WO2020085838A1 - 심비대증 동물 모델 제작용 재조합 벡터, 상기 재조합 벡터로 형질전환된 심비대증 동물 모델 및 이의 제작 방법 - Google Patents

심비대증 동물 모델 제작용 재조합 벡터, 상기 재조합 벡터로 형질전환된 심비대증 동물 모델 및 이의 제작 방법 Download PDF

Info

Publication number
WO2020085838A1
WO2020085838A1 PCT/KR2019/014133 KR2019014133W WO2020085838A1 WO 2020085838 A1 WO2020085838 A1 WO 2020085838A1 KR 2019014133 W KR2019014133 W KR 2019014133W WO 2020085838 A1 WO2020085838 A1 WO 2020085838A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
nucleotide sequence
mir
recombinant vector
wobble
Prior art date
Application number
PCT/KR2019/014133
Other languages
English (en)
French (fr)
Inventor
지성욱
석희영
Original Assignee
고려대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 고려대학교 산학협력단 filed Critical 고려대학교 산학협력단
Publication of WO2020085838A1 publication Critical patent/WO2020085838A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/8509—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells for producing genetically modified animals, e.g. transgenic
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K67/00—Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
    • A01K67/027—New or modified breeds of vertebrates
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K67/00—Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
    • A01K67/027—New or modified breeds of vertebrates
    • A01K67/0275—Genetically modified vertebrates, e.g. transgenic
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/5044—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics involving specific cell types
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00—Genetically modified animals
    • A01K2217/05—Animals comprising random inserted nucleic acids (transgenic)
    • A01K2217/054—Animals comprising random inserted nucleic acids (transgenic) inducing loss of function
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2227/00—Animals characterised by species
    • A01K2227/10—Mammal
    • A01K2227/105—Murine
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2267/00—Animals characterised by purpose
    • A01K2267/03—Animal model, e.g. for test or diseases
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/8509—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells for producing genetically modified animals, e.g. transgenic
    • C12N2015/8527—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells for producing genetically modified animals, e.g. transgenic for producing animal models, e.g. for tests or diseases

