. 압타민 G를 통해 이들 물질을 캡처하도록 하여 그 물질들과 산소와의 결합을 억제하도록 하여 물질을 최대한 안정하게 지속시키는 역할을 한다.As is well known, glutathione is a very unstable substance used as the main material for functional cosmetics. When exposed to air, it is easily combined with oxygen and decomposed, and its function is quickly lost. It helps capture these substances through aptamine G, thereby inhibiting the binding of the substances to oxygen, thereby maintaining the substances as stable as possible.
피부에서 분비되는 특정물질의 양에 따라 피부 활성 물질의 방출 (release) 성분을 조절하는 기능이다. 압타센싱 (aptasensing)이라 불리는 이 기술은 피부의 여러 상태를 보다 먼저 감지해서 그 상태에 맞추어 피부에 필요한 물질을 방출시키는 방법으로 미용 및 치료 등 여러 방면에 이용이 가능한 방법이다. 피부의 온도에 따라 다른 농도로 분비되는 ATP를 감지하거나, 피부의 상태에 따라 분비되는 사이토카인 (cytokines) 등을 압타머가 감지한 후 이에 맞춰 피부 활성 성분을 분비하는 시스템을 구현할 수 있다. 이에 따라 적당량의 항노화 물질을 분비하도록 함으로서 지속시간을 조절하거나 피부에 불필요한 과부하를 줄일 수 있도록 디자인할 수 있다.It is a function to control the release component of skin active substances according to the amount of specific substances secreted from the skin. This technique, called aptasensing, is a method that can detect various conditions of the skin first and release substances necessary for the skin in accordance with the condition, and can be used in various fields such as beauty and treatment. It is possible to implement a system that senses ATP secreted at different concentrations according to the temperature of the skin, or secretes skin active ingredients accordingly after the aptamer detects cytokines secreted according to the condition of the skin. Accordingly, it can be designed to control the duration or reduce unnecessary overload on the skin by secreting an appropriate amount of anti-aging material.
압타머란 single strand DNA나 RNA의 삼차원구조를 이용해 특정 물질을 검출하는 방법으로 항원-항체 반응과 비슷하나 물질의 사이즈가 훨씬 작고, 다양한 방법으로 그 활성을 조절할 수 있으며, 항체에 비해 생산과 보관이 용이한 장점이 있다. 또한 항체와 달리 사이즈가 아주 작은 화학물질 (글루타치온) 등에 결합하는 압타머를 합성할 수도 있으며 화학적 합성에 의해 제조되므로 그 효능을 일정하게 유지하는 데 용이하다.Aptamers are a method of detecting a specific substance using a three-dimensional structure of single strand DNA or RNA, similar to an antigen-antibody reaction, but the size of the substance is much smaller, and its activity can be regulated in various ways. This is an easy advantage. In addition, unlike antibodies, it is possible to synthesize aptamers that bind to very small chemicals (glutathione), etc., and it is easy to maintain its efficacy constant because it is produced by chemical synthesis.
글루타치온 (glutathione, GSH)은 글루타민, 시스테인, 시스테인 세 가지 아미노산으로 구성된 트리펩타이드로 존재하는 환원형과 티올 (thiol)기가 글루타티온 이황화물 (glutathione disulfide, GSSG)로 산화형이 있다.Glutathione (GSH) is a tripeptide composed of three amino acids, glutamine, cysteine, and cysteine, and the reduced form and thiol group are glutathione disulfide (GSSG), which are oxidized.
본 발명의 압타머를 구성하는 염기와 글루타치온의 티올기를 통해 글루타치온의 환원 상태를 유지하게 된다 (도 1).The reduced state of glutathione is maintained through the thiol group of glutathione and the base constituting the aptamer of the present invention (FIG. 1).
본 발명의 압타민 G와 결합하여 환원상태를 유지하고 있는 글루타치온을 콜라겐, 엘라스틴, 히알루론산 등을 포함하는 크림 타입 혹은 하이드로젤 타입의 다양한 제형의 피부미용 조성물과 건강기능식품에 사용할 수 있다.Glutathione, which is in a reduced state in combination with aptamine G of the present invention, can be used in skin-like compositions and health functional foods of various formulations of cream type or hydrogel type including collagen, elastin, hyaluronic acid, and the like.
본 발명은 또한 피부의 상태나 외부자극에 따라 (예컨데 자외선이나 피부의 온도나 산도) 다르게 반응하는 압타머를 통해 (aptasensing) 피부의 다양한 컨디션에 따라 글루타치온을 서서히 방출하게 하는 방법을 포함한다. 예컨데 피부의 자외선 조사에 따라 압타머의 구조가 바뀌면 결합된 글루타치온이 방출되게 하거나, 피부의 온도나 산도의 변화에 따라 ATP양이 바뀔 때 이에 결합하는 압타머 G의 구조가 바뀜으로서 글루타치온을 방출하게 하는 방법 등을 포함한다.The present invention also includes a method of gradually releasing glutathione according to various conditions of the skin (aptasensing) through an aptamer that reacts differently according to the condition of the skin or external stimulation (for example, ultraviolet or skin temperature or acidity). For example, when the structure of the aptamer changes according to ultraviolet irradiation of the skin, the combined glutathione is released, or when the ATP amount changes according to the change in the temperature or acidity of the skin, the structure of the aptamer G binding to it changes to release glutathione. And how to do it.
또 본 발명은 상기 본 발명의 압타머 G와 글루타치온을 유효성분으로 포함하는 다양한 제형 (serum, gel, lotion, cream, toner, mask pack 등)의 화장품에 사용하는 것을 포함한다.In addition, the present invention includes the use of cosmetics of various formulations (serum, gel, lotion, cream, toner, mask pack, etc.) containing the aptamer G and glutathione of the present invention as active ingredients.
