WO2020080941A1 - Anticorps anti-protéine 5/6 associée au récepteur de lipoprotéines de faible densité - Google Patents

Anticorps anti-protéine 5/6 associée au récepteur de lipoprotéines de faible densité Download PDF

Info

Publication number
WO2020080941A1
WO2020080941A1 PCT/NL2019/050683 NL2019050683W WO2020080941A1 WO 2020080941 A1 WO2020080941 A1 WO 2020080941A1 NL 2019050683 W NL2019050683 W NL 2019050683W WO 2020080941 A1 WO2020080941 A1 WO 2020080941A1
Authority
WO
WIPO (PCT)
Prior art keywords
antibody
vhh
lrp5
wnt
cell
Prior art date
Application number
PCT/NL2019/050683
Other languages
English (en)
Inventor
Nicola FENDERICO
Madelon Maria MAURICE
Michael Goldflam
Christopher Ullman
Original Assignee
Umc Utrecht Holding B.V.
Isogenica Limited
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Umc Utrecht Holding B.V., Isogenica Limited filed Critical Umc Utrecht Holding B.V.
Publication of WO2020080941A1 publication Critical patent/WO2020080941A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/20—Immunoglobulins specific features characterized by taxonomic origin
    • C07K2317/22—Immunoglobulins specific features characterized by taxonomic origin from camelids, e.g. camel, llama or dromedary
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/30—Immunoglobulins specific features characterized by aspects of specificity or valency
    • C07K2317/33—Crossreactivity, e.g. for species or epitope, or lack of said crossreactivity
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
    • C07K2317/569—Single domain, e.g. dAb, sdAb, VHH, VNAR or nanobody®
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/76—Antagonist effect on antigen, e.g. neutralization or inhibition of binding

