WO2020071524A1 - Automatic expression control colony assay method - Google Patents

Abstract

The present invention provides a colony assay method in which it is possible to automatically induce expression following colony formation and automatically stop expression after expression has occurred, the method being an "automatic expression control colony assay method" whereby screening for the expression of a functional protein that recognizes a target such as an antibody can be easily and reliably performed. The method is characterized in that neither glucose nor an expression inducer is added to a solid microorganism nutrient medium, and sugar or an expression inducer such as IPTG is added in an optimal range, along with glucose, to a microorganism inoculation liquid. In addition, the detection process can be made faster and easier by using an expression library in which alkaline phosphatase (AP) has been fused to the N-terminal of the protein.

Description

Expression Controlled Colony Assay

The present invention relates to an improved colony assay method suitable for expression screening of a functional protein recognizing a target, which is capable of automatically inducing expression after colony formation and automatically stopping expression after expression. Automated control colony assay ".

Monoclonal antibodies are proteins that have high affinity and specificity for antigens and are indispensable for research, diagnosis, and medicine. Therefore, there is a demand for a monoclonal antibody having higher affinity and specificity. In addition, the need for monoclonal antibodies having not only high affinity and specificity for antigens but also functions such as neutralizing antibodies that inhibit the function of antigens is increasing.
In accordance with the speed of such research and drug development, it is required to rapidly establish a monoclonal antibody having desired properties against the target antigen, and the conventional antibody production method using a hybridoma requires this. Cannot respond to needs and speed. As an alternative, antibody production methods using recombinant techniques have become important.

Recombinant antibodies can be engineered using molecular biology techniques, such as fusion with various effector molecules and tags, antibody-drug conjugates, production of multiple recognition antibodies and humanization of antibodies, Affinity maturation technology that introduces mutations and improves specificity / affinity for antigens will be more useful.
In the method of establishing a recombinant antibody, a monoclonal antibody is established by producing and expressing an antibody gene library and screening using the antigen-binding property as an index. Of the recombinant antibodies, single-chain antibodies (scFv) are small and relatively easy to handle, and are often used for screening. It can be changed to IgG as appropriate by establishing it in the form of scFv and using recombinant technology.
Compared with the conventional hybridoma method, large libraries can be handled, screening under various conditions is possible, and it is easy to add functions by engineering technology.In addition, it is possible to establish monoclonal antibodies in a shorter time. It has become possible.

The main methods for establishing antibodies using recombinant techniques are roughly classified into a display method and a colony assay method. The former method involves panning a large library of displayed antibody fragments and genes in association with antigens and selecting antibody fragments that bind to the antigens. It has the advantage that it can handle libraries (10 ⁹ to 10 ¹¹ ) and can also handle artificial libraries. However, the background derived from large phages is much higher than antibodies, and there are many false positives in the clones obtained because the antigen-antibody binding is not directly observed during screening. Therefore, it is difficult to establish a useful monoclonal antibody only by repeating panning.
In addition, an essential problem is that the antibody fragment is a large burden on the growth of Escherichia coli. In other words, clones expressing antibody fragments that are not toxic to the growth of Escherichia coli grow well, so during repeated panning, selection is performed based on the ease of growth of Escherichia coli rather than binding to antigen, Rather than enriching (selecting and amplifying) clones with high antigen specificity, it is often possible that clones that are not toxic to Escherichia coli will selectively grow and become dominant populations.

In the phage display method, panning is repeated in order to select and amplify positive clones.During this time, E. coli undergoes generations, resulting in the fatal disadvantage that unintended clones are very easy to be selected and amplified as described above. There is. In the phage display method, positive clones cannot be concentrated without repeated panning, and this is an unavoidable problem.
Similar problems include the ribosome display method and the two-hybrid method using yeast, as well as the mRNA display method (Non-Patent Document 1) that can handle a larger library, particularly widely applied to “artificial evolution” of proteins, drug discovery, etc. It is also present in some in vitro virus methods.
Therefore, these display methods have been expected to have great potential, but their practical application and application have not progressed as much as expected.

As another technique for establishing an antibody using a recombinant technique, a colony assay (colony lift assay) is widely known.
As shown in FIG. 1, the colony assay (colony lift assay) is a technique in which an antibody gene library is expressed in Escherichia coli, yeast, etc. to form a colony, and a clone with good antigen-binding properties is selected ( Non-patent documents 3, 4). Transformed E. coli was inoculated at high density on a filter on the surface of the medium, and allowed to grow sufficiently to generate an E. coli colony.Then, after removing the filter, superimposing it on a membrane on which the target antigen was adsorbed, It is moved to the surface of the selection medium containing the expression inducer. In the initial colony lift assay, a step of transferring the colony formed on the surface of the nutrient medium to a nitrocellulose membrane and overlapping the membrane with the target antigen adsorption was employed. In order to distinguish it from the earlier techniques, the technique is sometimes referred to simply as "colony assay". However, since there is still a lift step for removing and moving the colony forming filter, the term “colony lift assay” is used herein.

The colony lift assay is a screening method in which a colony producing an antibody fragment having an antigen-binding property is identified, an antibody gene is isolated from the colony, and a monoclonal antibody is established. Therefore, there is an advantage that there is no false positive. In addition, although not as large as the display method, it can handle a much larger library (about 10 ⁶ to 10 ⁷ ) than the hybridoma method.
On the other hand, complicated long-term operations are required, antibodies are not expressed or expression is often very low, contamination occurs due to complicated operations, and Escherichia coli is killed during operation. Therefore, there is a problem that a situation such as a failure to collect the gene may occur. There are papers showing the potential of this method, but it has not been widely applied. It is considered that these problems are caused by difficulty in setting the timing of expression (the growth state of E. coli is important). This colony lift assay was combined with an immunochemiluminescence labeling system to increase sensitivity, and a _VH library created using the heavy chain CDR3 binding specificity determinant and a _VH library created using the light chain CDR3 binding specificity determinant. A technique (Patent Document 1) has been proposed in which the combination with an _L library is applied to Fab protein screening.

Dreher and colleagues have improved this colony lift assay and developed a Filter-sandwich assay that eliminates colony lift by forming colonies expressing antibody fragments on the filter. Escherichia coli is inoculated on a hydrophilic filter prepared on a plate to form a colony. The filter having formed the colony is placed on an antigen-coated membrane placed on a plate containing an expression inducer. When the antibody fragment produced by Escherichia coli has antigen-binding properties, a positive clone is identified by detecting that it binds to an antigen on the membrane. By this method, the assay became possible without performing the operation of a colony lift, which is difficult and has many failures (Non-Patent Document 4, etc.).