본 발명의 일 구현예에 있어서, 상기 화장료 조성물은 콜라겐, 엘라스틴, 히알루론산 및 펩타이드 중 하나 이상을 추가로 포함하는 것이 바람직하나 이에 한정되지 아니한다.In one embodiment of the present invention, the cosmetic composition is preferably further comprising one or more of collagen, elastin, hyaluronic acid and peptides, but is not limited thereto.
2. 압타민 G 또는 압타민 G와 글루타치온 성분 복합체를 이용한 건강기능식품2. Health functional foods using aptamine G or aptamine G and glutathione complex
본 발명은 상기 본 발명의 압타민 G와 글루타치온 복합체 또는 압타민 G를 단독으로 유효성분으로 포함하는 건강기능식품 조성물을 제공한다.The present invention provides a health functional food composition comprising the aptamine G and glutathione complex of the present invention or aptamine G alone as an active ingredient.
본 발명의 건강기능식품에 적합한 글루타치온의 예는 글루타치온, 비타민 A, 비타민 C, 비타민 D, 비타민 E, 비타민 K, 비타민 B 6, 비타민 B 12, 티아민, 리보플라빈, 비오틴, 폴산, 니아신, 판토텐산, 이들의 혼합물 등이다. 건강기능식품 조성물에 포함될 적합한 미네랄 영양소의 예는 나트륨, 칼륨, 칼슘, 마그네슘, 인, 황, 염소, 철, 구리, 요오드, 아연, 셀레늄, 망간, 크롬, 몰리브덴, 불소, 코발트, 이들의 화합물에서 선택되는 한가지 이상의 원소를 보유하는 것들이다.Examples of glutathione suitable for the dietary supplement of the present invention are glutathione, vitamin A, vitamin C, vitamin D, vitamin E, vitamin K, vitamin B 6, vitamin B 12, thiamine, riboflavin, biotin, folic acid, niacin, pantothenic acid, these Mixtures, etc. Examples of suitable mineral nutrients to be included in the dietary supplement composition include sodium, potassium, calcium, magnesium, phosphorus, sulfur, chlorine, iron, copper, iodine, zinc, selenium, manganese, chromium, molybdenum, fluorine, cobalt, and compounds thereof. Those that have more than one element selected.
다양한 허브도 건강기능식품으로 사용될 수 있다. 일반적으로, 허브는 다양한 의약이나 식이 보조제 특성을 갖는 것 들로부터 선택된다. 일반적으로, 허브는 의약용 또는 풍미용으로 사용될 수 있는 방향족 식물이나 식물의 일부분이다.Various herbs can also be used as health functional food. In general, herbs are selected from those with various medicinal or dietary supplement properties. In general, herbs are aromatic plants or parts of plants that can be used for medicinal or flavoring purposes.
또 본 발명은 글루타치온에 압타민 G를 결합시켜 글루타치온을 포함하는 항산화 물질의 환원 상태를 유지하여 산화 속도를 지연시키는 방법을 제공한다.In addition, the present invention provides a method of delaying the oxidation rate by binding glutamine to glutathione to maintain a reduced state of an antioxidant containing glutathione.
이하 본 발명을 설명한다.Hereinafter, the present invention will be described.
본 발명은 글루타치온과 마찬가지로 Vitamin C, Vitamin A (Retinol), Vitamin E, 아스타잔틴, 레스베라티놀, 폴리페놀, 코엔자임 Q10, Peptide, Oil 등 산화에 매우 불안정한 항산화 물질들을 압타머와 결합하여 건강기능식품으로 제조 사용할 수 있다. 이를 통하여 물질들의 산화 (부패)를 방지하게 함으로써 그 물질들이 요구하는 효과를 최대한 유지하도록 한다. 또한, 이를 압타센싱을 통해 목표로 하는 조건에서 방출하도록 함으로써 그 효과를 최대한 증가시킬 수 있다.In the present invention, like glutathione, vitamin C, vitamin A (Retinol), vitamin E, astaxanthin, resveratinol, polyphenol, coenzyme Q10, Peptide, Oil, etc. Can be manufactured and used as food. This prevents the oxidation (corrosion) of the substances, thereby maintaining the desired effect of the substances as much as possible. In addition, it is possible to increase the effect as much as possible by allowing it to be released under target conditions through apt sensing.
또한 본 발명은 그 항산화 성분에 맞게 개발된 압타머와 항산화성분 복합체로 제공하거나 활성상태의 압타머와 항산화 성분을 개별적으로 제공한다.In addition, the present invention provides an aptamer and an antioxidant component complex developed for its antioxidant component, or separately provides an active aptamer and an antioxidant component.
본 발명의 일 구현예에 있어서, 상기 글루타치온을 포함한 항산화 물질은 비타민 C, 비타민 A, 레티놀, 비타민 E, 아스타잔틴, 레스베라트롤, 4'-아세톡시레스베라트롤 (acetoxy resveratrol), 카테킨, 각종폴리페놀류, 에피갈로카테킨 갈레이트, 코엔자임 Q10, 유비퀴놀, 유비퀴논, 오메가 3, 및 오일로 구성된 군으로부터 선택된 물질인 것이 바람직하나 이에 한정되지 아니한다.In one embodiment of the present invention, the antioxidant substance including glutathione is vitamin C, vitamin A, retinol, vitamin E, astaxanthin, resveratrol, 4'-acetoxy resveratrol, catechin, various polyphenols, Epigallocatechin gallate, coenzyme Q10, ubiquinol, ubiquinone, omega 3, and is preferably a material selected from the group consisting of oil, but is not limited thereto.
3. 3. 압타민Aptamine G 및/또는  G and / or 압타민Aptamine G와  G and 글루타치온Glutathione 성분 복합체를 이용한 식음료 및 식품 조성물 Food and beverage and food composition using ingredient complex
본 발명은 상기 본 발명의 압타민 G와 압타민 G와 글루타치온 복합체를 유효성분으로 포함하거나 음료에 압타민 G를 단독으로 포함하는 음료 조성물을 제공한다.The present invention provides a beverage composition comprising aptamine G and aptamine G and a glutathione complex of the present invention as an active ingredient or aptamine G alone in a beverage.
본 발명의 일 구현예에 있어서, 상기 조성물은 콜라겐, 엘라스틴, 히알루론산, 및 펩티드 중 하나 이상을 추가로 포함하는 것이 바람직하나 이에 한정되지 아니한다.In one embodiment of the present invention, the composition is preferably, but is not limited to, further comprising at least one of collagen, elastin, hyaluronic acid, and peptide.
