WO2020080739A1 - Composition pour le diagnostic de l'hyperprolactinémie, et procédé pour fournir des informations permettant de prédire une réponse à un traitement médicamenteux - Google Patents

Composition pour le diagnostic de l'hyperprolactinémie, et procédé pour fournir des informations permettant de prédire une réponse à un traitement médicamenteux Download PDF

Info

Publication number
WO2020080739A1
WO2020080739A1 PCT/KR2019/013295 KR2019013295W WO2020080739A1 WO 2020080739 A1 WO2020080739 A1 WO 2020080739A1 KR 2019013295 W KR2019013295 W KR 2019013295W WO 2020080739 A1 WO2020080739 A1 WO 2020080739A1
Authority
WO
WIPO (PCT)
Prior art keywords
mir
hyperprolactinemia
hsa
level
group
Prior art date
Application number
PCT/KR2019/013295
Other languages
English (en)
Korean (ko)
Inventor
구철룡
이은직
이양종
Original Assignee
연세대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 연세대학교 산학협력단 filed Critical 연세대학교 산학협력단
Publication of WO2020080739A1 publication Critical patent/WO2020080739A1/fr

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA

Definitions

  • the present invention relates to a composition for diagnosing hyperprolactinemia, and more particularly, to a composition for diagnosing hyperprolactinemia induced by prolactinoma. It also relates to a method for providing information for predicting the responsiveness of drug treatment in hyperprolactinemia.
  • Hyperprolactinemia means that the level of prolactin in the blood is less than 25 ng / mL in women and less than 15 ng / mL in men compared to normal levels.
  • the prolactin is produced by prolactin-secreting cells in the anterior lobe of the pituitary gland and secreted by pulsation while being regulated by a dopamine type 2 receptor distributed in prolactin-secreting cells.
  • Dopamine is a representative factor for inhibiting prolactin secretion, and there are somatostatin, gamma-aminobutyric acid, and the like.
  • the amount of prolactin present in the blood may increase after pregnancy or lactation, exercise, eating, general anesthesia, surgical treatment, and acute stress.
  • hyperprolactinemia can be induced are very diverse. Physiological situations include things like pregnancy, lactation, stress, exercise and sleep, and can also be induced by taking medications such as neuroleptics and antipsychotics. Moderate hyperprolactinemia can also be induced by primary hypothyroidism. In addition, hyperprolactinemia, which is not related to pregnancy, can be induced mainly by prolactinoma, or by pathological cases that interfere with the hypothalamic-pituitary-dopamine pathway or by the cause of the drug. In addition, non-functional pituitary tumors or other tumors around Turkey may be induced by a phenomenon in which prolactin inhibition is lowered when the dopamine neurons are damaged or the dopamine signal is blocked by compressing the pituitary stem.
  • hyperprolactinemia treatment aims to correct the causative disease and to prevent or improve various diseases caused by hyperprolactinemia.
  • drug treatment, surgery, and radiation treatment with bromocriptine, pergolide, cabergoline, metergoline, quinagolide, etc., which are dopamine agonists, may be considered.
  • surgical treatment methods such as craniotomy or transconjunctival sinusectomy or radiation therapy methods should be considered when there is a visual field disorder, a giant adenocarcinoma that invades the cranial nerve, or resistance to drugs.
  • Surgical treatment methods include CSF rhinorrhea, uremia, and infection. It is very important to accurately discriminate the cause of hyperprolactinemia and predict the responsiveness of drug treatment for optimal primary treatment application, as side effects such as vision loss and pituitary dysfunction may be involved.
  • One object of the present invention is to provide a composition and kit for diagnosing hyperprolactinemia.
  • Another object of the present invention is to provide a method for providing information for the diagnosis of hyperprolactinemia.
  • Another object of the present invention is to provide a method for providing information for predicting the responsiveness of drug treatment.
  • Another object of the present invention is to provide a device for predicting responsiveness of drug treatment.
  • Another object of the present invention is to provide a composition for predicting the reactivity of drug treatment of pituitary tumors.
  • Another object of the present invention is to provide a method for providing information for predicting the reactivity of drug treatment of a pituitary tumor.