Um Also, Kumada et al. Report a method of forming a colony directly on the surface of an agar medium instead of the surface of a filter in order to omit the movement of a colony filter (Non-Patent Document 5 and the like). Specifically, the transformed E. coli is expressed on the surface of an agar selection medium containing an expression inducer to form a colony. The target antigen-adsorbed membrane is coated directly or via a hydrophilic membrane on the colonies on the agar surface, and reacted with antibodies secreted from the colonies. The binding property to the antigen on the blotted membrane is detected with a peroxidase-encapsulating antibody-bound liposome or the like, and the detected spot is made to correspond to the colony, and a positive colony on the agar surface is collected. Since the expression inducing agent is included from the beginning during the culture, there is an advantage that there is no complicated step such as moving colonies, but the presence of the expression inducing agent inhibits the growth of Escherichia coli. Since the whole E. coli is covered with the membrane during the blotting, the growth environment of E. coli is changed from an aerobic environment to an anaerobic environment, which also causes the growth to deteriorate. Inhibition of E. coli growth not only increases the screening time, but also increases the probability of mutations in promoters and expression products during that time, increasing the possibility that the desired antibody cannot be obtained. Is not suitable. Moreover, no gene is recovered in this method.

Further, improved techniques for obtaining human Fab fragments highly expressing hybridoma lines with high affinity assay using microtiter plates coated with antibody reagents for capturing is a kind of the hybridoma method "CellSpot ^TM assay" is It has been developed and proposed to be applied to a recombinant bacterium that secretes an antibody library (Patent Document 2). Specifically, the antibody secreted from the E. coli microcolonies on the plastic membrane with a clearly visible hole in the plastic membrane for forming E. coli colonies on the top layer is bound to the capture antibody-coated membrane placed on the agar medium layer. This indicates that the detection step by the “CellSpot ^™ assay” can be applied. However, there is no description of the step of growing to a microcolony.

The present inventors, while leaving the advantage of a colony lift assay with few false positives, eliminating the need for a lift step that causes contamination and stress of Escherichia coli and also causes expression inhibition, allows simple and rapid high-activity We have been conducting intensive research to develop a new colony assay that can screen antibodies with good reproducibility, and have found a solution using an agar plate with a concentration gradient of an expression inducer, which we have named the "One-Step Colony Assay" method (Patent Reference 4).
Specifically, by changing the amount of the expression inducing agent in the selection medium to form a layered agar plate, the transformed cells do not come into contact with the expression inducing agent until the transformed cells have sufficiently grown, so that they can grow sufficiently. When a colony is formed, it comes into contact with an expression inducer that has gradually reached the surface of the culture medium by diffusion to initiate antibody production. As a result, it was possible to perform an assay on a colony in a growth process with good expression, and it was possible to more efficiently establish a high-affinity and high-selectivity antibody. In addition, since production of an antibody that burdens the growth of the bacterium starts at the stage when the bacterium is sufficiently matured, the final concentration of the expression inducing agent can be set high and the expression amount can be increased, so that an antibody having a high binding activity can be obtained. However, there is also an advantage of picking up a large number of clones having a low expression level, and conversely, a clone which may not be able to withstand the burden of expression due to high expression and may die.

The “One-Step Colony Assay” method of the present inventors has made it possible to easily and quickly screen highly active antibodies, and has successfully established antibodies with high affinity and high selectivity.
However, one of the drawbacks of this method is that it is difficult to precisely adjust the concentration of the expression inducer. Since the growth status of colonies differs for each target transformant cell library, the concentration gradient of the expression inducing agent for setting the optimal timing of expression initiation, especially when applying to new transformed cells, must be determined in advance. It is difficult to decide.
The second disadvantage is that it is difficult to set the detection time by the antigen-antibody reaction, and the skill of the detection is required. In this method, the action of the expression inducing agent increases over time, so that active antibody production occurs continuously while waiting for the detection result, and some clones with high expression strength die and cannot bear the burden of expression. there is a possibility. In that case, it may be impossible to collect a useful clone. Therefore, it is necessary to set an optimal detection time while visually confirming the growth state of the colony, detect it as soon as possible, and obtain a desired positive clone.
Further, as another drawback, the problem of so-called "leak expression" in which antibody expression occurs in a colony in the growth process before encountering an expression inducer has not been solved. Immediately after plating or in the early stage of colony formation, Escherichia coli is vulnerable, and if "leak expression" of the antibody occurs, it may not grow due to the burden, or colonization may take a long time. In such a case, even if a clone expresses an antibody having excellent antigen recognition (specificity and affinity), it cannot be selected by screening, leading to a substantial reduction in the effective library size.

In addition, the present inventors have also developed a "Single-step colony assay" method as a method for more reliably controlling the expression induction timing and intensity (Non-Patent Document 7). Agar plate, antigen-coated membrane, hydrophilic filter are overlaid, transformed E. coli containing the antibody gene library is spread on the filter, and when the colony size is optimized, the expression inducer is sprayed with a spray to express the antibody This is the method of inducing.
However, this method is not a general method because it is necessary to constantly observe the growth state of the colony. In addition, this method does not solve the problem of "leak expression".

Therefore, the “One-Step Colony Assay” method, which can screen high-activity antibodies easily and quickly, solves the problem of “leak expression” and makes it easier and more automated to set the optimal expression start time and detection time. It is an object of the present invention to provide a further improved colony assay, if possible.

Japanese Patent No. 4782700 Japanese Patent Publication No. 2009-544014 JP 2013-2333096 A JP 2017-73995 A

An object of the present invention is to provide an improved colony assay that can be referred to as an “expression automatic control colony assay” in which the setting of an optimal expression start time and a detection time is simpler and can be automated, and “leak expression” is suppressed. It is in.

The present inventors have keenly developed a method for providing a colony assay method in which the optimal expression induction time and detection time can be automatically set without visually observing the growth state of colonies, and furthermore, leak expression is suppressed. Studied. As a result, they came to the conclusion that it is necessary not only to automatically start the induction of expression but also to automatically suppress expression and stop the induction of expression. Then, as in various conventional improved colony assays, the idea of adding an expression inducing agent to the medium component was discarded, and the medium component was changed to an agar medium set as a normal nutrient medium (LB medium, etc.). I came up with the idea of devising a seeding solution for seeding transformed E. coli containing an antibody gene library. Specifically, the medium component side of the transformed Escherichia coli does not add any expression inducing agent such as glucose or saccharides, and the growth of the bacteria is achieved by adding an expression inducing agent such as lactose together with glucose to the seeding solution for seeding. Thus, the present inventors came to realize that simple and reliable antibody screening can be carried out with almost no change in the procedure of the conventional colony assay by the method of controlling antibody expression (FIG. 3). In other words, the present inventors have applied for the first time the principle of catabolite suppression, which has been employed in a mass production technique using a tank culture of a recombinant protein by transformed Escherichia coli, to an antibody screening system by a colony assay. become.