또 본 발명은 상기 본 발명의 압타머 및/또는 항산화 물질을 유효성분으로 포함하는 식품 조성물을 제공한다.In addition, the present invention provides a food composition comprising the aptamer and / or antioxidant of the present invention as an active ingredient.
본 발명의 일 구현예에 있어서, 상기 식품 조성물은 콜라젠, 엘라스틴, 히알루론산, 및 펩티드 중 하나 이상을 추가로 포함하는 것이 바람직하나 이에 한정되지 아니한다.In one embodiment of the present invention, the food composition is preferably one or more of collagen, elastin, hyaluronic acid, and peptide, but is not limited thereto.
본 발명의 일 구현예에 있어서, 상기 식품 조성물은 과자류, 캔디류, 유제품, 껌류, 또는 장류, 빵류, 또는 아이스크림인 것이 바람직하나 이에 한정되지 아니한다.In one embodiment of the present invention, the food composition is preferably, but not limited to, confectionery, candy, dairy, gum, or berry, bread, or ice cream.
또 본 발명은 상기 본 발명의 압타민 G를 식품에 첨가하여 식품을 제조하는 방법을 제공한다.In addition, the present invention provides a method for preparing food by adding aptamine G of the present invention to the food.
본 발명의 다른 구현예에 있어서, 상기 식품, 음료 조성물은 체내에 흡수되어 압타민 G의 구조가 바뀌면 결합된 글루타치온이 방출되게 하거나, 체내의 환경 변화에 따라 ATP양이 바뀔 때 이에 결합하는 압타민 G의 구조가 바뀜으로서 글루타치온을 방출하는 것이 바람직하나 이에 한정되지 아니한다.In another embodiment of the present invention, the food and beverage composition is absorbed into the body, and when the structure of aptamine G is changed, the bound glutathione is released, or when the amount of ATP changes according to the environmental change in the body, aptamine binds to it. As the structure of G is changed, it is preferable to release glutathione, but it is not limited thereto.
또한 압타머를 이용하여 글루타치온의 산화를 방지하고 안정화하는 것은 기존의 방법에 비교하여, 안전하고 혁신적인 새로운 개념의 접근이며, 이를 각종 산업에 적용하여 효과를 극대화할 수 있도록 제조가 가능하다.In addition, preventing and stabilizing the oxidation of glutathione using an aptamer is a safe and innovative new concept approach compared to the existing method, and it can be manufactured to maximize the effect by applying it to various industries.
특히, 기존의 케미칼 기반의 화장품, 식품, 동물, 제약 시장을 획기적으로 DNA 기반의 시장으로 변화시키는 기폭제가 될 것이다. 또한 각종 산업 등 다양한 분야에 활용되고 있다. 향후, DNA 시장의 폭발적인 증가와 혁신적인 솔루션을 제공할 것으로 예상된다.In particular, it will be a catalyst that dramatically changes the existing chemical-based cosmetics, food, animal, and pharmaceutical markets into a DNA-based market. It is also used in various fields such as various industries. In the future, it is expected to provide an explosive increase in the DNA market and innovative solutions.
4. Aptamer G 또는 Aptamer G 및 글루타치온 복합체를 이용한 약학 조성물4. Pharmaceutical composition using Aptamer G or Aptamer G and glutathione complex
본 발명의 조성물이 약학 조성물인 경우, 배경기술에서 언급한 글루타치온의 약리효과를 나타내는 적용증에 사용될 수 있다. 본 발명의 조성물의 투여를 위하여, 상기 기재한 유효성분 이외에 약학적으로 허용 가능한 담체, 부형제 또는 희석제를 포함할 수 있다. 상기 담체, 부형제 및 희석제로는 락토오스, 덱스트로오스, 수크로오스, 소르비톨, 만니톨, 자일리톨, 에리스리톨, 말티톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로오스, 메틸 셀룰로오스, 미정질 셀룰로오스, 폴리비닐피롤리돈, 물, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 탈크, 마그네슘 스테아레이트 및 광물유를 들 수 있다.When the composition of the present invention is a pharmaceutical composition, it can be used in an application that shows the pharmacological effect of glutathione mentioned in the background art. For administration of the composition of the present invention, a pharmaceutically acceptable carrier, excipient, or diluent may be included in addition to the active ingredients described above. The carrier, excipients and diluents include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, Polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil.
본 발명의 약학 조성물은 각각 통상의 방법에 따라 산제, 과립제, 정제, 캡슐제, 현탁액, 에멀젼, 시럽, 에어로졸 등의 경구형 제형, 외용제, 좌제 또는 멸균 주사용액의 형태로 제형화하여 사용할 수 있다. 상세하게는 제형화할 경우 통상 사용하는 충진제, 중량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제를 사용하여 조제될 수 있다. 경구투여를 위한 고형 제제로는 정제, 환제, 산제, 과립제, 캡슐제 등을 포함하나, 이에 한정되는 것은 아니다. 이러한 고형 제제는 상기 유효성분 외에 적어도 하나 이상의 부형제, 예를 들면, 전분, 칼슘 카보네이트, 수크로오스, 락토오스, 젤라틴 등을 섞어 조제될 수 있다. 또한, 단순한 부형제 이외에 마그네슘 스테아레이트, 탈크 같은 윤활제들도 사용될 수 있다. 경구를 위한 액상물, 리퀴드 파라핀 이외에 여러 가지 부형제, 예를 들면 습윤제, 감미제, 방향제, 보존제 등을 첨가하여 조제될 수 있다. 비경구 투여를 위한 제제는 멸균된 수용액, 비수성 용제, 현탁제, 유제, 동결건조 제제 및 과제를 포함한다. 비수성 용제 및 현탁제로는 프로필렌글리콜, 폴리에틸렌글리콜, 올리브 오일과 같은 식물성 오일, 에틸올레이트와 같은 주사 가능한 에스테르 등이 사용될 수 있다. 