  • One embodiment of the present invention is to provide a composition for the diagnosis of hyperprolactinemia.
  • the diagnostic composition includes an agent that measures the level of the presence of at least one miRNA selected from the group consisting of hsa-miR-424-5p, hsa-miR-514a-5p and hsa-miR-20a-5p.
  • the agent for measuring the level of miRNA present is an agent for measuring miRNA present in a sample separated from a target patient, etc., hsa-miR-424-5p, hsa-miR-514a-5p or hsa-miR- It may be a primer or probe that specifically binds 20a-5p.
  • the design of the primer or probe can be easily produced according to methods known in the art with reference to the base sequences of hsa-miR-424-5p, hsa-miR-514a-5p and hsa-miR-20a-5p.
  • the base sequence of the hsa-miR-424-5p may be SEQ ID NO: 1, CAGCAGCAAUUCAUGUUUUGAA, and the base sequence of the hsa-miR-514a-5p may be SEQ ID NO: 2, UACUCUGGAGAGUGACAAUCAUG, the hsa-miR-20a-5p
  • the base sequence of UAAAGUGCUUAUAGUGCAGGUAG may be SEQ ID NO: 3, but is not limited thereto.
  • the primer can form a complementary template and base pair with a base sequence having a short free 3 'hydroxyl group, and a short base functioning as a starting point for template strand copying.
  • a PCR product may be generated through a process in which a forward primer and a reverse primer are paired with a miRNA to be amplified and reacted.
  • the probe is a fragment of several to hundreds of base sequences that can specifically bind to the miRNA, and since fluorescent lamps are labeled to be visualized, the presence or absence of miRNA and the amount present in the sample can be confirmed when using the probe. You can.
  • the diagnostic composition in the present invention after measuring the level of miRNA present in the sample separated from the target patient and the normal person, it can be diagnosed as hyperprolactinemia when the level is higher than the normal person.
  • the hyperprolactinemia is an endocrine disease found in the hypothalamic-pituitary axis, which may be induced by a pituitary tumor.
  • the pituitary tumor may be prolactinoma, but is not limited thereto.
  • hyperprolactinemia induced by the prolactinoma is highly responsive to drug treatment, so the composition is a drug for hyperprolactinemia It may be intended to predict reactivity, but is not limited thereto.
  • an appropriate primary treatment method can be provided early, and the occurrence of side effects and the cure rate due to improper treatment is remarkably reduced. Can be reduced.
  • the hyperprolactinemia may be accompanied by at least one disease selected from the group consisting of osteoporosis, sexual dysfunction, infertility and galactorrhea, pituitary tumors, and brain tumors.
  • Another embodiment of the present invention is to provide a kit for diagnosing hyperprolactinemia.
  • the diagnostic kit may include a solution or device of one or more other component compositions suitable for a primer, probe, or analytical method for measuring the level of miRNA.
  • kit is to be performed via RT-PCR, such as test tubes or other suitable containers, reaction buffers (pH and magnesium concentrations vary), deoxynucleotides (dNTPs), Taq-polymerases and reverse transcriptases. Enzymes, DNase, RNase inhibitors, DEPC-water (DEPC-water), and sterile water.
  • reaction buffers pH and magnesium concentrations vary
  • dNTPs deoxynucleotides
  • Taq-polymerases reverse transcriptases. Enzymes, DNase, RNase inhibitors, DEPC-water (DEPC-water), and sterile water.
  • the kit when the kit is performed through a DNA chip assay, it may include a substrate attached to the probe.
  • the kit for diagnosing hyperprolactinemia is an agent for measuring the level of at least one miRNA selected from the group consisting of hsa-miR-424-5p, hsa-miR-514a-5p and hsa-miR-20a-5p Phosphorus can be diagnosed with hyperprolactinemia using the diagnostic composition. Therefore, content related to agents, probes, primers, hyperprolactinemia, comorbidities, etc. that measure the level at which miRNA is present is omitted to avoid excessive complexity of the specification according to the repeated description.
  • Another embodiment of the present invention is to provide a method for providing information for the diagnosis of hyperprolactinemia.