In a gene expression system under the control of a glucose metabolism promoter such as the lactose operon, transcription from the promoter is controlled not only by a promoter activator such as lactose but also by a cAMP-dependent transcriptional activator protein (CAP). Glucose inhibits cAMP synthesis. Therefore, in the presence of glucose, the intracellular cAMP concentration is kept low, and transcription is suppressed (catabolite suppression) even in the presence of a promoter activator such as lactose.
In the present invention, by mixing glucose in the diluent instead of the medium, consumption of only glucose occurs immediately when the bacteria are seeded on the filter, and rapid growth of Escherichia coli starts, while the conventional problem was `` The occurrence of "leak expression" does not occur. When glucose is almost completely consumed, the induction of antibody expression depending on the activation of the promoter by lactose or the like starts, but at the same time, lactose itself is gradually consumed as a nutrient by Escherichia coli, and there is no supplementation from the medium. Its expression induction is transient.
Among the expression inducers, the sugar analog IPTG (Isopropyl β-D-1-thiogalactopyranoside) is not metabolized in cells like sugar, It is known that the ability to bind to a promoter is lost by acetylation (Non-Patent Document 8). Therefore, even when IPTG is used, it is the same as saccharides in that the effective concentration decreases with time and expression induction becomes transient unless supplemented from the medium.
Although the transient expression of this antibody was not originally intended by the present inventors, as a result, it worked very effectively in the antibody detection system in antibody screening. Unlike the antibody production system, the amount of expressed antibody required in the antibody detection system is extremely small, so transient expression is sufficient, and the antibody expression level decreases promptly after detection, which leads to colony growth. Has a limited adverse effect, making it possible to assay almost all clones having antibody-producing ability.

As described above, in the present invention, by adding an expression inhibitor called glucose and an expression inducer such as IPTG and lactose to only the seeding solution, it is possible to suppress leak expression and achieve transient expression of the expression inducer. As a result, it was possible to perform an assay on a colony in a developing process with good expression, and it became possible to perform an assay on all clones capable of producing antibodies. Therefore, it has become possible to more efficiently establish antibodies with high affinity and high selectivity.

Further, in the present invention, a detection method for simultaneously identifying and cloning positive clones using an antibody expression library in which alkaline phosphatase (AP) is fused to the N-terminus has been developed. It became possible to obtain antibodies.

Prior to the present invention relating to the “automatic expression control colony assay method”, the present inventors described the “One-Step Colony Assay” method (Patent Document 4) and the “Single-step Colony Assay” method (Patent Document 7). Has been developed. All of these techniques can be said to be techniques for directly identifying an antibody while simultaneously identifying a positive clone producing the target protein using a microorganism transformed with the gene library as a colony. The method of identifying positive clones using an antibody expression library obtained by fusing alkaline phosphatase (AP) to the N-terminus, which has been newly developed, can be applied to any of these techniques. Therefore, the present inventors have generically named all these techniques as “antibody direct cloning method (DC)”.
That is, when the term “antibody direct cloning method (DC)” is used, the “One-Step Colony Assay” method, “Single-step colony assay” method, “Expression-controlled colony assay method”, and AP fusion antibody expression in these methods. Refers to all methods using a detection technique using a library.

That is, the present invention is as follows.
[1] An automatic control colony assay for expression of a functional protein that recognizes a target,
(1) (a) A membrane on which a target recognized by the protein is adsorbed or coated is placed on the upper surface of a solid nutrient medium for microorganisms that does not contain glucose and an expression inducer, and (c) a colony is further placed on the upper surface. Mounting a forming filter,
(2) seeding a microorganism transformed with the protein gene library on the surface of (c),
(3) binding the antibody expressed and secreted from each colony formed on the colony filter to a target antigen in the form of an antigen membrane;
(4) a step of detecting the binding activity to the target antigen on the antigen membrane as a label spot, and (5) a step of overlapping the label spot on the antigen membrane with the colony on the colony filter to select a positive clone,
Including
Here, the method is characterized in that the seeding solution for seeding the microorganism in step (2) contains (i) glucose and (ii) an expression inducer.
[2] The method of the above-mentioned [1], wherein the expression inducer (ii) contained in the inoculum is lactose, arabinose, rhamnose or IPTG.
[2] can also be described as follows.
[2 '] When the gene in the gene library in step (2) is under the control of the lac promoter, the expression inducing agent is lactose or IPTG, and when the gene is under the control of the arabinose promoter, the expression inducing agent is arabinose. Wherein the expression inducing agent is rhamnose when the gene is under the control of a rhamnose promoter.
[3] The seeding solution for seeding the microorganism in step (2) is:
(I) glucose at a concentration of 0.02-0.2%, and (ii) lactose, arabinose or rhamnose at a concentration of 0.05-0.2%, or ITPG at a concentration of 0.05-0.5 mM;
The method according to the above [2], comprising:
[4] The protein gene library in step (2) is a protein gene library obtained by fusing alkaline phosphatase (AP) to the N-terminal of the protein,
The method according to any one of the above [1] to [3], wherein the labeled spot in the step (4) is a labeled spot based on an AP color reaction.
In addition, using this AP fusion protein expression library, an AP expression screening method using a detection method using an AP color reaction is not limited to the “automatic expression control colony assay method” according to the present invention, but may be a conventional colony assay method. Because the technique is generally applicable to direct cloning (DC), it can also be described as follows.
[4 ']
A direct cloning method (DC) for screening a functional protein that recognizes a target,
(1) A step of (a) mounting a membrane on which a target recognized by the protein is adsorbed or coated on the upper surface of a solid nutrient medium for microorganisms, and further mounting (c) a filter for colony formation on the upper surface. ,
(2) inoculating the colony-forming filter surface of (c) with a microorganism transformed with a gene library in which AP is fused to the N-terminal of the protein,
(3) binding the antibody expressed and secreted from each colony formed on the colony filter to a target antigen in the form of an antigen membrane;
(4) a step of detecting a label spot by an AP color reaction obtained by adding an AP color substrate on the antigen membrane; and (5) superimposing the label spot on the antigen membrane with the colony on the colony filter, Selecting clones,
Including, methods.
[5] A functional protein that recognizes the target is an antibody, the target that the protein recognizes is an antigen or a peptide or a sugar chain that is an epitope thereof, and the recognition reaction step with the target is an antigen-antibody reaction step The method according to any one of the above [1] to [4].
[6] The method according to [5], wherein the antibody is a single-chain antibody (scFv) or a Fab antibody.
[7] The method according to any one of [1] to [6] above, wherein the transformed microorganism is transformed Escherichia coli.
[8] A seeding solution for seeding a microorganism transformed with a gene library of the protein on a filter for colony formation in an automatic control colony assay for expression of a functional protein recognizing a target, a seeding solution containing i) and (ii);
(I) glucose, and (ii) an expression inducer.
[9] The seed solution according to [8], wherein the expression inducer of (ii) is lactose, arabinose, rhamnose or IPTG.
[9] can also be described as follows.
[9 ′] When the gene in the gene library contained in the transformed microorganism is under the control of the lac promoter, the expression inducing agent is lactose or IPTG, and when the gene is under the control of the arabinose promoter, the expression inducing agent is The inoculum according to [8], wherein arabinose is used, and when the gene is under the control of a rhamnose promoter, the expression inducing agent is rhamnose.