Definitions

  • the present invention relates to a recombinant vector for producing an animal model of cardiomegaly, an animal model of cardiomegaly transformed with the recombinant vector, and a method of manufacturing the same.
  • MicroRNA is a small RNA composed of ⁇ 21 bases, and functions to induce RNA interference that suppresses expression of a gene in a step after transcription of a target gene. MicroRNA recognizes hundreds of target mRNAs and suppresses their expression through nucleotide sequence of the seed region (positions 1-8) mainly located at the 5 'end, thereby controlling various biological phenomena.
  • the microRNA when the microRNA binds to the target mRNA, at least six contiguous nucleotide sequences, i.e., 2nd to 7th, mainly through the seed region between the 2nd and 8th nucleotides at the 5 'end. It is known to use a nucleotide sequence or a nucleotide sequence between the 3rd and 8th nucleotides, which is called canonical target recognition, and recently, Ago, a technique for sequencing mRNA positions binding to microRNA As HITS-CLIP was developed, it became known that there were many irregular target recognitions that deviated from these rules in addition to regular target recognition.
  • heart disease is one of the top three death diseases in Korean adults, including cancer, and various pathological stresses in the onset process begin to cause cardiac hypertrophy by changing the size of heart tissue.
  • Hypertrophy is characterized by increased myocardial cell size and increased protein synthesis rate. Cardiac hypertrophy gradually induces myocardial fibrosis and heart failure, and finally appears as heart failure (or heart failure).
  • heart failure since the mortality rate is very high, especially around 50%, studies are being conducted to ultimately prevent myocardial hypertrophy or develop a treatment method, so it is necessary to establish a disease model for this.
  • a well-known method for inducing such hypertrophy in animal and cell models is a method of treating an adrenergic receptor agonist such as phenylephrine (PE) or isoproterenol (ISO).
  • PE phenylephrine
  • ISO isoproterenol
  • this treatment has a difficulty in repeatedly experimenting to inject into the body of a mouse at the same interval every time for at least 1 month, or inserting a pump that constantly delivers drugs into a subject through surgical surgery.
  • Cardiac hypertrophy is also known to be regulated by microRNA like many other diseases.
  • miR-1 plays a very important role in the development of myocardial cells, as well as inducing cardiac atrophy. It was reported.
  • miR-133 expressed like miR-1 is also known to have a function of suppressing myocardial hypertrophy.
  • the inventors of the G A wobble seed site (G: A wobble seed site), an irregular target recognition form of miR-1, a microRNA known to be specifically expressed in muscle cells including the heart, are regularly seeded.
  • G A wobble seed site
  • miR-1 miR-1
  • a microRNA known to be specifically expressed in muscle cells including the heart are regularly seeded.
  • the recombinant vector containing the modified base sequence specifically to the mouse myocardial cells to recognize it as a site we observed the phenomenon of myocardial cell enlargement, and attempted to construct an animal model of cardiomegaly disease using this.
  • the problem to be solved by the present invention is represented by the nucleotide sequence of SEQ ID NO: 1 (5'-UGGAAUGUAAAGAAGUAUGUAU-3 '), and any one of 2 to 3 based on the 5' end of the miR-1 gene inducing RNA interference
  • Starting from the nucleotide of the total of 6 consecutive polynucleotides, and at least one of nucleotides 2, 3, or 7 of the nucleotide sequence of SEQ ID NO: 1 is guanine (Guanine; G) to uracil (Uracil; U
  • the sequence from the 2nd to the 7th based on the 5 'end of the RNA interference-inducing nucleic acid binding to the Argonaute protein may be UGAAUG, GUAAUG, GGAAUU, GAAUGU, UAAUGU or GAAUUU,
  • the sequence shows the effect that miR-1 represented by the nucleotide sequence of SEQ ID NO: 1 binds only to a target recognized as a G:
  • the present invention includes a total of six consecutive polynucleotides starting from any one of nucleotides 2 to 3 of the 5 'end of the gene represented by the nucleotide sequence of SEQ ID NO: 1 , RNA interference-inducing nucleic acid comprising a polynucleotide in which one or more of nucleotides 2, 3, or 7 of SEQ ID NO: 1 is substituted with uracil (U) in guanine (G) It provides a recombinant vector for producing an animal model of cardiomegaly, characterized in that.
  • the polynucleotide may be selected from the following groups of polynucleotides:
  • a polynucleotide represented by the nucleotide sequence of SEQ ID NO: 2 (5'-UGAAUG-3 '); A polynucleotide represented by the nucleotide sequence of SEQ ID NO: 3 (5'-GUAAUG-3 '); A polynucleotide represented by the nucleotide sequence of SEQ ID NO: 4 (5'-GGAAUU-3 '); A polynucleotide represented by the nucleotide sequence of SEQ ID NO: 5 (5'-UAAUGU-3 '); Or a polynucleotide represented by the nucleotide sequence of SEQ ID NO: 6 (5'-GAAUUU-3 ').
  • the recombinant vector may include a base sequence substituted with adenine (A) in front of the first nucleotide at the 5 'end of the polynucleotide, and is not limited thereto, and may bind to an agonist protein.
  • the first nucleotide at the 5 'end can be A, U, C, G all nucleotide sequences.
  • the recombinant vector can express any one of the following groups of RNA interference-inducing nucleic acids:
  • RNA interference-inducing nucleic acid represented by the nucleotide sequence of SEQ ID NO: 7 (5'-UUG AAU GUA AAG AAG UAU GUA U-3 ');
  • RNA interference-inducing nucleic acid represented by the nucleotide sequence of SEQ ID NO: 8 (5'- UGU AAU GUA AAG AAG UAU GUA U-3 ');
  • RNA interference-inducing nucleic acid represented by the nucleotide sequence of SEQ ID NO: 9 (5'-UGG AAU UUA AAG AAG UAU GUA U-3 ');
  • RNA interference-inducing nucleic acid represented by the nucleotide sequence of SEQ ID NO: 10 (5'-AUG AAU GAC UGC CGG UUG UUA UG-3 ');
  • RNA interference-inducing nucleic acid represented by the nucleotide sequence of SEQ ID NO: 11 (5'-AGU AAU GAC UGC CGG UUG UUA UG-3 ');
  • RNA interference-inducing nucleic acid represented by the nucleotide sequence of SEQ ID NO: 12 (5'-AGG AAU UAC UGC CGG UUG UUA UG-3 ');
  • RNA interference-inducing nucleic acid represented by the nucleotide sequence of SEQ ID NO: 13 (5'-AUA AUG UAC UGC CGG UUG UUA UG-3 '); or
  • RNA interference-inducing nucleic acid represented by the nucleotide sequence of SEQ ID NO: 14 (5'-AGA AUU UAC UGC CGG UUG UUA UG-3 ').
  • the gene represented by the nucleotide sequence of SEQ ID NO: 1 may be miR-1.
  • the polynucleotide may be a polynucleotide that recognizes a target site where a G: A wobble arrangement occurs.
  • the recombinant vector is an alpha MHC ( ⁇ MHC) promoter, a beta MHC ( ⁇ MHC) promoter, an Nkx2.5 promoter, a cardiac troponin T (TNNT2) promoter, a muscle creatine kinase ( A promoter selected from the group consisting of a muscle creatine kinase (MCK) promoter, a human alpha-skeletal actin (HAS) promoter, and a murine stem cell virus (MSCV) promoter is operably linked.
  • ⁇ MHC alpha MHC
  • ⁇ MHC beta MHC
  • Nkx2.5 promoter
  • TNNT2 cardiac troponin T
  • TNNT2 cardiac troponin T
  • a promoter selected from the group consisting of a muscle creatine kinase (MCK) promoter, a human alpha-skeletal actin (HAS) promoter, and a murine stem cell virus (MSCV) promoter is operably linked.
  • the cardiac hypertrophy is cardiac hypertrophy, heart failure, cardiac fibrosis, mitral valve insufficiency, aortic valve regurgitation, dilated cardiomyopathy, ischemic heart disease, ventricular septal defect, tricuspid valve It may be occlusive insufficiency, pulmonary valve insufficiency, pulmonary arterial hypertension, right ventricular myocardial infarction, cardiomyopathy involving the right ventricle, atrial septal defect, atrial fibrillation, hypertrophic cardiomyopathy or invasive cardiomyopathy.
  • the animal may be a mammal except human.
  • the animal may be a mouse.
  • the present invention provides a cardiac hypertrophy animal model characterized by being transformed with the recombinant vector.
  • the present invention starting from any one of nucleotides 2 to 3 of the 5 'end of the gene represented by the nucleotide sequence of SEQ ID NO: 1 includes a total of six consecutive nucleotides, the SEQ ID NO: 1 Symbiosis by operably connecting DNA expressing polynucleotides in which at least one of the nucleotide sequences 2, 3, or 7 of nucleotides is substituted with uracil (U) in guanine (G) Preparing a recombinant vector for animal model production;
  • the present invention comprises the steps of (a) treating a candidate substance to the cardiomyocytes of the cardiac hypertrophy animal model;
  • a wobble (wobble) array target site is reduced compared to an animal model of cardiomegaly that did not process the candidate substance, the method comprising selecting the candidate substance as a therapeutic agent for cardiomegaly, It provides a method of screening for a treatment for hypertrophy.
  • the biological function of increasing the size of the myocardial cells appears by recognizing and inhibiting only the non-regular G: A wobble base sequence target site of the microRNA. Since cardiac hypertrophy is induced, it is expected that an animal model in which cardiomegaly is induced can be prepared and usefully used in the study of pathology and pathophysiology and physiological mechanisms of cardiac diseases including cardiomegaly at the individual level.
  • Ago HITS-CLIP is sequence data for a microRNA binding to an agonist protein in human brain tissue and its target mRNA position, as well as a normal target (seed) target . It is a diagram showing the result of confirming that the non-regular G: A wobble array (G: A wobble) starting target naturally exists.
  • Figures 2a and 2b are human RNA myocardial infarction (Cardiomyopathy) miR- expressing heart tissue specifically through Ago HITS-CLIP, a sequence mRNA data for the target mRNA position and microRNA binding to agonist protein in the heart tissue of patients
  • G A wobble
  • 3A to 3D show that miR-1 functions to suppress the expression of a non-regular G: A wobble sequence initiation target gene. It is a figure showing the results confirmed in.
  • 4A to 4D are expressed by substituting 2, 3, or 7th guanine base with uracil from the 5 'end corresponding to miR-1 to recognize only the non-regular G: A wobble sequence initiation target gene of miR-1. It is a figure showing the result of confirming through the luciferase reporter experiment that only the target gene of the G: A wobble sequence is inhibited.
  • 5A to 5C are expressed by substituting 2, 3, or 7 guanine bases from the 5 'end of miR-1 with uracil, thereby expressing 2, 3, or 7 guanine bases from the 5' end of miR-1
  • This diagram shows the result of confirming the function of G: A wobble array initiation target gene through observation of cell morphology and molecular biological characteristics for myocardial hypertrophy-inducing effect.
  • 6A to 6C show the minimum nucleotide sequence showing the regulatory function of an irregular G: A wobble sequence initiation target gene for 2, 3, or 7 guanine bases from the 5 'end of miR-1 from the 5' end of miR-1 It is defined as the 2nd to 7th sequence, or the 3rd to 8th sequence, and the effect of inducing the myocardial hypertrophy induced by introducing RNA interference-inducing substances containing only the nucleotide sequence into the cardiomyocyte cell line (H9c2) is observed in the cell form. It is a diagram showing the results confirmed through.
  • 7A to 7D show microRNA sequences in which the 7th guanine from the 5 'end of miR-1 is substituted with uracil to control only the non-regular G: A wobble sequence initiation target for the 7th guanine base from the 5' end of miR-1. It is a diagram showing the manufacturing process of a transgenic mouse expressing specifically myocardial cells.
  • 8A to 8D show myocardial hypertrophy in an individual of a transgenic mouse expressing a microRNA sequence in which the 7th guanine from the 5 'end of miR-1 was specifically substituted with uracil for myocardial cell cells, and monitoring the survival of the individual. It is a diagram showing one result.
  • 9A to 9C show myocardial hypertrophy of transformed mouse lines generated while maintaining an individual of a transformed mouse expressing a microRNA sequence in which a 7th guanine substituted with uracil from the 5 'end of miR-1 specifically for cardiomyocytes It is a diagram showing the results of observing.
  • the present invention can recognize a G: A wobble seeding site (G: A wobble seed site), which is a form of irregular target recognition of microRNAs found by the present inventors through Ago HITS-CLIP analysis, as a regular seed site. It is based on the technology to modify the sequence so as to develop a technology to efficiently suppress only the non-regular target gene of the microRNA through this, and it was confirmed that the effect of the technology is to selectively show only the non-regular target inhibition, which is a function of the microRNA. In particular, when the technique was applied to miR-1, a microRNA known to be expressed mainly in muscle cells including the heart, a phenomenon in which myocardial cells were enlarged was observed.
  • the present invention includes a total of six consecutive polynucleotides starting from any one of nucleotides 2 to 3 based on the 5 'end of the gene represented by the nucleotide sequence of SEQ ID NO: 1, and among the nucleotide sequences of SEQ ID NO: 1 Cardiac hypertrophy animal, characterized in that at least one of nucleotides 2, 3 or 7 expresses RNA interference-inducing nucleic acid comprising polynucleotides substituted with Guanine (G) to Uracil (U)
  • G Guanine
  • Uracil U
  • the polynucleotide is a polynucleotide represented by the nucleotide sequence of SEQ ID NO: 2 (5'-UGAAUG-3 '); A polynucleotide represented by the nucleotide sequence of SEQ ID NO: 3 (5'-GUAAUG-3 '); A polynucleotide represented by the nucleotide sequence of SEQ ID NO: 4 (5'-GGAAUU-3 '); A polynucleotide represented by the nucleotide sequence of SEQ ID NO: 5 (5'-UAAUGU-3 '); Or it may be selected from polynucleotides represented by the nucleotide sequence of SEQ ID NO: 6 (5'-GAAUUU-3 '), but is not limited thereto.
  • the recombinant vector can efficiently load agonists by including a base sequence substituted with adenine (A) in front of the first nucleotide of the 5 'end of the polynucleotide, but is not limited thereto. If it is possible to bind to the protein, the first nucleotide at the 5 'end can be A, U, C, G all nucleotide sequences.
  • A adenine
  • the RNA interference-inducing nucleic acid is microRNA, small interfering RNA (siRNA), short hairpin RNA (shRNA), DsiRNA, lsiRNA, ss-siRNA, piRNA, endo-siRNA, And it may be selected from the group consisting of asiRNA, but if the nucleic acid inducing RNA interference is not limited to the above type.
  • the recombinant vector is an RNA interference-inducing nucleic acid represented by the nucleotide sequence of SEQ ID NO: 7 (5'-UUG AAU GUA AAG AAG UAU GUA U-3 ');
  • RNA interference-inducing nucleic acid represented by the nucleotide sequence of SEQ ID NO: 8 (5'- UGU AAU GUA AAG AAG UAU GUA U-3 ');
  • RNA interference-inducing nucleic acid represented by the nucleotide sequence of SEQ ID NO: 9 (5'-UGG AAU UUA AAG AAG UAU GUA U-3 ');
  • RNA interference-inducing nucleic acid represented by the nucleotide sequence of SEQ ID NO: 10 (5'-AUG AAU GAC UGC CGG UUG UUA UG-3 ');
  • RNA interference-inducing nucleic acid represented by the nucleotide sequence of SEQ ID NO: 11 (5'-AGU AAU GAC UGC CGG UUG UUA UG-3 ');
  • RNA interference-inducing nucleic acid represented by the nucleotide sequence of SEQ ID NO: 12 (5'-AGG AAU UAC UGC CGG UUG UUA UG-3 ');
  • RNA interference-inducing nucleic acid represented by the nucleotide sequence of SEQ ID NO: 13 (5'-AUA AUG UAC UGC CGG UUG UUA UG-3 '); or
  • RNA interference-inducing nucleic acid represented by the nucleotide sequence of SEQ ID NO: 14 (5'-AGA AUU UAC UGC CGG UUG UUA UG-3 ') can be expressed, but is not limited thereto.
  • the gene represented by the nucleotide sequence of SEQ ID NO: 1 may be miR-1.
  • the polynucleotide may be a polynucleotide that recognizes a target site where G: A wobble alignment occurs.
  • nucleotide in the present invention includes nitrogen-containing heterocyclic bases, sugars and one or more phosphate groups. These are the monomer units of the nucleic acid sequence.
  • sugar is ribose
  • DNA it is deoxyribose, ie, a sugar that lacks the hydroxyl group present in ribose.
  • the nitrogen-containing heterocyclic base can be a purine or pyrimidine base.
  • Purine bases include adenine (A) and guanine (G), and modified derivatives or analogs thereof.
  • Pyrimidine bases include cytosine (C), thymine (T) and uracil (U), and their modified derivatives or analogs.
  • the sugar of the nucleotide is ribose
  • the base includes adenine (A), guanine (G), cytosine (C), or uracil (U).
  • the recombinant vector may include DNA, and the DNA includes a polynucleotide complementary to the polynucleotide of the RNA interference-inducing nucleic acid of the present invention.
  • the base of the RNA interference-inducing nucleic acid is adenine (A), the thymine (T) base
  • the base of the RNA interference-inducing nucleic acid is guanine (G)
  • the cytosine (C) base the base of the RNA interference-inducing nucleic acid is cytosine
  • the base of the guanine (G) base and the RNA interference inducing nucleic acid may include the adenine (A) base when the base is uracil (U).
  • the recombinant vector is an RNA interference-inducing nucleic acid represented by the nucleotide sequence of SEQ ID NO: 7 (5'-UUG AAU GUA AAG AAG UAU GUA U-3 ');
  • RNA interference-inducing nucleic acid represented by the nucleotide sequence of SEQ ID NO: 8 (5'- UGU AAU GUA AAG AAG UAU GUA U-3 ');
  • RNA interference-inducing nucleic acid represented by the nucleotide sequence of SEQ ID NO: 9 (5'-UGG AAU UUA AAG AAG UAU GUA U-3 ');
  • RNA interference-inducing nucleic acid represented by the nucleotide sequence of SEQ ID NO: 10 (5'-AUG AAU GAC UGC CGG UUG UUA UG-3 ');
  • RNA interference-inducing nucleic acid represented by the nucleotide sequence of SEQ ID NO: 11 (5'-AGU AAU GAC UGC CGG UUG UUA UG-3 ');
  • RNA interference-inducing nucleic acid represented by the nucleotide sequence of SEQ ID NO: 12 (5'-AGG AAU UAC UGC CGG UUG UUA UG-3 ');
  • RNA interference-inducing nucleic acid represented by the nucleotide sequence of SEQ ID NO: 13 (5'-AUA AUG UAC UGC CGG UUG UUA UG-3 '); or
  • RNA interference-inducing nucleic acid represented by the nucleotide sequence of SEQ ID NO: 14 (5'-AGA AUU UAC UGC CGG UUG UUA UG-3 ') can be expressed.
  • the DNA comprises SEQ ID NO: 15: 5'-A TAC ATA CTT CTT TAC ATT CAA-3 ';
  • SEQ ID NO: 16 5'-A TAC ATA CTT CTT TAC ATT ACA-3 ';
  • SEQ ID NO: 17 5'-A TAC ATA CTT CTT TAA ATT CCA-3 ';
  • SEQ ID NO: 18 5'-CA TAA CAA CCG GCA GTC ATT CAT-3 ';
  • SEQ ID NO: 19 5'-CA TAA CAA CCG GCA GTC ATT ACT-3 ';
  • SEQ ID NO: 20 5'-AT TAA CAA CCG GCA GTA ATT CCT-3 ';
  • SEQ ID NO: 21 5'-CA TAA CAA CCG GCA GTA CAT TAT-3 '; or
  • SEQ ID NO: 22 5'-CA TAA CAA CCG GCA GTA AAT TCT-3 '.
  • target site refers to the target nucleotide sequence that binds to the second to eighth nucleotide sequence based on the 5 'end of the micro RNA.
  • seed region refers to the second to eighth base sequence of the 5 'end of the microRNA.
  • the term "wobble (wobble) arrangement" when the microRNA binds to the target mRNA, even if the target region of the microRNA is not exactly complementary to the seed region of the microRNA, the guanine base is adenine G: A sequence binding to a base or guanine base refers to a base sequence through a G: U sequence binding to an uracil base, and in the present invention, the G: A or G: U wobble base sequence refers to microRNA and micro It means that the base of the target gene recognized by RNA has a nucleotide sequence of G: A or G: U in addition to the arrangement of complementary relationships of A: U, G: C, C: G, and U: A.
  • the base region of the origin of a specific microRNA the alignment of the base of the target gene recognized by the specific microRNA is G: A
  • the base of a specific microRNA The sequence of the base of the target gene recognized by the specific microRNA is G: U.
  • the term "recombinant" in the present invention refers to a cell in which a cell replicates a heterologous nucleic acid, expresses the nucleic acid, or expresses a peptide, a heterologous peptide or a protein encoded by a heterologous nucleic acid.
  • Recombinant cells can express genes or gene segments not found in the natural form of the cells, either in sense or antisense form. Recombinant cells can also express genes found in natural cells, but these genes have been modified and reintroduced into cells by artificial means.
  • vector in the present invention means a DNA structure containing a DNA sequence operably linked to a suitable regulatory sequence capable of performing expression of DNA in a suitable host.
  • Suitable regulatory sequences include promoters for performing transcription, any operator sequences for regulating transcription, sequences encoding suitable mRNA ribosomal binding sites, and sequences that control the termination of transcription and translation.
  • the vector of the present invention is not particularly limited as long as it can be replicated in a cell, and any vector known in the art can be used, such as a plasmid, cosmid, phage particle, or viral vector.
  • the term “recombinant vector” is used as an expression vector of a target polypeptide capable of expressing the target polypeptide with high efficiency in a suitable host cell when the coding gene of the target polypeptide to be expressed is operably linked.
  • the recombinant vector can be expressed in a host cell.
  • the host cell may be preferably a eukaryotic cell, and appropriately selects an expression control sequence such as a promoter, terminator, enhancer, etc., a sequence for membrane targeting or secretion, etc., depending on the type of host cell. And can be combined in various ways depending on the purpose.
  • operably linked refers to a gene that requires expression and a control sequence thereof are functionally linked to each other to be linked in a manner that enables gene expression.
  • the term "promotor (promotor)” refers to a nucleic acid sequence that regulates gene expression as a DNA sequencing site to which transcription regulators bind, and is intended to induce overexpression of a target gene.
  • the promoter include a Pribno box, a TATA box, and the like.
  • the recombinant vector of the present invention includes an alpha MHC ( ⁇ MHC) promoter, a beta MHC ( ⁇ MHC) promoter, an Nkx2.5 promoter, a cardiac troponin T (TNNT2) promoter, a muscle creatine kinase (MCK).
  • a promoter selected from the group consisting of a promoter, a human ⁇ -skeletal actin (HAS) promoter, and a murine stem cell virus (MSCV) promoter is operably linked to myocardial cell specific expression It can be controlled, and according to an embodiment of the present invention, the alpha MHC ( ⁇ MHC) promoter may be operably linked, but is not limited to the type of the promoter.
  • myocardial cell-specific refers to a characteristic that is not expressed in cells other than myocardial cells or is expressed to a low degree, while expressed in a very high degree in myocardial cells.
  • expression in the present invention refers to a process in which a polypeptide is produced from a structural gene, the process including transcription of a gene into mRNA, and translation of such mRNA into the polypeptide (s).
  • overexpression refers to a state in which transcription of a gene into mRNA and translation of such mRNA into polypeptide (s) are produced more than in the normal state.
  • the term "transformation” means that the genetic properties of a living organism are changed by introducing a vector form of DNA directly into a cell physicochemically or by infecting a virus with a host cell to express a foreign gene, that is, the gene in the host cell. It means that it can be introduced and expressed in a host cell.
  • the method of introducing a vector form of DNA into a cell is not particularly limited, such as nucleofection, transient transfection, cell fusion, liposome-mediated transfection. transfection), polybrene-mediated transfection, transfection with calcium phosphate (Graham, FL et al., Virology, 52: 456 (1973)), transfection with DEAE dextran, microinjection By transfection (Capecchi, MR, Cell, 22: 479 (1980)), transfection by cationic lipids (Wong, TK et al., Gene, 10:87 (1980)), electroporation (Neumann E et al., EMBO J, 1: 841 (1982), as described in Basic methods in molecular biology, Davis et al., 1986 and Molecular cloning: A laboratory manual, Davis et al., 1986, such as transduction or transfection. In methods well known to those skilled in the art LA can be achieved.
  • cardiac hypertrophy refers to a condition in which myocardial fibers are enlarged, an increase in heart weight, and a thickening of the ventricular walls, cardiac hypertrophy, heart failure, cardiac fibrosis, mitral valve insufficiency, Aortic valve insufficiency, dilated cardiomyopathy, ischemic heart disease, ventricular septal defect, tricuspid valve insufficiency, pulmonary valve failure, pulmonary arterial hypertension, right ventricular myocardial infarction, myocardial invasion of the right ventricle, atrial septal defect, atrial fibrillation, hypertrophy It may be an initial symptom of cardiomyopathy or infiltrative cardiomyopathy, but if it is a disease related to cardiac hypertrophy other than the above-mentioned diseases, the type is not limited.
  • the present invention also provides an animal model of cardiac hypertrophy characterized by transformation with the recombinant vector.
  • the animal may be a mammal other than a human, for example, a non-human primate, mouse, dog, cat, rabbit, horse, or cow.
  • the animal may be a mouse, but if it is a mammal other than a human, there is no particular limitation on its type.
  • the present invention starting from any one of nucleotides 2 to 3 of the 5 'end of the gene represented by the nucleotide sequence of SEQ ID NO: 1 includes a total of six consecutive nucleotides, the SEQ ID NO: 1 Symbiosis by operably connecting DNA expressing polynucleotides in which at least one of the nucleotide sequences 2, 3, or 7 of nucleotides is substituted with uracil (U) in guanine (G) Preparing a recombinant vector for animal model production;
  • the present invention comprises the steps of (a) treating a candidate substance to the cardiomyocytes of the cardiac hypertrophy animal model;
  • Target G A wobble sequence of polynucleotides in which one or more of nucleotides 2, 3, or 7 of SEQ ID NO: 1 is substituted with uracil (U) in guanine (G) Analyzing the frequency of binding with the site;
  • a wobble (wobble) array target site is reduced compared to an animal model of cardiomegaly that did not process the candidate substance, the method comprising selecting the candidate substance as a therapeutic agent for cardiomegaly, It provides a method of screening for a treatment for hypertrophy.
  • the candidate substance refers to an unknown substance used for screening to examine whether it affects the frequency of binding of the polynucleotide to the G: A wobble array target site in cardiomyocytes of the cardiac hypertrophy animal model. And, it may include a chemical, protein, (poly) nucleotide, antisense-RNA, siRNA (small interference RNA), or natural extracts, but is not limited thereto.