  • the method for providing information for the diagnosis is selected from the group consisting of hsa-miR-424-5p, hsa-miR-514a-5p and hsa-miR-20a-5p in a sample separated from a desired patient or normal person. Measuring a level in which at least one miRNA is present; And comparing the level of the miRNAs measured in a sample separated from the target patient and a normal person.
  • the sample separated from the desired patient or normal person may be whole blood, serum, plasma, saliva, urine, sputum, lymph fluid, cells, etc., but is not limited thereto.
  • the method for providing the above information of the present invention may further include a step of determining as hyperprolactinemia induced by a pituitary tumor when the level of miRNAs present in a sample isolated from a hyperprolactinemia patient is higher than that of a normal person.
  • the pituitary tumor may be prolactinoma, but is not limited thereto.
  • the miRNAs are present at a higher level than the normal humans, by providing information for diagnosis of hyperprolactinemia induced by a pituitary tumor, it is possible to provide an appropriate primary treatment method in the early stage of the invention.
  • Measurement of the level in which the miRNA is present can be confirmed through a conventional method such as amplifying miRNA or complementarily binding to a probe labeled with fluorescence, for example, polymerase chain reaction), fluorescence correlation spectroscopy, microarray, and chip assay (chip-assay), but may be at least one selected from the group consisting of, but is not limited thereto.
  • a conventional method such as amplifying miRNA or complementarily binding to a probe labeled with fluorescence, for example, polymerase chain reaction), fluorescence correlation spectroscopy, microarray, and chip assay (chip-assay), but may be at least one selected from the group consisting of, but is not limited thereto.
  • the method for providing information for the diagnosis may provide information for the diagnosis of hyperprolactinemia by measuring the level of the miRNAs in the sample using the composition for diagnosis. Therefore, content related to agents, probes, primers, hyperprolactinemia, comorbidities, etc. that measure the level at which miRNA is present is omitted to avoid excessive complexity of the specification according to the repeated description.
  • Another embodiment of the present invention provides a method for providing information for predicting responsiveness of drug treatment.
  • Methods for providing information for predicting the reactivity of the drug treatment include hsa-miR-424-5p, hsa-miR-514a-5p, and hsa-miR-20a-5p in samples isolated from hyperprolactinemia patients or normal subjects. Measuring the level of at least one miRNA selected from the group consisting of; And comparing the levels of the miRNAs measured in a sample separated from the hyperprolactinemia patient and a normal person.
  • the method for providing information for predicting the reactivity of the drug treatment of the present invention is to predict that the reactivity of the drug treatment is good when the level of miRNAs in the sample isolated from the hyperprolactinemia patient is higher than the normal person. It further includes.
  • the pituitary tumor may be prolactinoma, but is not limited thereto.
  • the drug treatment is to help normalize the level of prolactin in the blood in patients with hyperprolactinemia, and may be, for example, dopamine agonist, but is not limited thereto.
  • the method of providing information for predicting the reactivity of the drug treatment is to measure the level of at least one miRNA selected from the group consisting of miR-424-5p, miR-514a-5p and miR-20a-5p
  • the composition for diagnosis which is an agent, as described in the method for providing information for the diagnosis, it is possible to provide information for predicting the responsiveness of drug treatment by measuring the level in which the miRNA is present. Therefore, the content related to the agent, probe, primer, hyperprolactinemia, accompanying disease, measurement method, etc. for measuring the level of miRNA present is omitted to avoid excessive complexity of the specification according to the repeated description.
  • Another embodiment of the present invention provides a composition for predicting the reactivity of drug treatment of a pituitary tumor.
  • composition of the present invention comprises an agent that measures the level of at least one miRNA selected from the group consisting of hsa-miR-424-5p, hsa-miR-514a-5p and hsa-miR-20a-5p do.