In the colony assay method of the present invention, since the setting of the optimal expression start time and detection time is easier, the expression can be automatically started and stopped, and it is not necessary to monitor the colony formation state of Escherichia coli. No need to work.
In addition, since leak expression before colony formation can be avoided, all Escherichia coli having antibody-producing ability can form colonies. At that time, since the expression can be induced with the highest efficiency, the sensitivity of the assay can be increased, many positive clones can be identified, and the killing of E. coli during the assay and the mutation / deletion of the antibody gene from E. coli can be avoided. As a result, the assay can be performed using a large, high-quality library. Therefore, it has become possible to more efficiently establish an antibody having high affinity and high specificity.
Furthermore, by developing a method for identifying positive clones using an antibody expression library in which alkaline phosphatase (AP) is fused to the N-terminus, it has become possible to obtain the target antibody more simply and quickly.

Conventional method 1: colony lift assay Conventional method 2: "One-Step Colony Assay" method Procedure of "Expression Controlled Colony Assay" Method of the Present Invention Procedure of improved method using AP fusion protein Conventional detection method using secondary antibody detection Improved detection method using AP coloring Structure of AP fusion scFv expression vector Positive clone detected using antibody library Characterization of positive clones screened from the antibody library: sequence {in the figure, underlined parts indicate linkers. The N-terminal side (upstream) of the linker is VH, and the C-terminal side (downstream) of the linker is VL. Characterization of positive clones screened from antibody libraries: ELISA Positive clone detected using AP fusion antibody library Characterization of positive clones screened from the AP fusion antibody library: sequence {in the figure, the underlined part indicates a linker. The N-terminal side (upstream) of the linker is VH, and the C-terminal side (downstream) of the linker is VL. Characterization of positive clones screened from AP fusion antibody library: ELISA

1. Regarding "Expression Controlled Colony Assay" The improved colony assay of the present invention is also referred to as "Expression Controlled Colony Assay" or "Expression Controlled Colony Assay". The "expression automatic control colony assay" method is basically a method based on a colony assay method that has been widely used in the past, and thus the following description will focus on differences from the conventional method.
The protein or peptide library to be screened in the present invention may be any protein or peptide that can be expressed by transformed cells. In the following description, an antibody (scFv) library is mainly described, but the present invention is not limited to an antibody (scFv) library.

(1-1) Conventional colony assay method (1-1-1) Procedure of conventional colony lift assay (Non-Patent Documents 2 and 3) (FIG. 1).
A conventional colony lift assay is typically performed by the following procedure, as described in Non-Patent Documents 2 and 3, for example.
(1) a step of preparing an Escherichia coli, yeast or the like transformed with an antibody (scFv) library,
(2) laying a hydrophilic filter on the surface of a nutrient medium for growth, inoculating transformed Escherichia coli and yeast at a high density, and allowing them to grow sufficiently to generate colonies,
In the initial colony lift assay (Patent Literature 1), a step of copying colonies onto a nitrocellulose membrane or the like is further required in order to inoculate and grow transformed Escherichia coli and yeast directly on the surface of a nutrient medium. In addition, since the reaction with the antigen on the antigen membrane surface is an antibody secreted by the copied colonies on the membrane surface, it is necessary to invert the label spot when selecting a positive clone.
(3) a step of preparing an antigen membrane (membrane) on which the target antigen has been adsorbed or coated,
(4) removing the filter that formed the colonies, in the state of being superimposed on the antigen membrane, the step of moving to the surface of the expression inducer-containing selection medium,
(5) after culturing in an expression-inducing agent-containing selection medium, expressed in each colony by the action of the expression-inducing agent, binding the antibody that has been secreted to the target antigen on the membrane,
(6) removing the filter having formed a colony, and storing on a medium,
(7) detecting the binding activity with the target antigen on the antigen membrane as a labeled spot,
(8) A method in which a labeled spot on an antigen membrane and a colony on a colony filter are overlapped to select a positive clone.

(1-1-2) Procedure of One-Step Colony Assay (Fig. 2)
The one-step colony assay is a method developed by the present inventors as an improved method of the conventional colony lift assay (Patent Document 4). Screening of antibodies was made possible.

(1) a step of preparing an Escherichia coli, yeast or the like transformed with an antibody (scFv) library,
(2) preparing a target antigen-adsorbed or coated antigen membrane,
(3) a step of preparing a nutrient medium containing an expression inducer (such as IPTG) with a concentration gradient,
(4) The antigen membrane of (2) is placed on the surface of the nutrient medium containing the expression inducer of (3), and the transformed Escherichia coli and yeast of (1) are further densely placed on a colony filter provided thereon. Sowing process,
(5) a step of binding the antibody that has been expressed and secreted from each colony formed on the colony filter to the target antigen on the antigen membrane,
(6) detecting the binding activity with the target antigen on the antigen membrane as a labeled spot,
(7) A method in which a labeled spot on an antigen membrane and a colony on a colony filter are overlapped to select a positive clone.

As described above, the one-step colony assay (One-Step Colony Assay) is as shown in (FIG. 2). Is omitted. In other words, the main feature is that an appropriate concentration gradient is provided for an expression inducer (such as IPTG) to be contained in a nutrient medium for growth in order to omit the colony lift step.
Therefore, the antibody detection assay steps, such as a method for preparing a target antigen-coated membrane and a method for detecting a labeled spot using the antigen membrane, are based on the previous colony lift assay ( Non-Patent Documents 2 and 3, Patent Document 1, etc.), phage display, All the methods used in the hybrid method and the like can be diverted. Further, the present invention can be directly applied to antibody libraries prepared for these assays.