Definitions

  • the invention relates to antibodies for use in the treatment of a wnt3/3a-dependent cancer.
  • the invention relates to single domain VHH antibodies that target a surface of the third propeller domain of low-density lipoprotein receptor-related protein 5 and 6.
  • Wingless/Int-1 (Wnt)/b-catenin signaling is a critical driver of stem cell self renewal and cell fate specification during development and adult tissue
  • Wnt/b-catenin signaling is initiated by binding of Wnt proteins to members of the Frizzled (FZD) receptor family and their co-receptors low-density lipoprotein receptor-related protein 5 or 6 (LRP5/6) (Janda et al.,
  • Wnt-mediated receptor activation inhibits proteolytic turnover of b-catenin by the destruction complex, a multiprotein assembly composed of the scaffold proteins AXIN and Adenomatous Polyposis Coli (APC) and kinases GSK3 B and CK1 (van Kappel and Maurice, 2017. Br J Pharmacol 174: 4575-4588.
  • APC AXIN and Adenomatous Polyposis Coli
  • GSK3 B and CK1 van Kappel and Maurice, 2017. Br J Pharmacol 174: 4575-4588.
  • b-catenin accumulates, migrates to the nucleus and drives transcription of Wnt target genes (MacDonald and He, 2012. Cold Spring Harb Perspect Biol 4: pii: a007880; Niehrs, 2012. Nat Rev Mol Cell Biol 13: 767- 779).
  • Wnt-mediated cellular responses are balanced by negative regulatory feedback components such as the membrane-bound PA RING ubiquitin ligases RNF43 and ZNRF3 that mediate internalization and lysosomal degradation of FZD receptors (Koo et al., 2912. Nature 488: 665-669; Hao et al., 2012. Nature 485: 195-200.
  • Wnt signals are locally kept elevated by secreted R-spondin (Rspo) proteins that bind Lgr4/5/6 receptors to capture and neutralize RNF43/ZNRF3 activity (de Lau et al., Nature 476: 293-297; Cannon et al., 2011. Proc Natl Acad Sci U S A 108: 11452-11457; Glinka et al., 2011. EMBO Rep 12: 1055-1061; Koo and Clevers, 2014.
  • Porcupine an essential acyltransferase in Wnt secretion
  • Wnt-dependent tumors Zhang and Lum, 2018. Prog Mol Biol Transl Sci 153: 245-269.
  • Porcupine inhibitors block both b-catenin-dependent and - independent Wnt signaling pathways and thus might cause major side effects, as exemplified by treatment-induced defects in bone turnover (Zhong et al., 2014. Wiley Interdiscip Rev Dev Biol 3: 489-500).
  • depletion of a single Wnt
  • LRP6 A key mediator of b-catenin- dependent Wnt signaling is the type I single-pass co-receptor LRP6 (Niehrs, 2012. Nat Rev Mol Cell Biol 13: 767-779; MacDonald et al., 2011. PLoS One 6: e23537).
  • the extracellular region of LRP6 comprises four YWTD-b-propeller-EGF domain modules (P1E1, P2E2, P3E3 and P4E4) and an LDLR-repeat domain preceding its transmembrane helix.
  • the b-propeller-EGF modules harbor two independent Wnt binding sites.
  • the first site located within the N-terminal P1E1P2E2 domains, binds Wntl, Wnt2, Wnt2b, Wnt.6, Wnt8a, Wnt9a, Wnt9b and WntlOb (site 1); while the second site, located within
  • P3E3P4E4 binds Wnt3 and Wnt3a (site 2) (Bourhis et al., 2010. J Biol Chem 285: 9172-9179; Gong et al., 2010. PLoS One 5: el2682; Itasaki et al., 2003.
  • the invention provides an antibody that binds low-density lipoprotein receptor-related protein 5 and 6 (LRP5/6), and inhibits wingless/int-1 (wnt) 3/3a- dependent b-catenin signaling.
  • Said antibody preferably binds to a third YWTD-b- propeller-EGF domain module, termed P3E3, of LRP5/6.
  • P3E3 YWTD-b- propeller-EGF domain module
  • a preferred antibody of the invention comprises heavy chain CDR1, CDR2 and CDR3 amino acid sequences as depicted in Table 1.
  • Said antibody preferably is a single heavy chain variable domain antibody (VHH), preferably comprising heavy chain amino acid sequences as depicted in Table 1.
  • VHH variable domain antibody
  • An antibody of the invention preferably is humanized. Examples of humanized heavy chain amino acid sequences are depicted in Table 5. Said antibody preferably is modified to extend its half-life. For this, said antibody may be fused to an immunoglobulin Fc region or functional part thereof, preferably derived from IgG1, IgG2, IgG3, or IgG4, more preferably derived from IgG1. Said Fc region or functional part thereof preferably is human or a humanized Fc, or functional part thereof.
  • said antibody may be linked, chemically or otherwise, to one or more groups or moieties in order to extend the half-life of the antibody.
  • groups or moieties include PolyEthlene Glycol (PEG), recombinant PEG mimetic peptides, hydroxyethyl starch, polysialic acid and serum albumin, preferably human serum albumin (HSA).
  • the invention further provides an antibody that effectively competes with an antibody of the invention for binding to the epitope on a surface of the third propeller domain of LRP5/6 and inhibits wnt 3/3a-dependent b-catenin signaling.
  • the invention provides a bi- or multi-specific antibody comprising an antibody of the invention.
  • the invention further provides a nucleic acid encoding an antibody of the invention.
  • the invention further provides a method for producing an antibody of the invention, the method comprising expressing the nucleic acid of the invention in a relevant cell and recovering the thus produced antibody from the cell.
  • the invention further provides the antibody of the invention for use as a medicament, preferably for use in a method for treatment of an epithelial cancer, preferably a colorectal cancer.
  • said use in a method for treatment may additionally comprise the administration of at least one
  • said use in a method for treatment further comprises 5-fluorouracil, leucovorin, and oxaliplatin.
  • the invention further provides a pharmaceutical composition comprising an antibody as claimed.
  • VHHs targeting LRP6P3E3P4E4 block cellular responses to Wnt3a.
  • Graphs show average (bars) and range (dots) of luciferase activity in duplicate cell cultures transfected in parallel.
  • Wnt luciferase reporter assay performed in HEK293T cells treated with 5 mM CHIR-99021 and 10 mM of the indicated anti-LRP6P3E3P4E4 VHHs.
  • Graph shows average (bars) and range (dots) of luciferase activity in duplicate cell cultures transfected in parallel d) Wnt luciferase reporter assay performed in LRP6-/- HEK293T cells. Wnt pathway activation achieved upon LRP5 overexpression is counteracted by anti- LRP5/6P3E3P4E4 VHHs.
  • Graph shows average (bars) and range (dots) of luciferase activity in duplicate cell cultures transfected in parallel e) Western blot showing inhibition of Wnt3a-induced LRP6 phosphorylation (pLRP6) by the different anti-LRP5/6P3E3P4E4 VHHs.
  • pLRP6 phosphorylation pLRP6 phosphorylation
  • Top panels Schematic representation of the growth conditions, associated phenotypes and experimental set up.
  • Bottom panels anti-LRP5/6P3E3P4E4 VHHs induce death of Wnt,3a-treated wild type (WT) intestinal organoids. Organoids were cultured in WENR and treated with 10 mM of the indicated anti-LRP5/6P3E3P4E4 VHHs for 4 d (Scale bar, 400 mm).
  • Anti-LRP5/6P3E3P4E4 VHHs halt tumorigenic R/Z mutant organoid growth by driving collective differentiation a) Anti-LRP5/6P3E3P4E4 VHHs block tumorigenic R/Z mutant organoid growth. Organoids were cultured in EN and treated with 10 mM of the indicated anti-LRP5/6P3E3P4E4 VHHs for 4 d (Scale bar, 400 pm) b) anti-LRP5/6P3E3P4E4 VHHs strongly diminish cell viability of tumorigenic R/Z mutant organoids.
  • Organoids were cultured in EN and treated with 10 mM of the indicated anti-LRP5/6P3E3P4E4 VHHs for 4 d.
  • antibody refers to an antigen binding protein comprising at least a heavy chain variable region (Vh) that binds to a target epitope.
  • Vh heavy chain variable region
  • the term antibody includes monoclonal antibodies comprising
  • immunoglobulin heavy and light chain molecules single heavy chain variable domain antibodies, and variants and derivatives thereof, including scFv, tandem scFv, scFab, and improved scFab (Koerber et al., 2015. J Mol Biol 427: 576-86), chimeric variants of monoclonal and single heavy chain variable domain antibodies.
  • the term also includes antibody mimetics such as a designed ankyrin repeat protein (i.e. DARPIN), a binding protein that is based on a Z domain of protein A, a binding protein that is based on a fibronectin type III domain (i.e. Centyrin), engineered lipocalin (i.e.
  • VHH refers to single heavy chain variable domain antibodies devoid of light chains.
  • a VHH is an antibody of the type that can be found in Camelidae which are naturally devoid of light chains, or a synthetic and non immunized VHH which can be constructed accordingly.
  • Lamalidae includes reference to Llamas such as, for example, Lamaglama, Lama vicugna ( Vicugna vicugna) and Lama pacos (Vicugna pacos), and to Camelus species including, for example, Camelus dromedarius and Camelus bactrianus).
  • the amino acid sequence and structure of a heavy chain variable domain can he considered - without however being limited thereto - to be comprised of four framework regions or‘FR', which are referred to in the art and herein as‘Framework region 1’ or‘FRT; as‘Framework region 2’ or FR2’; as‘Framework region 3’ or‘FR3’; and as‘Framework region 4’ or ‘FR4’, respectively; which framework regions are interrupted by three
  • CDRs complementary determining regions or CDRs, which are referred to in the art as ‘Complementarity Determining Region l' or‘CDRl'; as‘Complementarity
  • amino acid residues of heavy chain variable regions are numbered according to the general numbering of Kabat (Rabat, et al. (1991) Sequences of Proteins of Immunological Interest, 5th edition. Public Health Service, NIH, Bethesda, MD).
  • amino acid residues 26-32 of VHH are defined as CDR1
  • amino acid residues 52-58 of VHH are defined as CDR2
  • amino acid residues 95-103 of VHH are defined as CDR3, with the amino acid residue numbering according to the Kabat numbering.
  • VHH antibody refers to an antibody that comprises at least one single heavy chain variable domain.
  • said VHH antibody may comprise camelid or humanized amino acid sequences and may be coupled, for example, to human or humanized Fc regions.
  • binding refers to the process of a non-covalent interaction between molecules.
  • said binding is specific.
  • the terms‘specific’ or‘specificity’ or grammatical variations thereof refer to the number of different types of antigens or their epitopes to which a particular antibody such as a VHH can bind.
  • the specificity of an antibody can be determined based on affinity.
  • a specific antibody preferably has a binding affinity K d for its epitope of less than 10 -7 M, preferably less than 10 -8 M, most preferable less than 10 -9 M.
  • LRP5 refers to a low-density lipoprotein receptor-related protein 5 that is encoded by the LRP5 gene.
  • the gene is known as Ensembl: ENSG00000162337, Entrez Gene: 4041 and UmProtKB: 075197.
  • LRP5 protein has four b-propeller domains (P domains) at the amino terminal end that alternate with four epidermal growth factor-like repeats.
  • P3 domain The amino acid sequence of the third propeller domain (P3 domain) of LRP5 is depicted in Table 2.
  • LRP5 protein participates in the Wnt signaling pathway, which is important for cell division (proliferation), attachment of cells to one another (adhesion), cell movement (migration), and cell differentiation.
  • LRP6 refers to a low-density lipoprotein receptor-related protein 6 that is encoded by the LRP6 gene.