  • composition for predicting reactivity of drug treatment of the pituitary tumor of the present invention hsa-miR-424-5p, hsa-miR-514a-5p, hsa-miR-20a-5p, an agent for measuring the level of miRNA present,
  • the contents related to probes, primers, etc. are the same as those described above, so that the description is omitted to avoid excessive complexity of the specification.
  • the drug treatment of the present invention may include any drug that can treat a pituitary tumor, may be a hormone accelerator or inhibitor secreted from the pituitary gland, for example, may be a dopamine agonist, but is not limited thereto. no.
  • the pituitary tumor of the present invention may be at least one selected from the group consisting of prolactinoma, growth hormone-secreting adenoma, and non-functional pituitary adenoma, but is not limited thereto.
  • Another embodiment of the present invention provides a method for providing information for predicting the responsiveness of drug treatment of a pituitary tumor.
  • the method of the present invention at least one or more selected from the group consisting of hsa-miR-424-5p, hsa-miR-514a-5p and hsa-miR-20a-5p in a sample isolated from a desired patient or normal person measuring the level of miRNA present; And comparing the level of the miRNAs measured in a sample separated from the target patient and a normal person.
  • the method further includes predicting that drug response is good.
  • the contents related to the agent, probe, primer, measurement method, sample, drug treatment, etc. for measuring the level of miRNA are as described above. The same is omitted to avoid excessive complexity of the specification.
  • Another embodiment of the present invention provides an apparatus for predicting responsiveness of drug treatment.
  • the apparatus for predicting treatment reactivity of the drug includes an input unit, a comparison determination unit, and an output unit.
  • the level in which the miRNA measured in the sample is present is input, and the input is in a sample separated from a hyperprolactinemia patient or a normal person, hsa-miR-424
  • the level in which at least one miRNA selected from the group consisting of -5p, hsa-miR-514a-5p and hsa-miR-20a-5p is present is input.
  • the drug treatment is to help normalize the level of prolactin in the blood in patients with hyperprolactinemia, and may be, for example, dopamine agonist, but is not limited thereto.
  • the sample may be whole blood, serum, plasma, saliva, urine, sputum, lymph fluid, cells, etc., but is not limited thereto.
  • Measurement of the level in which the miRNA is present is confirmed through a conventional method such as amplifying miRNA using a primer or complementarily binding to a probe labeled with fluorescence, etc., and can be input to the input unit, for example
  • the input unit may be at least one selected from the group consisting of polymerase chain reaction, fluorescence correlation spectroscopy, microarray and chip-assay, but is not limited thereto. It is not.
  • an agent for measuring the level in which the miRNA is present is an agent for measuring miRNA present in a sample separated from a target patient, etc., hsa-miR-424-5p, hsa- Primers or probes that specifically bind to miR-514a-5p or hsa-miR-20a-5p can be used.
  • the design of the primer or probe can be easily produced according to methods known in the art with reference to the base sequences of hsa-miR-424-5p, hsa-miR-514a-5p and hsa-miR-20a-5p.
  • the base sequence of the hsa-miR-424-5p may be SEQ ID NO: 1, CAGCAGCAAUUCAUGUUUUGAA, and the base sequence of the hsa-miR-514a-5p may be SEQ ID NO: 2, UACUCUGGAGAGUGACAAUCAUG, the hsa-miR-20a-5p
  • the base sequence of UAAAGUGCUUAUAGUGCAGGUAG may be SEQ ID NO: 3, but is not limited thereto.
  • the comparison determining unit compares and determines the level of the miRNA present in the sample separated from the hyperprolactin patient and the normal person input from the input unit.
  • the method may further include determining that it is hyperprolactinemia induced by a pituitary tumor.
  • the pituitary tumor may be prolactinoma, but is not limited thereto.
  • the miRNAs when the miRNAs are present at a high level compared to normal humans, it can be predicted that it is hyperprolactinemia induced by pituitary tumors, and through this, it can be predicted that responsiveness to drug treatment may be very good.
  • the output unit outputs the result determined by the comparison determination unit.
  • the data output from the output unit may further include a liquid crystal display unit capable of visually displaying a liquid crystal display window.