좌제의 기제로는 위텝솔, 마크로솔, 트윈 61, 카카오지, 라우린지, 글리세로젤라틴 등이 사용될 수 있다.The pharmaceutical composition of the present invention can be formulated and used in the form of an oral dosage form such as a powder, granule, tablet, capsule, suspension, emulsion, syrup, aerosol, external preparation, suppository, or sterile injectable solution, respectively, according to a conventional method. . In detail, when formulated, it may be prepared using diluents or excipients such as fillers, weights, binders, wetting agents, disintegrating agents, surfactants, etc., which are commonly used. Solid preparations for oral administration include, but are not limited to, tablets, pills, powders, granules, capsules, and the like. Such a solid preparation may be prepared by mixing at least one excipient other than the active ingredient, for example, starch, calcium carbonate, sucrose, lactose, gelatin, and the like. In addition, lubricants such as magnesium stearate and talc may be used in addition to simple excipients. In addition to liquids for oral administration and liquid paraffin, various excipients, such as wetting agents, sweeteners, fragrances, and preservatives, can be added. Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations and challenges. Non-aqueous solvents and suspensions may include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate. As a base for suppositories, witepsol, macrosol, tween 61, cacao butter, laurin butter, and glycerogelatin may be used.
본 발명의 약학 조성물의 적합한 투여량은 환자의 상태 및 체중, 질병의 정도, 약물형태, 시간에 따라 다르지만, 당 업자에 의해 적절하게 선택될 수 있는 바, 상기 조성물의 일일 투여량은 바람직하게는 0.001mg/kg체중 내지 500 mg/kg체중이며, 필요에 따라 일일 1회 내지 수회로 나누어 투여할 수 있다.The suitable dosage of the pharmaceutical composition of the present invention depends on the patient's condition and body weight, the degree of disease, the drug form, and the time, but may be appropriately selected by a person skilled in the art, and the daily dosage of the composition is preferably It is 0.001 mg / kg body weight to 500 mg / kg body weight, and can be divided and administered once to several times a day as needed.
본 발명을 통하여 알 수 있는 바와 같이, 본 발명의 압타머는 글루타치온의 산화 방지와 안정화 효과를 가지며, 본 발명의 압타머가 피부 활성 성분의 방출 (release) 속도를 조절하고, 피부에서 분비되는 특정물질의 양에 따라 항산화 물질의 방출 (release) 성분을 조절하는 기능을 가질 것으로 예상된다.As can be seen through the present invention, the aptamer of the present invention has an anti-oxidation and stabilizing effect of glutathione, the aptamer of the present invention regulates the release rate of the skin active ingredient, and the specific substances secreted from the skin It is expected to have the function of controlling the release component of the antioxidant according to the amount.
본 발명의 압타머는 글루타치온과 같은 항산화 물질의 산화방지 효과를 가지며, 본 발명의 단독 또는 압타머와 글루타치온의 복합체는 예를 들어, 글루타치온에 선택적으로 결합하는 압타머를 이용해 글루타치온의 환원 상태를 유지해서 그 항산화 기능을 장기간 유지하게 하여 다양한 제형의 기능성 화장품과 건강기능식품 및 식품 등에 이용할 수 있다. 글루타치온에 선택적으로 결합하는 압타머를 이용해 작은 양의 글루타치온으로도 지속적이고 극대화된 항산화와 안정화 효과를 기대할 수 있다.The aptamer of the present invention has an antioxidant effect of an antioxidant such as glutathione, and the complex of the present invention alone or the aptamer and glutathione maintains a reduced state of glutathione by using, for example, an aptamer that selectively binds glutathione. By maintaining its antioxidant function for a long time, it can be used for functional cosmetics, health functional foods and foods of various formulations. By using an aptamer that selectively binds to glutathione, even a small amount of glutathione can be expected to continuously and maximize antioxidant and stabilizing effects.
또한 본 발명을 통하여 알 수 있는 바와 같이 본 발명은 글루타치온에 선택적으로 결합하는 압타머를 이용해 글루타치온 등 생리활성 성분의 환원 상태를 유지해서 그 항상화와 안정화 기능을 장기간 유지하게 하여 다양한 건강 음료, 항산화 음료 및 항산화 식품 등에 이용할 수 있다.In addition, as can be seen through the present invention, the present invention maintains a reduced state of physiologically active ingredients such as glutathione by using an aptamer that selectively binds to glutathione, thereby maintaining its homeostasis and stabilization functions for a long period of time. It can be used for beverages and antioxidant foods.
또한 압타머를 이용하여 글루타치온을 항산화와 안정화하는 것은 기존의 방법에 비교하여, 안전하고 혁신적인 새로운 개념의 접근으로서, 이를 각종 산업에 적용하여 효과를 볼 수 있도록 제조가 가능하다. 특히, 기존의 케미칼 기반의 화장품, 건강기능식품, 식품, 동물, 제약 시장을 획기적으로 DNA 기반의 시장으로 변화시키는 기폭제가 될 것이다. 향후 DNA 시장의 폭발적인 증가와 혁신적인 솔루션을 제공할 것으로 예상된다.In addition, anti-oxidation and stabilization of glutathione using aptamers is a safe and innovative new concept approach compared to existing methods, and it can be manufactured to be effective in various industries. In particular, it will be a catalyst that dramatically changes the existing chemical-based cosmetics, health functional food, food, animal, and pharmaceutical markets into a DNA-based market. It is expected that the DNA market will explode in the future and provide innovative solutions.
도 1은 압타머를 구성하는 염기와 글루타치온의 thiol group의 수소결합을 통해 글루타치온의 안정화 상태를 유지하는 그림.Figure 1 is a picture of maintaining the stabilization state of glutathione through the hydrogen bond of the thiol group of the base and glutathione constituting the aptamer.