(1-2) Procedure of Expression Controlled Colony Assay of the Present Invention (FIG. 3)
The expression control colony assay of the present invention is used to prepare an inoculum such as E. coli or yeast transformed with an antibody (scFv) library for inoculation on a filter, and specifically, to inhibit expression in a conventional inoculum. In addition to glucose acting as an agent, lactose, IPTG and other expression inducers are added in trace amounts in the optimum concentration range, and the transformed Escherichia coli in the inoculum is seeded on a filter on the surface of the medium. It is an invention. Therefore, other procedures are performed in substantially the same manner as the one-step colony assay. That is, the following procedure shown in FIG. 3 is performed.
(1) a step of preparing an Escherichia coli, yeast or the like transformed with an antibody (scFv) library,
(2) a step of preparing a seeding solution containing glucose and an expression inducer at a specific mixing ratio,
(3) preparing a target antigen-adsorbed or coated antigen membrane,
(4) a step of preparing a normal nutrient solid medium (such as an LB medium),
(5) The antigen membrane of (2) was placed on the surface of the nutrient medium of (3), and a colony filter was further provided thereon, and the transformed Escherichia coli of (1) suspended in the inoculum of (2) , A step of inoculating yeast at a high density on a colony filter,
(6) a step of binding the antibody that has been expressed and secreted from each colony formed on the colony filter to the target antigen on the antigen membrane,
(7) detecting the binding activity with the target antigen on the antigen membrane as a labeled spot,
(8) A method in which a labeled spot on an antigen membrane and a colony on a colony filter are overlapped to select a positive clone.

Therefore, in the present invention, a method for preparing an antibody (scFv) library used in each step other than a method for preparing a seed solution, a method for preparing a target antigen-coated membrane, a method for detecting a labeled spot using the antigen membrane, a colony preservation method, For the series of steps leading to the acquisition of a useful antibody-producing clone such as a positive clone identification method, the procedure of the one-step colony assay method described in (1-1-2) can be applied mutatis mutandis.

(1-3) Procedure of improved expression control colony assay of the present invention (FIG. 4)
The basic procedure of the improved expression control colony assay of the present invention is performed according to the steps shown in the above (1-2), but the antibody (scFv) library in the above step (1) is used as An AP fusion antibody (scFv) library obtained by fusing alkaline phosphatase (AP) to the N-terminal of scFv) is used. The AP can be made into a fusion protein with scFv by a method according to the method of Harper et al. (K. Harper, et al. Journal of Virological Methods 63 (1997) 237-242). K. Harper et al. Fused the AP to the C-terminal side of the scFv, but we fused the AP to the N-terminal side of the scFv. The AP gene sequence is available under accession number EG10727. A modified AP gene in which the 153rd amino acid residue Asp is substituted with Gly and the 330th amino acid residue Asp is substituted with Asn may be used (Patent No. 3560972, WO2015056659A1).
By using the AP fusion antibody (scFv) library, it became possible to directly detect the binding activity to the target antigen on the antigen membrane in the above step (7) by a color development reaction of AP. The specific procedure is as shown in (FIG. 4), and the difference in the detection step from the conventional detection method using a secondary antibody is shown in FIG. 5 and FIG.

2. Preparation of target protein of the present invention and library thereof (2-1) Target protein of the present invention The target protein of the screening of the present invention is a "functional protein that recognizes a target", that is, a "protein having excellent binding activity". It is. Since an antibody is typically an antibody, the present specification mainly describes "antibody", but is not limited to an antibody. If the protein has a binding activity to the target, a protein having excellent binding activity can be obtained by applying the following method described for the “antibody” using the binding activity. The "target antigen" to be bound by the "antibody" may be any "antigen", but typically, is a bioactive protein such as a membrane protein such as a receptor or a channel, a ligand, or a toxin. , Pathogenic bacteria and the like.
Here, the term “antibody” in the present invention refers to an antibody fragment that can be expressed mainly in Escherichia coli in addition to IgG or an antibody in which one or more domains have been deleted, and includes a single-chain antibody (scFv), Fab , Fv, Fab ′, F (ab ′) ^2, etc., and particularly scFv. Antibodies having sequences derived from mammals such as humans are preferred, but not limited thereto.
The “protein having excellent binding activity” other than the “antibody” includes DNA binding proteins, peptides, proteinA, and the like.

(2-2) Kinds of Transformation Host and Transformation Method Any microorganism or yeast can be used as a host as long as it is a colony-forming microorganism and effective in suppressing catabolite. Specifically, bacteria of the genus Bacillus such as E. Coli (Escherichia coli) and B. megaterium, bacteria such as the genus Brevibacillus, other bacteria, Saccharomyces cerevisiae, yeasts of the genus Pichia and Candida, particularly Escherichia coli are preferred.
Note that many microorganisms have a catabolite suppression mechanism, and when glucose and other saccharides are present in the growth environment, glucose is preferentially metabolized. Therefore, when the inducer of protein expression is a saccharide, expression is suppressed while glucose is present, and metabolism of the saccharide of the inducer starts after glucose metabolism, and expression occurs with a delay.
Methods for transforming hosts and expression vectors suitable for each host are known to those skilled in the art.
As the transformation method, an appropriate method such as a chemical transformation method using calcium chloride or an electroporation method can be selected.
However, the expression vector used in the present invention needs to have a transcription mechanism under the control of a saccharide metabolism promoter, which is a transcription mechanism in which a catabolite suppression mechanism works. Preferred expression vectors in the case of Escherichia coli include a pET vector, a pGEX vector and the like.

(2-3) Library Preparation Method Hereinafter, an antibody library for screening an antibody having high affinity and specificity as a target protein of the screening of the present invention, among which a scFv library which is a typical antibody library The production method will be described in detail, but the library of the present invention is not limited to the scFv library. A screening library for other “proteins having excellent binding activity” can be prepared in the same manner. Further, the host cell for transforming the library is not limited to E. coli.

(2-3-1) Collection of antibody genes from immunized animals Sources of antibody genes include rodents such as mice, rats, rabbits and the like, primates such as monkeys, as well as sheep, goats, cows and camels. And large mammals such as llamas, and their spleens, peripheral blood mononuclear cells (PBMC), lymphocytes, B cells and the like can be used.
In this example, rat, rabbit spleen, or rabbit PBMC was used, but not limited thereto.

(2-3-2) Method for preparing scFv library In order to prepare an scFv library, after preparing an antibody heavy chain gene-derived _VH gene and a light chain gene-derived _VL gene, an appropriate linker is prepared. And incorporated into an expression vector. In preparing an scFv library, it is important to incorporate it into a vector so that mutation, deletion, and shift do not occur in the _VH and _VL genes. Furthermore, since there are parts of the gene that have great diversity (antigen recognition part: CDR part), it is necessary to create a scFv library while maintaining that diversity and not hindering its creation. is there. Conventionally, there are mainly the following two methods.
(A) Two-step cloning: amplified by V _H and V _L, respectively PCR method, by inserting the first V _L into a vector to produce a V _L library increased in E. coli, then insert the V _H into the vector How to create a scFv library.
(B) One-step cloning ( _VH - _VL assembly): A method in which _VH and _VL are respectively amplified by PCR and then ligated, and the ligated product is incorporated into a vector to prepare a scFv library. In particular, the joining method of the V _H and V _L genes, C-end side of the V _H, and addition of a linker region to the N-terminal of the V _L, overlap PCR reaction (SOE-PCR utilizing overlapping of the linker moiety: Splicing by overlap extension-PCR) by V _H, a method of connecting the V _L has been widely used.