  • composition and method of the present invention not only can hyperprolactinemia be diagnosed, but also high prolactinemia caused by prolactinoma, which is one of pituitary tumors and pituitary tumors, has a small side effect and high cure rate. It can provide a method of treating prolactinemia very effectively.
  • Figure 1 shows a pituitary tumor sample collection method with hyperprolactinemia for miRNA discovery according to an embodiment of the present invention.
  • 5 to 11 show the result of comparing the level of miRNA present in each group for the verification of miRNA according to an embodiment of the present invention.
  • Figure 12 shows the results of comparing the level of miRNA present in various pituitary tumor tissue according to an embodiment of the present invention.
  • FIG. 13 is a schematic diagram of an apparatus according to an embodiment of the present invention.
  • an agent for measuring the level of at least one miRNA selected from the group consisting of hsa-miR-424-5p, hsa-miR-514a-5p and hsa-miR-20a-5p is provided. It provides a composition for the diagnosis of hyperprolactinemia, including.
  • At least a sample selected from the group consisting of hsa-miR-424-5p, hsa-miR-514a-5p and hsa-miR-20a-5p in samples isolated from hyperprolactinemia patients or normal subjects A first input unit into which a level of any one or more miRNAs is input; A comparison and determination unit comparing the levels of the miRNAs measured in samples separated from the hyperprolactinemia patient and the normal person; And it provides an apparatus for predicting the responsiveness of drug treatment including an output unit for outputting the determination result of the comparison determination unit.
  • an agent for measuring the level of at least one miRNA selected from the group consisting of hsa-miR-424-5p, hsa-miR-514a-5p and hsa-miR-20a-5p It provides a composition for predicting drug therapy responsiveness of a pituitary tumor comprising a.
  • blood was drawn before drug treatment in a pituitary tumor patient with hyperprolactinemia, and an MRI scan was performed. Three months after starting the drug treatment, blood sampling and MRI imaging of the patient were performed.
  • the drug was continued for 15 months in the patient whose tumor size had decreased, and at the 15th month, blood sampling and MRI were performed in the patient.
  • total RNA total RNA containing miRNA in serum derived from blood collected prior to the drug treatment according to the protocol provided by the manufacturer. was extracted.
  • nCounter analysis of miRNAs present in the total RNA extracted in the preparation example was performed by dividing into three groups as shown in Table 1 below.
  • prolactinoma PRLoma
  • NFPA non-functional adenomas
  • 6 non-prolactinoma were selected.
  • the clinically estimated diagnostic group was screened with 12 non-reactive and drug-reactive groups, respectively, based on prolactin levels in blood and changes in tumor size on the MRI of the pituitary gland following drug treatment.
  • the groups before and after the drug treatment were screened into 12 normal or abnormal groups, respectively, according to the normalization of prolactin levels before and after starting the drug treatment.
  • RNA extracted from the patients in the three groups thus selected NCounter analysis was performed.
  • miRNAs that are identified as normalization value 15 or higher, P-value 0.05 or lower, and group-to-group values of 2 or higher are selected, and the results are shown in FIGS. 2 to 4 and It is shown in Tables 2-4.
  • miRNA type PRLoma VS NFPA levels P-value hsa-miR-612 -2.59 0.00034159 hsa-miR-301a-3p -4.01 0.00111505 hsa-miR-4755-5p -3.18 0.00205509 hsa-miR-509-5p -2.88 0.00369512 hsa-miR-424-5p 2.14 0.0008 hsa-miR-514a-5p 1.24 0.0009 hsa-miR-20a-5p 3.17 0.0006
  • hsa-miR-612, hsa-miR-301a-3p, hsa-miR-4755-5p, and hsa-miR-509-5p within the histological diagnostic group are non-functional adenoma.
  • prolactin adenomas were reduced by at least 2 times or more, and hsa-miR-424-5p, hsa-miR-514a-5p and hsa-miR-20a-5p were increased by at least 1.24 times or more.
  • hsa-miR-3196, hsa-miR-211-3p, hsa-miR-501-3p, hsa-miR-548h-5p and hsa-miR-190a-5p are non-response drugs It was confirmed that the drug response group was reduced by 1.5 times or more, and hsa-miR-424-5p, hsa-miR-514a-5p and hsa-miR-20a-5p were increased by at least 1.74 times compared to the group.