  • the gene is known as Ensembl: ENSG00000070018, Entrez Gene: 4040 and UmProtKB: 075581.
  • LRP6 protein has four b-propeller domains (P domains) at the amino terminal end that alternate with four epidermal growth factor-like repeats.
  • P domains b-propeller domains
  • the amino acid sequence of the P3 domain of LRP6 is depicted in Table 2. Similar to the LRP5 protein, also the LRP6 protein participates in the Wnt signaling pathway, which is important for cell division (proliferation), attachment of cells to one another (adhesion), cell movement (migration), and cell differentiation.
  • Wingless/integrated- 1 or int.-l (Wnt) proteins are secreted glycoproteins and comprise a total of nineteen proteins in humans. Wnt proteins are ligands for Frizzled- LRP5/6 co-receptors, whereby binding is controlled by a number of secreted Wnt antagonists.
  • a canonical signal transduction pathway involves the cytoplasmic phosphoprotein Dishevelled, Axin, adenomatosis polyposis coli (APC), protein phosphatase 2A (PP2A), glycogen synthase kinase 3 (GSK3) and casein kinase 1a (CK1a), and results in either proteolytic destruction of a protein termed b-catenin, or nuclear translocation of b-catenin and complexation of b-catenin with Lef/Tef family members to mediate transcriptional induction of target genes.
  • APC cytoplasmic phosphoprotein Dishevelled, Axin, adenomatosis polyposis coli
  • P2A protein phosphatase 2A
  • GSK3 glycogen synthase kinase 3
  • CK1a casein kinase 1a
  • epitope or antigenic determinant refers to a part of an antigen that is recognized by an antibody.
  • epitope includes linear epitopes and conformational epitopes.
  • a conformational epitope is based on 3-dimensional surface features of the antigen such as shape and/or tertiary structure of the antigen.
  • affinity refers to the strength of a binding reaction between a binding domain of an antibody and an epitope. It is the sum of the attractive and repulsive forces operating between the binding domain and the epitope.
  • affinity refers to the dissociation constant, Kd.
  • strong interaction and“strong binding” refers to electrostatic interactions as is known to the skilled person.
  • the invention provides an antibody that binds low-density lipoprotein receptor-related protein 5 and 6 (LRP5/6), and inhibits wingless/int-1 (wnt) S/da- dependent b-catenin signaling.
  • Said antibody preferably is a single domain antibody, more preferably a small single domain antibody, such as a camelid VHH or a shark immunoglobulin- derived variable new antigen receptor (VNAR).
  • VHH single-domain antibody fragment
  • VHHs all bind a surface of the third propeller domain of LRP5/6 that is likely involved in Wnt3 binding.
  • treatment with anti-LRP6 VHHs induces strong growth inhibition of Wnt-hypersensitive intestinal organoids by driving collective terminal
  • VHHs that target Wnt- hypersensitive tumors.
  • VHH antibodies efficiently block Wnt3/3a-dependent 6-catenin signaling. All isolated VHH antibodies leave Wntl-mediated signaling responses unaffected.
  • the invention therefore provides an antibody, preferably a single heavy chain variable domain antibody (VHH) that binds low- density lipoprotein receptor- related protein 5 and 6 (LRP5/6), and inhibits wingless/int-1 (wnt) 3/3a-dependent b-catenin signaling.
  • VHH single heavy chain variable domain antibody
  • Preferred antibodies according to the invention bind to a third YWTD-b- propeller-EGF domain module, termed P3E3, of LRP5/6.
  • An antibody preferably a VHH antibody according to the invention, preferably comprises heavy chain CDR1, CDR2 and CDR3 amino acid sequences as depicted in Table 1, or a derivative, for example a derivative in which some amino acid residues have been exchanged for amino acid residues that have similar side groups.
  • Said CDR1, CDR2 and CDR3 amino acid sequences may be grafted onto framework regions of other single domain antibodies, such as a shark
  • VNAR immunoglobulin-derived variable new antigen receptor
  • scFv immunoglobulin-derived variable new antigen receptor
  • scFab immunoglobulin-derived variable new antigen receptor
  • a further preferred antibody comprises any one of the heavy chain variable domain amino acid sequences as depicted in Table 1 and/or Table 5, or a derivative, for example a conservative derivative, thereof.
  • a derivative preferably is more than 90% identical, more preferably more than 95% identical, more preferably more than 99% identical to the amino acid sequences depicted in Table 1.
  • Said derivative preferably has 10 or less conserved amino acid exchanges, such as 5 conserved amino acid exchanges, 4 conserved amino acid exchanges, 3 conserved amino acid exchanges, 2 conserved amino acid exchanges or 1 conserved amino acid exchange.
  • conserved derivatives include the substitution of one hydrophobic residue such as isoleucine, valine, leucine or methionine for another hydrophobic residue, or the substitution of one polar residue for another polar residue, such as the substitution of arginine for lysine, glutamic acid for aspartic acid, or glutamine for asparagine, and the like.
  • De-immunization is an approach to reduce the immunogenicity of a VHH antibody according to the invention. It involves the identification of linear T-cell epitopes in the antibody of interest, using bioinformatics, and their subsequent replacement by site-directed mutagenesis to non-immunogenic sequences or, preferably human sequences. Methods for de immunization are known in the art, for example from WO098/52976.
  • Various recombinant DNA-based approaches have been established that are aimed at increasing the content of amino acid residues in antibodies that also occur at the same or similar position in human antibodies while retaining the specificity and affinity of the parental non-human antibody.
  • Most preferred are amino acid residues that occur in antibodies as they are encoded by genomic germ line sequences.
  • Preferred examples of humanized heavy chain amino acid sequences are depicted in Table 5.
  • Preferred methods for humanizing antibodies include grafting of CDRs (Queen et al., 1989. PNAS 86: 10029; Carter et al., 1992. PNAS 89: 4285; resurfacing (Padlan et. al., 1991. Mol Immunol 28: 489; superhumanization (Tan et. al., 2002. J Immunol 169: 1119), human string content optimization (Lazar et al., 2007. Mol Immunol 44: 1986) and humaneering (Almagro et. al., 2008.
  • Humanization may also include the construction of chimeric antibodies, such as VHH-human chimeric antibodies, in which a VHH antibody is covalently attached, for example by amino acid bonds, to one or more human constant (C) regions.
  • VHH-human chimeric antibodies in which a VHH antibody is covalently attached, for example by amino acid bonds, to one or more human constant (C) regions.
  • Said antibody may further comprise means for eliminating cells carrying complexed LRP5/6 co-receptors on their surface via antibody-dependent cell- mediated cytotoxicity (ADCC) routes and/or complement dependent cytotoxicity (CDC) routes.
  • ADCC antibody-dependent cell- mediated cytotoxicity
  • CDC complement dependent cytotoxicity
  • a single heavy chain variable domain that binds LRP5/6 according to the invention preferably is combined with an immunoglobulin Fc region.
  • the Fc domain, also termed constant domain, of an antibody determines its binding properties to Fc gamma receptors (FcyR, FcR) and complement factors (Clq). Changing antibody subtype may therefore mediate downstream effector function.
  • human IgG1 displays high antibody dependent cell- mediated cytotoxicity (ADCC) and complement-dependent cytotoxicity (CDC), and is the most suitable subtype for cytotoxic therapeutic use. Where cytotoxicity is not desirable, IgC2 and IgG4 antibodies would be preferable.
  • an antibody preferably a VHH antibody according to the invention comprises an immunoglobulin Fc region or functional part thereof of an immunoglobulin heavy chain.
  • the Fc region or functional part thereof is preferably derived from IgG1, IgG2, IgG3, IgG4, IgM, IgD, IgA or IgE. It is further preferred that the Fc region or part thereof is a human or humanized Fc region or part thereof, for example a humanized camelid Fc region or part thereof.
  • a VHH antibody preferably is connected to a Fc region or functional part thereof via a hinge region.
  • a preferred hinge region is the hinge region of a camelid or human immunoglobulin heavy chain molecules from IgG1 , IgG2, IgG3, IgG4, IgM, IgD, IgA or IgE, most preferred from IgG1.
  • a hinge region of a camelid is the hinge region of a camelid or human immunoglobulin heavy chain molecules from IgG1 , IgG2, IgG3, IgG4, IgM, IgD, IgA or IgE, most preferred from IgG1.
  • immunoglobulin heavy chain molecule preferably is humanized.
  • a preferred part of a Fc region is the region comprising the CH2 domain, the CH3 domain, or the CH2 and CH3 domains of IgGs, preferably IgG1 or IgG3, most preferably CH2 and CH3 domains of human IgG1.
  • the constant region that is fused to an antibody of the invention preferably a VHH antibody, preferably comprises a dimerization or multimerization motif.
  • a hi- or multivalent antibody may he generated by chemical cross- linking or by a heterologous dimerization or multimerization domain comprising, for example, a leucine zipper or jun-fos interaction domain (Pack and Pliickthun, 1992. Biochemistry 31, 1579-1584; de Kruif and Logtenberg, 1996. JBC 271: 7630- 7634).
  • a further preferred antibody is a bi- or multivalent antibody comprising an anti- LRP5/6 antibody according to the invention, preferably an anti- LRP5/6 antibody.
  • Said bi- or multivalent antibody preferably is a bispecific or multispecific antibody comprising two or more antibodies. Said antibodies may be the same, or different recognizing the same or different epitopes on a LRP5/6 molecule.
  • Abi- or multivalent antibody preferably comprises two or more antibodies according to the invention. However, a antibody of the invention may be combined with other, preferably non-competing and non-interfering anti- LRP5/6 antibodies.
  • a further preferred bi- or multivalent antibody is a bihead or a multihead antibody, for example a trihead VHH, as described in W02000/024884.
  • the bihead or multihead antibodies preferably comprise a linking group which provides conformational flexibility so that each of the single heavy chain variable domains can interact with its epitope.
  • a preferred linker group is a linker polypeptide comprising from 1 to about 60 amino acid residues, preferably from 10 to about 40 amino acid residues, most preferred about 35 amino acid residues such as 30 amino acid residues, 31 amino acid residues, 32 amino acid residues, 33 amino acid residues, 34 amino acid residues, 35 amino acid residues, 36 amino acid residues,
  • Gly-Ser linkers for example of the type (Glyx Sery)z such as, for example, (Gly4 Ser)3, (Gly4 Ser)7 or (Gly3 Ser2)3, as described in WO 99/42077, and the GS30, GS15, GS9 and GS7 linkers described in, for example, WO 06/040153 and WO 06/122825, as well as hinge-like regions, such as the hinge regions of naturally occurring heavy chain antibodies or similar sequences (such as described in WO 94/04678).
  • an antibody according to the invention is preferably provided with means to extend the half life of the antibody after administration to a human individual.