도 2는 글루타치온과 특이적으로 결합하는 압타머 제작을 위한 SELEX 과정을 나타낸 것이다.Figure 2 shows the SELEX process for the production of aptamer specifically binding glutathione.
도 3은 GSH(글루타치온)과 특이적으로 결합하는 압타머의 글루타치온 산화지연 효과를 나타낸 그래표로, 도 3의 결과로 보아 15일째부터 GSH가 산화되어 감소되는 것이 확인되었고, 30일째는 남아 있는 GSH의 양이 60% 이하가 되었으나, 30일 째에 압타머 G1, G4에 의해 약 90%, 압타머 G10에 의해 약 80% 이상의 GSH가 산화되지 않고 남아있는 것이 확인되었으며,3 is a graph showing the glutathione oxidative delay effect of aptamer specifically binding to GSH (glutathione), and as a result of FIG. 3, it was confirmed that GSH was oxidized and decreased from the 15th day, and the remaining GSH on the 30th day The amount of was less than 60%, but on day 30, it was confirmed that more than about 90% of GSH by aptamers G1 and G4 and about 80% by aptamers G10 remained unoxidized,
도 4는 GSH(글루타치온)과 특이적으로 결합하는 압타머의 Tyrosinase activity inhibition rate 유지 효과를 확인한 그래프로, 도 4의 결과로 보아 0일째, 약 70% 정도로 확인되는 GSH의 tyrosinase actvitiy inhibition rate이 14일 째 60% 이하로 감소되었다. 하지만, 압타머G1, G4, G10과 반응하는 GSH의 경우 14일째에도 약 70 % 이상 tyrosinase inhibition rate을 유지하였다. Figure 4 is a graph confirming the effect of maintaining the tyrosinase activity inhibition rate of the aptamer that specifically binds to GSH (glutathione), as seen from the results of Figure 4, on day 0, about 70% of the tyrosinase actvitiy inhibition rate of GSH confirmed 14 On the first day, it was reduced to below 60%. However, in the case of GSH reacting with aptamers G1, G4, and G10, tyrosinase inhibition rate was maintained at about 70% or more on the 14th day.
이하 본 발명을 비한정적인 실시예를 통하여 상세하게 설명한다. 단 하기 실시예는 본 발명을 예시하기 위한 의도로 기재된 것으로서 본 발명의 범위는 하기 실시예에 의하여 제한되는 것으로 해석되지 아니한다.Hereinafter, the present invention will be described in detail through non-limiting examples. However, the following examples are intended to illustrate the present invention, and the scope of the present invention is not to be construed as being limited by the following examples.
본 발명에서는 타겟 (글루타치온)을 신속하게 산화되지 않기 위하여, 모든 버퍼와 용액들을 Chelex®100 resin (BioRad)에서 1시간 교반하고, 0.2 μm 필터를 통하여 여과하였고, N2 gas (Praxair)로 10분간 살포하여 우발적인 금속을 제거한 분자 생물학급 워터 (Phenix Research)를 사용하여 제조하였다.In the present invention, in order not to rapidly oxidize the target (glutathione), all buffers and solutions were stirred for 1 hour in Chelex®100 resin (BioRad), filtered through a 0.2 μm filter, and sprayed with N2 gas (Praxair) for 10 minutes. It was prepared using molecular biology grade water (Phenix Research) to remove the accidental metal.
실시예Example 1: DNA  1: DNA aptameraptamer 선택 및 서열 분석 Selection and sequencing
GlutathioneGlutathione SELEXSELEX ::
Glutathione에 대한 9 라운드의 SELEX를 ~ 10 15 독특한 올리고뉴크레오타이드로 구성된 DNA library를 사용하여 수행하였다. 사용된 버퍼 조성은 다음과 같다: 50 mM Sodium Acetate pH 5.5 (Sigma), 1 mM MgCl2 (Sigma), 0.05% Tween 20 (Sigma), 1% BSA (Sigma) 및 1 mM glutathione (Sigma). The stringency of the SELEX의 스트린전시를 타겟에 대한 압타머의 결합시간을 감소시키고, 버퍼 조성을 변경하고 자유 분자 용출에서 타겟의 농도를 감소시켜 변경하였다 (도 2).Nine rounds of SELEX for glutathione were performed using a DNA library consisting of ˜10 15 unique oligonucleotides. The buffer compositions used were: 50 mM Sodium Acetate pH 5.5 (Sigma), 1 mM MgCl2 (Sigma), 0.05% Tween 20 (Sigma), 1% BSA (Sigma) and 1 mM glutathione (Sigma). The stringency of the SELEX was changed by reducing the binding time of the aptamer to the target, changing the buffer composition, and decreasing the concentration of the target in free molecular elution (FIG. 2).
DNA DNA aptameraptamer 선택 Select
SELEX 방법에 의하여 생산된 풍부한 라이브러리의 바이오정보 분석은 후보 압타머를 얻었고, 이들 상위 23개로부터 산화로부터 글루타치온을 보호하는 능력을 스크리닝하여 그 결과를 아래의 표 1에 나타내었다.Analysis of the bioinformation of the rich library produced by the SELEX method yielded candidate aptamers, and the results of screening the ability to protect glutathione from oxidation from these top 23 are shown in Table 1 below.
서열번호Sequence number 선별된 서열Selected sequence 서열크기Sequence size (bp)(bp)
서열번호 1SEQ ID NO: 1 GACCAACGGAAGCGCGGCACCACAACGGTGGACCAACGGAAGCGCGGCACCACAACGGTG 3030
서열번호 2SEQ ID NO: 2 CGAACAGCATGGAGGCGCGCCCGTTGTGCCGTGCGCGCGGGATCGAACAGCATGGAGGCGCGCCCGTTGTGCCGTGCGCGCGGGAT 4343
서열번호 3SEQ ID NO: 3 GGCACGCAGTGTGACGCGCCTCGTCGTTCACTCGGCGCGGGATGGCACGCAGTGTGACGCGCCTCGTCGTTCACTCGGCGCGGGAT 4343
서열번호 4SEQ ID NO: 4 GCACGGCACAACGGGCGCGCCTCCATGCTGTTCGGCGCGGGATGCACGGCACAACGGGCGCGCCTCCATGCTGTTCGGCGCGGGAT 4343
서열번호 5SEQ ID NO: 5 CGAGTGAACGACGAGGCGCGTCACACTGCGTGCCGCGCGGGATCGAGTGAACGACGAGGCGCGTCACACTGCGTGCCGCGCGGGAT 4343
서열번호 6SEQ ID NO: 6 CGAGTCAGTGCGAGGCGCTCCCCTGTCGGTGCGCGCGGGATCGAGTCAGTGCGAGGCGCTCCCCTGTCGGTGCGCGCGGGAT 4141
서열번호 7SEQ ID NO: 7 GCACCGACAGGGGAGCGCCTCGCACTGACTCGGCGCGGGATGCACCGACAGGGGAGCGCCTCGCACTGACTCGGCGCGGGAT 4141