  • hsa-miR-587, hsa-miR-1185-2-3p, hsa-miR-1285-3p and hsa-miR-939-5p within the group before and after drug treatment were compared to 2 before and after drug treatment. It was confirmed that it was increased more than twice.
  • Example 1 Among the miRNAs selected in Example 1, a process was performed in which miRNAs expected to have functions related to pituitary tumors and hormone production were selected as miRNAs.
  • RNA targeting a specific miRNA was identified from the miRNAs found in Example 1, and among these, only miRNA targeting RNA related to the pituitary gland was selected.
  • hsa-miR-424-5p hsa-miR-514a-5p and hsa-miR-20a-5p, which were found to be related to pituitary tumors and hormone production, were selected. .
  • Prolactin adenoma (PRLoma) 36 29 Prolactinemia (caused by stem effect from pituitary tumors, not prolactin adenoma) 2 36 No clinical estimation 3 92 Idiopathic hyperPRL One 3 2 groups Size reduction by over 20% 28 60 No size change 12 83 Idiopathic hyperprolactinemia One 3 3 groups Size reduction by over 30% 23 33 No size change 7 23 Idiopathic hyperprolactinemia One 3 4 groups Prolactin adenoma One 25 Non-prolactin adenoma 0 18
  • the embodiment In the blood extracted from blood collected before or after drug treatment of the 1 to 4 groups, the embodiment In order to compare the level of miRNA selected in 2, a polymerase chain reaction was performed.
  • cDNA was synthesized by using the miRNA cDNA synthesis kit (ABI, Cat no. A28007, USA), using the extracted RNA as a template strand. Then, using each of the above cDNA as a template strand, using a TaqMan TM Advanced miRNA analysis probe (ABI, Cat no.
  • hsa-miR-424-5p 478586_mir
  • hsa-miR-514a-5p 478092_mir
  • polymerase chain reaction for hsa-miR-20a-5p 478974_mir
  • FIGS. 5 to 7 The results of the level of miRNA present in the blood extracted from the blood collected before the drug treatment are shown in FIGS. 5 to 7. In addition, comparison results of levels of miRNA present in blood extracted from blood collected before and after drug treatment are shown in FIGS. 8 to 11.
  • the level of the miRNA present in group 1 is higher in prolactinoma patients compared to normal, and thus, hyperprolactinemia patients and hyperprolactinemia induced by prolactinoma are diagnosed through the miRNA. You can see that you can.
  • the miRNA is high in prolactinoma patients in which the tumor size has been reduced by drug treatment. Therefore, when the miRNA is present in the serum at a high level, drug treatment is the optimal primary treatment. It can be seen that can be applied as. In addition, it can be seen that when the miRNA is present in a low level in serum, non-pharmacological treatment can be applied as the first treatment.
  • the levels of the miRNAs according to the present invention in the pituitary gland of normal and tumor patients were confirmed.
  • hsa-miR-20a-5p is present in the level of normal tissue was 1.1, while prolactin adenomas were confirmed to be 5.9 in the tumor tissue. This was a significantly higher level compared to the non-functional pituitary adenoma GH and ACTH-secreting pituitary adenoma.
  • the correlation between the level of the miRNAs measured in the blood collected before the drug treatment measured in Example 3 and the drug treatment responsiveness was analyzed.
  • the analysis compares the value of the level of miRNAs present in serum obtained from blood collected before drug treatment of groups 2 and 3 of Example 3, based on the level of miRNA present in the normal, and the results are as follows. It is shown in Table 6.
  • the correlation between the level of the miRNAs measured in the blood collected before the drug treatment measured in Example 3 and prolactinemia induced by prolactinoma was analyzed.
  • the analysis is based on the level of the presence of miRNA in the normal, by comparing the value of the level of the presence of miRNA in the serum obtained from the blood of the 4 groups of Example 3, the results are shown in Table 7 below.
  • composition and method of the present invention it is possible to diagnose pituitary tumors and hyperprolactinemia, as well as to screen for hyperprolactinemia caused by prolactinoma, and to treat hyperprolactinemia with fewer side effects and high cure rate Because it provides a very effective method, it has a very high availability in the medical industry.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Pathology (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