  • Ago HITS- CLIP As a method to analyze the target of microRNA at the transcript level, an experimental method called Ago HITS- CLIP has been developed and widely used.
  • Ago HITS CLIP experiment cells and tissue samples are irradiated with UV and RNA and ago within the cell After inducing a covalent bond between nut proteins, the RNA-agonut complex thus generated is isolated by immunoprecipitation using an antibody that specifically recognizes the agonut, and then the isolated RNA is next-generation. sequencing).
  • the sequencing data thus obtained can not only identify the target mRNA of the microRNA through bioinformatics analysis, but also accurately analyze the binding position and sequence.
  • Ago HITS-CLIP was applied to mouse cortical tissue for the first time to map the target of microRNA in brain tissue, and since then, the method has been applied to various tissues. These Ago HITS-CLIP analyzes revealed the location of microRNA binding in different tissues, especially similar to the initiation binding of microRNAs in these target sequences, but other forms of irregular binding targets in the sequence of the target mRNA. I learned that there are many.
  • Ago HITS-CLIP is performed on the gray matter of the posterior brain tissue as shown in FIG. 1A.
  • One data was analyzed.
  • the RNA sequence bound with the agonut-microRNA was performed by arranging the human genome sequence with the Bowtie2 program in the sequenced FASTQ file.
  • the sequencing results were arranged in the human microRNA sequence, and 20 types of microRNAs (top20 miRNAs) frequently associated with agonist proteins in corresponding brain tissues were also analyzed.
  • G A wobble allowed target (median value 1119.5 site, error range +/- 526.48) and G: U wobble allowed target (median value 995 site, error range +/- 523.22 ) All of the sites showed a higher distribution than the control group (median 891 site, error range +/- 410.71), and in particular, the microRNA target site with G: A wobble exists about 1.1 times more than the G: U wobble. Shown.
  • miR-124 specifically expressed in brain tissue (5'-UAA GGC ACG CGG UGA AUG CCA A-3 '; SEQ ID NO: 23), as shown in Fig. It has the 4th and 5th from the terminal, so that G: U and G: A wobble nucleotides can be formed. Therefore, as a result of distinguishing and analyzing the G: A and G: U wobble nucleotide sequences by G at a specific position, as shown in FIG. 1D, the miR-124's canonical target site (5'-GUGCCUU-3) '; SEQ ID NO: 24) was found the most (1,992).
  • the fourth is the G: U wobble (1,800) (4G: U site), and the fourth is the G: A wobble (1,542). 4G: A site).
  • the 5th G also showed G: U wobble (1,427) (5G: U site) and G: A wobble (1,196) irregular target sites (5G: A site). It was confirmed that all sites existed more than the number of controls (647).
  • the microRNA recognizes the target mRNA through the nucleotide sequence of the initiating region, it allows not only regular nucleotide sequence through the initiating region, but also irregularly G: U or G: A wobble nucleotide sequence. It has been found that it can bind to the target mRNA.
  • Target recognition of the microRNA through the G: A wobble base is a new result that has not been reported, and it was confirmed that irregular microscopic target recognition and regulation in several microRNAs as observed above.
  • Example 2 Cardiac tissue in patients with myocardial infarction Ago HITS - CLIP Results analysis miR -1 of G: A Wobble Base sequence MicroRNA Discovering irregular target sites allowed in the origin region
  • Example 1 the presence of a wobble nucleotide sequence including G: A among microRNA targets in human brain tissue was confirmed, and it was confirmed whether such irregular G: A wobble nucleotide sequence binding was also present in the heart tissue of a patient with heart disease.
  • the data of Ago HITS-CLIP performed in left ventricular tissue of 6 patients with cardiomyopathy (Nucleic Acids Res. 2016 Sep 6; 44 (15): 7120-7131) were reanalyzed.
  • let-7 / 98 family, miR-27-3p, miR-143, miR-126- always show high expression without tissue specificity of the individual, even the transcript containing the miR-1 target site In order to exclude the possibility of overlapping binding by 3p, etc., it was performed by limiting the transcript having only the target site of miR-1 without including the regular target sites of the above micro RNAs.
  • the target site of miR-1 investigated in the analysis is defined as a site that binds the nucleotide sequence of 2 to 8 (7 base target) as a regular seed binding site based on the 5 'end of micro RNA.
  • Fig. 2A 120 normal target sites composed of only 7 bases of miR-1 were found in the heart tissue of patients with myocardial infarction.
  • the non-regular G A wobble base sequence target site of miR-1 was analyzed for the position of each G base.
  • FIG. 2B there are 21 non-regular G: A wobble base sequence targets (G2A) for the second G base, which corresponds to 38% of the analyzed non-standard G: A wobble base sequence
  • the third G 12 non-canonical G A wobble nucleotide targets (G3A) for the base, 22% of the analyzed non-canonical G: A wobble nucleotide sequence
  • the non-canonical G A wobble nucleotide target (G7A) site for the 7th G base Is 22, which corresponds to 40% of the analyzed irregular G: A wobble base sequence.
  • Example 3 In the cardiomyocyte cell line (H9c2) Using fluorescent protein reporter miR -1 non-regular G: A Array inception target Confirm the effect of suppressing gene expression
  • the microRNA can bind to the target mRNA by allowing the G: A wobble sequence in the initiating sequence, and whether such binding can actually cause inhibition of the target gene.
  • Reporter experiments were performed at the cellular level.
  • the confirmation experiment was conducted on miR-1, which is known to be highly expressed in muscle system cells, such as the cardiomyocyte cell line H9c2, and as observed in Example 2, in the 7th from the 5 'end of miR-1 Focusing on the existing G, G: A wobble nucleotide sequence through it was performed.
  • a fluorescent protein expression reporter system was constructed and used.
  • the fluorescent protein expression reporter system was constructed so that two colors of fluorescent proteins were expressed in one vector, where the green fluorescent protein (GFP) was expressed in the SV40 promoter, and the 3 'non-global portion (3')
  • the target sites of micro RNA were continuously arranged in the untranslated region: 3'UTR) to measure the gene suppression effect by the microRNA through the intensity of the green fluorescent protein, and at the same time, the red fluorescent protein (red fluorescent protein) : RFP) was expressed by the Tk promoter, and the green fluorescence signal was standardized and used.
  • the 500 ng GFP-7G: A site reporter vector and 25 nM miR-1 were simultaneously introduced into the cardiomyocyte cell line H9c2 according to the protocol provided by the company using lipofectamine 2000 (Invitrogen) reagent (co-transfection). After 24 hours, each fluorescence signal was measured by flow cytometry through Attune NxT of Life Technology.
  • control nucleic acid (cont; NT; cel-miR-67) inhibits the 7G: A site of miR-1 very efficiently (in the middle of FIG. 3A) by expression of miR-1. duplex) was introduced and compared (left side of FIG. 3A).
  • GFP-7G A site reporter vector was inhibited to some extent in H9c2 cells without the introduction of miR-1. This can be expected to be suppressed by miR-1 already expressed in H9c2 cells through G: A wobble nucleotide sequence with the reporter target mRNA.
  • a miRIDIAN microRNA Hairpin inhibitor capable of inhibiting the expression of miR-1 in H9c2 cells was purchased from Dharmacon and transfected into cells at a concentration of 50 nM. Used.
  • a control (GFP-no site) without a microRNA target site in a fluorescent protein expression reporter and a GFP-7G: A site, a reporter containing a 7G: A site of miR-1, were introduced into H9c2 cells to compare their activity. It was confirmed by quantitative comparison with the case where miR-1 was introduced together as a positive control.
  • the red fluorescence protein (RFP) value measured by the flow cytometer was divided by section, and the green fluorescence protein (GFP) value at this time was averaged and converted to a log ratio, where the green fluorescence of the control GFP-no site The protein level was set to 1 (relative log GFP) and calculated relative to it.
  • the reporter experiment was repeated after inserting miR-1-7G; A sequence 5 times into the 3 'UTR portion of the red fluorescent protein (RFP) regulated by the SV40 promoter in the p.UTA.3.0 vector, and then reporter The vector (RFP-7G: A site) was prepared and the expression value of the red fluorescent protein was used as a standardization reflecting the degree of green fluorescent protein (GFP) expressed by the Tk promoter, which was introduced into the cell. It was used by modification.
  • RFP-7G A site
  • the 7G: A site of miR-1 is inhibited by miR-1 expressed in H9c2, and a control group without a miRNA target site (RFP-no site)
  • the results of the reporter (RFP-7G: A site) containing the 7G: A site of miR-1 were compared and confirmed, and at the same time, as shown in FIG. 3D, the positive control group also miR-1 in co-transfection with miR-1.
  • the phenomenon of inhibiting the -7G: A site was observed.
  • miR-1 that recognizes both a regular initiating target and an irregular G: A wobble sequence target cannot be used, so miR-1- artificially substituted the second guanine base from the 5 'end of miR-1 with uracil 2GU (5'-UGAAUG-3 '; SEQ ID NO: 2), miR-1-3GU (5'-GUAAUG-3'; SEQ ID NO: 3) with 3rd guanine base replaced with uracil, 7th guanine base with uracil It was designed as shown in Fig. 4A to align only the irregular G: A wobble alignment target, including the sequence of the substituted miR-1-7GU (5'-GGAAUU-3 '; SEQ ID NO: 4).
  • the target inhibitory effect of the miR-1 modified microRNA of FIG. 4A synthesized by the above method was measured by a luciferase reporter.
  • the siRNA of 75 nM prepared in the above-described duplex is HeLa according to the manufacturer's protocol using the Lipofectamine 2000 reagent (Invitrogen) with a psi-check2 vector expressing Renilla luciferase in HeLa cells (ATCC CCL-2).
  • the effect on the concentration of microRNA was investigated by co-transfection to cells.
  • a reporter inserting a non-canonical target site nucleotide sequenced with a G: A wobble was used.
  • HeLa cells were cultured in Dulbecco's modified Eagle's medium (Invitrogen) supplemented with 10% fetal bovine serum (FBS), 100 U / ml penicillin, and 100 ⁇ g / ml steptomycin, and transduced in complete medium without antibiotics. Speculation was performed. 24 hours after transfection, the effect of siRNA was investigated by measuring the activity of luciferase according to the manufacturer's protocol using Promega's Dual-luciferase reporter asssay system. It was standardized and calculated by the activity of firefly luciferase in at least 3 repeated experiments using a Glomax Luminometer.
  • FBS fetal bovine serum
  • Example 5 miR Irregular for the 2, 3, 7th G base of -1 G: A Wobble Confirmation of the hypertrophy-inducing effect of myocardial cells through the regulation of the sequence-targeting target gene
  • the non-regular gene suppression phenomenon identified in Example 3 is a G: A wobble sequence control specificity verified in Example 4 in which the possibility that the G: A wobble base sequence acts as a non-regular target of the microRNA and can also regulate biological functions.
  • G A wobble sequence control specificity verified in Example 4 in which the possibility that the G: A wobble base sequence acts as a non-regular target of the microRNA and can also regulate biological functions.
  • siRNA-GU appropriately substituted nucleic acid
  • miR-1 In order to investigate whether an irregular G: A wobble target has a specific biological function, miR-1 must recognize a non-regular G: A wobble array target site without recognizing a regular target.
  • the miRNA-GU produced by substituting the corresponding G with U so that the G in the initiation region was aligned with A rather than C was used in the experiment.
  • new white paper myocardial cells (neonatal cardiomyocytes) were cultured from rat heart tissue.
  • the culture of new white paper cardiomyocytes is performed by separating new white paper myocardial cells through an enzyme reaction from the heart tissue of rat neonate on day 1 (Cellutron's neomyt kit), and the new white paper cardiomyocytes are 10% FBS (fetal bovine) Dulbecco's modified Eagle's medium (Invitrogen) and M199 (WellGene) medium supplemented with serum), 5% HS (horse serum), 100 U / ml penicillin, and 100 ⁇ g / ml steptomycin were mixed into a 4: 1 medium.
  • the brdU was added and cultured separately from other cells having a cell cycle present in the heart tissue.
  • myocardial hypertrophy is induced in the new white paper myocardial cells obtained from Example 5-1.
  • Myocardial cells have the characteristic of stopping the cell cycle and increasing the size of myocardial cells, which is called myocardial hypertrophy.
  • Myocardial hypertrophy has played a role in supplementing myocardial cell dysfunction, also known as an intermediate stage of pathology of heart disease, and is a system of heart disease model that is well known for cell morphological observation and gene expression profile changes.
  • myocardial hypertrophy can be induced by treating adrenal receptor receptor agonists such as phenylephrine (PE) to myocardial cells.
  • PE phenylephrine
  • the cultured new white paper myocardial cells were treated with 100 uM of phenylephrine to induce myocardial hypertrophy, and as a result, the size of the new white paper myocardial cells compared to the control group (rCMC) that did not process anything as shown in FIG. 4A.
  • the increase was confirmed morphologically (+ PE).
  • the size of the myocardial cells decreases when miR-1 is introduced into the new white paper myocardial cells. This is consistent with the well-known myocardial hypertrophy and miR-1 function in myocardial cells.
  • miR-1 contains 3 G bases in the initiation region, and thus miR- substituted with U in order to recognize only the irregular G: A wobble sequence target site without recognizing the regular target. 1 was designed, and according to the position where the G base is located, in the 2nd position (miR-1-G2U), 3rd position (miR-1-G3U), and 7th position (miR-1-G7U) based on the 5 'end.
  • the miR-1 substituent was synthesized by application.
  • the substituted base sequence of miR-1 used is as follows (miR-1-G2U: 5'p-UUGAAUGUAAAGAAGUAUGUAU-3 ', SEQ ID NO: 7; miR-1-G3U: 5'p-UGUAAUGUAAAGAAGUAUGUAU-3', SEQ ID NO: 8; miR-1-G7U: 5'p-UGGAAUUUAAAGAAGUAUGUAU-3 ', SEQ ID NO: 9), synthesized as a guide strand, from the 5' end of the substituted miR-1 to the 2, 3, 7th base
  • the carrier strand hsa-miR-1-5p; miRBase accession number: MIMAT0031892, 5'-ACAUACUUCUUUAUAUGCCCAU-3 '; SEQ ID NO: 26
  • that forms a duplex with the guide strand is not completely complementary for humans recorded in miRBase.
  • the miR-1 sequence After chemically synthesized and produced by Bioneer, it was separated by HPLC and used as a duplex of guide and carrier strands according to the method provided by the company. The transfection of the microRNA into the new white paper heart muscle cell line was performed at a concentration of 50 nM using RNAimax (Invitrogen) reagent.
  • RNAimax Invitrogen
  • -1 substituents (miR-1-G2U, miR-1-G3U, miR-1-G7U) were analyzed to be about 1.5 to 1.8 times larger in size than when the control (NT) nucleic acid was introduced. This is similar to the myocardial cell size of the myocardial hypertrophy model induced by the phenylephrine (PE) drug, and miR-1 itself shows the effect of reducing the cell size in the form of myocardial cells, thereby preventing its regular target suppression effect. It was observed that it exhibits different functions in cell morphology than target inhibition through G: A wobble.
  • the expression of the ANP (atrial naturiuretic peptide) gene which is known to increase its expression as a marker, is GAPDH through qPCR (Quantitative Polymerase Chain Reaction) experiment. Compared with and measured by relative value.
  • a miR-1 substituent (miR-1-G2U, miR-1-G3U, miR-1-G7U) synthesized to recognize only the G: A wobble sequence site of miR-1 was newly developed.
  • ANP expression was significantly increased by 1.2 to 1.5 times compared to the control (NT).
  • the increase in ANP expression is less than that of the phenylephrine (PE) drug-treated cardiomyocyte test group, which is about two times larger in size than the control group, but ANP expression is significantly reduced when the original miR-1 is introduced.
  • PE phenylephrine
  • Example 6 miR Irregular for the 2nd, 3rd and 7th G bases of -1 G: A Wobble Confirmation of the hypertrophy-inducing effect of myocardial cells through a minimal sequencing function that regulates the target gene sequence
  • miR Irregular for the 2nd, 3rd and 7th G bases of -1 G A Wobble Array inception target Definition of minimum sequencing with gene regulation
  • Example 5 it was confirmed that non-regular G: A wobble sequence initiation target regulation of miR-1's 2, 3, and 7 G bases can induce hypertrophy of myocardial cells, which is completely different from the conventional normal target inhibition.
  • the base sequence of the replacement nucleic acid that allows only the non-regular G A sequence for the 2nd, 3rd, and 7th G bases of miR-1, an experiment was conducted to define the minimum base sequence that induces myocardial hypertrophy.
  • RNA substituted with A base was designed as a guide strand for efficient agonist loading and synthesized in Bioneer as in Example 4 above. This was named miR-1_2-7, and its base sequence was shown in FIG. 5A and was as follows (miR-1_2-7: 5'-AGG AAU GAC UGC CGG UUG UUA UG-3 '; SEQ ID NO: 28).
  • ribonucleic acid miR-1_2-7 which contains only the minimum target base sequence of miR-1
  • ribonucleic acid was designed by replacing the 2nd, 3rd, and 7th G base positions with U bases capable of G: A alignment, respectively.
  • This nucleotide sequence can be defined as the minimum nucleotide sequence that enables the G: A sequence at the 2nd, 3rd and 7th G base positions of miR-1.
  • Each substitution base sequence for the target base sequence of miR-1_2-7 is shown in FIG.
  • the minimum target nucleotide sequence of miR-1 may also consist of 6 consecutive nucleotide sequences from 3 to 8 based on the 5 'end. Therefore, the 6th nucleotide sequence from the 3rd to the 8th of miR-1 is used as a control, arranged at the 2nd to 7th position based on the 5 'end of the NT ribonucleic acid base sequence (SEQ ID NO: 27), and the 1st base and 8
  • the second base was substituted with A base to have a different base sequence from miR-1, and ribonucleic acid having NT base sequence from 9 to 23 was devised, which was miR-1_3-8 (5'-AGA AUG UAC UGC) CGG UUG UUA UG -3 '; SEQ ID NO: 29).
  • RNAs in which the positions of the 3rd and 7th G bases of miR-1_3-8 were replaced with U bases capable of G: A alignment were designed, and this nucleotide sequence was 3rd and 7th G of miR-1. It can be defined as another minimal nucleotide sequence that enables G: A alignment at the base position.
  • Each substitution base sequence for the base sequence of miR-1_3-8 is shown in FIG.
  • Irregular G A Wobble Array inception target Confirmation of hypertrophy-inducing effect of myocardial cells through minimal sequencing with gene regulation
  • the transfection of the microRNA prepared in Example 6-1 into the cardiomyocyte cell line (H9c2) was performed at a concentration of 50 nM using RNAimax (Invitrogen) reagent.
  • miR-1_2-7 and miR-1_3-8 cells containing 6 nucleotide sequences are introduced into miR-1 cells as shown in FIG. 6B. Similarly, it was confirmed that the cell size was reduced.
  • miR-1_2-7_G2U, miR-1_2-7_G3U, miR-1_2-7_G7U, miR-1_3-8_G3U, miR-1_3-8_G7U In the case of introduced cells, hypertrophy was observed in comparison with cells introduced with the control group NT (H9c2).
  • the minimum target nucleotide sequence consisting of 6 nucleotide sequences in the normal target regulation function of miR-1 could be confirmed through a change in cell morphology. Through this, it was confirmed through observation of cell hypertrophy that it showed a new function, which is completely different from the existing normal target control function.
  • Example 7 miR -1 non-regular G: A Wobble Array inception target Preparation of recombinant vector for cardiac specific expression of regulatory nucleic acid and production of transgenic mouse model
  • Examples 5 and 6 when a nucleic acid that selectively inhibits only the 2, 3, and 7th G: A sequence development target gene regulation of miR-1 is introduced into the myocardial myocardial cell and cardiomyocyte cell line, myocardial hypertrophy occurs. It was observed that the regulation of the normal initiation target has a new function that is completely different from the induction function. Based on this, an experiment was conducted to observe the miR-1 G: A sequence development target gene regulation function at the animal individual level, and miR-1's G: A sequence development target gene regulation nucleic acid (miR-1_G7U, sequence) With respect to No. 9), a mouse was specifically expressed and transformed into a cardiomyocyte of the mouse to prepare a mouse.
  • cardiomoycytes Of the various cells that make up the heart tissue of the mouse, the cells responsible for the contraction of the heart muscle are called cardiomoycytes.
  • the specialized function of myocardial cells that contract muscles in response to beats is regulated by transcription factors that are specifically expressed in myocardial cells, and studies of cardiomyocyte specific promoters dedicated to their expression have been conducted in the heart of mice. It is well-studied according to the timing and location of development.
  • miR-1_G7U A sequence-targeting gene regulatory nucleic acid specifically in myocardial cells is the myocardial cell specificity of this substituted nucleic acid. It is the choice of promoters that regulate expression.
  • ⁇ MHC ⁇ MHC It consists of a total of 5.5 kb up to the third non-coding exon of.
  • the vector containing the ⁇ MHC promoter was purchased from Adgene at pJG / ⁇ MHC (addgene reference: 55594).
  • the vector gene after the third non-coding exon of ⁇ MHC was recombined with the target gene regulatory nucleic acid (miR-1_G7U) at the 7th G: A sequence of miR-1, which is shown in FIG. 7A.
  • Target gene regulatory nucleic acid (5'-TGG AAT TTA AAG AAG TAT GTA T-3 ') of the 7th G: A sequence of miR-1 with 284 nucleotide sequences as a template; SEQ ID NOs: 30, 5'-ATA CAT ACT TCT TTA AAT TCC A-3 '; SEQ ID NO: 17) was prepared to be included (Fig. 7b, 6).
  • the recombinant vector prepared in Example 7-1 is injected into the nuclear part of the fertilized egg of the mouse to mix with the mouse gene, and is developed as an individual through a surrogate mother.
  • a process of extracting nucleic acid (genomicDNA) from each mouse and performing positive genotyping is required.
  • an untranslational region (UTR) of human growth hormone (UTR) contained in the recombinant vector is used, which is natural except for mice in which the recombinant vector has been transgened. This is because the mouse genome does not contain the non-global human growth hormone region. Therefore, as shown in FIG.
  • a recombinant vector (pJG / ⁇ MHC-miR-1_G7T) was prepared, and then an expression cassette of about 6 kb containing a promoter, miR-1_G7T, a size of 284 base, and a human growth hormone non-global region was added to the recombinant vector. It was linearly cut through the included restriction enzyme BamHI. About 155 base sequences are obtained by polymerase chain reaction through primers that specifically bind to the human growth hormone non-global region contained in this linear cassette, and the band is electrophoresed on an agarose gel. This was shown in Figure 7c.
  • the mouse transformed with the recombinant vector (pJG / ⁇ MHC-miR-1_G7T) can be effectively screened through identification of a specific 155 nucleotide sequence of human growth hormone poly A. .
  • a linear cassette of about 6 kb was cut, microinjected into the pronuclei of the fertilized egg, and then transplanted into a surrogate mouse. Thereafter, the transformed mouse was selected by polymerase chain reaction through the screening primer, and as shown in FIG. 7D, 155 sequencing bands were found in 2 out of 12 genomes, and a total of 9 transformed mice In (founder), a 155 nucleotide sequence specific to human growth hormone poly A was identified. Based on this, a transgenic mouse expressing miR-1_G7T nucleic acid specifically for the heart was prepared.
  • the left ventricular wall was enlarged, and specifically, in the case of the right ventricle, it was visually confirmed that it was significantly enlarged unlike the normal heart structure. It was estimated that there were pathological symptoms such as pulmonary circulation disorder and pulmonary hypertension (middle, right in FIG. 8A).
  • a mouse transformed with a vector (Fig. 9A, left) expressing the modified miR-1_G7T that inhibited the G: A wobble sequence target by replacing the 7th guanine of miR-1 with uracil is shown. It was observed that the myocardial hypertrophy was induced in both mice from two different types of parent (founder) in the next generation F1 while maintaining the generation of the corresponding transgenic mouse (Fig. 9a right drawing), HW / TL (heart Differences were also confirmed in weight / tibia length) and HW / BW (heart weight / body weight) ratio measurements (FIGS. 9B-C).
  • transgenic mouse overexpressing the 7th G A sequence initiation target gene regulatory nucleic acid (miR-1_G7T) of miR-1 specifically in the postnatal cardiac tissue through the above Example is that cardiac hypertrophy is induced at the individual level. It was observed that it could ultimately be used as a cardiac hypertrophy animal model.
  • the biological function of increasing the size of the myocardial cells appears by recognizing and inhibiting only the non-regular G: A wobble base sequence target site of the microRNA. Since cardiac hypertrophy is induced, it is expected that an animal model in which cardiomegaly is induced can be prepared and usefully used in the study of pathology and pathophysiology and physiological mechanisms of cardiac diseases including cardiomegaly at the individual level.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • Immunology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Hematology (AREA)
  • Urology & Nephrology (AREA)
  • Microbiology (AREA)
  • Wood Science & Technology (AREA)
  • Environmental Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Cell Biology (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Food Science & Technology (AREA)
  • Biodiversity & Conservation Biology (AREA)
  • Biophysics (AREA)
  • Animal Husbandry (AREA)
  • Plant Pathology (AREA)
  • Analytical Chemistry (AREA)
  • Pathology (AREA)
  • General Physics & Mathematics (AREA)
  • Medicinal Chemistry (AREA)
  • Toxicology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