서열번호 8SEQ ID NO: 8 ACGCATGCCGGGCGCGCTCCCTGTCGTCCGCGCGGGATACGCATGCCGGGCGCGCTCCCTGTCGTCCGCGCGGGAT 3838
서열번호 9SEQ ID NO: 9 CGACTACGAGGAGGCGCGCACCACACGTTCGACTACGAGGAGGCGCGCACCACACGTT 2929
서열번호 10SEQ ID NO: 10 AACGTACGTGGAGCGGCTCCCTGCACTGCGCGCGGGATAACGTACGTGGAGCGGCTCCCTGCACTGCGCGCGGGAT 3838
서열번호 11SEQ ID NO: 11 GCAGTGCAGGGAGCCGCTCCACGTACGTTGCGCGGGATGCAGTGCAGGGAGCCGCTCCACGTACGTTGCGCGGGAT 3838
서열번호 12SEQ ID NO: 12 GGTCTGCCGGGGCCGCACCTCCTGTCGTCGGCGCGGGATGGTCTGCCGGGGCCGCACCTCCTGTCGTCGGCGCGGGAT 3939
서열번호 13SEQ ID NO: 13 GCACAATCGGGGCGCGCTCGTCCTCTGGCCGGCGCGGGATGCACAATCGGGGCGCGCTCGTCCTCTGGCCGGCGCGGGAT 4040
서열번호 14SEQ ID NO: 14 CGGCCAGAGGACGAGCGCGCCCCGATTGTGCGCGCGGGATCGGCCAGAGGACGAGCGCGCCCCGATTGTGCGCGCGGGAT 4040
서열번호 15SEQ ID NO: 15 GGACGACAGGGAGCGCGCCC GGACGACAGGGAGCGCGCCC 2020
서열번호 16SEQ ID NO: 16 CGACGACAGGAGGTGCGGCCCCGGCAGACCGCGCGGGATCGACGACAGGAGGTGCGGCCCCGGCAGACCGCGCGGGAT 3939
서열번호 17SEQ ID NO: 17 CGAGTGAGGGCGAGGCGCGACGTCCCTTCGGTCCGCGCGGGATCGAGTGAGGGCGAGGCGCGACGTCCCTTCGGTCCGCGCGGGAT 4343
서열번호 18SEQ ID NO: 18 CGAGTCAGTGCGAGGCGCGCTCCTGCCGTTGCGCGCGGGATCGAGTCAGTGCGAGGCGCGCTCCTGCCGTTGCGCGCGGGAT 4141
서열번호 19SEQ ID NO: 19 GGACCGAAGGGACGTCGCGCCTCGCCCTCACTCGGCGCGGGATGGACCGAAGGGACGTCGCGCCTCGCCCTCACTCGGCGCGGGAT 4343
서열번호 20SEQ ID NO: 20 CGACGGAGGGAGGCGCGCACCACACGTTCGACGGAGGGAGGCGCGCACCACACGTT 2828
서열번호 21SEQ ID NO: 21 GACCAACGGAGCGCGGCCCACAACGGTGACCAACGGAGCGCGGCCCACAACGGT 2727
서열번호 22SEQ ID NO: 22 GACATCAGGAGCGCGCCCCGTCACG GACATCAGGAGCGCGCCCCGTCACG 2525
서열번호 23SEQ ID NO: 23 GACCAACGGAGCGCGGCCCACAACGGTGGACCAACGGAGCGCGGCCCACAACGGTG 2828
실시예Example 2:  2: GSH(글루타치온)과GSH (glutathione) and 특이적으로 결합하는  Specifically binding 압타머의Aptamer 글루타치온Glutathione 산화지연 효과 Oxidation delay effect
상기 SELEX를 통해 얻은 GSH와 특이적으로 반응하는 압타머를 folding buffer (1mM MgCl 2 in PBS)에 녹인 뒤 95℃에서 5분간 끓인 후 서서히 상온으로 온도를 낮추어 3차 구조를 형성하도록 준비하였다.The aptamer that specifically reacts with GSH obtained through SELEX was dissolved in folding buffer (1 mM MgCl 2 in PBS), boiled at 95 ° C. for 5 minutes, and then slowly lowered to room temperature to prepare a tertiary structure.
125 μM GSH와 1.25 μM (몰농도 1:100)의 상기 준비된 압타머를 상온에서 일정기간 동안 보관하여 15일, 30일 째 샘플을 얻었다. 준비된 각 샘플을 DTNB (5,5＇-Dithio-bis (2-nitrobenzoic acid))와 반응시킨 뒤 405 nm absorbance를 측정하여 샘플 속에 남아있는 GSH가 측정되어졌다. The prepared aptamer of 125 μM GSH and 1.25 μM (molar concentration 1: 100) was stored at room temperature for a period of time to obtain samples on the 15th and 30th days. After reacting each prepared sample with DTNB (5,5＇-Dithio-bis (2-nitrobenzoic acid)), the GSH remaining in the sample was measured by measuring 405 nm absorbance.
도 3의 결과로 보아 15일째부터 GSH가 산화되어 감소되는 것이 확인되었고, 30일째는 남아 있는 GSH의 양이 60% 이하가 되었으나, 30일 째에 압타머 G1, G4(각각 서열번호 1 및 4의 압타머)에 의해 약 90%, 압타머 G10(서열번호 10의 압타머)에 의해 약 80% 이상의 GSH가 산화되지 않고 남아 있는 것이 확인되었다. As a result of FIG. 3, it was confirmed that GSH was oxidized and decreased from the 15th day, and the amount of remaining GSH was 60% or less on the 30th day, but aptamers G1 and G4 (SEQ ID NOs: 1 and 4, respectively) on the 30th day. It was confirmed that about 90% of the GSH remained unoxidized by about 90% by the aptamer) and about 80% or more by the aptamer G10 (aptamer of SEQ ID NO: 10).
실시예Example 3:  3: GSH(글루타치온)과GSH (glutathione) and 특이적으로 결합하는  Specifically binding 압타머의Aptamer TyrosinaseTyrosinase activity inhibition rate 유지 효과 Effect of maintaining activity inhibition rate
상기 SELEX를 통해 얻은 GSH와 특이적으로 반응하는 압타머는 앞서 설명한 것과 같이 준비되었다. Aptamers that specifically react with GSH obtained through SELEX were prepared as described above.
10 μM GSH와 0.1 μM 압타머 (몰농도 1:100)를 상온에 일정기간동안 보관하며 7일, 14일 째 샘플을 얻었다. 준비된 각 샘플을 mushroom tyrosinase, tyrosine와 섞은 뒤 37 ℃에서 15 분간 반응시켰다. 반응 후 plate reader를 이용하여 490 nm에서 absorbance가 측정되었다. 10 μM GSH and 0.1 μM aptamer (molar concentration 1: 100) were stored at room temperature for a period of time to obtain samples on the 7th and 14th days. Each prepared sample was mixed with mushroom tyrosinase and tyrosine and reacted at 37 ° C for 15 minutes. After the reaction, absorbance was measured at 490 nm using a plate reader.
도 4의 결과로 보아 0일째, 약 70% 정도로 확인되는 GSH의 tyrosinase actvitiy inhibition rate이 14일 째 60% 이하로 감소되었다. 하지만, 압타머G1, G4, G10과 반응하는 GSH의 경우 14일째에도 약 70 % 이상 tyrosinase inhibition rate을 유지하였다. As a result of FIG. 4, the tyrosinase actvitiy inhibition rate of GSH, which was confirmed to be about 70% on day 0, was reduced to less than 60% on day 14. However, in the case of GSH reacting with aptamers G1, G4, and G10, tyrosinase inhibition rate was maintained at about 70% or more on the 14th day.