  • a preferred multivalent antibody may comprise at least one anti-LRP5/6 antibody according to the invention and an antibody, preferably a single domain antibody such as a VHH that interacts with an abundant antigen, preferably an antibody such as a VHH directed against a serum protein.
  • an antibody such as a VHH may be used that is directed against, for example, serum albumin, preferably human serum albumin (HSA).
  • An antibody according to the invention may be linked, chemically or otherwise, to one or more groups or moieties that extend the half-life of the antibody.
  • groups or moieties include PolyEthlene Glycol (PEG), recombinant PEG mimetic peptides, hydroxyethyl starch, polysialic acid and serum albumin, preferably human serum albumin (HSA).
  • PEG PolyEthlene Glycol
  • HSA human serum albumin
  • an antibody that effectively competes with an anti-lrp5/6 antibody of the invention for binding to the epitope on a surface of the third propeller domain of LRP5/6 and inhibits wingless/int- 1 (wnt) 3/3a-dependent b- catenin signaling.
  • the term effectively is used to indicate that the competing antibody binds with substantially the same affinity, or higher affinity, to the epitope, when compared to the antibody of the invention.
  • the term substantially is used to indicate that the difference in affinity between an antibody of the invention and a competing antibody is preferably less than 10-fold, more preferred less than 5-fold, more preferred less than 2-fold, more preferred less than 1,5 fold.
  • the affinity of a competing antibody preferably is higher, preferably by a factor of 2, more preferred higher by a factor of 5, more preferred still higher by a factor or 10, when compared to the affinity of an antibody of the invention.
  • a preferred competing antibody is capable of effectively competing with an antibody of the invention when the competing antibody lowers the affinity of the observed binding of an antibody of the invention to its epitope about 2-fold using the same molar amount of competing antibody.
  • Assays for measuring competition are known in the art and include, for example, competitive ELISA.
  • An antibody as described may be produced using antibody producing prokaryotic cells or eukaryotic cells, preferably mammalian cells such as CHO cells or HEK cells, or fungi, most preferably filamentous fungi or yeasts such as
  • eukaryotic production system An advantage of a eukaryotic production system is that folding of the protein results in proteins that may be more suitable for treating a human individual. Moreover, eukaryotic cells often carry out desirable post translational modifications that resemble
  • Production of antibodies, especially of single domain antibodies such as VHH antibodies, in prokaryotic cells such as Escherichia coli, may be performed as described in Arbabi-Ghahroudi et al., 2005. Cancer Metastasis Rev 24: 501-519).
  • Production of antibodies such as VHH antibodies in bacteria such as E. coli can be performed by secretion of the antibody into the periplasmic space, or by expression in the reducing cytosol. The latter may require refolding of antibody fragments (Arbabi-Ghahroudi et al., 2005. Ibid.).
  • a further preferred method for production of therapeutic antibody comprises mammalian cells such as fibroblasts, Chinese hamster ovary cells, mouse cells, kidney cells, human retina cells, or derivatives of any of these cells.
  • a most preferred cell is a human cell such as, but not limited to, Hek293 and PER.C6.
  • a further preferred cell line is a cell line in which alpha-(l,6)-fucosyltransferase has been inactivated, for example the AFUT8 CHO cell line, as described in Yamane- Ohnuki et al., 2004. Biotechnol Bioeng 87: 614-622. It was found that antibodies that are produced in DFUT8 cells show enhanced cytotoxicity through the ADCC route.
  • An antibody according to the invention is preferably produced by the provision of a nucleic acid encoding said antibody to a cell of interest. Therefore, provided herein is a nucleic acid encoding an antibody, preferably a VHH antibody according to the invention.
  • Said nucleic acid, preferably DNA is preferably produced by recombinant technologies, including the use of polymerases, restriction enzymes, and ligases, from the constructs encoding the single heavy chain variable domains that were isolated from the immunized animal, as is known to a skilled person.
  • said nucleic acid is provided by artificial gene synthesis, for example by synthesis of partially or completely overlapping oligonucleotides, or by a combination of organic chemistry and recombinant technologies, as is known to the skilled person.
  • Said nucleic acid is preferably codon-optimized to enhance expression of the antibody in the selected cell or cell line. Further optimization preferably includes removal of cryptic splice sites, removal of cryptic polyA tails and/or removal of sequences that lead to unfavorable folding of the mRNA. The presence of an intron flanked by splice sites may encourage export from the nucleus in a eukaryotic producing cell.
  • the nucleic acid preferably encodes a protein export signal for secretion of the antibody out of the cell into the periplasm of prokaryotes or into the growth medium, allowing efficient purification of the antibody.
  • a vector comprising a nucleic acid encoding an antibody according to the invention.
  • Said vector preferably additionally comprises means for high expression levels such as strong promoters, for example of viral origin (e.g., human cytomegalovirus) or promoters derived from genes that are highly expressed in a cell such as a mammalian cell (Running Deer and Allison, 2004. Biotechnol Prog 20: 880-889; US patent No: 5888809).
  • the vectors preferably comprise selection systems such as, for example, expression of glutamine synthetase or expression of dihydrofolate reductase for amplification of the vector in a suitable recipient cell, as is known to the skilled person.
  • the invention further provides a method for producing an antibody, the method comprising expressing a nucleic acid encoding an antibody of the invention in a relevant cell and recovering the thus produced antibody from the cell.
  • the nucleic acid preferably a vector comprising the nucleic acid, is preferably provided to a cell by transfection or electroporation.
  • the nucleic acid is either transiently, or, preferably, stably provided to the cell. Methods for transfection or electroporation of cells with a nucleic acid are known to the skilled person.
  • a cell that expresses high amounts of the antibody may subsequently be selected. This cell is grown, for example in roller bottles, in fed-batch culture or continuous perfusion culture.
  • An intermediate production scale is provided by an expression system comprising disposable bags and which uses wave-induced agitation (Birch and Racher, 2006. Advanced Drug Delivery Reviews 58: 671- 685).
  • Methods for purification of antibodies are known in the art and are generally based on chromatography, such as protein A affinity and ion exchange, to remove contaminants. In addition to contaminants, it may also be necessary to remove undesirable derivatives of the product itself such as degradation products and aggregates. Suitable purification process steps are provided in Berthold and Walter, 1994. Biologicals 22: 135- 150.
  • a host cell comprising a nucleic acid or vector that encodes an antibody, preferably a VHH antibody according to the invention.
  • Said host cell may be grown or stored for future production of an antibody, preferably a VHH antibody according to the invention.
  • the invention further provides a product or composition comprising at least one anti-LRP5/6 antibody according to the invention.
  • the invention provides an antibody, preferably a VHH antibody, according to the invention for use as a medicament.
  • the antibodies of the invention may be used to delay tumor growth and/or enhance host antitumor immunity. It has been reported that loss of LRP5/6-mediated signaling in dendritic cells resulted in enhanced effector T cell differentiation and decreased regulatory T cell differentiation (Hong et al., 2015. Oncoimmunology 5: e!115941). Hence, blocking the Wnt pathway by one or more antibodies according to the invention may overcome tumor-mediated immune suppression and augment antitumor immunity.
  • the antibodies of the invention are preferably used for prophylactic administration or therapeutic administration in humans that are suffering from a Wnt3/3a- dependent cancer, or at risk of suffering from such cancer.
  • Said Wnt3/3a-dependent cancer may comprise mutations that impede or abolish negative signaling that normally control Wnt signaling activity.
  • negative signaling may be provided by mutations in, for example, AXIN,
  • Adenomatous Polyposis Coli APC and the kinases GSK3b and CK15, and/or mutations in negative regulatory feedback components such as the membrane- hound PA-RING ubiquitin ligases RNF43 and ZNRF3 that mediate internalization and lysosomal degradation of Frizzled receptors.
  • Said Wnt3/3a- dependent cancer may be selected from the group consisting of a cholangiocarcinoma, an esophageal cancer, a leukemia, a melanoma, a breast cancer, a prostate cancer, a pancreatic cancer, a lung cancer, a gastric cancer and a colorectal cancer.
  • said Wnt3/3a-dependent cancer is an epithelial cancer, preferably an esophageal cancer, a gastric cancer or a colorectal cancer.
  • an antibody preferably a VHH antibody, according to the invention may be administered to an individual in order to lessen signs and symptoms of said Wnt3/3a-dependent cancer in a human individual that is suffering from said cancer, or to reduce or prevent occurrence of said Wnt3/3a-dependent cancer in a human individual that is at risk of suffering from said cancer, for example a human individual that is known to have mutations in the adenomatous polyposis coli (APC) gene.
  • APC adenomatous polyposis coli
  • An antibody according to the invention preferably is used in a medicament for treatment of an individual suffering from a Wnt3/3a-dependent cancer such as an epithelial cancer.
  • an antibody according to the invention may comprise a radiolabel and/or a chemolabel for use as an antibody-drug conjugate (ADC).
  • ADC antibody-drug conjugate
  • Said therapeutic anti-LRP5/6 antibody may also he coupled to the human IgG1 Fc region, which can induce strong ADCC and CDC, when compared with the other heavy chain isotypes of a human antibody.
  • a therapeutic antibody with a human IgG1 Fc region in addition may have a long-term stability in blood, when compared to antibodies having Fc regions from other immunoglobulins.
  • said antibody may be linked, chemically or otherwise, to one or more groups or moieties in order to extend the half-life of the antibody.
  • Treatment of a human individual suffering from a Wnt3/3a-dependent cancer may inhibit tumor growth by promoting differentiation of cancer cells and loss of cancer stem-cell functioning.
  • An antibody preferably a VHH antibody of the invention may be
  • a human individual suffering from a Wnt3/3a-dependent cancer in combination with administration of at least one chemotherapeutic agent and/or at least one other antibody that is currently developed or used in cancer medicine.