La présente invention concerne une composition pour le diagnostic de l'hyperprolactinémie, et des procédés pour fournir des informations liées au diagnostic et des informations permettant de prédire une réponse à un traitement médicamenteux. Il n'est pas seulement possible de diagnostiquer l'hyperprolactinémie, mais l'hyperprolactinémie qui est provoquée par un prolactinome peut être identifiée, ce qui permet de fournir un procédé de traitement hautement efficace de l'hyperprolactinémie qui présente peu d'effets secondaires et une probabilité élevée de guérison complète.
PCT/KR2019/013295 2018-10-19 2019-10-10 Composition pour le diagnostic de l'hyperprolactinémie, et procédé pour fournir des informations permettant de prédire une réponse à un traitement médicamenteux WO2020080739A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020180125094A KR102070893B1 (ko) 2018-10-19 2018-10-19 고프로락틴혈증의 진단용 조성물 및 약물 치료의 반응성을 예측하기 위한 정보를 제공하는 방법
KR10-2018-0125094 2018-10-19

Publications (1)

Publication Number Publication Date
WO2020080739A1 true WO2020080739A1 (fr) 2020-04-23

Family

ID=69322180

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2019/013295 WO2020080739A1 (fr) 2018-10-19 2019-10-10 Composition pour le diagnostic de l'hyperprolactinémie, et procédé pour fournir des informations permettant de prédire une réponse à un traitement médicamenteux

Country Status (2)

Country Link
KR (1) KR102070893B1 (fr)
WO (1) WO2020080739A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112501304A (zh) * 2020-12-17 2021-03-16 浙江清华长三角研究院 miRNA-424作为脑垂体瘤诊断标志物的应用

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20140141986A1 (en) * 2011-02-22 2014-05-22 David Spetzler Circulating biomarkers

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20140141986A1 (en) * 2011-02-22 2014-05-22 David Spetzler Circulating biomarkers

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
DEVORE, S. B. ET AL.: "Histone citrullination represses microRNA expression, resulting in increased oncogene mRNAs in somatolactotrope cells", MOLECULAR AND CELLULAR BIOLOGY, vol. 38, no. 19, 9 July 2018 (2018-07-09) - 14 September 2018 (2018-09-14), pages 1 - 15, XP055701975 *
FENG, Y. ET AL.: "MicroRNAs and target genes in pituitary adenomas", HORMONE AND METABOLIC RESEARCH, vol. 50, no. 3, 19 January 2018 (2018-01-19), pages 179 - 192 *
LIANG, S. ET AL.: "The experimental study of miRNA in pituitary adenomas", TURKISH NEUROSURGERY, vol. 23, no. 6, 2013, pages 721 - 727, XP055701981 *
TRIEBEL, J. ET AL.: "From bench to bedside: translating the prolactin/vasoinhibin axis", FRONTIERS IN ENDOCRINOLOGY, vol. 8, no. 342, 11 December 2017 (2017-12-11), pages 1 - 7, XP055701977 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112501304A (zh) * 2020-12-17 2021-03-16 浙江清华长三角研究院 miRNA-424作为脑垂体瘤诊断标志物的应用