Claims (15)

  1. 글루타치온에 압타머를 처리하여 글루타치온의 산화 방지 방법.Method of preventing glutathione oxidation by treating glutathione with aptamer.
  2. 제1항에 있어서, 상기 압타머는 서열번호 1 내지 23에 기재된 염기서열로 이루어진 군으로부터 선택된 하나의 염기서열로 이루어진 것을 특징으로 하는 방법.The method of claim 1, wherein the aptamer comprises one nucleotide sequence selected from the group consisting of the nucleotide sequences set forth in SEQ ID NOs: 1 to 23.
  3. 글루타치온에 압타머를 처리하여 글루타치온의 안정화 방법.A method for stabilizing glutathione by treating glutathione with aptamer.
  4. 제3항에 있어서, 상기 압타머는 서열번호 1 내지 23에 기재된 염기서열로 이루어진 군으로부터 선택된 하나의 염기서열로 이루어진 것을 특징으로 하는 방법.The method of claim 3, wherein the aptamer comprises one base sequence selected from the group consisting of the base sequences of SEQ ID NOs: 1 to 23.
  5. 제1항에 있어서, 상기 글루타치온의 경우에 상기 압타머는 글루타치온의 ㅌ티올(thiol)기의 산화를 억제하는 것을 특징으로 하는 방법.The method of claim 1, wherein in the case of glutathione, the aptamer inhibits oxidation of a thiol group of glutathione.
  6. 항산화 물질을 산화 방지 또는 안정화하는 압타머.An aptamer that prevents or stabilizes antioxidants.
  7. 제6항에 있어서, 상기 항산화 물질은 글루타치온, 비타민 C, 비타민 A, 레티놀, 비타민 E, 아스타잔틴, 레스베라티놀, 폴리페놀, 코엔자임 Q10, 펩티드 및 오일로 구성된 군으로부터 선택된 물질인 것을 특징으로 하는 압타머.The method of claim 6, wherein the antioxidant is glutathione, vitamin C, vitamin A, retinol, vitamin E, astaxanthin, resveratinol, polyphenol, coenzyme Q10, characterized in that the material selected from the group consisting of peptides and oils Aptamers.
  8. 제6항에 있어서, 상기 압타머는 서열번호 1 또는 23에 기재된 염기서열로 이루어진 군으로부터 선택된 하나의 염기서열로 이루어진 것을 특징으로 하는 압타머.The aptamer according to claim 6, wherein the aptamer comprises one nucleotide sequence selected from the group consisting of the nucleotide sequences set forth in SEQ ID NO: 1 or 23.
  9. 제6항의 압타머를 유효성분으로 포함하는 화장료 조성물.Cosmetic composition comprising the aptamer of claim 6 as an active ingredient.
  10. 제9항에 있어서, 상기 압타머는 서열번호 1 또는 23에 기재된 염기서열로 이루어진 군으로부터 선택된 하나의 염기서열로 이루어진 것을 특징으로 하는 조성물.10. The composition of claim 9, wherein the aptamer comprises one base sequence selected from the group consisting of the base sequences set forth in SEQ ID NO: 1 or 23.
  11. 제6항의 압타머를 유효성분으로 포함하는 식품 조성물.A food composition comprising the aptamer of claim 6 as an active ingredient.
  12. 제11항에 있어서, 상기 압타머는 서열번호 1 또는 23에 기재된 염기서열로 이루어진 군으로부터 선택된 하나의 염기서열로 이루어진 것을 특징으로 하는 조성물.12. The composition of claim 11, wherein the aptamer consists of one base sequence selected from the group consisting of the base sequences set forth in SEQ ID NO: 1 or 23.
  13. 제11항에 있어서, 상기 식품은 음료, 과자류, 캔디류, 유제품, 껌류, 장류, 빵류, 및 아이스크림으로 구성된 군으로부터 선택된 식품인 것을 특징으로 하는 식품 조성물.12. The food composition of claim 11, wherein the food is a food selected from the group consisting of beverages, confectionery, candy, dairy products, gum, berry, bread, and ice cream.
  14. 제6항의 압타머를 유효성분으로 포함하는 약학 조성물.A pharmaceutical composition comprising the aptamer of claim 6 as an active ingredient.
  15. 제14항에 있어서, 상기 압타머는 서열번호 1 내지 23의 염기서열로 이루어진 군으로부터 선택된 하나의 염기서열로 이루어진 것을 특징으로 하는 약학 조성물.15. The method of claim 14, wherein the aptamer is a pharmaceutical composition, characterized in that consisting of one base sequence selected from the group consisting of the base sequence of SEQ ID NO: 1 to 23.
PCT/KR2019/014051 2018-11-06 2019-10-24 Dna aptamer specifically binding to glutathione and use thereof WO2020096240A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR20180135215 2018-11-06
KR10-2018-0135215 2018-11-06