  • the term“combination”, as is used herein, indicates that the antibody of the invention may be administered before, during, or after administration of said at least one chemotherapeutic agent and/or at least one other antibody. Combined administration of the antibody of the invention and the at least one
  • chemotherapeutic agent and/or at least one other antibody may indicate that the antibody of the invention and the at least one chemotherapeutic agent and/or at least one other antibody are administrated together in one dosage form, at the same time using at least two different dosage forms, or at different times using different dosage forms.
  • Said chemotherapeutic agent may comprise molecules for targeted therapy, such as an antibody or a recombinant protein that blocks growth and development of blood vessels, for example bevacizumab or a biosimilar thereof, ramucirumab, and/or Ziv-aflibercept, an antibody or a recombinant protein that inhibits cell growth, for example cetuximab and/or apanitumumab, and/or a small molecule kinase inhibitor such as regorafenib which targets angiogenic, stromal and oncogenic receptor tyrosine kinase.
  • molecules for targeted therapy such as an antibody or a recombinant protein that blocks growth and development of blood vessels, for example bevacizumab or a biosimilar thereof, ramucirumab, and/or Ziv-aflibercept, an antibody or a recombinant protein that inhibits cell growth, for example cetuximab and/or apanitumumab, and/
  • said chemotherapeutic agent may comprise an antimetabolite such as capecitabine, 5-fluorouracil, gemcitabine, a folic acid or folate analogue such as methotrexate, hydroxyurea, mercaptopurine, thioguanine and/or leucovorin, a DNA-damaging agent such as anthracyeline, caliche amicin, duocarmycin, and pyrrolobenzodiazepine, and/or an intercalating agent such as a platinum-based compound like cisplatin, carboplatin, nedaplatin, oxaliplatin and satraplatin.
  • an antimetabolite such as capecitabine, 5-fluorouracil, gemcitabine, a folic acid or folate analogue such as methotrexate, hydroxyurea, mercaptopurine, thioguanine and/or leucovorin
  • a DNA-damaging agent such as anthracyeline
  • a preferred combination comprises administration of a VHH antibody of the invention with 5-fluorouracil, leucovorin, and oxaliplatin.
  • a further preferred combination comprises administration of a VHH antibody of the invention with capecitabine and oxaliplatin. regimens are used most often, but some patients may get 5-FU with leucovorin or capecitabine alone based on their age and health needs.
  • Said at least one other antibody that is currently developed or used in cancer medicine includes rituximab, ibritumomab, tositumomab, epratuzumab, gemtuzumab, alemtuzumab, eetuximab, ABX-EGF, huA33, (1250, KW-2189, trastuzumab, HuJ591,BB- 10901, bevacizumab, IMC-1C11, CEA-cide, Hu3S193, brentuximab, blinatumomab, avelumab, atezolizumab, daratumumab,
  • dinutuximab elotuzumab, ibritumomab tiuxetan, ipilimumab, necitumumab, nimotuzumab, nivolumab, obinutuzumab, ocrelizumab, ofatumumab, olaratumab, Onartuzumab, panitumumab, pembrolizumab, pertuzumab, and ramucirumab.
  • Said at least one other antibody that is currently developed or used in cancer medicine may comprise a radiolabel such as 88 Y, 90 Y, 125 I, 131 I, 177 Lu, or 186 Re and/or a chemolabel such as the antimitotic agent monomethyl auristatin E, and emtansine, a derivative of maysantine.
  • a radiolabel such as 88 Y, 90 Y, 125 I, 131 I, 177 Lu, or 186 Re and/or a chemolabel such as the antimitotic agent monomethyl auristatin E, and emtansine, a derivative of maysantine.
  • an antibody preferably a VHH antibody according to the invention is preferably provided in an effective amount to an individual in need thereof.
  • An effective amount of an antibody of the invention is a dosage large enough to produce the desired effect in which the signs and symptoms of said Wnt3/3a-dependent cancer are ameliorated, or the likelihood of cancer formation is decreased.
  • a therapeutically effective amount preferably does not cause adverse side effects, such as pulmonary edema, congestive heart failure, and the like.
  • a therapeutically effective amount may vary with the individual's age, condition, and sex, as well as the extent of the disease and can be determined by one of skill in the art.
  • the dosage may be adjusted by the individual physician or veterinarian in the event of any complication.
  • a therapeutically effective amount may vary from about 0.01 mg/kg to about 500 mg/kg, preferably from about 0.1 mg/kg to about 200 mg/kg, most preferably from about 0.2 mg/kg to about 20 mg/kg, in one or more dose administrations daily, for one or several days. Preferred is administration of the antibody for 2 to 5 or more consecutive days.
  • antibodies preferably is parenteral such as, for example, intravenous, intraperitoneal, intranasal, or intramuscular.
  • An antibody, preferably a VHH antibody, according to the invention can be administered by injection or by gradual infusion over time. Preparations for parenteral
  • Aqueous carriers include water, alcoholic/aqueous solutions, emulsions or suspensions, including saline and buffered media.
  • Parenteral vehicles include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's or fixed oils.
  • Intravenous vehicles include fluid and nutrient replenishers, electrolyte replenishers (such as those based on Ringer's dextrose), and the like. Preservatives and other additives may also be present such as, for example, antimicrobials, anti-oxidants, chelating agents, and inert gases and the like.
  • the invention further provides a pharmaceutical composition comprising an antibody, preferably a VHH antibody, according to the invention.
  • a pharmaceutical composition preferably comprises a pharmaceutically acceptable carrier.
  • a carrier as used herein, means a non-toxic material that does not interfere with the effectiveness of the biological activity of the active ingredients.
  • physiologically acceptable refers to a non-toxic material that is compatible with a biological system such as a cell, cell culture, tissue, or organism.
  • characteristics of the carrier will depend on the route of administration.
  • Physiologically and pharmaceutically acceptable carriers include diluents, fillers, salts buffers, stabilizers, solubilizers, and other materials which are well known in the art.
  • Said pharmaceutical composition may further, in addition to the antibody, preferably VHH antibody, according to the invention, comprise the at least one chemotherapeutic agent, and/or the at least one other antibody that is currently developed or used in cancer medicine, as is indicated herein above.
  • the antibody preferably VHH antibody
  • Said pharmaceutical composition may further, in addition to the antibody, preferably VHH antibody, according to the invention, comprise the at least one chemotherapeutic agent, and/or the at least one other antibody that is currently developed or used in cancer medicine, as is indicated herein above.
  • HEK293T cells were cultured in RPMI medium (Thermo Scientific) supplemented with 10% Fetal Calf Serum (Bodinco B.V.), 100 units/mL penicillin and 100 mg/mL streptomycin (Thermo Scientific).
  • Mouse L-cells were cultured in DMEM containing 1 g/L glucose (Thermo Scientific) with the same supplements.
  • L- cells stably expressing Wnt3a were used to generate Wnt3a-conditioned medium (Wnt3a-CM).
  • R-Spondinl-CM and Noggin-CM were produced using HEK293T cells stably transfected with HA- mouse Rspol-Fc or after transient transfection with mouse Noggin-Fe expression vector, respectively. All cells were grown at 37 °C at 5% C02. CHIR-99021 (Tocris Bioscience) was used at 5 mM for 5 h.
  • Small intestine mouse organoids were established and maintained as described (Sato et al., 2009. Nature 459: 262-265) from isolated crypts collected from the entire length of the small intestine.
  • the basic culture medium (advanced DMEM/F12, with penicillin/streptomycin, 10 mM HEPES, 1x Glutamax, lx B27 [all from Life Technologies] and 1 mM N- acetylcysteine (Sigma Aldrich) was supplemented with 50 ng/mL murine recombinant EGF (Peprotech), Noggin-CM (1% v/v) and R-spondinl-CM (2.5% final volume, if not indicated otherwise) to obtain ENR medium.
  • Wnt3a-CM was used at 50% (v/v) to obtain WENR.
  • the Rnf43/Znfr3 double Knock Out (R/Z dKO) organoid line was a gift of BK Koo, Wellcome Trust - Medical Research Council Stem Cell Institute, University of Cambridge, Cambridge, UK68 and grown in EN medium (ENR without Rspol). Organoids were cultured in matrigel droplets (Corning).
  • Myc-LRP6 was a gift of C. Niehrs, Institute of Molecular Biology, Mainz, Germany.
  • LRP5-Myc-His was a gift of G. Bu, Mayo Clinic, Jacksonville, United States.
  • mWntl was a gift of H. Clevers, Hubrecht Institute, The Netherlands.
  • LRP6 CRISPR-Cas9 targeting GGACAGATTCTGAAACTAAT was generated by ligating the annealing product of 5 ’ -CACCGGGACAGATTCTGAAACTAAT-3’ and 5’-AAACATTAGTTTCAGAATCTGTCCC-3’ to pX330 (obtained from Addgene #48139) digested with Bbsl (Thermo Scientific). Single clones were established and genotyped. For genotyping, genomic DNA was isolated using QIAamp DNA micro kit (Qiagen).
  • mouse anti-a-Tubulin Sigma Aldrich
  • rabbit anti-LRP6 Cell Signaling
  • rabbit anti-Phospho-LRP6 Cell Signaling
  • All goat secondary antibodies were conjugated with either Alexa Fluorphores (Life Technologies).
  • IRDyes IRDyes
  • rabbit anti-Ki67 Abeam
  • mouse anti-b-catenin BD Transduction Labs
  • rabbit anti-Lysozyme Dako
  • mouse anti-ChgA Santa Cruz
  • goat anti-rabbit IgG-488 and goat anti-mouse-IgG-568 were used (Life Technologies).
  • Hoechst 33342 Invitrogen was used at 1:500 and Phalloidin (Ph647) (Invitrogen) at 1:50.
  • Luciferase TOPFlash and FOPFlash reporter assays were performed as described (Tauriello et ak, 2010. Mol Cell 37: 607-619). Briefly, HEK293T cells were seeded in 96 well plates (22,000 cells/well) and transfected with 5 ng
  • TopFlash70 reporter and either empty vector or 5 ng of myc-LRP6 or 7.5 ng of LRP5-Myc-His.
  • 0.3 ng of mWntl was co transfected.
  • Transfection efficiency was controlled and normalized by including 1 ng of TK-Renilla reporter plasmid in all transfections. All transfections were performed with FuGENE 6 transfection reagent (Promega) according to the manufacturer’s protocol. Six hours post transfection, cells were incubated with 10 mM of VHH and either control conditioned medium or Wnt3a-CM overnight.
  • Luciferase activity was measured using Dual Luciferase Reporter Kit (Promega) according to the manufacturer’s protocol in a Centro XS 960 microplate
  • organoids were grown in 10 mL matrigel droplets and images were captured with an EVOS (Thermo Scientific).
  • EVOS Thermo Scientific
  • R/Z dKO organoids were grown in 10 mL matrigel in slide angiogenesis chambers (Ibidi) in 40 ml EN and treated with 10 mM of IWP-2 (R&D systems) or 10 mM of each VHH for 3 d. After treatment organoids were fixed in paraformaldehyde (4% diluted in 0.1 M Na-Pi) for 1 h after which
  • Organoids were trypsinized and 1000 single cells per well were seeded in a 96-well plate in Basement Membrane Extract (BME) (Cultrex). Before addition of 100 mL of EN media, the BME was polymerized for 20 min at 37 °C. Organoids were cultured for the indicated times in the absence or presence of the indicated VHHs. The Cell titer Glo Luminiscent Cell viability assay (Promega) was used to assess viability of the organoids in a Centro XS 960 microplate luminometer.