Also Published As

Publication number Publication date
KR102070893B1 (ko) 2020-01-29

Similar Documents

Publication Publication Date Title
WO2020027569A1 (fr) Composition pour le diagnostic de la maladie d'alzheimer par utilisation d'une altération de la méthylation des cpg dans le promoteur du gène ide dans des cellules de la peau, et son utilisation
WO2020046045A1 (fr) Biomarqueur pour diagnostiquer ou prédire la réactivité de l'ovaire à la fsh et son utilisation
WO2020080739A1 (fr) Composition pour le diagnostic de l'hyperprolactinémie, et procédé pour fournir des informations permettant de prédire une réponse à un traitement médicamenteux
WO2022031072A1 (fr) Composition de diagnostic du cancer du pancréas destinée à être utilisée dans un échantillon de couche leucocytaire
WO2022119243A1 (fr) Kit pcr pour diagnostiquer l'asthme ou l'exacerbation de l'asthme et procédé pour fournir des informations pour diagnostiquer l'asthme ou l'exacerbation de l'asthme l'utilisant
WO2022039565A1 (fr) Biomarqueur pour le diagnostic d'une dégénérescence maculaire liée à l'âge et utilisation associée
WO2021025412A1 (fr) Méthode de diagnostic de la maladie d'alzheimer au moyen du composant c8 gamma du complément
WO2017007275A1 (fr) Composition pour la détermination d'un phénotype nasal
WO2014014157A1 (fr) Utilisation de l'adcy3 pour diagnostiquer et traiter le cancer de l'estomac
WO2022119204A1 (fr) Analyse ciblée du génome pour prédire l'efficacité d'un agent immunothérapeutique contre le cancer, y compris l'identification de l'ebv
WO2022025387A1 (fr) Biomarqueur pour diagnostiquer une stéatohépatite non alcoolique à l'aide d'une combinaison de miarn
WO2012060636A2 (fr) Procédé pour le diagnostic du cancer de l'estomac
WO2021107713A1 (fr) Procédé de diagnostic de la sclérose latérale amyotrophique sur la base d'un marqueur de mutation du gène lats1
KR102162110B1 (ko) 고프로락틴혈증의 진단용 조성물 및 약물 치료의 반응성을 예측하기 위한 정보를 제공하는 방법
WO2012002598A1 (fr) Amorce et sonde pour le diagnostic de la tuberculose, trousse comprenant celles-ci et méthode de diagnostic de la tuberculose à l'aide de la trousse
WO2020204313A1 (fr) Marqueur snp pour diagnostiquer un anévrisme cérébral, comprenant un polymorphisme monobasique du gène gba
WO2020242082A1 (fr) Procédé pour diagnostiquer un cancer de l'estomac par l'intermédiaire d'une analyse pcr en temps réel
WO2022045768A1 (fr) Biomarqueur micro-arn pour prédire une réponse médicamenteuse à des antidiabétiques et utilisation associée
WO2019093585A1 (fr) Biomarqueur pour le pronostic de résultat d'une thérapie au lénalidomide et à la dexaméthasone chez des patients présentant un myélome multiple
WO2024143779A1 (fr) Composition pour détecter les espèces bactériennes dominantes dans l'infection de l'articulation périprothétique et son utilisation
WO2023158207A1 (fr) Biomarqueur d'arn long non codant dans des exosomes pour diagnostiquer une fibrillation auriculaire et son utilisation
WO2023043257A1 (fr) Composition pharmaceutique pour la prévention ou le traitement de l'arthrose, contenant un régulateur de smpd1 en tant que principe actif
WO2020242081A1 (fr) Méthode pour diagnostiquer une colite par l'intermédiaire d'une analyse de réaction de polymérisation en chaîne quantitative (qpcr)
WO2022019626A1 (fr) Procédé de criblage d'inhibiteur de métastase du cancer colorectal
WO2021029462A1 (fr) Composition pour la prédiction ou le diagnostic de l'hypertension ou de l'obésité

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 19872758

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 19872758

Country of ref document: EP

Kind code of ref document: A1