Publications (1)

Publication Number Publication Date
WO2020096240A1 true WO2020096240A1 (en) 2020-05-14

Family

ID=70611069

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2019/014051 WO2020096240A1 (en) 2018-11-06 2019-10-24 Dna aptamer specifically binding to glutathione and use thereof

Country Status (1)

Country Link
WO (1) WO2020096240A1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP4116422A4 (en) * 2020-03-03 2024-03-20 Nexmos Co., Ltd. Dna aptamer specifically binding to glutathione and use thereof

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20070112064A1 (en) * 2003-07-24 2007-05-17 Lyles Mark B Nucleic acid antioxidant compositions, methods for obtaining such compositions and formulations thereof
KR20160007931A (en) * 2014-07-10 2016-01-21 한양대학교 산학협력단 Nucleic Acid Aptamer for inhibiting Acetohydroxyacid Synthase of Mycobacterium tuberculosis
WO2017196077A1 (en) * 2016-05-12 2017-11-16 주식회사 넥스모스 Cosmetic and nutritional supplement using aptamer, and method for producing same
KR20180054508A (en) * 2016-03-04 2018-05-24 주식회사 넥스모스 Antioxidant anti-oxidation method, materials and uses thereof
KR20180056190A (en) * 2016-11-18 2018-05-28 주식회사 넥스모스 An Aptamer-based vitamin and antioxidant beverages and foods, and a producing method thereof

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20070112064A1 (en) * 2003-07-24 2007-05-17 Lyles Mark B Nucleic acid antioxidant compositions, methods for obtaining such compositions and formulations thereof
KR20160007931A (en) * 2014-07-10 2016-01-21 한양대학교 산학협력단 Nucleic Acid Aptamer for inhibiting Acetohydroxyacid Synthase of Mycobacterium tuberculosis
KR20180054508A (en) * 2016-03-04 2018-05-24 주식회사 넥스모스 Antioxidant anti-oxidation method, materials and uses thereof
WO2017196077A1 (en) * 2016-05-12 2017-11-16 주식회사 넥스모스 Cosmetic and nutritional supplement using aptamer, and method for producing same
KR20180056190A (en) * 2016-11-18 2018-05-28 주식회사 넥스모스 An Aptamer-based vitamin and antioxidant beverages and foods, and a producing method thereof

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
CHOI, S ET AL: "Advances in dermatology using DNA aptamer ''Aptamin C'' innovation: Oxidative stress prevention and effect maximization of vitamin C through antioxidation", JOURNAL OF COSMETIC DERMATOLOGY, vol. 19, no. 4, 1 April 2020 (2020-04-01), pages 970 - 976, XP055705080, ISSN: 1473-2130, DOI: 10.1111/jocd.13081 *
SIN, DAVINA K: "Isolation of aptamers with binding affinity for reduced and oxidized glutathione", 13 June 2018 (2018-06-13), pages 1 - 58, XP055705078, Retrieved from the Internet <URL:http://hdl.handle.net/10211.3/203802> *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP4116422A4 (en) * 2020-03-03 2024-03-20 Nexmos Co., Ltd. Dna aptamer specifically binding to glutathione and use thereof

Similar Documents

Publication Publication Date Title
WO2016104911A1 (en) Pharmaceutical composition for prevention or treatment of cellular senescence, comprising exosome as active ingredient
US20130196937A1 (en) Age production inhibitor
JP2007091693A (en) Moisture retention composition
WO2020262933A1 (en) Pharmaceutical composition for preventing hair loss or promoting hair growth, comprising ginsenoside rg4 or mixture (rgx 365) of ginsenosides rg2, rg4, rg6, and rh1 as active ingredient
JP7461876B2 (en) Devil&#39;s claw extract, various compositions containing same and method for producing devil&#39;s claw extract
KR20200043406A (en) Whitening agents, external preparations for skin whitening and methods for whitening skin
WO2017003086A1 (en) Composition for inhibiting and preventing myopathy, containing bean leaf extract as active ingredient
WO2020096240A1 (en) Dna aptamer specifically binding to glutathione and use thereof
JP5224770B2 (en) Collagen production promoter, promotion method, cosmetics, food and drink, and pharmaceuticals
WO2018074763A1 (en) Method for preventing oxidation of antioxidant material using aptamer, material, and use thereof
WO2018203668A1 (en) External-use skin preparation composition for alleviating atopic skin, and cosmetic containing same
WO2022197170A1 (en) Anticancer or anti-inflammatory composition comprising composite ion mineral solution as active ingredient
WO2021177657A1 (en) Dna aptamer specifically binding to glutathione and use thereof
JP2008074792A (en) Composition for anti-fatigue use
WO2020096190A1 (en) Cosmetic composition for protecting skin against fine dust containing c-peptide as active ingredient
WO2013115456A1 (en) Food, cosmetic material, or pharmaceutical composition containing ginger supercritical extract and fermented dropwort residue extract
KR101679480B1 (en) Cosmetic Compositions Including a Natural Extract for Improvement of Acne
WO2013141565A1 (en) Composition for enhancing defenses of skin
JP2011016727A (en) Melanogenesis inhibitor
JP2016130230A (en) SKIN BARRIER FUNCTION IMPROVING AGENT, INTERCELLULAR ADHESION STRUCTURE FORMATION PROMOTER, TIGHT JUNCTION FORMATION PROMOTER, TRPV4 ACTIVATOR, INTRACELLULAR Ca CONCENTRATION INCREASING ENHANCER, AND SEBUM PRODUCTION PROMOTER
WO2021049768A1 (en) Chitosan-coated nanocapsule containing retinol or retinol derivative, and use thereof
JP2008074802A (en) Skin-beautifying composition
KR20210111683A (en) DNA aptamer specifically binding to glutathione and use of the same
KR101869639B1 (en) Composition comprising Astilboides tabularis extracts or fraction thereof as an active ingredient and use thereof
WO2018186705A1 (en) Composition, containing siraitia grosvenorii residue extract as active ingredient, for prevention, alleviation, or treatment of inflammation

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 19881438

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 19881438

Country of ref document: EP

Kind code of ref document: A1