  • BME Basement Membrane Extract
  • RNA was extracted using the Qiagen RNeasy kit (Qiagen) and used as a template for cDNA production using the iScriptTM cDNA Synthesis Kit (Biorad) according to the manufacturer’s protocol.
  • the synthesized cDNA was subsequently used in a qRT-PCR using IQ SYBR green mix (Biorad) according to the
  • Loss-of- function Rnf43/Znrf3 mutations generate a Wnt-hypersensitive cellular state that promotes the growth of intestinal tumors in a Wnt3-dependent manner (Koo et al., 2015. Proc Natl Acad Sci U S A 112: 7548-7550).
  • Wnt3-mediated signaling holds potential for tumor treatment, while limiting side effects as seen for general Wnt secretion inhibitors (Koo et al., 2015. Proc Natl Acad Sci U S A 112: 7548-7550; Zhang and Lum, 2018. Prog Mol Biol Transl Sci 153, 245-269).
  • VHHs were tested for inhibition of overexpressed and endogenous LRP6-dependent Wnt.3a responses in a dose- dependent manner using 12.5, 2.5, 0.5 and 0.1 mM of each VHH.
  • a VHH targeting an irrelevant antigen (human CD3) served as a negative control. Clear dose-response effects were observed for some VHHs, while others remained inhibitory at all doses tested (data not shown).
  • the structures of LRP6 P3E3P4E4 itself in complex with either L-P2-B10 or L-P2-D07 were very similar and closely resembled previously reported structures, revealing a tight arrangement between the six bladed b-propeller followed by an EGF domain (Ahn et al., Dev Cell 21: 862-873; Cheng et al., 2011.
  • L-P2-B10 binds through its complementarity determining region (CDR) 2 and CDR3 loops to an epitope that spans across the center of the P3 domain of LRP6.
  • CDR complementarity determining region
  • the interface buries 1,655 A 2 total surface area and is stabilized by intermolecular hydrophobic contacts, salt bridges and hydrogen bonds (data not shown).
  • L-P2-B10 interacts with the LRP6P3 barrel through two clusters of polar and electrostatic side-chain interactions, involving 7 residues from CDR2 and CDR3 of L-P2-B10 and 10 residues from LRP6P3.
  • Glu663 and Glu708 form salt bridges with ArglOO and Arg102, respectively.
  • Several other side chains form hydrogen bonds in this cluster.
  • a second array of side-chain interactions occurs at blades 5 and 6, with a salt bridge formed by Arg792, Arg853 and Asp55, Asp63 on the CDR2 loop of L-P2-B10, respectively.
  • Arg792, Arg853 and Asp55, Asp63 on the CDR2 loop of L-P2-B10 respectively.
  • L-P2-D07 and LRP6P3 buries 1,605 ⁇ 2 total surface area. All three CDR loops participate in the interaction, while hydrophobic contacts in CDR3 of L-P2-D07 contribute to key interactions; with some residues, like Tyrl02 and Argl04, making similar interactions with LRP6P3 in both complexes.
  • Arg 104 forms a salt bridge with Glu663, similar to CDR3 of L-P2-B10.
  • CDR1 and CDR2 are also involved in the interactions on 6-propeller blades 5 and 6, whereas there are less interactions observed around the barrel near blades 1 and 2.
  • the CDR3 of L-P2-B10 is 6 residues longer than that of L-P2-D07 (see Table 1), which explains a difference in binding orientation of the two VHH molecules.
  • the longer CDR3 loop of L-P2-B10 folds back over the VHH framework region, whereas the CDR3 loop of L-P2-D07 is directed towards the barrel. Additionally, the distribution of charged residues on the paratope comprising three CDRs is different.
  • L-P2-B10 displays a combination of positive and negatively charged residues involved in binding LRP6, while L-P2-D07 mainly has positive residues at the VHH-LRP6 interface in CDRs 1 and 3. Apart from minor side-chain rearrangements in both complex structures, no major
  • LRP6 P3E3P4E4 conformational changes were observed in LRP6 P3E3P4E4 upon binding to the single domain antibodies.
  • the L-P2-B10 and L-P2-D07 epitopes on the P3 domain of LRP6 are virtually identical.
  • the epitope strongly overlaps with the binding site for DKK1_C, a natural antagonist of Wnt signaling (Ahn et al., Dev Cell 21: 862-873; Cheng et al., 2011. Nat Struct Mol Biol 18: 1204-1210).
  • DKK1_C a natural antagonist of Wnt signaling
  • the VHHs act as a competitive inhibitor for Wnt3 ligands by sterically blocking access of Wnt ligands to LRP6P3.
  • anti-LRP6 VHHs efficiently inhibit cellular responses to Wnt at nanomolar levels, even in the presence of the strong Wnt pathway agonist Rspol.
  • anti-LRP6 VHHs did not inhibit responses of HEK293T cells to CHIR-99021, a GSK36 inhibitor that compromises destruction complex activity to induce downstream b-catenin activation (Figure 2C).
  • LRP6 shares high homology with LRP5 we investigated whether the selected anti-LRP6 VHHs might also target LRP5-mediated signaling.
  • Wnt ligands are divided in three main classes according to their interaction with different regions of the ERP5/6 extracellular domain (Gong et al., 2010. PLoS One 5: el2682; Ettenberg et al., 2010. Proc Natl Acad Sci U S A 107; Joiner et al., 2013. Trends Endocrinol Metab 24: 31-39). While Wnt,3 and Wnt3a selectively bind the P3 region in the third module (P3E3), Wntl interacts with the first two modules of LRP6 (P1E1P2E2 region) (Bourhis et al., 2011. Structure 19: 1433-1442).
  • organoids that critically depend on Wnt for viability. Organoids are embedded in matrigel and require supplementation with EGF, Noggin and Rspo (ENR medium) to drive tissue renewal in vitro (Clevers, 2016. Cell 165: 1586-1597). In this setup, organoids fully recapitulate the crypt and villus structures and the associated proliferative and differentiated cell compartments present in the intestine (Sato et al., 2009. Nature 459: 262-265).
  • ISC Intestinal stem cells
  • Rnf43/Znrf3-deleted (R/Z dKO) organoids grow independently of Rspol and thus display loss of niche factor requirement, a hallmark of tumorigenesis (Koo et al., 2012. Nature 488: 665-669; Fujii et al., 2016. Cell Stem Cell 18: 827-838).
  • these R/Z dKO tumors remain dependent on the generation of Wnt3 by specialized Paneth cells in the tumor niche (Koo et al., 2015. Proc Natl Acad Sci U S A 112: 7548-7550), revealing a vulnerability that might be targeted by anti-LRP5/6P3 VHHs.
  • VHH amino acid sequences. CDRs 1-3 are indicated.
  • the amino acid sequences in front of CDRl is termed framework region 1; the amino acid sequences between CDRl and CDR2 is termed framework region 2; the amino acid sequences between CDR2 and CDR3 is termed framework region 3; the amino acid sequences beyond (C-terminal to) CDR3 is termed framework region 4.
  • VHH sequences depicted in Table 1 were isolated from the synthetic VHH library described in Example 1 and references contained therein. In its original form, this library encodes antibody framework sequences similar to those of antibodies isolated from camelids. However, the potential immunogenicity of such antibodies should be minimized when used as a medicament in man, especially when dosing repeatedly.
  • a first humanized variant (‘Hul’) was designed for each original clone wherein the CDR1, CDR2 and CDR3 sequences were put into the context of DP-47 like framework 1, framework 3 and framework 4 sequences but retaining the original camelid framework 2.
  • the unpaired Cys at position 10 of clone L-P2- B10 was replaced with Gly as in the DP-47 human germline at that position.
  • Residues in Framework 2 are known to those skilled in the art as being important for the good solubility of camelid VHHs as compared to human VH domains in the absence of an antibody Light Chain and were therefore left unmodified in this series of variants.
  • a second variant was therefore designed for all three VHH clones (‘Hu2’) wherein most Framework 2 residues were replaced with the amino acids encoded at that position in the human DP-47 germline, except for those considered to be Hallmark Residues.
  • Humanization of Framework 1, Framework 3 and Framework 4 residues was kept as in Hul variants, including the removal of the free Cys in Framework 1 of clone L-P2-B10 as described above.
  • CDR1, CDR2 and CDR3 sequences of all three clones were kept unmodified in both Hul and Hu2 humanization variants.
  • E. coli codon optimized synthetic DNA encoding all three variants of all three VHHs was gene synthesized by a commercial provider as shown in Table 6 and cloned into pCyto3, an E. coli cytoplasmic protein expression plasmid carrying pUC origin and selectable Kanamycin resistance gene.
  • the plasmid allows for the IPTG inducible expression of C-terminal 3xFLAG-6His tagged recombinant proteins in the bacterial cytoplasm.
  • 3xFLAG-6His tagged open reading frames will be transformed into SHuffle T7 E. coli cells (New England Biolabs; Ipswich, Massachusetts) and selected for antibiotic resistance. Individual colonies will be used to inoculate liquid cultures containing antibiotics, which are grown overnight in a shaking incubator to high optical density without protein expression induction.
  • an inoculum of this starter culture will be used to inoculate a larger amount of fresh culture medium.
  • Protein expression will be induced by adding IPTG at the point where in this culture reaches sufficiently high OD600 optimal density, and incubated for another 8 hours at 30 °C.
  • Bacteria will be harvested using centrifugation, and the cell pellet will be lysed using combined Bugbuster® detergent (Sigma- Aldrich; St. Louis, Missouri), protease inhibitor (SigmaFastTM; Sigma-Aldrich; St. Louis, Missouri), and benzonase (Sigma- Aldrich; St. Louis, Missouri) treatment.
  • Recombinant protein will be obtained from this crude lysate using
  • IMAC Immobilized Metal Affinity Chromatography
  • Imidazole eluted protein will be further purified and buffer exchanged into lxD-PBS using size exclusion column chromatography. Purified protein concentration of pooled main peak fractions will be determined using UV spectrophotometry.
  • Unbound protein will be removed by washing the plate with washing buffer, and bound protein will be detected by applying horse radish peroxidase (HRP) coupled anti -FLAG tag antibody M2 (Sigma-Aldrich; St. Louis, Missouri) to the plate and further washing.
  • HRP-M2 antibody conjugate will then be determined by adding Chemiluminescence ELISA Substrate (POD; (Sigma-Aldrich; St. Louis, Missouri) to the plate and quantifying the resulting luminescence signal on a PerkinElmer Envision plate reader.
  • Raw luminescence count data will be plotted versus VHH concentration using GraphPad Prism software, and EC50 values representing apparent affinity values will be obtained using the software’s curve fitting module. Loss or gain of affinity of humanized VHH variants for recombinant human LRP5 will be expressed as fold change of each clone over camelid VHH reference value.
  • HEK293T cells will be seeded in 96 well plates and transfected using Fugene6 reagent (Promega, Madison, Wisconsin) with TopFlash64 reporter and either empty vector, myc-LRP6 or LRP5-Myc-His expression vectors.
  • Fugene6 reagent Promega, Madison, Wisconsin
  • TopFlash64 reporter either empty vector, myc-LRP6 or LRP5-Myc-His expression vectors.
  • variable concentrations of the different camelid or humanized VHHs and a fixed dilution of Wnt3a- conditioned medium will be added.
  • luciferase activity will be measured using the Dual