본 발명은 심비대증 동물 모델 제작용 재조합 벡터, 상기 재조합 벡터로 형질전환된 심비대증 동물 모델 및 이의 제작 방법에 관한 것으로, 본 발명에 따른 재조합 벡터를 마우스의 심근 세포에 특이적으로 발현시킬 경우, 마이크로RNA의 비정규 G:A 워블 염기 배열 표적 사이트만을 인식하여 억제함으로써 심근 세포의 크기가 증가하는 생물학적 기능이 나타나고, 이로 인해 심비대증이 유도되는바, 심비대증이 유도된 동물 모델을 제조하여 개체 수준에 있어서 심비대증을 포함한 심장 질환의 진행 경과 및 병리, 생리학적 기전 연구에 유용하게 이용할 수 있을 것으로 기대된다.

Description

심비대증 동물 모델 제작용 재조합 벡터, 상기 재조합 벡터로 형질전환된 심비대증 동물 모델 및 이의 제작 방법
본 발명은 심비대증 동물 모델 제작용 재조합 벡터, 상기 재조합 벡터로 형질전환된 심비대증 동물 모델 및 이의 제작 방법 등에 관한 것이다.
본 출원은 2018년 10월 26일에 출원된 한국특허출원 제10-2018-0129360호에 기초한 우선권을 주장하며, 해당 출원의 명세서 및 도면에 개시된 모든 내용은 본 출원에 원용된다.
마이크로RNA(miRNA)는 ~21개의 염기로 구성된 작은 RNA로서, 표적 유전자의 전사 후 단계에서 유전자의 발현을 억제하는 RNA 간섭(RNA interference)을 유도하는 기능을 한다. 마이크로RNA는 주로 5' 말단에 위치하는 발단 지역(seed region, positions 1-8)의 염기 배열을 통해 수백개의 타겟 mRNA를 인식하고 그 발현을 억제하며, 이로 인하여 여러 가지 생물학적 현상이 조절된다.
특히, 마이크로RNA가 표적 mRNA와 결합할 때, 주로 5' 말단 기준 2번째부터 8번째 뉴크레오티드 사이의 발단 지역(seed region)을 통해 최소 6개의 연속된 염기배열, 즉 2번째부터 7번째의 염기배열이나 3번째부터 8번째 뉴크레오티드 사이의 염기 배열을 사용하는 것으로 알려져 있고, 이를 정규적인 표적 인식(canonical target recognition)이라고 하며, 최근에 들어서는 마이크로RNA와 결합하는 mRNA 위치를 시퀀싱하는 기술인 Ago HITS-CLIP이 개발됨에 따라, 정규적인 표적 인식 외에 이러한 규칙에서 벗어나는 비정규 표적 인식이 많이 존재한다고 알려지게 되었다.
한편, 심장 질환은 암을 포함하여 우리나라 성인의 3대 사망질환 중 하나로, 그 발병 과정의 여러 병리적 스트레스가 심장 조직의 크기에 변화를 일으켜 심비대증(cardiac hypertrophy)을 유발하는 것으로 시작하며, 심비대증은 심근세포의 크기, 단백질의 합성속도 증가 등의 특징을 나타낸다. 심비대증은 점차적으로 심근섬유화 및 심부전증을 유도하여, 최종적으로는 심장기능상실(또는 심부전: heart failure)로 나타난다. 특히, 심부전의 경우는 특히 사망률이 50% 전후로 매우 높기 때문에 궁극적으로는 심근비대증을 예방하거나 치료법을 개발하려는 연구들이 진행되고 있으며, 따라서 이에 대한 질환 모델을 구축하는 것이 필요하다.
이러한 심비대증을 동물 및 세포 모델에서 유도하기 위해 잘 알려진 방법으로는 페닐에프린(PE)이나 아이소프로테레놀(ISO)과 같은 아드레날린계 수용체 활성약물(Adrenergic receptor agonist)을 처리하는 방법이 있다. 그러나, 이러한 처리는 최소 1달간 매번 같은 간격으로 마우스의 체내에 반복적으로 주입하는 실험을 진행하거나, 일정하게 약물을 전달해 주는 펌프를 외과적 수술을 통해 개체에 삽입시켜야 하는 어려움이 있다. 또한, 약물에 의한 심비대증 유도 현상에는 개체간의 차이가 존재하며, 심장이 커진 정도도 상황에 따라 미비할 수 있는 문제점을 지니고 있으므로, 이를 대체할 수 있는 심비대증 질환 모델의 구축이 필요한 실정이다.
심비대증 질환도 여러 다른 질환과 마찬가지로 마이크로RNA에 의해서 조절되는 것으로 알려져 있는데, 특히 miR-1은 심근세포의 발달에서 매우 중요한 역할을 할 뿐만 아니라 심장이 작아지는 수축(cardiac atrophy) 현상을 유도하는 것으로 보고 되었다. 또한, miR-1과 같이 발현되는 miR-133도 심근 비대 현상을 억제하는 기능을 지닌다고 알려져 있다.
따라서, 심비대증 발병 현상을 이해하고 이에 대한 치료제를 개발하기 위해서, 마이크로RNA에 의한 심비대증 모델을 동물 개체 수준에서 확립하고 이를 활용하고자 하였다.
본 발명자들은 심장을 포함한 근육세포에 특이적으로 발현하는 것으로 알려진 마이크로RNA인 miR-1의 비정규 표적 인식 형태인 G:A 워블 배열 발단 사이트(G:A wobble seed site)를 정규적인 발단 사이트(seed site)로 인식할 수 있도록 변형한 염기서열을 포함하는 재조합 벡터를 마우스 심근 세포에 특이적으로 발현시킨 결과, 심근세포가 커지는 현상을 관찰하였으며, 이를 이용하여 심비대증 질환 동물 모델을 구축하고자 하였다.
따라서, 본 발명이 해결하고자 하는 과제는 서열번호 1(5'- UGGAAUGUAAAGAAGUAUGUAU -3')의 염기서열로 표시되고 RNA간섭을 유도하는 miR-1 유전자의 5' 말단 기준 2번 내지 3번 중 어느 하나의 뉴클레오타이드에서 시작하여 총 6개의 연속된 폴리뉴클레오타이드를 포함하고, 상기 서열번호 1의 염기서열 중 2번, 3번 또는 7번 중 하나 이상의 뉴클레오타이드가 구아닌(Guanine; G)에서 유라실(Uracil; U)로 치환된 폴리뉴클레오타이드를 포함하는 RNA 간섭 유도 핵산을 발현하는 것을 특징으로 하는, 심비대증 동물 모델 제작용 재조합 벡터, 상기 재조합 벡터로 형질전환된 심비대증 동물 모델 및 이의 제작 방법 등을 제공하는 것이다.
이때, RNA 간섭을 유도하기 위해 아고너트(Argonaute) 단백질과 결합하는 RNA 간섭 유도 핵산의 5' 말단 기준 2번째부터 7번째까지의 서열은 UGAAUG, GUAAUG, GGAAUU, GAAUGU, UAAUGU 또는 GAAUUU 일 수 있으며, 상기 서열은 서열번호 1의 염기서열로 표시되는 miR-1이 심근경색 환자의 심장조직에서 G:A 워블 배열로 인식하는 표적에만 결합하여 이를 억제하도록 하는 효과를 나타냄으로써, 이를 동물 개체에 발현하여 인간에게서 발생하는 심장질환을 발생시킨 심장질환 동물 모델로 사용할 수 있다.
그러나, 본 발명이 이루고자 하는 기술적 과제는 이상에서 언급한 과제에 제한되지 않으며, 언급되지 않은 또 다른 과제들은 아래의 기재로부터 본 발명이 속하는 기술 분야의 통상의 지식을 가진 자에게 명확하게 이해될 수 있을 것이다.
상기와 같은 목적을 달성하기 위하여, 본 발명은 서열번호 1의 염기서열로 표시되는 유전자의 5' 말단 기준 2번 내지 3번 중 어느 하나의 뉴클레오타이드에서 시작하여 총 6개의 연속된 폴리뉴클레오타이드를 포함하고, 상기 서열번호 1의 염기서열 중 2번, 3번 또는 7번 중 하나 이상의 뉴클레오타이드가 구아닌(Guanine; G)에서 유라실(Uracil; U)로 치환된 폴리뉴클레오타이드를 포함하는 RNA 간섭 유도 핵산을 발현하는 것을 특징으로 하는, 심비대증 동물 모델 제작용 재조합 벡터를 제공한다.
본 발명의 일구현예로서, 상기 폴리뉴클레오타이드는 다음 그룹의 폴리뉴클레오타이드에서 선택될 수 있다:
서열번호 2의 염기서열로 표시되는 폴리뉴클레오타이드(5'-UGAAUG-3'); 서열번호 3의 염기서열로 표시되는 폴리뉴클레오타이드(5'-GUAAUG-3'); 서열번호 4의 염기서열로 표시되는 폴리뉴클레오타이드(5'-GGAAUU-3'); 서열번호 5의 염기서열로 표시되는 폴리뉴클레오타이드(5'-UAAUGU-3'); 또는 서열번호 6의 염기서열로 표시되는 폴리뉴클레오타이드(5'-GAAUUU-3').
본 발명의 다른 구현예로서, 상기 재조합 벡터는 상기 폴리뉴클레오타이드 5' 말단의 1번째 뉴클레오타이드 앞에 아데닌(Adenine; A)으로 치환된 염기서열을 포함할 수 있으며, 이에 국한하지 않고 아고너트 단백질에 결합할 수 있다면 5' 말단의 1번째 뉴크레오타이드는 A, U, C, G 모든 염기 서열이 가능하다.
본 발명의 또 다른 구현예로서, 상기 재조합 벡터는 다음 그룹의 RNA 간섭 유도 핵산 중 어느 하나를 발현할 수 있다:
서열번호 7의 염기서열로 표시되는 RNA 간섭 유도 핵산 (5'-UUG AAU GUA AAG AAG UAU GUA U-3');
서열번호 8의 염기서열로 표시되는 RNA 간섭 유도 핵산 (5'- UGU AAU GUA AAG AAG UAU GUA U-3');
서열번호 9의 염기서열로 표시되는 RNA 간섭 유도 핵산 (5'- UGG AAU UUA AAG AAG UAU GUA U-3');
서열번호 10의 염기서열로 표시되는 RNA 간섭 유도 핵산 (5'-AUG AAU GAC UGC CGG UUG UUA UG-3');
서열번호 11의 염기서열로 표시되는 RNA 간섭 유도 핵산 (5'-AGU AAU GAC UGC CGG UUG UUA UG-3');
서열번호 12의 염기서열로 표시되는 RNA 간섭 유도 핵산 (5'-AGG AAU UAC UGC CGG UUG UUA UG-3');
서열번호 13의 염기서열로 표시되는 RNA 간섭 유도 핵산 (5'-AUA AUG UAC UGC CGG UUG UUA UG-3'); 또는
서열번호 14의 염기서열로 표시되는 RNA 간섭 유도 핵산 (5'-AGA AUU UAC UGC CGG UUG UUA UG-3').
본 발명의 또 다른 구현예로서, 상기 서열번호 1의 염기서열로 표시되는 유전자는 miR-1일 수 있다.
본 발명의 또 다른 구현예로서, 상기 폴리뉴클레오타이드는 G:A 워블(wobble) 배열이 일어나는 표적 사이트를 인식하는 폴리뉴클레오타이드일 수 있다.
본 발명의 또 다른 구현예로서, 상기 재조합 벡터는 알파MHC(αMHC) 프로모터, 베타 MHC(β MHC) 프로모터, Nkx2.5 프로모터, 심근 트로포닌 T(cardiac troponin T; TNNT2) 프로모터, 근육 크레아틴 키나아제(muscle creatine kinase; MCK) 프로모터, 인간 알파-골격 액틴(human α-skeletal actin; HAS) 프로모터, 및 뮤린 줄기세포 바이러스(murine stem cell virus; MSCV) 프로모터로 이루어진 군으로부터 선택된 프로모터가 작동 가능하게 연결된 것일 수 있다.
본 발명의 또 다른 구현예로서, 상기 심비대증은 심장비대증, 심부전증, 심섬유증(cardiac fibrosis), 승모판막 폐쇄부전증, 대동맥판막 폐쇄부전증, 확장성 심근병증, 허혈성 심장 질환, 심실 중격 결손증, 삼첨판막 폐쇄부전증, 폐동맥판막 폐쇄부전증, 폐동맥 고혈압, 우심실 심근경색, 우심실을 침범하는 심근병증, 심방중격 결손증, 심방 세동, 비후성 심근증 또는 침윤성 심근증의 초기증상일 수 있다.
본 발명의 또 다른 구현예로서, 상기 동물은 인간을 제외한 포유류일 수 있다.
본 발명의 또 다른 구현예로서, 상기 동물은 마우스일 수 있다.
또한, 본 발명은 상기 재조합 벡터로 형질전환된 것을 특징으로 하는, 심비대증 동물 모델을 제공한다.
또한, 본 발명은 (a) 서열번호 1의 염기서열로 표시되는 유전자의 5' 말단 기준 2번 내지 3번 중 어느 하나의 뉴클레오타이드에서 시작하여 총 6개의 연속된 뉴클레오타이드를 포함하고, 상기 서열번호 1의 염기서열 중 2번, 3번 또는 7번 중 하나 이상의 뉴클레오타이드가 구아닌(Guanine; G)에서 유라실(Uracil; U)로 치환된 폴리뉴클레오타이드를 발현하는 DNA를 프로모터에 작동 가능하게 연결하여 심비대증 동물 모델 제작용 재조합 벡터를 제조하는 단계;
(b) 상기 재조합 벡터를 동물의 수정란에 도입시키는 단계; 및
(c) 상기 수정란을 대리모에 이식한 후 수정란을 발생시켜 형질전환 동물 모델을 수득하는 단계를 포함하는, 심비대증 동물 모델의 제작 방법을 제공한다.
또한, 본 발명은 (a) 심비대증 동물 모델의 심근 세포에 후보물질을 처리하는 단계;
(b) 상기 심비대증 동물 모델의 심근 세포에서 서열번호 1의 염기서열로 표시되는 유전자의 5' 말단 기준 2번 내지 3번 중 어느 하나의 뉴클레오타이드에서 시작하여 총 6개의 연속된 폴리뉴클레오타이드를 포함하고, 상기 서열번호 1의 염기서열 중 2번, 3번, 또는 7번 중 하나 이상의 뉴클레오타이드가 구아닌(Guanine; G)에서 유라실(Uracil; U)로 치환된 폴리뉴클레오타이드의 G:A 워블(wobble) 배열 표적 사이트와의 결합 빈도를 분석하는 단계; 및
(c) 상기 G:A 워블(wobble) 배열 표적 사이트와의 결합이 후보물질을 처리하지 않은 심비대증 동물 모델에 비해 감소할 경우, 상기 후보물질을 심비대증 치료제로 선별하는 단계를 포함하는, 심비대증 치료제의 스크리닝 방법을 제공한다.
본 발명에 따른 재조합 벡터를 마우스의 심근 세포에 특이적으로 발현시킬 경우, 마이크로RNA의 비정규 G:A 워블 염기 배열 표적 사이트만을 인식하여 억제함으로써 심근 세포의 크기가 증가하는 생물학적 기능이 나타나고, 이로 인해 심비대증이 유도되는바, 심비대증이 유도된 동물 모델을 제조하여 개체 수준에 있어서 심비대증을 포함한 심장 질환의 진행 경과 및 병리, 생리학적 기전 연구에 유용하게 이용할 수 있을 것으로 기대된다.
도 1a 내지 1d는 인간 뇌조직에서 아고너트 단백질과 결합하는 마이크로RNA와 그 표적 mRNA 위치에 대한 시퀀스 데이터인 Ago HITS-CLIP 결과를 생물정보학적으로 분석한 결과로, 정규 발단(seed) 타겟 뿐만 아니라, 비정규 G:A 워블 배열(G:A wobble) 발단 타겟이 자연적으로 존재하는 것을 확인한 결과를 나타낸 도면이다.
도 2a 및 2b는 인간 심근경색(Cardiomyopathy) 환자의 심장 조직에서 아고너트 단백질과 결합하는 마이크로RNA와 그 표적 mRNA 위치에 대한 시퀀스 mRNA 데이터인 Ago HITS-CLIP을 통해 심장 조직 특이적으로 발현하는 miR-1의 표적 결합에 대해 생물정보학적으로 분석한 결과로, 정규 발단(seed) 결합 뿐만 아니라, 비정규 G:A 워블 배열(G:A wobble) 발단 결합이 심근경색 환자에서 존재하는 것을 확인한 결과를 나타낸 도면이다.
도 3a 내지 3d는 miR-1이 비정규 G:A 워블 배열 발단 타겟 유전자의 발현 억제 기능을 한다는 점을 형광 단백질 리포터에서 유세포 분석(Fluorescence-activated cell sorting: FACS)을 통해 심장근육모세포주(H9c2)에서 확인한 결과를 나타낸 도면이다.
도 4a 내지 4d는 miR-1의 비정규 G:A 워블 배열 발단 타겟 유전자만 인식하도록 miR-1의 해당 위치인 5' 말단으로부터 2, 3, 또는 7번째 구아닌 염기를 유라실로 치환하여 발현시킴으로써, 비정규 G:A 워블 배열 발단 타겟 유전자만 억제한다는 사실을 루시퍼라제 리포터 실험을 통해 확인한 결과를 나타낸 도면이다.
도 5a 내지 5c는 miR-1의 5' 말단으로부터 2, 3, 또는 7번째 구아닌 염기를 유라실로 치환하여 발현시킴으로써, miR-1의 5' 말단으로부터 2, 3, 또는 7번째 구아닌 염기에 대한 비정규 G:A 워블 배열 발단 타겟 유전자의 기능을 심근비대 유도 효과에 대한 세포형태상 및 분자생물학적 특징 관찰을 통해 확인한 결과를 나타낸 도면이다.
도 6a 내지 6c는 miR-1의 5' 말단으로부터 2, 3, 또는 7번째 구아닌 염기에 대한 비정규 G:A 워블 배열 발단 타겟 유전자의 조절 기능을 보이는 최소 염기 서열을 miR-1의 5' 말단으로부터 2번째부터 7번째까지 서열, 또는 3번째부터 8번째 서열로 정의하고, 상기 염기 서열만을 포함하는 RNA간섭 유도 물질들을 심장근육모세포주(H9c2)에 도입하여 나타나는 심근비대 유도 효과를 세포형태상 관찰을 통해 확인한 결과를 나타낸 도면이다.
도 7a 내지 7d는 miR-1의 5' 말단으로부터 7번째 구아닌 염기에 대한 비정규 G:A 워블 배열 발단 타겟만을 조절하도록 miR-1의 5' 말단으로부터 7번째 구아닌을 유라실로 치환한 마이크로RNA 서열을 심근 세포 특이적으로 발현하는 형질 전환 마우스의 제조 과정을 나타낸 도면이다.
도 8a 내지 8d는 심근 세포 특이적으로 miR-1의 5' 말단으로부터 7번째 구아닌을 유라실로 치환한 마이크로RNA 서열을 발현시킨 형질전환 마우스의 개체에서 심근 비대 현상을 관찰하고, 개체의 생존을 모니터한 결과를 나타낸 도면이다.
도 9a 내지 9c는 심근 세포 특이적으로 miR-1의 5' 말단으로부터 7번째 구아닌을 유라실로 치환한 마이크로RNA 서열을 발현시킨 형질전환 마우스의 개체를 유지하면서 생성된 형질전환 마우스 라인들의 심근 비대 현상을 관찰한 결과를 나타낸 도면이다.
본 발명은 Ago HITS-CLIP 분석을 통해 본 발명자들이 찾아낸 마이크로RNA의 비정규 표적 인식 형태인 G:A 워블 배열 발단 타겟(G:A wobble seed site)을 정규적인 발단 사이트(seed site)로 인식할 수 있도록 서열을 변형하는 기술에 기반하며, 이를 통해 마이크로RNA의 비정규 표적 유전자만을 효율적으로 억제하는 기술을 개발하였고, 상기 기술의 효과가 마이크로RNA의 일부 기능인 비정규 표적 억제만을 선택적으로 나타내게 하는 것임을 확인하였다. 특히, 심장을 포함한 근육세포에 주로 많이 발현하는 것으로 알려진 마이크로RNA인 miR-1에 본 기술을 적용하였을 때 심근세포가 커지는 현상을 관찰하였다.
이하, 본 발명을 상세히 설명한다.
본 발명은 서열번호 1의 염기서열로 표시되는 유전자의 5' 말단 기준 2번 내지 3번 중 어느 하나의 뉴클레오타이드에서 시작하여 총 6개의 연속된 폴리뉴클레오타이드를 포함하고, 상기 서열번호 1의 염기서열 중 2번, 3번 또는 7번 중 하나 이상의 뉴클레오타이드가 구아닌(Guanine; G)에서 유라실(Uracil; U)로 치환된 폴리뉴클레오타이드를 포함하는 RNA 간섭 유도 핵산을 발현하는 것을 특징으로 하는, 심비대증 동물 모델 제작용 재조합 벡터를 제공한다.
본 발명에 있어서, 상기 폴리뉴클레오타이드는 서열번호 2의 염기서열로 표시되는 폴리뉴클레오타이드(5'-UGAAUG-3'); 서열번호 3의 염기서열로 표시되는 폴리뉴클레오타이드(5'-GUAAUG-3'); 서열번호 4의 염기서열로 표시되는 폴리뉴클레오타이드(5'-GGAAUU-3'); 서열번호 5의 염기서열로 표시되는 폴리뉴클레오타이드(5'-UAAUGU-3'); 또는 서열번호 6의 염기서열로 표시되는 폴리뉴클레오타이드(5'-GAAUUU-3') 중에서 선택되는 것일 수 있으나, 이에 제한되지 않는다.
본 발명에 있어서, 상기 재조합 벡터는 상기 폴리뉴클레오타이드 5' 말단의 1번째 뉴클레오타이드 앞에 아데닌(Adenine; A)으로 치환된 염기서열을 포함하여 효율적으로 아고너트 로딩을 할 수 있으나, 이에 국한하지 않고 아고너트 단백질에 결합할 수 있다면 5' 말단의 1번째 뉴크레오타이드는 A, U, C, G 모든 염기 서열이 가능하다.
본 발명에 있어서, 상기 RNA 간섭 유도 핵산은 마이크로RNA, 작은 간섭 RNA(small interfering RNA; siRNA), 짧은 헤어핀 RNA(short hairpin RNA; shRNA), DsiRNA, lsiRNA, ss-siRNA, piRNA, endo-siRNA, 및 asiRNA로 이루어진 군으로부터 선택될 수 있으나, RNA 간섭을 유도하는 핵산이라면 상기 종류에 제한되지 않는다.
본 발명에 있어서, 상기 재조합 벡터는 서열번호 7의 염기서열로 표시되는 RNA 간섭 유도 핵산 (5'-UUG AAU GUA AAG AAG UAU GUA U-3');
서열번호 8의 염기서열로 표시되는 RNA 간섭 유도 핵산 (5'- UGU AAU GUA AAG AAG UAU GUA U-3');
서열번호 9의 염기서열로 표시되는 RNA 간섭 유도 핵산 (5'- UGG AAU UUA AAG AAG UAU GUA U-3');
서열번호 10의 염기서열로 표시되는 RNA 간섭 유도 핵산 (5'-AUG AAU GAC UGC CGG UUG UUA UG-3');
서열번호 11의 염기서열로 표시되는 RNA 간섭 유도 핵산 (5'-AGU AAU GAC UGC CGG UUG UUA UG-3');
서열번호 12의 염기서열로 표시되는 RNA 간섭 유도 핵산 (5'-AGG AAU UAC UGC CGG UUG UUA UG-3');
서열번호 13의 염기서열로 표시되는 RNA 간섭 유도 핵산 (5'-AUA AUG UAC UGC CGG UUG UUA UG-3'); 또는
서열번호 14의 염기서열로 표시되는 RNA 간섭 유도 핵산 (5'-AGA AUU UAC UGC CGG UUG UUA UG-3') 중 어느 하나를 발현할 수 있으나, 이에 제한되지 않는다.
본 발명에 있어서, 상기 서열번호 1의 염기서열로 표시되는 유전자는 miR-1일 수 있다.