In the ordinary phage display method and the conventional colony assay method, the simple and quick method (b) is often used for construction of an scFv expression vector, but has a disadvantage that a gene mutation is easily introduced. The present inventors recently developed the “λ exonuclease method” (Non-patent Document 6, Patent Document 3) corresponding to the improved method (b) as a method for constructing a scFv library for phage display. In the “λ exonuclease method”, without using SOE-PCR, using a λ exonuclease and a 3′- and 5′-terminal S-primed primer to prevent non-specific reaction of λ exonuclease .
In the construction of the scFv library by the expression control colony assay method of the present invention, other antibody library construction methods such as “One-step cloning” of (b) using conventional SOE-PCR can be applied, It is particularly preferable to employ the “Two-step cloning method” of a) or the “λ exonuclease method” developed by the present inventors.

(2-3-3) Regarding “Two-step cloning method” The procedure of “Two-step cloning method”, which is one of the particularly preferable methods to be employed in the expression-controlled colony assay of the present invention, will be briefly described below. Will be described.

<Preparation of _VL library>
The _VL library and vector amplified and purified by PCR were each sufficiently digested with NheI and NotI at 37 ° C. for 2 hours or more, purified, and then ligated between the _VL library and vector. Then, a DH5α competent cell (Nippon Gene Co., Ltd.) capable of stably storing genes was transformed with a ligation solution, seeded in LB agar medium containing ampicillin, and colonies were formed to prepare a _VL vector library. .

<ScFv library preparation>
After V _L library of vectors obtained above purified plasmid, V _H library and V _L vector library amplified by PCR chromatography is over sufficient time for each 37 ° C. over 2 hours with NcoI and KpnI cut, was Ligation of V _H library and V _L vector library. BL21 (DE3) competent cell (Nippon Gene) was transformed with the ligation solution, seeded in LB agar medium containing ampicillin, colonies were formed, and an scFv library expression vector was prepared.

<Preparation of _VL library for AP-scFv>
The _VL library and vector amplified and purified by PCR were each sufficiently digested with NheI and NotI at 37 ° C. for 2 hours or more, purified, and then ligated between the _VL library and the vector into which the AP gene was inserted. Then, a DH5α competent cell (Nippon Gene Co., Ltd.) capable of stably storing genes was transformed with a ligation solution, seeded in LB agar medium containing ampicillin, and colonies were formed to prepare a _VL vector library. .

<AP-scFv library preparation>
After V _L library of vectors obtained above purified plasmid, V _H library and V _L vector library amplified by PCR chromatography is over sufficient time for each 37 ° C. over 2 hours with NcoI and XhoI cut, was Ligation of V _H library and V _L vector library. BL21 (DE3) competent cell (Nippon Gene) was transformed with the ligation solution, seeded on LB agar medium containing ampicillin, and colony was formed to prepare an AP-scFv library expression vector. The structure is shown in FIG.

(2-3-3) λ exonuclease method The present inventors have recently developed a scFv library construction method using λ exonuclease (Non-patent Document 6, Patent Document 3). Very suitable for construction.
The construction method is as described in (Non Patent Literature 6, Patent Literature 3), but specifically, the following procedure is used.
(1) V _H gene, the V _L gene by adding a linker sequence in the primer of one C-terminal side and the other N-terminal when amplified by PCR, additional 5 'end to add phosphoric acid.
(2) The phosphorylated 5 'end of each of the two types of DNA fragments obtained is digested with λ exonuclease, the linker portion is made single-stranded, and _VH and _VL are ligated. A new complementary strand is synthesized (strand displacement synthesis) while stripping the remaining complementary strand in the 3 ′ direction by the polymerase to produce a complete double strand of _VH and _VL linked by a linker.
(3) This double strand is inserted into a vector and used as a scFv library.
In this method, by utilizing the property that λ exonuclease cannot digest S-phosphorylated (Phosphorothioate) DNA, the 5 ′ end of the non-phosphorylated primer is converted into S, so that non-specific (non-phosphorylated) λ exonuclease Reaction (oxidized 5 'end) can be prevented. Also, by making the phosphorylation primer near the 3 'end S, the length of the DNA digested by λ exonuclease can be controlled, and the diversity of CDR regions is prevented from becoming single-stranded. And the background reaction can be drastically reduced.
Therefore, in conventional "One-step cloning" using SOE-PCR, disadvantages such as gene deletion / insertion / substitution / shift are likely to occur and uniform PCR reaction may be inhibited. Therefore, it is extremely suitable for construction of the scFv library of the present invention.

In the present example, actually, the scFv library was constructed using the “λ exonuclease method”, and the “expression automatic control colony assay method” of the present invention was performed, and the “One-Step Colony Assay” method was used. As in the case of (Patent Document 4), the same good results were obtained as when the scFv library constructed by the “Two-step cloning method” was used.
This “λ exonuclease method” can be applied to the preparation of an AP-scFv library, and can be performed in exactly the same procedure.

3. Seeding solution used in the present invention and inoculation of transformed Escherichia coli (3-1) Expression inducer used in the present invention The expression inducer used in the present invention is typically a saccharide such as lactose, arabinose, rhamnose and the like, and an allolactose analog. Refers to sugar analogs such as ITPG. Lactose and IPTG increase gene expression by activating the transcription in an expression vector containing a foreign gene under the control of the lac promoter, arabinose for the arabinose promoter, and rhamnose for the rhamnose promoter.
A pET system (T7 expression system) in which T7 RNA polymerase is placed under the control of a T7 promoter (L8-UV5-lac promoter) for high protein expression is often used. A system in which T7 RNA polymerase is placed under the control of an arabinose-inducible promoter (araBAD promoter) (BL21-AI) has also been used for high protein expression, which is suppressed by glucose and can be strictly controlled by arabinose. It is also useful as an expression vector of the invention.
In the case of rhamnose, an expression system for a rhamnose-inducible promoter (rhaPBAD promoter) is also used for high protein expression, and is suppressed by glucose and can be strictly controlled by rhamnose, so that it is also useful as the expression vector of the present invention. It is.
The following ITPG embodiment mainly describes a case in which scFv expression is induced by a scFv expression vector under the control of a T7 promoter having a lac promoter (L8-UV5-lac promoter).