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Immunology (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Peptides Or Proteins (AREA)

Abstract

L'invention concerne un anticorps à domaine variable de chaîne lourde unique (VHH) qui se lie à une région spécifique sur des protéines 5 et 6 associées au récepteur de lipoprotéines de faible densité (LRP5/6). L'invention concerne en outre des procédés de production de l'anticorps, une composition pharmaceutique comprenant l'anticorps, et la première et la seconde utilisation médicale de l'anticorps.
PCT/NL2019/050683 2018-10-16 2019-10-16 Anticorps anti-protéine 5/6 associée au récepteur de lipoprotéines de faible densité WO2020080941A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP18200751.8 2018-10-16
EP18200751 2018-10-16

Publications (1)

Publication Number Publication Date
WO2020080941A1 true WO2020080941A1 (fr) 2020-04-23

Family

ID=63878425

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/NL2019/050683 WO2020080941A1 (fr) 2018-10-16 2019-10-16 Anticorps anti-protéine 5/6 associée au récepteur de lipoprotéines de faible densité

Country Status (1)

Country Link
WO (1) WO2020080941A1 (fr)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2020200997A1 (fr) * 2019-03-29 2020-10-08 Boehringer Ingelheim International Gmbh Polythérapie anticancéreuse
WO2023112965A1 (fr) * 2021-12-15 2023-06-22 学校法人帝京平成大学 Anticorps vhh

Citations (16)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1994004678A1 (fr) 1992-08-21 1994-03-03 Casterman Cecile Immunoglobulines exemptes de chaines legeres
WO1998052976A1 (fr) 1997-05-21 1998-11-26 Biovation Limited Procede de production de proteines non immunogenes
US5888809A (en) 1997-05-01 1999-03-30 Icos Corporation Hamster EF-1α transcriptional regulatory DNA
WO1999042077A2 (fr) 1998-02-19 1999-08-26 Xcyte Therapies, Inc. Compositions et procedes de regulation de l'activation des lymphocytes
WO2000024884A2 (fr) 1998-10-27 2000-05-04 Unilever Plc Proteines de fixation d'antigene
WO2006040153A2 (fr) 2004-10-13 2006-04-20 Ablynx N.V. Nanocorps™ contre la proteine beta-amyloide et polypeptides les renfermant pour le traitement de maladies degeneratives neurales, telles que la maladie d'alzheimer
WO2006122825A2 (fr) 2005-05-20 2006-11-23 Ablynx Nv 'nanobodies™' (nanocorps) perfectionnes pour traiter des troubles medies par une agregation
WO2009004065A2 (fr) 2007-07-03 2009-01-08 Ablynx N.V. Méthodes d'obtention de séquences améliorées d'immunoglobuline
WO2011049449A1 (fr) 2009-10-22 2011-04-28 University Of Twente Vhh utilisable en réparation tissulaire, régénération d'organe, remplacement d'organe et ingéniérie tissulaire
WO2011080350A1 (fr) 2010-01-04 2011-07-07 Argen-X B.V. Anticorps humanisés
US7981398B2 (en) 2005-04-06 2011-07-19 Ibc Pharmaceuticals, Inc. PEGylation by the dock and lock (DNL) technique
WO2011119661A1 (fr) * 2010-03-24 2011-09-29 Genentech, Inc. Anticorps anti-lrp6
WO2011138391A1 (fr) * 2010-05-06 2011-11-10 Novartis Ag Compositions et méthodes d'utilisation d'anticorps multivalents thérapeutiques de faible densité de la protéine apparentée à la lipoprotéine 6 (lrp6)
WO2014033252A1 (fr) 2012-08-31 2014-03-06 arGEN-X BV Procédé de production de molécules d'anticorps ayant une activité croisée interspécifique, intra-cible
WO2017093478A1 (fr) * 2015-12-04 2017-06-08 Boehringer Ingelheim International Gmbh Polypeptides biparatopiques ayant un effet antagoniste sur la signalisation wnt dans des cellules tumorales
WO2018220080A1 (fr) * 2017-05-31 2018-12-06 Boehringer Ingelheim International Gmbh Polypeptides ayant un effet antagoniste sur la signalisation wnt dans des cellules tumorales

Patent Citations (16)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1994004678A1 (fr) 1992-08-21 1994-03-03 Casterman Cecile Immunoglobulines exemptes de chaines legeres
US5888809A (en) 1997-05-01 1999-03-30 Icos Corporation Hamster EF-1α transcriptional regulatory DNA
WO1998052976A1 (fr) 1997-05-21 1998-11-26 Biovation Limited Procede de production de proteines non immunogenes
WO1999042077A2 (fr) 1998-02-19 1999-08-26 Xcyte Therapies, Inc. Compositions et procedes de regulation de l'activation des lymphocytes
WO2000024884A2 (fr) 1998-10-27 2000-05-04 Unilever Plc Proteines de fixation d'antigene
WO2006040153A2 (fr) 2004-10-13 2006-04-20 Ablynx N.V. Nanocorps™ contre la proteine beta-amyloide et polypeptides les renfermant pour le traitement de maladies degeneratives neurales, telles que la maladie d'alzheimer
US7981398B2 (en) 2005-04-06 2011-07-19 Ibc Pharmaceuticals, Inc. PEGylation by the dock and lock (DNL) technique
WO2006122825A2 (fr) 2005-05-20 2006-11-23 Ablynx Nv 'nanobodies™' (nanocorps) perfectionnes pour traiter des troubles medies par une agregation
WO2009004065A2 (fr) 2007-07-03 2009-01-08 Ablynx N.V. Méthodes d'obtention de séquences améliorées d'immunoglobuline
WO2011049449A1 (fr) 2009-10-22 2011-04-28 University Of Twente Vhh utilisable en réparation tissulaire, régénération d'organe, remplacement d'organe et ingéniérie tissulaire
WO2011080350A1 (fr) 2010-01-04 2011-07-07 Argen-X B.V. Anticorps humanisés
WO2011119661A1 (fr) * 2010-03-24 2011-09-29 Genentech, Inc. Anticorps anti-lrp6
WO2011138391A1 (fr) * 2010-05-06 2011-11-10 Novartis Ag Compositions et méthodes d'utilisation d'anticorps multivalents thérapeutiques de faible densité de la protéine apparentée à la lipoprotéine 6 (lrp6)
WO2014033252A1 (fr) 2012-08-31 2014-03-06 arGEN-X BV Procédé de production de molécules d'anticorps ayant une activité croisée interspécifique, intra-cible
WO2017093478A1 (fr) * 2015-12-04 2017-06-08 Boehringer Ingelheim International Gmbh Polypeptides biparatopiques ayant un effet antagoniste sur la signalisation wnt dans des cellules tumorales
WO2018220080A1 (fr) * 2017-05-31 2018-12-06 Boehringer Ingelheim International Gmbh Polypeptides ayant un effet antagoniste sur la signalisation wnt dans des cellules tumorales

Non-Patent Citations (78)