본 발명에 있어서, 상기 폴리뉴클레오타이드는 G:A 워블 배열이 일어나는 표적 사이트를 인식하는 폴리뉴클레오타이드일 수 있다.
본 발명에서 용어 "뉴클레오타이드"는 질소 함유 헤테로사이클릭 염기, 당 및 하나 이상의 포스페이트기를 포함한다. 이들은 핵산 서열의 단량체 유닛이다. RNA에서, 당은 리보스이고, DNA에서는 데옥시리보스, 즉, 리보스에 존재하는 하이드록실기를 결여하는 당이다. 질소 함유 헤테로사이클릭 염기는 퓨린 또는 피리미딘 염기일 수 있다. 퓨린 염기는 아데닌(A) 및 구아닌(G), 및 그들의 변형된 유도체 또는 유사체를 포함한다. 피리미딘 염기는 사이토신(C), 티민(T) 및 유라실(U), 및 그들의 변형된 유도체 또는 유사체를 포함한다. 본 발명에 있어서, 상기 뉴클레오타이드의 당은 리보스이고, 염기로는 아데닌(A), 구아닌(G), 사이토신(C), 또는 유라실(U)을 포함한다.
본 발명의 RNA 간섭 유도 핵산을 발현하는 재조합 벡터에 있어서, 상기 재조합 벡터에는 DNA가 포함될 수 있으며, 상기 DNA는 본 발명의 RNA 간섭 유도 핵산의 폴리뉴클레오티드에 상보적인 폴리뉴클레오티드를 포함한다. 예컨대, RNA 간섭 유도 핵산의 염기가 아데닌(A)일 경우 티민(T) 염기, RNA 간섭 유도 핵산의 염기가 구아닌(G)일 경우 사이토신(C) 염기, RNA 간섭 유도 핵산의 염기가 사이토신(C)일 경우 구아닌(G) 염기, RNA 간섭 유도 핵산의 염기가 유라실(U)일 경우 아데닌(A) 염기를 포함할 수 있다.
본 발명에 있어서, 예컨대, 상기 재조합 벡터는 서열번호 7의 염기서열로 표시되는 RNA 간섭 유도 핵산 (5'-UUG AAU GUA AAG AAG UAU GUA U-3');
서열번호 8의 염기서열로 표시되는 RNA 간섭 유도 핵산 (5'- UGU AAU GUA AAG AAG UAU GUA U-3');
서열번호 9의 염기서열로 표시되는 RNA 간섭 유도 핵산 (5'- UGG AAU UUA AAG AAG UAU GUA U-3');
서열번호 10의 염기서열로 표시되는 RNA 간섭 유도 핵산 (5'-AUG AAU GAC UGC CGG UUG UUA UG-3');
서열번호 11의 염기서열로 표시되는 RNA 간섭 유도 핵산 (5'-AGU AAU GAC UGC CGG UUG UUA UG-3');
서열번호 12의 염기서열로 표시되는 RNA 간섭 유도 핵산 (5'-AGG AAU UAC UGC CGG UUG UUA UG-3');
서열번호 13의 염기서열로 표시되는 RNA 간섭 유도 핵산 (5'-AUA AUG UAC UGC CGG UUG UUA UG-3'); 또는
서열번호 14의 염기서열로 표시되는 RNA 간섭 유도 핵산 (5'-AGA AUU UAC UGC CGG UUG UUA UG-3') 중 어느 하나를 발현할 수 있다.
상기 DNA는 서열번호 15: 5'-A TAC ATA CTT CTT TAC ATT CAA-3';
서열번호 16: 5'-A TAC ATA CTT CTT TAC ATT ACA-3';
서열번호 17: 5'-A TAC ATA CTT CTT TAA ATT CCA-3';
서열번호 18: 5'-CA TAA CAA CCG GCA GTC ATT CAT-3';
서열번호 19: 5'-CA TAA CAA CCG GCA GTC ATT ACT-3';
서열번호 20: 5'-AT TAA CAA CCG GCA GTA ATT CCT-3';
서열번호 21: 5'-CA TAA CAA CCG GCA GTA CAT TAT-3'; 또는
서열번호 22: 5'-CA TAA CAA CCG GCA GTA AAT TCT-3' 중 어느 하나일 수 있다.
본 발명에서 용어 "표적 사이트"는 마이크로 RNA의 5' 말단을 기준으로, 2번째부터 8번째의 염기 서열과 결합하는 표적 염기 서열을 의미한다.
본 발명에서 "발단 지역(seed region)"은 마이크로RNA의 5' 말단 기준 2번째부터 8번째 사이의 염기 서열을 의미한다.
본 발명에서 용어 "워블(wobble) 배열"은 마이크로RNA가 표적 mRNA와 결합할 때 마이크로RNA의 발단 지역(seed region)과 정확히 상보관계가 아니더라도 마이크로RNA의 표적으로 인식하는 경우 중에서, 구아닌 염기가 아데닌 염기와 결합하는 G:A 배열 또는 구아닌 염기가 유라실 염기와 결합하는 G:U 배열을 통한 염기 배열을 의미하며, 본 발명에 있어서 상기 G:A 또는 G:U 워블 염기 배열은 마이크로RNA와 마이크로RNA가 인식하는 표적 유전자의 염기가 A:U, G:C, C:G, U:A의 상보 관계의 배열 외에도 G:A 또는 G:U의 염기 배열을 가지는 것을 말한다.
예컨대, 마이크로RNA와 마이크로RNA가 인식하는 표적 유전자가 G:A의 워블 관계에 있을 때, 특정 마이크로RNA의 발단 지역 염기 : 상기 특정 마이크로RNA가 인식하는 표적 유전자의 염기의 배열은 G:A이며, 마이크로RNA와 마이크로RNA가 인식하는 표적 유전자가 G:U의 워블 관계에 있을 때, 특정 마이크로RNA의 염기 : 상기 특정 마이크로RNA가 인식하는 표적 유전자의 염기의 배열은 G:U이다.
본 발명에서 용어 "재조합"은 세포가 이종의 핵산을 복제하거나, 상기 핵산을 발현하거나 또는 펩티드, 이종의 펩티드 또는 이종의 핵산에 의해 암호화된 단백질을 발현하는 세포를 지칭하는 것이다. 재조합 세포는 상기 세포의 천연 형태에서는 발견되지 않는 유전자 또는 유전자 절편을, 센스 또는 안티센스 형태 중 하나로 발현할 수 있다. 또한 재조합 세포는 천연 상태의 세포에서 발견되는 유전자를 발현할 수 있으며, 그러나 상기 유전자는 변형된 것으로서 인위적인 수단에 의해 세포 내 재도입된 것이다.
본 발명에서 용어 "벡터"는 적합한 숙주 내에서 DNA의 발현을 수행할 수 있는 적합한 조절 서열에 작동 가능하게 연결된 DNA 서열을 함유하는 DNA 구조물을 의미한다. 적합한 조절 서열은 전사를 수행하기 위한 프로모터, 전사를 조절하기 위한 임의의 오퍼레이터 서열, 적합한 mRNA 리보좀 결합 부위를 코딩하는 서열, 및 전사 및 해독의 종결을 조절하는 서열을 포함한다. 본 발명의 벡터는 세포 내에서 복제 가능한 것이면 특별히 한정되지 않고 당업계에 알려진 임의의 벡터를 이용할 수 있으며, 예컨대 플라스미드, 코즈미드, 파지 입자, 바이러스 벡터일 수 있다.
본 발명에서 용어 "재조합 벡터"는 발현시키고자 하는 목적 폴리펩타이드의 암호화 유전자가 작동 가능하게 연결될 경우, 적절한 숙주 세포에서 상기 목적 폴리펩타이드를 높은 효율로 발현시킬 수 있는 목적 폴리펩타이드의 발현 벡터로 사용될 수 있으며, 상기 재조합 벡터는 숙주 세포에서 발현 가능할 수 있다. 숙주 세포는 바람직하게는 진핵세포일 수 있으며, 숙주세포의 종류에 따라 프로모터(promotor), 종결자(terminator), 인핸서(enhancer) 등과 같은 발현 조절 서열, 막 표적화 또는 분비를 위한 서열 등을 적절히 선택하고 목적에 따라 다양하게 조합할 수 있다.
본 발명에서 사용되는 "작동 가능하게 연결된”이라는 용어는 발현이 필요한 유전자와 이의 조절 서열이 서로 기능적으로 결합되어 유전자 발현을 가능케 하는 방식으로 연결되는 것을 말한다.
본 발명에서 용어 "프로모터(promotor)"는 전사조절인자들이 결합하는 DNA 염기서열 부위로 유전자 발현을 조절하는 핵산 서열을 의미하며, 목적 유전자의 과발현을 유도하기 위한 것이다. 상기 프로모터의 예로는 프리브노 박스(Pribnow box), 타타박스(TATA box) 등이 있다. 예컨대, 본 발명의 재조합 벡터는 알파MHC (αMHC) 프로모터, 베타 MHC(β MHC) 프로모터, Nkx2.5 프로모터, 심근 트로포닌 T(cardiac troponin T; TNNT2) 프로모터, 근육 크레아틴 키나아제(muscle creatine kinase; MCK) 프로모터, 인간 알파-골격 액틴(human α-skeletal actin; HAS) 프로모터, 및 뮤린 줄기세포 바이러스(murine stem cell virus; MSCV) 프로모터로 이루어진 군으로부터 선택된 프로모터가 작동 가능하게 연결되어 심근 세포 특이적 발현을 조절할 수 있으며, 본 발명의 일 실시예에 따르면 알파MHC(αMHC) 프로모터가 작동 가능하게 연결된 것일 수 있으나, 상기 프로모터의 종류에 제한되지 않는다.
본 발명에서 상기 "심근 세포 특이적"이란 용어는 심근 세포 이외의 세포에서는 발현되지 않거나 낮은 정도로 발현되는 반면, 심근 세포에서는 매우 높은 정도로 발현되는 특징을 의미한다.
본 발명에서 용어 "발현"은 폴리펩타이드(polypeptide)가 구조 유전자로부터 생산되는 과정을 지칭하며, 상기 과정은 유전자의 mRNA로의 전사, 및 이러한 mRNA의 폴리펩타이드(들)로의 해독을 포함한다. 또한 "과발현"은 유전자의 mRNA로의 전사, 및 이러한 mRNA의 폴리펩타이드(들)로의 해독이 정상 상태보다 많이 생산된 상태를 의미한다.
본 발명에서 용어 "형질전환"은 벡터 형태의 DNA를 세포에 물리화학적으로 직접 도입하거나 바이러스를 숙주세포에 감염시켜 외래 유전자를 발현시킴으로써 생물의 유전적인 성질이 변하는 것으로, 즉, 유전자를 숙주세포 내에 도입하여 숙주 세포 내에서 발현시킬 수 있도록 하는 것을 의미한다.
본 발명에 있어서, 벡터 형태의 DNA를 세포에 도입하는 방법으로는 특별히 제한이 없으며, 예컨대 뉴클레오펙션(nucleofection), 일시적인 형질감염(transient transfection), 세포 융합, 리포좀 매개된 형질감염(liposom-mediated transfection), 폴리브렌-매개된 형질감염(polybrene-mediated transfection), 인산칼슘을 이용한 형질감염(Graham, FL 등, Virology, 52:456(1973)), DEAE 덱스트란에 의한 형질감염, 미세주사에 의한 형질감염(Capecchi, MR, Cell, 22:479(1980)), 양이온성 지질에 의한 형질감염(Wong, TK 등, Gene, 10:87(1980)), 전기천공법(Neumann E등, EMBO J, 1:841(1982)), 형질도입 또는 트랜스펙션과 같이 문헌(Basic methods in molecular biology, Davis 등, 1986 및 Molecular cloning: A laboratory manual, Davis 등, 1986)에 기재된 바와 같이 본 발명이 속한 기술 분야에서 통상의 지식을 가진 자에게 익히 공지되어 있는 방법들에 따라 이뤄질 수 있다.
본 발명에서 "심비대증(cardiac hypertrophy)"은 심근섬유가 비대한 결과, 심중량의 증가, 심실벽이 비후된 상태를 말하며, 심장비대증, 심부전증, 심섬유증(cardiac fibrosis), 승모판막 폐쇄부전증, 대동맥판막 폐쇄부전증, 확장성 심근병증, 허혈성 심장 질환, 심실 중격 결손증, 삼첨판막 폐쇄부전증, 폐동맥판막 폐쇄부전증, 폐동맥 고혈압, 우심실 심근경색, 우심실을 침범하는 심근병증, 심방중격 결손증, 심방 세동, 비후성 심근증 또는 침윤성 심근증의 초기증상일 수 있으나, 상기 질환들 외에 심비대증과 관련된 질환이라면 그 종류에 제한되지 않는다.
본 발명은 또한 상기 재조합 벡터로 형질전환된 것을 특징으로 하는 심비대증 동물 모델을 제공한다.
본 발명의 심비대증 동물 모델 제작용 재조합 벡터에 있어서, 상기 동물은 인간을 제외한 포유류일 수 있으며, 예컨대 비-인간인 영장류, 마우스, 개, 고양이, 토끼, 말, 또는 소일 수 있다.
본 발명의 일실시예에 따르면 상기 동물은 마우스일 수 있으나, 인간을 제외한 포유류라면 그 종류에 특별히 제한이 없다.
또한, 본 발명은 (a) 서열번호 1의 염기서열로 표시되는 유전자의 5' 말단 기준 2번 내지 3번 중 어느 하나의 뉴클레오타이드에서 시작하여 총 6개의 연속된 뉴클레오타이드를 포함하고, 상기 서열번호 1의 염기서열 중 2번, 3번 또는 7번 중 하나 이상의 뉴클레오타이드가 구아닌(Guanine; G)에서 유라실(Uracil; U)로 치환된 폴리뉴클레오타이드를 발현하는 DNA를 프로모터에 작동 가능하게 연결하여 심비대증 동물 모델 제작용 재조합 벡터를 제조하는 단계;
(b) 상기 재조합 벡터를 동물의 수정란에 도입시키는 단계; 및
(c) 상기 수정란을 대리모에 이식한 후 수정란을 발생시켜 형질전환 동물 모델을 수득하는 단계를 포함하는, 심비대증 동물 모델의 제작 방법을 제공한다.
또한, 본 발명은 (a) 심비대증 동물 모델의 심근 세포에 후보물질을 처리하는 단계;
(b) 상기 심비대증 동물 모델의 심근 세포에서 서열번호 1의 염기서열로 표시되는 유전자의 5' 말단 기준 2번 내지 3번 중 어느 하나의 뉴클레오타이드에서 시작하여 총 6개의 폴리뉴클레오타이드를 포함하고, 상기 서열번호 1의 염기서열 중 2번, 3번, 또는 7번 중 하나 이상의 뉴클레오타이드가 구아닌(Guanine; G)에서 유라실(Uracil; U)로 치환된 폴리뉴클레오타이드의 G:A 워블(wobble) 배열 표적 사이트와의 결합 빈도를 분석하는 단계; 및
(c) 상기 G:A 워블(wobble) 배열 표적 사이트와의 결합이 후보물질을 처리하지 않은 심비대증 동물 모델에 비해 감소할 경우, 상기 후보물질을 심비대증 치료제로 선별하는 단계를 포함하는, 심비대증 치료제의 스크리닝 방법을 제공한다.
본 발명에 있어서, 상기 후보물질은 심비대증 동물 모델의 심근 세포에서 상기 폴리뉴클레오타이드의 G:A 워블 배열 표적 사이트와의 결합 빈도에 영향을 미치는지 여부를 검사하기 위하여 스크리닝에 이용되는 미지의 물질을 의미하며, 화학물질, 단백질, (폴리)뉴클레오타이드, 안티센스-RNA, siRNA(small interference RNA), 또는 천연물 추출물 등이 포함될 수 있으나, 이에 제한되지 않는다.
이하, 본 발명의 이해를 돕기 위하여 바람직한 실시예를 제시한다. 그러나 하기의 실시예는 본 발명을 보다 쉽게 이해하기 위하여 제공되는 것일 뿐, 하기 실시예에 의해 본 발명의 내용이 한정되는 것은 아니다.
실시예 1. Ago HITS - CLIP 분석을 통한 워블 염기 배열을 마이크로RNA의 발단 지역에서 허용하는 비정규 표적 사이트의 발견
마이크로RNA의 표적을 전사체 수준에서 분석할 수 있는 방법으로는 Ago HITS- CLIP이라는 실험 방법이 개발되어 널리 사용되고 있는데, Ago HITS CLIP 실험은 세포나 조직 샘플에 UV를 조사하여 세포 내에서 RNA와 아고너트 단백질 사이에 공유결합을 유도하고, 이렇게 생성된 RNA-아고너트 복합체를 아고너트를 특이적으로 인식하는 항체를 이용하여 면역침강법으로 분리한 다음, 분리된 RNA를 차세대염기서열(Next-generation sequencing)로 분석하는 방법이다. 이렇게 얻어진 염기서열 데이터는 생물정보학적 분석을 통해서 마이크로RNA의 표적mRNA를 동정할 수 있을 뿐만 아니라, 그 결합 위치와 서열도 정확하게 분석할 수 있다. Ago HITS-CLIP은 최초로 마우스의 대뇌피질 조직에 적용되어 뇌 조직에서의 마이크로RNA의 표적에 대한 지도를 작성하였고, 그 이후 지금까지 여러 조직에 해당 방법이 적용되었다. 이러한 여러 Ago HITS-CLIP 분석을 통해 여러 조직에서의 마이크로RNA 결합 위치가 밝혀지게 되었고, 특히 이러한 표적 서열에서 마이크로RNA의 발단 결합과는 유사하지만, 표적 mRNA의 서열에서 다른 형태의 비정규적 결합 표적이 많이 존재한다는 것을 알게 되었다.
밝혀진 비정규적 결합 법칙 중 일부는 기존의 알려진 염기배열 이외에 G:U 염기배열을 통한 워블(wobble)로 존재한다는 것이 관찰되었다. 워블 염기배열은 기존의 염기배열과는 다르게 특정 RNA에서 발견되며, 이미 알려진 G:U 워블은 마이크로RNA의 비정규 표적에서도 배열할 수 있음이 제시되었다. 하지만 이에 비해 그 결합이 약하며 자주 관찰되지 않았던 G:A 워블의 경우는 특정 RNA에서 염기배열을 형성할 수 있지만 그 외에는 전혀 조사가 되지 않았다. 하지만 마이크로RNA의 발단 서열 같은 경우에는 염기배열의 자유에너지(free energy)가 구조적으로 아고너트 단백질에 의해 안정화되기 때문에 일반적으로 약한 G:A 염기배열이 상대적으로 중요할 수 있다.
이에, 먼저 G:A를 포함한 워블 염기배열이 사람의 뇌 조직에서의 마이크로RNA 표적에 존재하는지를 확인하기 위해서 도 1a에 나타낸 바와 같이, 사후 뇌 조직의 회백질(gray matter)에 Ago HITS-CLIP을 수행한 데이터를 분석하였다. 이때의 분석은 Ago HITS-CLIP을 개발했을 때의 방법에 따라 아고너트-마이크로RNA와 함께 결합했던 RNA 서열을 시퀀싱된 FASTQ 파일에서 Bowtie2 프로그램으로 인간 유전체 서열에 배열하여 수행하였다. 동시에 해당 시퀀싱 결과를 인간 마이크로RNA 서열에 배열하여, 해당 뇌 조직에서 아고너트 단백질과 자주 결합하고 있는 20 종류의 마이크로RNA(top20 miRNA)도 분석하였다. 최종적으로는 이렇게 파악한 top20 miRNA에 대하여 해당 발단(seed) 서열인 5’ 말단 기준 2번째부터 8번째까지에 대하여 상보적인 서열을 가지는 정규 표적(canonical target) 사이트를 살펴보았다. 그 결과, 도 1b에 나타낸 바와 같이, 마이크로RNA 결합위치에 상당히 많은 수의 정규 발단 표적 사이트가 발견됨을 관찰하였다(중앙값 1292.5 사이트, 오차범위 +/- 706.62). 이후, 이러한 마이크로RNA의 발단 염기 서열에서 G:U 또는 G:A 워블 염기배열로 결합할 수 있는 비정규적 표적 사이트가 존재하는지를 Ago HITS-CLIP 데이터에서 살펴보았다. 이때 분석에 대한 대조군(Control)으로 마이크로RNA 발단(seed) 염기 서열과 동일한 염기 서열로 인해 염기의 상보적 배열이 불가능한 표적 서열을 사용하여 분석하였다.
그 결과, 도 1b에 나타낸 바와 같이, G:A 워블이 허용된 표적(중앙값 1119.5 사이트, 오차범위 +/- 526.48)과 G:U 워블이 허용된 표적(중앙값 995 사이트, 오차범위 +/- 523.22) 사이트 모두 대조군(중앙값 891 사이트, 오차범위 +/- 410.71)에 비해 높은 분포를 보였으며, 특히 G:A 워블이 존재하는 마이크로RNA 표적 사이트는 G:U 워블보다 약 1.1배 더 많이 존재함을 나타내었다.
또한, 뇌조직에서 특이적으로 발현되는 miR-124 (5'-UAA GGC ACG CGG UGA AUG CCA A-3'; 서열번호 23)는 도 1c에 나타낸 바와 같이, 발단 부분에 2개의 G를 5’ 말단으로부터 4번째와 5번째에 가지고 있어서, 이를 통한 G:U, G:A 워블 염기배열을 할 수 있다. 따라서 특정 위치의 G에 의한 G:A, G:U 워블 염기배열을 구별하여 분석해본 결과, 도 1d에 나타낸 바와 같이, miR-124의 정규 발단 표적 사이트(seed site) (5'-GUGCCUU-3'; 서열번호 24)가 가장 많이 발견되었다(1,992개). 하지만, 이와 견줄 수 있을 정도로 4번째가 G:U 워블(1,800개)을 이루는 것(4G:U site)을 발견하였으며, 그 다음으로는 4번째가 G:A 워블(1,542개)을 이루는 것(4G:A site)을 관찰하였다. 또한 5번째의 G도 G:U 워블(1,427개)을 이루는 것(5G:U site)과 G:A 워블(1,196개)을 이루는 비정규 표적 사이트(5G:A site)가 많이 보였으며, 이렇게 조사한 모든 사이트는 대조군의 개수(647개) 보다 모두 많이 존재하는 것을 확인할 수 있었다.
따라서, 마이크로RNA는 발단 지역의 염기서열을 통한 표적 mRNA를 인식할 때, 발단 지역을 통한 정규적인 염기배열 뿐만 아니라 비정규적으로 G:U 또는 G:A 워블 염기배열을 허용하며, 이러한 결합을 통해서 표적 mRNA와 결합할 수 있다는 것을 알 수 있었다. 이러한 G:A 워블 염기를 통한 마이크로RNA의 표적 인식은 보고 된 바가 없는 새로운 결과이며, 상기에서 관찰한 바와 같이 여러 마이크로RNA에서 비정규적인 표적 인식 및 조절이 된다는 것을 확인할 수 있었다.
실시예 2. 심근경색 환자의 심장조직에서의 Ago HITS - CLIP 결과 분석을 통한 miR -1의 G:A 워블 염기 배열을 마이크로RNA의 발단 지역에서 허용하는 비정규 표적 사이트의 발견
상기 실시예 1에서 사람의 뇌 조직에서의 마이크로RNA 표적 중 G:A를 포함한 워블 염기배열의 존재를 확인하였으며, 이와 같은 비정규 G:A 워블 염기 배열 결합이 심장 질환 환자의 심장 조직에서도 존재하는지를 확인하기 위해, 6명의 심근경색(Cardiomyopathy) 환자의 좌심실 조직에서 Ago HITS-CLIP을 수행한 데이터(Nucleic Acids Res. 2016 Sep 6; 44(15): 7120-7131)를 재분석하였다.