(3-2) Preparation of Seeding Solution In the conventional colony assay method, a common nutrient medium (for example, LB medium) is used as a seeding solution for seeding transformed Escherichia coli on a sheet or diluted appropriately. Although used in the present invention, in the seeding solution, the nutrient medium-containing seeding solution, together with glucose acting as an expression inhibitor, lactose, an expression inducer such as IPTG in a necessary minimum amount and an optimal amount. Prepare by adding in proportions. Depending on the expression system used, saccharides such as lactose, arabinose and rhamnose, and allolactose analog ITPG can be used alone or in combination.
Specifically, the concentration of glucose as an expression inhibitor is 0.02 to 0.2%, preferably 0.05 to 0.15%, in the seed solution. The concentration of saccharides such as lactose, arabinose and rhamnose as expression inducers in the seed solution is 0.05 to 0.2%, preferably 0.07 to 0.13%. ～ 0.5 mM, preferably 0.07-0.15 mM.
A seed solution is prepared by adding these expression inhibitors and expression inducers to a nutrient medium solution (LB medium, TB medium, 2 × YT medium, or the like, or a solution containing the same or PBS) so as to have the above concentration, and inoculates the cells. the transformed E. coli containing culture solution for, OD value of at least 0.1 or higher, 0.1 or higher, preferably cultured to 0.2-0.3 and diluted to about 10 ⁴ times.

(3-3) Filter for colony formation The material of the filter is the same as in the conventional various colony assay methods. For example, polyvinylidene fluoride, the thickness is preferably 30 to 250 μm, and the pore size is preferably 0.22 μm or 0.45 μm. The colony filter is arranged so that there is no gap above the antigen membrane.

(3-4) Preparation of agar medium The agar medium used in the present invention may be prepared in the same manner as the agar medium used in the conventional colony lift assay. It is necessary to select a medium that does not contain an inducer.
For example, an LB medium plate containing neither glucose nor an expression inducer is prepared as follows.
Add 1 L of ultrapure water to an Erlenmeyer flask, add nutrients (10 g of Trypton and 5 g of Yeast Extract), sodium chloride (5 g) and Agar (15 g), cover with aluminum foil etc. And dissolve nutrients and Agar at the same time as sterilization. After autoclaving, add antibiotics when the temperature drops to near 50 ° C. Pour into a 10 cm sterile Petri dish on a level surface so that the thickness is about 5 mm. When it cools and set, put the lid upside down. If not used immediately, store in a plastic box at 4 ° C.

(3-5) Escherichia coli concentration to be inoculated and timing of inoculation In the automatic expression control colony assay method of the present invention, Escherichia coli containing about 1000 scFv expression vectors was prepared together with the inoculum prepared as described in (3-2) above. Seed on a filter for colony formation.
As for the timing of seeding, as in the case of the “One-Step Colony Assay” method (Patent Document 4), very early logarithmic growth of E. coli having a low OD value, specifically, the OD at 600 nm was 0.1%. Screening efficiency can be increased by using Escherichia coli within the range of 0.4 to 0.4, preferably 0.15 to 0.3, and more preferably 0.2 to 0.25. Generally, when inoculating Escherichia coli on an agar medium, it is effective to inoculate it at an extremely early timing in view of the fact that Escherichia coli in a logarithmic growth phase (OD at 600 nm is about 0.5 to 1.0) is used.

4. Detection Method Utilizing Target Antigen Binding Property and Establishment of Clones The detection step utilizing the target antigen binding property and the clone establishment step in the present invention are not different from the conventional colony assay method. All the methods used in the conventional colony assay can be applied.
(4-1) Preparation of Target Antigen Membrane of the Present Invention Target antigens of the present invention include physiologically active proteins such as membrane proteins such as receptors and channels, ligands, toxins, and pathogenic bacteria.
In this example, experiments were performed using human IgG as a model target antigen, but it is natural that the present invention is not limited to these antigens.
The target antigen may be used as it is. For example, when the target antigen has a known peptide epitope or sugar chain epitope, only the epitope may be used.
The target antigen membrane is preferably nitrocellulose or polyvinylidene fluoride, and the pore size is preferably 0.22 μm or 0.45 μm.
For example, the target antigen is diluted to 100 μg / mL with PBS, the membrane is immersed therein, and the membrane is coated with the antigen for 2 hours at room temperature. Thereafter, the plate is washed three times with PBS, and placed on the LB agar plate without any gap.

(4-2) Detection method using secondary antibody (conventional method) (FIG. 5)
In a detection method using a secondary antibody, after colony formation and expression induction, the filter on which colonies have been formed is transferred onto a storage medium, and the target antigen membrane is separated. An HRP-labeled detection antibody is added to the separated target antigen membrane, and allowed to bind to the tag added to the scFv captured on the target antigen membrane. Wash 4 times to wash off unbound HRP-labeled detection antibody and add HRP luminescent substrate. The luminescence due to the reaction with the substrate is photographed with a CCD camera, and after image processing, spot images are printed and colonies are superimposed to identify positive clones. When a multiple-sheet assay is performed, printing of spot images from the addition of the substrate is performed for each sheet.

(4-3) Detection method using AP coloring (improved method) (FIG. 6)
In the detection method using AP coloring of AP-scFv, after colony formation and expression induction, the filter on which colonies have been formed is transferred onto a storage medium, and the target antigen membrane is separated. An AP coloring substrate (for example, pNPP, BCIP / NBT, etc.) is added to the separated target antigen membrane, and when a coloring spot appears, the substrate is washed to stop coloring. The colonies are overlapped on the target antigen membrane where the spots appeared, and positive clones are identified. Even if multiple assays are performed, the color reaction is performed at one time.

(4-4) Method for Obtaining Positive Clones The method for obtaining positive clones is the same as the conventional colony assay method. Make a hole. After detecting the antigen membrane, a positive clone is identified by overlaying a mark on the top of the antigen membrane, and a colony is picked up.

(4-5) Establishment of clones by this method The method for evaluating the reactivity of the established clones is in accordance with a conventional method.
In this example, the positive clones picked up were cultured in a liquid medium until the OD ₆₀₀ reached 0.6, IPTG was added, the expression of scFv was induced overnight, and E. coli was recovered. The recovered Escherichia coli was sonicated, and the crushed supernatant was used for ELISA to evaluate the reactivity of scFv obtained from the established clone. As a result, as compared to the conventional colony assay method, including the “One-Step Colony Assay” method developed by the present inventors (Patent Document 4), a positive clone was obtained at a higher rate, and a clone having extremely high activity was obtained. Succeeded in getting.