* Cited by examiner, † Cited by third party
Title
"UNIPROT", Database accession no. 629-1244
"UniProtKB", Database accession no. 075581
AGUILERA ET AL., ONCOGENE, vol. 25, 2006, pages 4116 - 4121
ALMAGRO, FRONTIERS BIOSCI, vol. 13, 2008, pages 1619
ARBABI-GHAHROUDI ET AL., CANCER METASTASIS REV, vol. 24, 2005, pages 501 - 519
BARKER ET AL., NATURE, vol. 449, 2007, pages 1003 - 1007
BARKER, NAT REV MOL CELL BIOL, vol. 15, 2014, pages 19 - 33
BERTHOLDWALTER, BIOLOGICALS, vol. 22, 1994, pages 135 - 150
BINNERTS ET AL., MOL BIOL CELL, vol. 20, 2009, pages 3552 - 3560
BIRCHRACHER, ADVANCED DRUG DELIVERY REVIEWS, vol. 58, 2006, pages 671 - 685
BOURHIS ET AL., J BIOL CHEM, vol. 285, 2010, pages 9172 - 9179
BOURHIS ET AL., STRUCTURE, vol. 19, 2011, pages 1433 - 1442
CARMON ET AL., PROC NATL ACAD SCI U S A, vol. 108, 2011, pages 21188 - 21193
CARTER ET AL., PNAS, vol. 89, 1992, pages 4285
CHEN ET AL., DEV CELL, vol. 21, 2011, pages 848 - 861
CHENG ET AL., NAT STRUCT MOL BIOL, vol. 18, 2011, pages 1204 - 1210
CLEVERS, CELL, vol. 165, 2016, pages 1586 - 1597
DE VOER ET AL., PLOS GENET, vol. 12, 2016, pages e 1005880
ETTENBERG ET AL., PROC NATL ACAD SCI U S A, vol. 107, 2010, pages 15473 - 15478
ETTENBERG ET AL., PROC NATL ACAD SCI USA, 2010, pages 107
FARIN ET AL., GASTROENTEROLOGY, vol. 143, 2012, pages 1518 - 1529
FRENKEN ET AL., J BIOTECHNOL, vol. 78, 2000, pages 11 - 21
FRIGOTTO ET AL., ANTIBODIES, vol. 4, 2015, pages 88
FUJII ET AL., CELL STEM CELL, vol. 18, 2016, pages 827 - 838
GIANNAKIS ET AL., NAT GENET, vol. 46, 2014, pages 1264 - 1266
GLINKA ET AL., EMBO REP, vol. 12, 2011, pages 1055 - 1061
GONG ET AL., PLOS ONE, vol. 5, 2010, pages e 12682
HOLLAND ET AL., CURR OPIN CELL BIOL, vol. 25, 2013, pages 254 - 264
HONG ET AL., ONCOIMMUNOLOGY, vol. 5, 2015, pages e1115941
ITASAKI ET AL., DEVELOPMENT, vol. 130, 2003, pages 4295 - 4305
JACKSON ET AL., MOL CANCER RES, vol. 14, 2016, pages 859 - 868
JOINER ET AL., TRENDS ENDOCRINOL METAB, vol. 24, 2013, pages 31 - 39
JOOSTEN ET AL., J BIOTECHNOL, vol. 120, 2005, pages 347 - 359
KOERBER ET AL., J MOL BIOL, vol. 427, 2015, pages 576 - 86
KOO ET AL., NATURE, vol. 488, 2012, pages 665 - 669
KOO ET AL., PROC NATL ACAD SCI U S A, vol. 112, 2015, pages 7548 - 7550
KOOCLEVERS, GASTROENTEROLOGY, vol. 147, 2014, pages 289 - 302
KRUIFLOGTENBERG, JBC, vol. 271, 1996, pages 7630 - 7634
LAZAR ET AL., MOL IMMUNOL, vol. 44, 2007, pages 1986
MACDONALD ET AL., PLOS ONE, vol. 6, 2011, pages e23537
MACDONALDHE, COLD SPRING HARB PERSPECT BIOL, vol. 4, 2012, pages a007880
MAO ET AL., NATURE, vol. 411, 2001, pages 321 - 325
NICOLA FENDERICO ET AL: "Anti-LRP5/6 VHHs promote differentiation of Wnt-hypersensitive intestinal stem cells", NATURE COMMUNICATIONS, vol. 10, no. 1, 21 January 2019 (2019-01-21), XP055628311, DOI: 10.1038/s41467-018-08172-z *
NIEHRS, NAT REV MOL CELL BIOL, vol. 13, 2012, pages 767 - 779
NOVELLASDEMUNT ET AL., AM J PHYSIOL CELL PHYSIOL, vol. 309, 2015, pages C511 - 521
NUSSECLEVERS, CELL, vol. 169, 2017, pages 985 - 999
ODEGRIP ET AL., PROC NATL ACAD SCI U S A, vol. 101, 2004, pages 2806 - 2810
ONO ET AL., MOL. IMMUNOL., vol. 36, 1999, pages 387 - 395
PACKPLUCKTHUN, BIOCHEMISTRY, vol. 31, 1992, pages 1579 - 1584
PADLAN, MOL IMMUNOL, vol. 28, 1991, pages 489
POWELL ET AL., NATURE, vol. 359, 1992, pages 235 - 237
QU ET AL., CLIN. CANCER RES., vol. 5, 1999, pages 3095 - 3100
QUEEN ET AL., PNAS, vol. 86, 1989, pages 10029
RAHBARIZADEH ET AL., J MOL IMMUNOL, vol. 43, 2006, pages 426 - 435
RICHTER ET AL., PLOS ONE, vol. 8, 2013, pages e72156
RODRIGUEZ-COLMAN ET AL., NATURE, vol. 543, 2017, pages 424 - 237
RUNNING DEERALLISON, BIOTECHNOL PROG, vol. 20, 2004, pages 880 - 889
S. A. ETTENBERG ET AL: "Inhibition of tumorigenesis driven by different Wnt proteins requires blockade of distinct ligand-binding regions by LRP6 antibodies", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES, vol. 107, no. 35, 31 August 2010 (2010-08-31), pages 15473 - 15478, XP055002447, ISSN: 0027-8424, DOI: 10.1073/pnas.1007428107 *
SATO ET AL., CARCINOGENESIS, vol. 28, 2007, pages 2459 - 2466
SATO ET AL., NATURE, vol. 459, 2009, pages 262 - 265
SCHMITT ET AL., MABS, vol. 9, 2017, pages 831 - 843
SCHMITTGENLIVAK, NAT PROTOC, vol. 3, 2008, pages 1101 - 1108
SKERRA, CURRENT OPINION BIOTECHNOL, vol. 18, 2007, pages 295 - 304
SKRLEC ET AL., TRENDS BIOTECHNOL, vol. 33, 2015, pages 408 - 418
TAN, J IMMUNOL, vol. 169, 2002, pages 1119
TAURIELLO ET AL., MOL CELL, vol. 37, 2010, pages 607 - 619
TAURIELLO ET AL., MOL. CELL, vol. 37, 2010, pages 607 - 619
UNVERDORBEN ET AL., PLOS ONE, vol. 10, 2015, pages e0139838
VAN AUDENHOVEGETTEMANS, EBIOMEDICINE, vol. 8, 2016, pages 40 - 48
VAN DER LAAR ET AL., BIOTECH BIOENG, vol. 96, 2007, pages 483 - 494
VAN KAPPELMAURICE, BR J PHARMACOL, vol. 174, 2017, pages 4575 - 4588
VINCKE ET AL., J BIOL CHEM, vol. 284, 2009, pages 3273 - 84
WEIVODA ET AL., BONE, vol. 96, 2017, pages 45 - 50
YAMANE-OHNUKI ET AL., BIOTECHNOL BIOENG, vol. 87, 2004, pages 614 - 622
YASUI ET AL., J IMMUNOL METHODS, vol. 352, 2010, pages 153 - 160
ZHAN ET AL., ONCOGENE, vol. 36, 2017, pages 1461 - 1473
ZHANGLUM, PROG MOL BIOL TRANSL SCI, vol. 153, 2018, pages 245 - 269
ZHONG ET AL., WILEY INTERDISCIP REV DEV BIOL, vol. 3, 2014, pages 489 - 500

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2020200997A1 (fr) * 2019-03-29 2020-10-08 Boehringer Ingelheim International Gmbh Polythérapie anticancéreuse
WO2023112965A1 (fr) * 2021-12-15 2023-06-22 学校法人帝京平成大学 Anticorps vhh

Similar Documents

Publication Publication Date Title
US11952418B2 (en) Biparatopic polypeptides antagonizing Wnt signaling in tumor cells
US20220362393A1 (en) Polypeptides antagonizing wnt signaling in tumor cells
US20230138045A1 (en) Wnt super agonists
JP2024001292A (ja) 多特異性Ｗｎｔ代替分子及びその使用
US20220275095A1 (en) Monospecific anti-frizzled antibodies and methods of use
KR20230132544A (ko) 신규한 항-그렘린1 항체
US10280218B2 (en) Antibodies binding to BMP4, and uses thereof
WO2020080941A1 (fr) Anticorps anti-protéine 5/6 associée au récepteur de lipoprotéines de faible densité
TW202346347A (zh) Wnt受體特異性化合物及其相關方法
EA040170B1 (ru) БИПАРАТОПНЫЕ ПОЛИПЕПТИДЫ-АНТАГОНИСТЫ ПЕРЕДАЧИ СИГНАЛА Wnt В ОПУХОЛЕВЫХ КЛЕТКАХ

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 19828882

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 19828882

Country of ref document: EP

Kind code of ref document: A1