먼저, 이전 연구에서 심근경색 환자의 심조직에서의 Ago HITS-CLIP 결과로, 4000개의 mRNA에 Ago 단백질-마이크로RNA 복합체가 결합하는 것을 알 수 있었으며, 이때 심장에서 많이 발현되는 마이크로RNA의 top 20개 중, 심장 조직에서 특이적으로 발현되는 miR-1의 결합 사이트인 정규적 발단 결합 위치(seed site)뿐만 아니라, 비정규적 결합인 G:U 및 G:A 워블 염기 배열 결합 위치가 얼마나 분포하고 있는지를 분석해 보았다. 이때의 분석은, miR-1의 표적 사이트를 포함하고 있는 전사체라 할지라도 개체의 조직 특이성 없이 항상 높은 발현을 보이는 let-7/98 family, miR-27-3p, miR-143, miR-126-3p 등에 의해 중복으로 결합했을 가능성을 배제하기 위해, 상기와 같은 마이크로 RNA들의 정규 표적 사이트들을 포함하지 않고, 오직 miR-1의 표적 사이트만 가지는 전사체로 제한하여 수행하였다. 또한, 해당 분석에서 조사한 miR-1의 표적 사이트는 마이크로 RNA의 5’ 말단을 기준으로, 2번~8번의 염기서열과 결합하는 사이트(7 염기 표적)를 정규적 발단 결합 위치(seed site)로 정의하여 분석하였으며, 비정규 G:A 워블 염기 배열 표적 사이트의 경우에는 5’ 말단을 기준으로, 2번째부터 8번째 사이에 존재하는 발단 부분의 G:A 워블 염기 배열 표적에 우선적으로 국한하여 분석하였다. 분석에서의 표적 결합에 대한 분석 대조군으로는 Ago 단백질과 결합하였다고 보고된 4000개 전사체가 염기서열 분석기로 읽혀진 염기 서열 길이의 평균인 52.5 뉴클레오티드에 들어갈 수 있는 무작위(random)의 7개 염기 조합을 7염기 표적으로 대입하여 수학적으로 계산한 값을 사용하였다.
그 결과, 도 2a에 나타낸 바와 같이, 심근경색 환자의 심장 조직에서 오직 miR-1의 7개 염기로 구성된 정규 표적(seed) 사이트는 120개가 발견되었다. 발단 위치에 존재하는 miR-1의 비정규 G:A 워블 염기 배열 표적 사이트의 경우는 55개로 이는 정규 표적 사이트의 약 45%에 해당하는 부분이며, 대조군으로 사용된 무작위의 7개 염기 표적 계산 값인 11.23개보다 높은 값으로 관찰되었다. 이는 심장 조직에서 전혀 발현되지 않는 miR-124의 표적 결합이 1개로 분석된 결과와 비교해 보았을 때도 비정규 G:A 워블 염기 배열 표적 결합의 빈도가 높으며, 따라서 심근경색 환자의 심장 조직에서도 miR-1의 비정규 G:A 워블 염기 배열로 결합함을 확인할 수 있었다.
이어 miR-1의 비정규 G:A 워블 염기 배열 표적 사이트를 각 G염기의 위치에 대하여 분석해 보았다. 그 결과, 도 2b에 나타낸 바와 같이, 2번째 G 염기에 대한 비정규 G:A 워블 염기 배열 표적(G2A)은 21개로 이는 분석한 비정규 G:A 워블 염기 배열 중 38%에 해당되며, 3번째 G 염기에 대한 비정규 G:A 워블 염기 배열 표적 (G3A)은 12개로, 분석한 비정규 G:A 워블 염기 배열 중 22%이고, 7번째 G 염기에 대한 비정규 G:A 워블 염기 배열 표적(G7A) 사이트는 22개로 이는 분석한 비정규 G:A 워블 염기 배열 중 40%에 해당된다. 정규 발단위치에 존재하는 비정규 G:A 워블 염기 결합은 7번째 G 염기에 대한 비정규 G:A 워블 염기 배열 표적이 가장 높았다.
이를 통해, 심근 경색 환자의 심장 조직에서는 miR-1의 정규 표적 결합과 더불어 비정규 G:A 워블 염기 배열 표적 결합이 존재하며, 정규 발단 위치의 경우에는 7번째 G 염기가 A와 워블 염기 배열을 허용하는 비정규 표적의 결합이 가장 많이 관찰되었다. 이러한 관찰 결과를 통해, miR-1의 표적 발현 조절 기능이 정규 표적 결합과 더불어 비정규 표적 결합을 통해 매개 될 수 있음을 확인하였다.
실시예 3. 심장근육모세포주(H9c2)에서 형광 단백질 리포터를 이용한 miR -1의 비정규 G:A 배열 발단 타겟 유전자 발현 억제 효과 확인
상기 실시예 1 및 2에서 마이크로RNA가 비정규적으로 발단 서열에서 G:A 워블 배열을 허용하여 표적 mRNA와 결합할 수 있다는 사실을 발견한 후, 이러한 결합이 실제로 표적 유전자의 억제를 일으킬 수 있는지를 세포수준에서 확인하는 리포터 실험을 진행하였다. 이때, 확인 실험은 심장근육모세포주인 H9c2와 같이 근육계 세포에서 많이 발현되는 것으로 알려진 miR-1을 대상으로 진행하였으며, 상기 실시예 2에서 관찰된 바와 같이, miR-1의 5’ 말단으로부터 7번째에 존재하는 G에 주목하여, 이를 통한 G:A 워블 염기배열을 대상으로 수행하였다. 마이크로RNA에 의한 유전자 억제는 보다 정밀하게 개별 세포 수준에서 측정하기 위해서 형광 단백질 발현 리포터 시스템을 구축하여 사용하였다. 형광 단백질 발현 리포터 시스템은 두 가지 색의 형광단백질이 하나의 벡터에 발현되게 구성되었으며, 이때 SV40 프로모터에는 녹색 형광 단백질(green fluorescent protein: GFP)이 발현되게 하고, 그 3' 비전역 부분(3' untranslated region: 3'UTR)에 마이크로 RNA의 표적 사이트를 여러 개 연속적으로 배열하여, 녹색 형광 단백질의 세기를 통해 마이크로RNA에 의한 유전자 억제 효과를 측정할 수 있도록 하였으며, 동시에 적색 형광 단백질(red fluorescent protein: RFP)은 Tk 프로모터에 의해 발현되도록 하여 그 세기 정도로 녹색 형광 신호를 표준화하여 사용하였다.
상기와 같이 구축된 형광 단백질 발현 리포터 벡터에 miR-1의 5’ 말단으로부터 2번째부터 8번째까지 염기에 대해서 상보적이면서, 7번째 염기 G에 대해서는 G:A 워블로 염기배열하는 비정규 표적 사이트(7G:A-site) (5'p-AAAUUCCA-3'; 서열번호 25)를 삽입하여 리포터를 제작한 후(GFP-7G:A site), 이것이 miR-1에 의해서 억제되는지를 실험을 통해 확인하였다. 이때 실험은, 500 ng GFP-7G:A site 리포터 벡터와 25nM의 miR-1을 lipofectamine 2000(Invitrogen 사) 시약을 이용하여 회사에서 제공하는 프로토콜에 따라 심장근육모세포주인 H9c2에 동시에 도입(co-transfection)하였고, 24시간 후 Life Technology사의 Attune NxT를 통해 각각의 형광 신호를 유세포 분석으로 측정하였다.
그 결과, 도 3a에 나타낸 바와 같이, miR-1의 발현에 의해서 miR-1의 7G:A 사이트가 매우 효율적으로 억제(도 3a의 가운데)되는 것을 대조군 핵산(cont; NT; cel-miR-67 duplex)을 도입한 세포(도 3a의 왼쪽)와 비교하여 확인하였다. 즉, 심장근육모세포주인 H9c2 에서 두 가지 형광 단백질의 발현 정도에 따라 네 부분(Q5-1, Q5-2, Q5-3, Q5-4)으로 분석한 결과 miR-1이 도입된 세포의 경우, 대조군 핵산이 도입된 경우보다 10 3 세기의 적색 형광 단백질과 10 3 세기의 녹색 형광 단백질을 보이는 세포의 분포가 59.51%(control: Q5-3)에서 41.80%(miR-1: Q5-3)로 감소된 것을 관찰하였다.
상기로부터 GFP-7G:A site 리포터 벡터는 miR-1의 도입 없이도 H9c2 세포에서 어느 정도 억제되고 있는 것이 대조군에서 관찰되었다. 이것은 H9c2 세포 내에서 이미 발현되고 있는 miR-1에 의해서 리포터 표적 mRNA와의 G:A 워블 염기배열을 통해 억제하는 것으로 예상할 수 있다. 상기 내용을 확인하기 위해서 H9c2 세포 내의 miR-1의 발현을 억제할 수 있는 miRIDIAN microRNA Hairpin inhibitor(miR-1 inhibitor, 도 3a의 오른쪽)를 Dharmacon사로부터 구입하여 50 nM 농도로 세포에 트랜스펙션시켜 사용하였다.
그 결과, 대조군에서 비해 miR-1 inhibitor를 도입한 경우, 10 3 세기의 적색 형광 단백질과 10 3 세기의 녹색 형광 단백질을 보이는 세포의 분포가 81.56%(miR-1 inhibitor: Q5-3)로 증가하는 것으로 보아, 세포 내에 존재하는 miR-1이 miR-1의 7G:A 사이트를 통해 유전자 발현을 억제할 수 있음을 확인하였다.
또한, 형광 단백질 발현 리포터에 마이크로RNA 표적 사이트를 넣지 않은 대조군(GFP-no site)과 miR-1의 7G:A 사이트가 들어간 리포터인 GFP-7G:A site를 H9c2 세포에 도입하여 그 활성을 비교하여 확인하였으며, 양성 대조군으로는 miR-1을 함께 도입한 경우와 정량적으로 비교하여 확인하였다. 이때의 분석은 유세포 분석기에서 측정한 적색 형광 단백질(RFP) 값을 구간별로 나누고, 이때의 녹색 형광 단백질(GFP) 값을 평균을 내어 로그 비율로 변환하였으며, 이때 대조군인 GFP-no site의 녹색 형광 단백질 수치를 1로 두고(relative log GFP) 상대적으로 계산하였다.
그 결과, 도 3b에 나타낸 바와 같이, miR-1 과 7번째 G 염기에 대해, G:A 워블(wobble)을 통해 상보적으로 염기 배열되는 사이트가 있는 경우(GFP-7G:A site), 특히 1.5~2.5값의 적색 형광 단백질의 발현(log RFP)이 보이는 구간에서, G:A 워블을 통한 녹색 형광 단백질의 발현(relative log GFP)이 1보다 12.5% 정도 낮아지는 것을 확인하였다. 이러한 억제는 양성 대조군에서는 특히 1.5~2.5 구간의 적색 형광 단백질의 발현(log RFP)에서 40%~25% 정도 녹색 형광 단백질의 발현(relative log GFP)이 억제되는 패턴과 동일하게 나타나는 점을 관찰하였다.
상기에서 관찰한 결과가 해당 형광 단백질 리포터에서 사용한 서로 다른 프로모터의 세기와 두 가지 다른 형광 단백질이 가지는 형광 활성도의 차이에 의해서 영향을 받지 않음을 확인하기 위해서, 두 개의 형광 단백질을 서로 바꿔져 있는 형광 단백질 리포터인 p.UTA.3.0을 Addgene(plasmid # 82447)으로부터 구입하여 사용하였다. 이때 리포터 실험은 p.UTA.3.0 벡터에서 SV40 프로모터에 의해 조절되는 적색 형광 단백질(red fluorescent protein: RFP)의 3’ UTR 부분에 miR-1-7G;A 서열을 5번 반복하여 삽입한 후 리포터 벡터(RFP-7G:A site)를 제작하여 진행하였으며, 이때 적색 형광 단백질 발현 수치는 Tk 프로모터로 발현되는 녹색 형광 단백질(green fluorescent protein: GFP) 값을 세포 내에 도입된 정도를 반영한 표준화로 사용하여 변형하여 사용하였다.
그 결과, 도 3c에 나타낸 바와 같이, 상기와 동일하게 miR-1의 7G:A 사이트가 H9c2에서 발현되는 miR-1에 의해서 억제되는 것을 miRNA 표적 위치가 없는 리포터(RFP-no site)의 대조군과 miR-1의 7G:A site가 들어간 리포터(RFP-7G:A site)의 결과를 비교하여 확인하였으며, 동시에 도 3d에 나타낸 바와 같이, 양성 대조군이 miR-1과의 co-transfection에서도 miR-1-7G:A 사이트를 억제하는 현상을 관찰하였다.
상기로부터, Ago HITS-CLIP 분석을 통해 발견한 마이크로RNA의 비정규 표적이 실제로 마이크로RNA의 발단 서열에서 G:A 워블 배열을 통해 결합할 수 있을 뿐 아니라, 해당 표적 유전자의 발현을 억제할 수 있음을 확인하였다.
따라서, 이러한 점으로 미루어 볼 때, G:A 워블 배열을 통한 표적 사이트를 이용하여 마이크로RNA와 충분히 결합할 수 있으며, 이러한 점을 G:A 워블 배열 조절 특이적 치환 핵산(miRNA-GU)을 통해 유사하게 유도할 수 있다면, 비정규적 표적 억제에 의한 마이크로RNA의 생물학적 기능만을 활용할 수 있음을 유추할 수 있었다.
실시예 4. 루시퍼라제 리포터 실험을 통한 miR - 1 변형 마이크로RNA의 비정규 G:A 워블 배열 발단 사이트에 대한 억제 효과 확인
상기 실시예 1, 2, 및 3에서 miR-1이 비정규적으로 발단 서열에서 G:A 워블 배열을 허용하여 표적 mRNA와 결합하고 해당 표적 유전자의 발현을 억제한다는 사실을 바탕으로, 이러한 비정규 표적만이 다른 생물학적 기능을 할 수 있는 가능성을 조사하고자 하였다. 이를 위해서는 정규적인 발단 표적과 비정규적인 G:A 워블 배열 표적 둘 다 인식하는 miR-1을 사용할 수 없으므로, 인위적으로 miR-1의 5' 말단으로부터 2번째 구아닌 염기를 유라실로 치환시킨 miR-1-2GU (5'-UGAAUG-3'; 서열번호 2), 3번째 구아닌 염기를 유라실로 치환시킨 miR-1-3GU (5'-GUAAUG-3'; 서열번호 3), 7번째 구아닌 염기를 유라실로 치환시킨 miR-1-7GU (5'-GGAAUU-3'; 서열번호 4)의 서열을 포함하여 비정규적인 G:A 워블 배열 표적만을 배열하도록 도 4a에 나타난 바와 같이 디자인하였다.
추가적으로 도 4a에 나타난 서열의 miR-1 변형 마이크로RNA가 실제로 비정규적인 G:A 워블 배열 표적을 억제할 수 있는지를 확인하기 위해서 다음과 같은 실험을 수행하였다. 먼저, 가이드 가닥(guide strand) 상에 miR-1과 동일한 서열이지만 5' 말단으로부터 2, 3, 또는 7번째 구아닌 염기가 유라실로 치환된 RNA를 합성하고, 운반 가닥(passenger strand)은 변형이 가해지지 않은 miR-1의 동일한 서열로 합성하여 제조하였다. 이러한 RNA는 ST Pharma 사, Trilink Technologies 사 또는 Bioneer 사를 통해 화학적으로 합성하고, HPLC로 분리하였으며, 상기 회사에서 제공한 방법에 따라 가이드 가닥과 운반 가닥의 이중체(duplex)로 제조되었다.
상기 방법으로 합성한 도 4a의 miR-1 변형 마이크로RNA의 표적 억제 효과를 루시퍼라제 리포터로 측정하였다.
즉, 상기에서 이중체로 제조된 75 nM의 siRNA는 HeLa세포(ATCC CCL-2)에 레닐라 루시퍼라제를 발현시키는 psi-check2 벡터와 함께 Lipofectamine 2000 시약(Invitrogen)을 이용하여 제조자의 프로토콜에 따라 HeLa 세포에 전달(co-transfection)시켜서 마이크로RNA의 농도에 따른 그 효과를 조사하였다. 이때, 3'UTR(3'untranslated region) 부분에 miR-1의 5’ 말단으로부터 2번째부터 8번째까지 염기에 대해서 상보적이면서, 2번째(도 4b), 3번째(도 4c), 또는 7번째(도 4d) 염기 G에 대해서는 G:A 워블로 염기배열 하는 비정규 표적 사이트를 삽입한 리포터를 사용하였다.
또한, 실험 시 HeLa 세포는 10% FBS(fetal bovine serum), 100 U/ml 페니실린, 및 100 ㎍/ml 스텝토마이신을 보충한 Dulbecco's 개질 Eagle's 배지 (Invitrogen)에서 배양하였으며, 항생제 없는 완전배지에서 트랜스펙션을 수행하였다. 트랜스펙션을 수행한 후 24시간 후, Promega 사의 Dual-luciferase reporter asssay system을 이용하여 제조사의 프로토콜에 따라 루시퍼라제의 활성을 측정하여 siRNA의 효과를 조사하였으며, 레닐라 루시퍼라제 활성 계측은 promega 사의 Glomax Luminometer를 이용하여 최소 3번 이상의 반복 실험으로 반딧불(firefly) 루시퍼라제의 활성에 의해 표준화되어 계산하였다
여러 농도에서 비정규적인 G:A 워블 배열 표적에 대한 저해 효과를 측정하고 IC 50(inhibitory concentration 50)를 살펴본 결과, 도 4b(IC 50=0.2nM), 도 4c(IC 50=2.2nM), 및 도 4d(IC 50=4nM)에 나타난 바와 같이 miR-1의 5' 말단으로부터 2, 3, 또는 7번째 구아닌 염기를 유라실로 치환시(miRNA-GU), 루시퍼라제 리포터의 비정규 G:A 워블 배열 발단 사이트를 특이적으로 억제한다는 사실을 알 수 있었다.
실시예 5. miR -1의 2, 3, 7번째 G 염기에 대한 비정규 G:A 워블 배열 발단 타겟 유전자의 조절을 통한 심근 세포의 비대 유도 효과 확인
5-1. 실험 준비
상기 실시예 3에서 확인한 비정규적인 유전자 억제 현상은 G:A 워블 염기 배열이 마이크로RNA의 비정규 표적으로 작용하여, 생물학적 기능을 조절할 수도 있다는 가능성을 상기 실시예 4에서 검증한 G:A 워블 배열 조절 특이적 치환 핵산(miRNA-GU)을 통해 확인하고자, 상기 실시예 2 및 3에서 살펴본 심근세포의 miR-1을 중심으로 실험을 진행하였다.
비정규적인 G:A 워블 표적이 특정한 생물학적 기능을 가지고 있는지를 조사하기 위해서는, miR-1이 정규적인 표적은 인식하지 않고, 비정규적인 G:A 워블 배열 표적 사이트만을 인식하게 하여야 하므로, miR-1의 발단 지역에 있는 G가 C가 아닌 A와 염기 배열하도록 해당 G를 U로 치환하여 제작한 miRNA-GU를 실험에 사용하였다. 본 실험에서는 보다 생리학적으로 심장과 유사한 조건으로 수행하기 위해서 랫트(rat)의 심장 조직으로부터 신생백서 심근세포(neonatal cardiomyocyte)를 배양하여 수행하였다. 이때, 신생백서 심근세포의 배양은 생후 1일차 랫트(rat neonate)의 심장조직에서 효소 반응을 통해 신상백서 심근세포를 분리하고(Cellutron 사의 neomyt kit), 신생백서 심근세포는 10% FBS(fetal bovine serum), 5% HS(horse serum), 100 U/ml 페니실린, 및 100 ㎍/ml 스텝토마이신을 보충한 Dulbecco's 개질 Eagle's 배지(Invitrogen)와 M199(WellGene) 배지를 4:1로 섞어 준비한 배지에 brdU를 첨가하여, 심장 조직에 존재하는 세포주기를 갖는 다른 세포들과 구별하여 배양하였다.
5-2. miR -1에 의한 심근 세포 크기 감소 확인
상기 실시예 5-1로부터 얻어진 신생백서 심근 세포에서 심근비대현상이 유도되는지를 우선적으로 확인하였다. 심근 세포는 세포주기를 멈추고, 심근 세포의 크기를 증가시킬 수 있는 특징을 가지고 있는데, 이를 심근 비대 현상이라고 한다. 심근 비대 현상은 심근 세포의 기능 저하를 보완하는 역할을 해왔으며, 심장 질병의 병리 중간 단계로도 알려져 있으며, 세포 형태학적 관찰 및 유전자 발현 프로파일 변화가 잘 알려진 심장 질병 모델 시스템이다. 심근 비대증의 세포 모델에서는 페닐에프린(PE)과 같은 아드레널직 리셉터 작용제(agonist)를 심근 세포에 처리해주면 심근 비대증을 유도할 수 있다.
따라서, 배양한 신생백서 심근 세포에 100 uM의 페닐에프린을 처리하여 심근 비대를 유도하였고, 그 결과, 도 4a에 나타낸 바와 같이 아무것도 처리하지 않은 대조군(rCMC)과 비교하여 신생백서 심근 세포의 크기가 증가하는 것을 형태학적으로 확인하였다(+PE). 또한, 신생백서 심근 세포에 miR-1을 도입하였을 때 심근 세포의 크기가 감소하는 것을 관찰하였다. 이는 잘 알려진 심근 비대 현상과 miR-1 의 심근 세포에서의 기능과 일치한다.
5-3. miR -1 치환체의 심근 세포 비대 유도 효과 확인
miR-1은 발단지역에 3개의 G 염기를 포함하고 있으며, 이에 따라 정규적인 표적은 인식하지 않고, 비정규적인 G:A 워블 배열 표적 사이트만을 인식하게 하기 위해서, 이러한 G를 U로 치환한 miR-1을 디자인하였으며, 이를 G 염기가 있는 위치에 따라 5’말단 기준 2번째 위치(miR-1-G2U), 3번째 위치(miR-1-G3U), 7번째 위치(miR-1-G7U)에 적용하여 miR-1 치환체를 합성하였다. 이때, 사용한 miR-1의 치환 염기 서열은 다음과 같으며(miR-1-G2U: 5’p-UUGAAUGUAAAGAAGUAUGUAU-3', 서열번호 7; miR-1-G3U: 5’p-UGUAAUGUAAAGAAGUAUGUAU-3’, 서열번호 8; miR-1-G7U: 5’p-UGGAAUUUAAAGAAGUAUGUAU-3’, 서열번호 9), 이는 가이드 가닥으로 합성되었고, 상기 치환된 miR-1의 5' 말단으로부터 2, 3, 7번째 염기에 대해서는 완전 상보적이지 않으나 가이드 가닥과 이중체를 형성하는 운반자 가닥(hsa-miR-1-5p; miRBase accession 번호: MIMAT0031892, 5'-ACAUACUUCUUUAUAUGCCCAU-3'; 서열번호 26)은 miRBase에 기록된 인간의 miR-1 염기서열을 디자인하여 Bioneer 사에서 화학적으로 합성 제작 후, HPLC로 분리, 상기 회사에서 제공한 방법에 따라 가이드 가닥과 운반 가닥의 이중체 (duplex)로 제조하여 사용하였다. 해당 마이크로RNA의 신생백서 심장근육모세포주로의 도입(transfection)은 RNAimax(Invitrogen 사) 시약을 이용하여 50 nM 농도로 수행하였다.
그 결과, 도 5a에 나타낸 바와 같이, miR-1-G2U 또는 miR-1-G3U 또는 miR-1-G7U를 신생백서 심근세포배양에 도입하였을 때 신생백서 심근세포의 형태가 심근 비대를 유도한 세포(+PE)와 유사한 수준으로 커진 것을 관찰할 수 있었다. 이때 각각의 세포 크기를 정량적으로 분석하기 위해서, 100개 이상의 세포가 이미지J 프로그램(NIH)을 통해 정량화되었으며, 도 5b에 나타낸 바와 같이 miR-1의 G:A 워블 배열 사이트만을 인식하게 합성한 miR-1 치환체(miR-1-G2U, miR-1-G3U, miR-1-G7U)들 모두 대조군(NT) 핵산을 도입했을 때와 비교해서 약 1.5~1.8 배 정도 그 크기가 커진 것으로 분석되었다. 이는 페닐에프린(PE) 약물이 유도하는 심근세포 비대증 모델의 심근세포 크기와 비슷한 수준이며, miR-1 자체는 심근세포 형태상으로는 세포 크기를 감소시키는 효과를 보임으로써, 그 정규적인 표적 억제효과가 G:A 워블을 통한 표적 억제와는 세포 형태학상 다른 기능을 나타내는 것을 관찰하였다.
또한, 추가적으로 본 실시예에서 관찰한 심근비대 현상을 분자적 수준에서 확인하기 위해서 마커로 그 발현이 증가하는 것으로 알려진 ANP(atrial naturiuretic peptide) 유전자의 발현을 qPCR(Quantitative Polymerase Chain Reaction) 실험을 통해 GAPDH와 비교하여 상대적인 값으로 측정해 보았다.
그 결과, 도 5c에 나타낸 바와 같이 miR-1의 G:A 워블 배열 사이트만을 인식하게 합성한 miR-1 치환체(miR-1-G2U, miR-1-G3U, miR-1-G7U)를 신생백서 심근세포에 도입했을 경우에는 모두 ANP 발현양을 대조군(NT)에 비해 1.2~1.5 배 정도 유의하게 증가시킨 것을 4번의 반복 실험을 통해 확인할 수 있었다. 이러한 ANP 발현 증가는 페닐에프린(PE) 약물을 처리한 심근세포 실험군이 대조군에 비해 크기가 약 2배 정도 증가한 것 보다는 적지만, 원래의 miR-1이 도입되었을 때 도리어 ANP 발현이 유의하게 감소하는 현상과는 반대되는 것으로, 이를 통해 miR-1은 G:A 워블 배열 사이트를 통해 완전히 다른 생물학적 기능을 나타낸다고 볼 수 있다.
실시예 6. miR -1의 2, 3, 7번째 G 염기에 대해 비정규 G:A 워블 배열 발단 타겟 유전자 조절 기능을 하는 최소 염기 서열을 통한 심근 세포의 비대 유도 효과 확인
6-1. miR -1의 2, 3, 7번째 G 염기에 대해 비정규 G:A 워블 배열 발단 타겟 유전자 조절 기능을 하는 최소 염기 서열 정의
상기 실시예 5에서 miR-1의 2, 3, 7번째 G 염기에 대한 비정규 G:A 워블 배열 발단 타겟 조절을 통해 기존의 정규 표적 억제와는 전혀 다른 심근 세포의 비대화를 유도할 수 있음을 확인할 수 있었다. 이어, miR-1의 2, 3, 7번째 G 염기에 대해 비정규 G:A 배열만을 허용하는 치환 핵산의 염기 서열에 있어, 심근 비대 기능을 유도하는 최소한의 염기 서열을 정의하는 실험을 진행하였다.
이는 마이크로RNA의 G:A 워블 표적에 의한 생물학적 기능을 선택적으로 조절 하는데 있어 필수적인 정보이다. 따라서, miR-1 의 정규 발단 사이트로 알려진 5’ 말단 기준 2번부터 7번째까지의 염기 서열을 가지고, 9번~23번째 염기는 대조군으로 사용되는 NT(cel-miR-67-5p: 5'-CGC UCA UUC UGC CGG UUG UUA UG- 3', 염기서열 27)의 리보핵산 염기 서열을 가지며, 8번째 염기의 경우는 miR-1 염기 서열과 다르게 하기 위해 A 염기로 변경, 1번째 염기는 miR-1 염기 서열과 다르면서도, 효율적인 아고너트 로딩을 위해 A 염기로 치환한 RNA를 가이드 가닥으로 고안하여 상기 실시예 4에서와 같이 Bioneer 사에서 합성하였다. 이를 miR-1_2-7이라 명명하였으며, 그 염기 서열은 도 5a에 나타내었으며 다음과 같다(miR-1_2-7: 5’-AGG AAU GAC UGC CGG UUG UUA UG-3’; 서열번호 28).
miR-1의 최소 표적 염기 서열만을 포함한 리보핵산인 miR-1_2-7에 대하여, 2, 3, 7번째 G 염기 위치를 각각 G:A 배열이 가능하게 하는 U 염기로 치환한 리보핵산을 디자인하였으며, 이 염기서열은 miR-1의 2, 3, 7번째 G 염기 위치에서 G:A 배열을 가능하게 하는 최소한의 염기 서열로 정의될 수 있다. miR-1_2-7의 표적 염기 서열에 대한 각 치환 염기 서열은 도 5a에 나타내었으며 다음과 같다(miR-1_2-7_G2U: 5’-AUG AAU GAC UGC CGG UUG UUA UG-3, 서열번호 10; miR-1_2-7_G3U: 5’-AGU AAU GAC UGC CGG UUG UUA UG-3’, 서열번호 11; miR-1_2-7_G7U: 5’-AGG AAU UAC UGC CGG UUG UUA UG-3’, 서열번호 12).
또한, miR-1의 최소 표적 염기 서열은 5’ 말단 기준 3번째부터 8번째까지의 6개의 연속된 염기 서열로도 구성될 수 있다. 따라서 miR-1의 3번째부터 8번째까지의 6개의 염기 서열을 대조군으로 사용하는 NT 리보핵산 염기 서열(서열번호 27)의 5’ 말단 기준 2번째부터 7번째 위치에 배열하고 1번째 염기와 8번째 염기는 miR-1과 다른 염기 서열을 가지기 위해 A 염기로 치환, 9번부터 23번째까지는 NT의 염기 서열을 가지는 리보핵산을 고안했으며, 이는 miR-1_3-8(5'-AGA AUG UAC UGC CGG UUG UUA UG -3'; 서열번호 29)이라 명명하였다.
이를 바탕으로 miR-1_3-8의 각 3번, 7번째 G 염기의 위치를 각각 G:A 배열이 가능한 U 염기로 치환한 RNA를 디자인하였으며, 이 염기서열은 miR-1의 3, 7번째 G 염기 위치에서 G:A 배열을 가능하게 하는 또 다른 최소한의 염기 서열로 정의될 수 있다. miR-1_3-8의 염기 서열에 대한 각 치환 염기서열은 도 6a에 나타내었으며 다음과 같다(miR-1_3-8_G3U: 5’-AUA AUG UAC UGC CGG UUG UUA UG-3’, 서열번호 13; miR-1_3-8_G7U: 5’-AGA AUU UAC UGC CGG UUG UUA UG-3’, 서열번호 14). 이를 가이드 가닥으로 고안하여, 상기 실시예 5에서와 같이 Bioneer사에서 화학적으로 합성 제작 후, HPLC로 분리, 상기 회사에서 제공한 방법에 따라 가이드 가닥과 운반 가닥의 이중체(duplex)로 제조하여 사용하였다.
6-2. 비정규 G:A 워블 배열 발단 타겟 유전자 조절 기능을 하는 최소 염기 서열을 통한 심근 세포의 비대 유도 효과 확인
상기 실시예 6-1에서 제조한 마이크로RNA의 심장근육모세포주(H9c2)로의 도입(transfection)은 RNAimax(Invitrogen 사) 시약을 이용하여 50 nM 농도로 수행하였다.
이후 세포 형태 변화의 관찰 결과, 도 6b에 나타낸 바와 같이 최소 표적 염기 서열로 알려진 6개 염기 서열을 포함하는 miR-1_2-7 과 miR-1_3-8 이 도입된 세포는 miR-1이 도입된 세포와 비슷하게 세포의 크기가 줄어든 것을 확인할 수 있었다. 반면에 miR-1_2-7_G2U, miR-1_2-7_G3U, miR-1_2-7_G7U, miR-1_3-8_G3U, miR-1_3-8_G7U 가 도입된 세포의 경우, 대조군인 NT(H9c2)가 도입된 세포에 비하여 비대 현상을 관찰할 수 있었다. 이를 통해, miR-1의 정규 표적 조절 기능에 있어 6개 염기서열로 구성된 최소 표적 염기 서열을 세포 형태상의 변화를 통해 확인할 수 있었으며, 비정규 G:A 배열 표적 조절 기능에 있어서도 이러한 최소한의 염기 서열을 통해 기존의 정규적인 표적 조절 기능과는 전혀 다른, 새로운 기능을 보임을 세포 비대 관찰을 통해 확인할 수 있었다.
또한, 상기 실시예 6-1에서 도입한 치환 핵산의 표적 조절 기능을 정량적으로 분석하기 위해, 실험군 당 약 50개의 세포에 대해 그 크기를 이미지J 프로그램(NIH)을 통해 정량화하였다. 그 결과, 도 6c에 나타낸 바와 같이 miR-1_2-7과 miR-1_3-8, miR-1이 도입된 세포의 크기는 모두 대조군(NT) 핵산을 도입했을 때와 비교해서 약 23% 정도 감소한 것을 확인할 수 있었다. 반면에, G:A 워블 배열 사이트만을 인식하게 치환하여 합성한 핵산인 miR-1_2-7_G2U, miR-1_2-7_G3U, miR-1_2-7_G7U, miR-1_3-8_G3U, miR-1_3-8_G7U가 도입된 세포의 경우, 대조군(NT) 핵산이 도입된 세포에 비해 약 2.5배 정도 크기가 증가한 것으로 분석되었다. 이는 상기 실시예 5에서 수행한 실험군 중, 심근세포비대증 유도 약물인 페닐에프린(PE) 처리가 보이는 심근 세포 크기 변화(도 4b: 약 1.5 배)와 유사한 정도이며, miR-1_G2U, miR-1_G3U, miR-1_G7U 치환 핵산이 유도한 심근 비대 현상과도 유사한 결과로(도 5b: 약 1.5~1.8배), miR-1의 G:A 워블 배열을 통해 기능하는 최소 염기 서열을 정의했다고 할 수 있다.
상기로부터 마이크로RNA 발단 지역에서 G:A 워블 배열을 통해 억제하는 비정규 표적은 기존의 정규적인 표적 인식과는 생물학적으로 다른 기능을 나타낼 수 있다는 점을 다시 한 번 확인하였으며, 이런 기능을 하는 최소 염기 서열을 정의할 수 있었다. 이러한 발견은 마이크로RNA의 정규적인 표적을 통한 기능과 비정규적 표적을 통한 기능이 서로 다르다는 것을 나타내며, 이러한 점으로 미루어 볼 때 마이크로RNA의 G:A 워블 표적만을 억제할 수 있다면 G:A 워블 표적에 의해서 일어나는 생물학적 기능만을 선택적으로 제어할 수 있을 것으로 유추되었다. 또한, 최소한의 염기 서열을 이용하여 G:A 워블 표적조절의 선택적 제어가 좀 더 효과적일 것으로 예상되었다.
실시예 7. miR -1의 비정규 G:A 워블 배열 발단 타겟 조절 핵산의 심장 특이적 발현을 위한 재조합 벡터 제조 및 형질전환 마우스 모델 제조
7-1. 재조합 벡터 제조
상기 실시예 5 및 6에서 miR-1의 2, 3, 7번째 G:A 배열 발단 타겟 유전자 조절만을 선택적으로 억제하게 하는 핵산을 신생백서 심근세포 및 심장근육모세포주에 도입하였을 경우, 심근 비대 현상을 유도하며 정규 발단 타겟 조절이 유도하는 기능과는 전혀 다른 새로운 기능을 한다는 점을 관찰하였다. 이를 바탕으로 miR-1의 G:A 배열 발단 타겟 유전자 조절 기능을 동물 개체 수준에서 관찰하고자 하는 실험을 진행하였으며, miR-1의 7번 G:A 배열 발단 타겟 유전자 조절 핵산(miR-1_G7U, 서열번호 9)에 대하여 이를 마우스의 심근 세포에 특이적으로 발현, 형질을 전환한 마우스를 제조하였다.
마우스의 심장 조직을 구성하는 다양한 세포 중 심장 근육의 수축을 담당하는 세포를 심근 세포(Cardiomoycyte)라 한다. 박동에 맞춰 근수축을 하는 심근 세포의 특화된 기능은 심근 세포 특이적으로 발현되는 전사인자(transcription factor)들에 의해 조절되며, 이들의 발현을 전담하는 심근세포 특이적 프로모터에 대한 연구는 마우스의 심장 발달 시기 및 위치에 따라 잘 연구되어 있다. miR-1의 7번째 G:A 배열 발단 타겟 유전자 조절 핵산(miR-1_G7U)을 심근 세포에 특이적으로 발현하는 형질 전환 마우스의 제작에 있어 가장 중요하게 선택할 사항은 이 치환 핵산의 심근 세포 특이적 발현을 조절하는 프로모터의 선택이다. 마우스의 발달 과정 중 심장 조직은 선상 심장(cardiac tube)이 완성되는 배아기 8 일(E8 day) 경부터 미성숙하지만 수축 기능이 시작될 정도로 이르게 발달하기 때문에, miR-1의 7번째 G:A 배열 발단 타겟 유전자 조절 핵산(miR-1_G7U) 의 발현이 배아 발생 단계 프로모터의 조절로 인해 심장 발달 과정에 영향을 미칠 경우, 형질전환 마우스의 제작이 어려울 뿐 아니라 그 기능의 연구도 어려울 수 있다. 따라서 다양한 발달 시기에 따른 프로모터 중 αMHC 프로모터를 이용하여 유전자 재조합 벡터를 제작하였다. αMHC 프로모터는 1991년 Jeffrey Robinson 박사의 논문 발표(Subramaniam A et al, JBC, 1991, 266(36):24613-20) 이후 현재까지 사용되어지는 마우스의 유전체 일부분으로, βMHC의 마지막 엑손 부분부터, αMHC의 3번째 비암호화 엑손 (non-coding exon)까지 총 5.5 kb로 이루어져 있으며, 발현 시기는 생후 1일자부터 지속적으로 발현된다고 알려져 있다. αMHC 프로모터가 포함된 벡터는 pJG/αMHC (addgene reference: 55594)로 애드진에서 구입하였다.
αMHC의 3번째 비암호화 엑손(non-coding exon) 이후의 벡터 부분에 miR-1의 7번째 G:A 배열 발단 타겟 유전자 조절 핵산(miR-1_G7U)을 재조합 하였으며 이를 도7a에 나타내었다. miR-1의 7번째 G:A 배열 발단 타겟 유전자 조절 핵산(miR-1_G7U: 이후 miR-1_G7T)은 마우스의 심장 조직에서 리보핵산을 추출하고 이를 superscript III역전사 효소(Invitrogen)를 통해 cDNA로 만들어 발현된 전사체 (transcript)를 만든 후, 염색체(chromosome) 2번 위치의 miR-1 프리커서 헤어핀 (precursor hairpin : 77 염기)을 포함하는 284개의 염기 서열을 중합효소 연쇄반응(PCR) 하여 아가로우즈 젤에 전기영동으로 밴드를 확인하여 도 7b에 나타내었다(도7b의 1번). 이후 miR-1의 7번 위치의 G 염기를 T염기로 치환하기 위해, 284염기 서열중 1번부터 miR-1의 7번 위치까지 PCR 을 진행하여 전기영동으로 밴드를 확인하고(도 7b의 2, 3번), miR-1의 7번 위치부터 284번까지의 PCR 을 진행하여 전기영동으로 밴드를 확인한 다음(도 7b의 4, 5번), 도 7b의 2, 3, 4, 5번을 주형 (template)으로 284개의 염기서열을 지닌 miR-1의 7번째 G:A 배열 발단 타겟 유전자 조절 핵산(5'- TGG AAT TTA AAG AAG TAT GTA T- 3'; 서열번호 30, 5’-ATA CAT ACT TCT TTA AAT TCC A-3'; 서열번호 17)이 포함되게 준비하였다(도 7b, 6번). 이렇게 준비된 miR-1의 7번째 G:A 워블 배열 발단 타겟 유전자 조절 핵산(miR-1_G7T)은 SalI/HindIII 제한 효소 자리를 통해 pJG/αMHC벡터에 재조합 하였다(pJG/αMHC-miR-1_G7T).
7-2. 형질전환 마우스 제조
형질 전환 마우스를 제작할 때, 상기 실시예 7-1에서 제조한 재조합 벡터가 마우스의 수정란 중 핵부분에 주입(injection)되어 마우스의 유전자와 섞이게 되며, 대리모를 통해 개체로 발달하게 된다. 이렇게 태어난 마우스가 재조합 벡터를 유전체(genome)에 가지고 있는지 확인하기 위해 각 마우스에서 핵산(genomicDNA)을 추출하여 스크리닝(positive genotyping)하는 과정이 필요하다. 효율적인 스크리닝을 위해 재조합 벡터에 포함되어 있는 인간 성장호르몬(human growth hormone)의 비전역 부위(UTR: untranslational region)를 이용하는데, 이는 재조합 벡터가 이식(transgene)된 마우스의 경우를 제외하고는 자연적인 마우스의 유전체는 인간 성장호르몬 비전역 부위를 포함하지 않기 때문이다. 따라서 도 7a에 나타낸 바와 같이 재조합 벡터(pJG/αMHC-miR-1_G7T)를 제작한 다음 프로모터와 284염기 사이즈인 miR-1_G7T, 인간 성장호르몬 비전역 부위를 포함하는 약 6kb의 발현 카세트를 재조합 벡터에 포함된 제한효소인 BamHI을 통해 선형(linear)으로 잘라내었다. 이 선형의 발현 카세트(linear cassette)에 포함된 인간 성장호르몬 비전역 부위에 특이적으로 결합하는 프라이머를 통해 약 155개의 염기서열을 중합효소 연쇄반응 반응으로 얻어 그 밴드를 아가로우즈 젤에 전기영동하여 확인하였으며, 이를 도 7c에 나타내었다. 이를 통해 재조합 벡터(pJG/αMHC-miR-1_G7T)로 형질전환이 된 마우스는 인간 성장호르몬 비전역 부위(human growth hormone poly A) 특이적 155 염기배열밴드 확인을 통해 효과적으로 스크리닝할 수 있음을 확인하였다.
또한, 약 6kb의 선형 발현 카세트(linear cassette)를 잘라내어 수정란의 전핵(pronuclei)에 마이크로 주입(microinjection)한 다음, 이를 대리모 마우스에 이식하였다. 이후 형질 전환이 된 마우스를 상기 스크리닝 프라이머를 통해 중합효소 연쇄반응하여 선택한 결과, 도 7d에 나타낸 바와 같이 12마리 중 2마리의 유전체에서 155 염기서열 밴드를 확인할 수 있었으며, 총 9마리의 형질전환 마우스(founder)에서 인간 성장호르몬 비전역 부위(human growth hormone poly A)에 특이적인 155 염기배열밴드를 확인하였다. 이를 바탕으로 심장 특이적으로 miR-1_G7T핵산이 발현되는 형질전환 마우스를 제조하였다.
실시예 8. 심장 특이적으로 발현되는 miR -1_ G7T로 형질전환된 마우스의 심비대증 유도 효과 확인
상기 실시예 7에서 기술한 총 9마리의 형질전환 마우스(founder) 중에서 약 44%에 해당되는 4마리의 형질전환 마우스(founder)가 생후 56~73 day 사이에 죽는 것을 관찰할 수 있었다. 사인은 알 수 없으나 회수된 사체에서 심장 조직을 관찰한 결과, 도 8a에 나타낸 바와 같이, 흉곽(rib cage) 안쪽에 꽉 찬 심장을 관찰하였으며(도 8a의 왼쪽), 이를 정강뼈(tibia) 길이로 정규화(normalization)하여 심장 무게와 정강뼈(tibia) 길이 ratio (HW/TL)를 비교했을 때, 도 8b 및 8c에 나타낸 바와 같이 비숫한 연령대의 자연상태의 마우스 10마리에서 얻은 심장 무게와 정강뼈 길이 비율(ratio) (HW/TL)에 비해 약 2배 정도 커진 것으로 정량분석 되었다.
또한, 심장 형태상으로도 좌심실벽(left ventricular wall)의 비대와 함께, 특이적으로 우심실(right ventricle)의 경우 정상적인 심장 구조와는 달리 상당히 비대해진 것을 육안으로도 확인할 수 있었으며, 이는 체순환과 더불어 폐순환의 장애 및 폐고혈압과 같은 병리적 증후가 있었을 것으로 추정되었다(도 8a의 가운데, 오른쪽).
총 9마리의 형질전환 마우스(founder)에 대하여 현재까지의 생존 여부를 관찰하여 본 결과, 도 8d에 나타낸 바와 같이 생후 약 2개월의 연령에서 4마리가 사망하여 약 56%의 생존율을 보였다.
또한, 이렇게 miR-1의 7번째 구아닌을 유라실로 치환하여 G:A 워블 배열 표적을 억제하게 만든 변형 miR-1_G7T를 심장 조직 특이적으로 발현시키는 벡터(도 9a 왼쪽 도면)로 형질전환시킨 마우스를 제작하였고, 해당 형질전환 마우스의 세대를 유지하면서 그 다음 세대인 F1에서도 2종류의 다른 부모 개체(founder)에서 온 마우스 모두 심근 비대가 유도됨을 관찰하였으며(도 9a 오른쪽 도면), HW/TL (heart weight/tibia length) 및 HW/BW (heart weight/body weight) 비율(ratio) 측정값(도 9b-c)에서도 차이를 확인하였다.
최종적으로, 상기 실시예를 통해 생후 심장 조직 특이적으로 miR-1의 7번째 G:A 배열 발단 타겟 유전자 조절 핵산(miR-1_G7T)을 과발현한 형질전환 마우스는 개체수준에서 심장 비대가 유도되는 것을 관찰할 수 있었으며, 이는 궁극적으로 심장 비대 동물 모델로 사용될 수 있음을 확인하였다.
전술한 본 발명의 설명은 예시를 위한 것이며, 본 발명이 속하는 기술분야의 통상의 지식을 가진 자는 본 발명의 기술적 사상이나 필수적인 특징을 변경하지 않고서 다른 구체적인 형태로 쉽게 변형이 가능하다는 것을 이해할 수 있을 것이다. 그러므로 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적이 아닌 것으로 이해해야 한다.
본 발명에 따른 재조합 벡터를 마우스의 심근 세포에 특이적으로 발현시킬 경우, 마이크로RNA의 비정규 G:A 워블 염기 배열 표적 사이트만을 인식하여 억제함으로써 심근 세포의 크기가 증가하는 생물학적 기능이 나타나고, 이로 인해 심비대증이 유도되는바, 심비대증이 유도된 동물 모델을 제조하여 개체 수준에 있어서 심비대증을 포함한 심장 질환의 진행 경과 및 병리, 생리학적 기전 연구에 유용하게 이용할 수 있을 것으로 기대된다.

Claims (13)

  1. 서열번호 1의 염기서열로 표시되는 유전자의 5' 말단 기준 2번 내지 3번 중 어느 하나의 뉴클레오타이드에서 시작하여 총 6개의 연속된 폴리뉴클레오타이드를 포함하고, 상기 서열번호 1의 염기서열 중 2번, 3번 또는 7번 중 하나 이상의 뉴클레오타이드가 구아닌(Guanine; G)에서 유라실(Uracil; U)로 치환된 폴리뉴클레오타이드를 포함하는 RNA 간섭 유도 핵산을 발현하는 것을 특징으로 하는, 심비대증 동물 모델 제작용 재조합 벡터.
  2. 제1항에 있어서,
    상기 폴리뉴클레오타이드는 다음 그룹의 폴리뉴클레오타이드에서 선택되는 것을 특징으로 하는, 재조합 벡터:
    서열번호 2의 염기서열로 표시되는 폴리뉴클레오타이드(5'-UGAAUG-3'); 서열번호 3의 염기서열로 표시되는 폴리뉴클레오타이드(5'-GUAAUG-3'); 서열번호 4의 염기서열로 표시되는 폴리뉴클레오타이드(5'-GGAAUU-3'); 서열번호 5의 염기서열로 표시되는 폴리뉴클레오타이드(5'-UAAUGU-3'); 또는 서열번호 6의 염기서열로 표시되는 폴리뉴클레오타이드(5'-GAAUUU-3').
  3. 제2항에 있어서,
    상기 재조합 벡터는 상기 폴리뉴클레오타이드 5' 말단의 1번째 뉴클레오타이드 앞에 아데닌(Adenine; A)으로 치환된 염기서열을 포함하는 것을 특징으로 하는, 재조합 벡터.
  4. 제 1항에 있어서,
    상기 재조합 벡터는 다음 그룹의 RNA 간섭 유도 핵산 중 어느 하나를 발현하는 것을 특징으로 하는, 재조합 벡터:
    서열번호 7의 염기서열로 표시되는 RNA 간섭 유도 핵산 (5'-UUG AAU GUA AAG AAG UAU GUA U-3');
    서열번호 8의 염기서열로 표시되는 RNA 간섭 유도 핵산 (5'- UGU AAU GUA AAG AAG UAU GUA U-3');
    서열번호 9의 염기서열로 표시되는 RNA 간섭 유도 핵산 (5'- UGG AAU UUA AAG AAG UAU GUA U-3');
    서열번호 10의 염기서열로 표시되는 RNA 간섭 유도 핵산 (5'-AUG AAU GAC UGC CGG UUG UUA UG-3');
    서열번호 11의 염기서열로 표시되는 RNA 간섭 유도 핵산 (5'-AGU AAU GAC UGC CGG UUG UUA UG-3');
    서열번호 12의 염기서열로 표시되는 RNA 간섭 유도 핵산 (5'-AGG AAU UAC UGC CGG UUG UUA UG-3');
    서열번호 13의 염기서열로 표시되는 RNA 간섭 유도 핵산 (5'-AUA AUG UAC UGC CGG UUG UUA UG-3'); 또는
    서열번호 14의 염기서열로 표시되는 RNA 간섭 유도 핵산 (5'-AGA AUU UAC UGC CGG UUG UUA UG-3').
  5. 제1항에 있어서,
    상기 서열번호 1의 염기서열로 표시되는 유전자는 miR-1인 것을 특징으로 하는, 재조합 벡터.
  6. 제1항에 있어서,
    상기 폴리뉴클레오타이드는 G:A 워블(wobble) 배열이 일어나는 표적 사이트를 인식하는 폴리뉴클레오타이드인 것을 특징으로 하는, 재조합 벡터.
  7. 제1항에 있어서,
    상기 재조합 벡터는 알파MHC(αMHC) 프로모터, 베타 MHC(β MHC) 프로모터, Nkx2.5 프로모터, 심근 트로포닌 T(cardiac troponin T; TNNT2) 프로모터, 근육 크레아틴 키나아제(muscle creatine kinase; MCK) 프로모터, 인간 알파-골격 액틴(human α-skeletal actin; HAS) 프로모터, 및 뮤린 줄기세포 바이러스(murine stem cell virus; MSCV) 프로모터로 이루어진 군으로부터 선택된 프로모터가 작동 가능하게 연결된 것을 특징으로 하는, 재조합 벡터.
  8. 제1항에 있어서,
    상기 심비대증은 심장비대증, 심부전증, 심섬유증(cardiac fibrosis), 승모판막 폐쇄부전증, 대동맥판막 폐쇄부전증, 확장성 심근병증, 허혈성 심장 질환, 심실 중격 결손증, 삼첨판막 폐쇄부전증, 폐동맥판막 폐쇄부전증, 폐동맥 고혈압, 우심실 심근경색, 우심실을 침범하는 심근병증, 심방중격 결손증, 심방 세동, 비후성 심근증 또는 침윤성 심근증의 초기증상인 것을 특징으로 하는, 재조합 벡터.
  9. 제1항에 있어서,
    상기 동물은 인간을 제외한 포유류인 것을 특징으로 하는, 재조합 벡터.
  10. 제9항에 있어서,
    상기 동물은 마우스인 것을 특징으로 하는, 재조합 벡터.
  11. 제1항 내지 제10항 중 어느 한 항의 재조합 벡터로 형질전환된 것을 특징으로 하는, 심비대증 동물 모델.
  12. (a) 서열번호 1의 염기서열로 표시되는 유전자의 5' 말단 기준 2번 내지 3번 중 어느 하나의 뉴클레오타이드에서 시작하여 총 6개의 연속된 뉴클레오타이드를 포함하고, 상기 서열번호 1의 염기서열 중 2번, 3번 또는 7번 중 하나 이상의 뉴클레오타이드가 구아닌(Guanine; G)에서 유라실(Uracil; U)로 치환된 폴리뉴클레오타이드를 발현하는 DNA를 프로모터에 작동 가능하게 연결하여 심비대증 동물 모델 제작용 재조합 벡터를 제조하는 단계;
    (b) 상기 재조합 벡터를 동물의 수정란에 도입시키는 단계; 및
    (c) 상기 수정란을 대리모에 이식한 후 수정란을 발생시켜 형질전환 동물 모델을 수득하는 단계를 포함하는, 심비대증 동물 모델의 제작 방법.
  13. (a) 심비대증 동물 모델의 심근 세포에 후보물질을 처리하는 단계;
    (b) 상기 심비대증 동물 모델의 심근 세포에서 서열번호 1의 염기서열로 표시되는 유전자의 5' 말단 기준 2번 내지 3번 중 어느 하나의 뉴클레오타이드에서 시작하여 총 6개의 연속된 폴리뉴클레오타이드를 포함하고, 상기 서열번호 1의 염기서열 중 2번, 3번, 또는 7번 중 하나 이상의 뉴클레오타이드가 구아닌(Guanine; G)에서 유라실(Uracil; U)로 치환된 폴리뉴클레오타이드의 G:A 워블(wobble) 배열 표적 사이트와의 결합 빈도를 분석하는 단계; 및
    (c) 상기 G:A 워블 배열 표적 사이트와의 결합이 후보물질을 처리하지 않은 심비대증 동물 모델에 비해 감소할 경우, 상기 후보물질을 심비대증 치료제로 선별하는 단계를 포함하는, 심비대증 치료제의 스크리닝 방법.
PCT/KR2019/014133 2018-10-26 2019-10-25 심비대증 동물 모델 제작용 재조합 벡터, 상기 재조합 벡터로 형질전환된 심비대증 동물 모델 및 이의 제작 방법 WO2020085838A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020180129360A KR102634017B1 (ko) 2018-10-26 2018-10-26 심비대증 동물 모델 제작용 재조합 벡터, 상기 재조합 벡터로 형질전환된 심비대증 동물 모델 및 이의 제작 방법
KR10-2018-0129360 2018-10-26

Publications (1)

Publication Number Publication Date
WO2020085838A1 true WO2020085838A1 (ko) 2020-04-30

Family

ID=70330522

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2019/014133 WO2020085838A1 (ko) 2018-10-26 2019-10-25 심비대증 동물 모델 제작용 재조합 벡터, 상기 재조합 벡터로 형질전환된 심비대증 동물 모델 및 이의 제작 방법

Country Status (2)

Country Link
KR (1) KR102634017B1 (ko)
WO (1) WO2020085838A1 (ko)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6201165B1 (en) * 1997-10-16 2001-03-13 Board Of Regents, University Of Texas System Transgenic animal models for cardiac hypertrophy and methods of use thereof
KR20180103258A (ko) * 2017-03-09 2018-09-19 고려대학교 산학협력단 우울증 예방 또는 치료를 위한 콜린성 유전자의 용도

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101481007B1 (ko) 2012-07-19 2015-01-14 전남대학교산학협력단 심장 비대 억제 조성물 및 이를 포함하는 심장비대증 치료제

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6201165B1 (en) * 1997-10-16 2001-03-13 Board Of Regents, University Of Texas System Transgenic animal models for cardiac hypertrophy and methods of use thereof
KR20180103258A (ko) * 2017-03-09 2018-09-19 고려대학교 산학협력단 우울증 예방 또는 치료를 위한 콜린성 유전자의 용도

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
BRANCATI, G.: "An interplay of miRNA abundance and target site architecture determines miRNA activity and specificity", NUCLEIC ACIDS RESEARCH, 21 March 2018 (2018-03-21), pages 3259 - 3269 *
CALLIS, T. E.: "MicroRNA-208a is a regulator of cardiac hypertrophy and conduction in mice", THE JOURNAL OF CLINICAL INVESTIGATION, vol. 11 9, no. 9, September 2009 (2009-09-01), pages 2772 - 2786, XP055090003, DOI: 10.1172/JCI36154 *
DONG, D.: "Role of microRNAs in cardiac hypertrophy, myocardial fibrosis and heart failure", ACTA PHARMACEUTICA SINICA B, vol. 1, no. 1, 1 June 2011 (2011-06-01), pages 1 - 7, XP055708756 *
WANG, J.: "Overview of microRNAs in cardiac hypertrophy, fibrosis, and apoptosis", INTERNATIONAL JOURNAL OF MOLECULAR SCIENCES, vol. 17, no. 5, 18 May 2016 (2016-05-18), pages 749, XP055708754 *

Also Published As

Publication number Publication date
KR20200047207A (ko) 2020-05-07
KR102634017B1 (ko) 2024-02-05

Similar Documents

Publication Publication Date Title
Coccia et al. Regulation and expression of a growth arrest-specific gene (gas5) during growth, differentiation, and development
Bucher et al. Expression of the troponin complex genes: transcriptional coactivation during myoblast differentiation and independent control in heart and skeletal muscles
JP4371812B2 (ja) マイクロｒｎａ分子
Sprenkle et al. Involvement of multiple cis elements in basal-and α-adrenergic agonist–inducible atrial natriuretic factor transcription: roles for serum response elements and an SP-1–like element
Xu et al. Specific arrest of cardiogenesis in cultured embryonic stem cells lacking Cripto-1
Gavis et al. Identification ofcis-Acting Sequences That ControlnanosRNA Localization
Kawano et al. Identification and characterization of novel developmentally regulated neural-specific proteins, BRINP family
Payne et al. A critical role for the chromatin remodeller CHD7 in anterior mesoderm during cardiovascular development
Tiecke et al. Expression of the short stature homeobox gene Shox is restricted by proximal and distal signals in chick limb buds and affects the length of skeletal elements
Ladd New insights into the role of RNA-binding proteins in the regulation of heart development
Nurminskaya et al. Differential expression of genes associated with collagen fibril growth in the chicken tendon: identification of structural and regulatory genes by subtractive hybridization
EP2169059A1 (en) Means and methods for counteracting, preventing and/or determining fibrosis or a risk of fibrosis
WO2020085838A1 (ko) 심비대증 동물 모델 제작용 재조합 벡터, 상기 재조합 벡터로 형질전환된 심비대증 동물 모델 및 이의 제작 방법
Sugahara et al. Two types of albino mutants in desert and migratory locusts are caused by gene defects in the same signaling pathway
WO2009151304A2 (ko) 에이케이에이피일이를 함유하는 조성물 및 동물 모델로서 에이케이에이피일이 돌연변이 제브라피쉬의 용도
Smith et al. The MLC1v gene provides a transgenic marker of myocardium formation within developing chambers of the Xenopus heart
Chaudhari et al. The muscular dysgenesis mutation in mice leads to arrest of the genetic program for muscle differentiation
Miller et al. Prediction and characterisation of a highly conserved, remote and cAMP responsive enhancer that regulates Msx1 gene expression in cardiac neural crest and outflow tract
WO2019231299A1 (ko) 마이크로rna를 억제하는 변형 핵산 및 이의 용도
Motohashi et al. A core region of the mafK gene IN promoter directs neurone‐specific transcription in vivo
US20240287508A1 (en) Modified filamins and their uses
WO2022145949A2 (ko) Tead4억제제를 포함하는 대장암 예방 또는 치료용 조성물
Dzudzor et al. Regulated expression of the Ras effector Rin1 in forebrain neurons
Camp The Known MyoD Enhancers are Largely Dispensable for Proper Embryonic Expression and Cells of the MyoD Expressing Lineage are Multipotent in the Trunk but Not the Limbs of Amyogenic Embryos
EP4100423A1 (en) Modified filamins and their uses

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 19875831

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 19875831

Country of ref document: EP

Kind code of ref document: A1