Furthermore, when the improved detection method using AP coloring is used, detection is performed directly without using a secondary antibody in the detection process, so that the detection operation is simplified and the assay time is shortened (1/15 or less). In addition, since the signal was clear, the background and false positive derived from the secondary antibody were reduced. As a result, it has become possible to quickly and accurately establish a novel monoclonal antibody.
Another advantage of not using a secondary antibody is that AP-scFv can be immediately used as a detection antibody for sandwich ELISA which is important for diagnosis and the like.

Hereinafter, the present invention will be described more specifically with reference to Examples, but the scope of the present invention is not limited to the following Examples.
Other terms and concepts in the present invention are based on the meanings of terms commonly used in the art, and the techniques used to carry out the present invention are not particularly limited to those explicitly stated in their sources. Can be easily and reliably implemented by those skilled in the art based on known documents and the like. In addition, various analyzes and the like were performed using the methods described in the analytical instruments or reagents used, the instruction manual of the kit, the catalog, and the like.
It should be noted that the contents described in the technical literature, patent gazettes, and patent application specifications cited in the present specification are referred to as the description contents of the present invention.

(Example 1) Preparation of scFv library (1-1) Immunization of rats In this example, three rats commonly used as immunized animal species were used for one antigen. First, the antigen was immunized with adjuvant containing the killed M. tuberculosis, and then the antigen was immunized with the adjuvant containing the killed M. tuberculosis. By performing immunization twice, an immune reaction was sufficiently promoted.
Specifically, human IgG was mixed with FREUND Complete ADJUVANT (Sigma), and administered to the abdominal cavity of Wistar rats (female) at an antigen concentration of 100 μg / animal, and primary immunization was performed for 2 weeks. Subsequently, the antigen and FREUND Incomplete ADJUVANT (Sigma) were mixed, and a secondary immunization was performed in the same manner as the primary immunization. Two weeks after the last immunization, the rat was intraperitoneally administered with 100 μg of antigen and boosted.

(1-2) Spleen extraction The spleen was isolated from the immunized rat, and treated with RNAlater (Life Technology) to stabilize the RNA.

(1-3) Amplification of V _H (variable region of antibody heavy chain) and V _L (variable region of antibody light chain) In order to synthesize cDNA as a template for amplifying and obtaining an antibody gene, an RNA purification kit was used. Total RNA was purified by using the primers of random hexamer and oligo dT, and the full length cDNA was synthesized and used as a template for antibody gene amplification. Specifically, Total RNA was purified from spleens treated with RNAlater using RNeasy (Qiagen), and cDNA was synthesized using Transcriptor First Strand cDNA Synthesis Kit (Roche).
In this example, KOD-FX polymerase (Toyobo Co., Ltd.), a highly accurate Polymerase, was used for _VL and _VH gene amplification using PCR in order to prevent PCR errors and maintain the correct structure of scFv. It was used.
Using the synthesized cDNA as a template and a primer set for amplifying rat _VH and _VL genes, KOD-FX polymerase (Toyobo Co., Ltd.) was used. 5, (98 ° C 10sec, 63 ° C 30sec 68 ° C 1min) × 5, (98 ° C 10sec, 68 ° C 1.5min) × 20, 68 ° C 7min, perform PCR to amplify _VH and _VL genes did. Each amplified gene was electrophoresed on a 1.5% agarose gel to confirm the amplification.

The primer set of each gene used in this example is based on the previously published primer set of the _VH gene and _VL gene (Jorg Burmester, Andreas Pluckthun., Antibody Engineering Volume 1: 19-39, Springer). based on sequence used, the V _H sense primer NcoI, the V _H antisense primer KpnI, V _L sense primer NheI, as a primer set in the V _L antisense primer by synthesizing the primer plus NotI did. Each primer is degenerate at several positions to ensure antibody gene diversity.
The primer sequences used are as follows.

V _H sense primer
V _H S1 ATGCCCATGGGAKTRMAGCTTCAGGAGTC (SEQ ID NO: 1)
V _H S2 ATGCCCATGGGAGGTBCAGCTBCAGCAGTC (SEQ ID NO: 2)
V _H S3 ATGCCCATGGCAGGTGCAGCTGAAGSARTC (SEQ ID NO: 3)
V _H S4 ATGCCCATGGGAGGTCCARCTGCAACARTC (SEQ ID NO: 4)
V _H S5 ATGCCCATGGCAGGTYCAGCTBCAGCARTC (SEQ ID NO: 5)
V _H S6 ATGCCCATGGCAGGTYVARCTGCAGCARTC (SEQ ID NO: 6)
V _H S7 ATGCCCATGGCAGGTCCACGTGAAGCARTC (SEQ ID NO: 7)
V _H S8 ATGCCCATGGGAGGTGAASSTGGTGGARTC (SEQ ID NO: 8)
V _H S9 ATGCCCATGGGAVGTGAWGSTGGTGGAGTC (SEQ ID NO: 9)
V _H S10 ATGCCCATGGGAGGTGCAGSTGGTGGARTC (SEQ ID NO: 10)
V _H S11 ATGCCCATGGGAKGTGCAMCTGGTGGARTC (SEQ ID NO: 11)
V _H S12 ATGCCCATGGGAGGTGAAGCTGATGGARTC (SEQ ID NO: 12)
V _H S13 ATGCCCATGGGAGGTGCARCTTGTTGARTC (SEQ ID NO: 13)
V _H S14 ATGCCCATGGGARGTRAAGCTTCTCGARTC (SEQ ID NO: 14)
V _H S15 ATGCCCATGGGAAGTGAARSTTGAGGARTC (SEQ ID NO: 15)
V _H S16 ATGCCCATGGCAGGTTACTCTRAAASARTC (SEQ ID NO: 16)
V _H S17 ATGCCCATGGCAGGTCCAACTVCAGCARCC (SEQ ID NO: 17)
V _H S18 ATGCCCATGGGATGTGAACTTGGAASARTC (SEQ ID NO: 18)
V _H S19 ATGCCCATGGGAGGTGAAGGTCATCGARTC (SEQ ID NO: 19)

V _H antisense primer
V _H AS1 ATGCGGTACCCGAGGAAACGGTGACCGTGGT (SEQ ID NO: 20)
V _H AS2 ATGCGGTACCCGAGGAGACTGTGAGAGTGGT (SEQ ID NO: 21)
V _H AS3 ATGCGGTACCCGCAGAGACAGTGACCAGAGT (SEQ ID NO: 22)
V _H AS4 ATGCGGTACCCGAGGAGACGGTGACTGAGGT (SEQ ID NO: 23)

_VL sense primer
V _L Sκ1 ATGCGCTAGCGAYATCCAGCTGACTCAGC (SEQ ID NO: 24)
V _L Sκ2 ATGCGCTAGCGAYATTGTTCTCWCCCAGTC (SEQ ID NO: 25)
V _L Sκ3 ATGCGCTAGCGAYATTGTGMTMACTCAGTC (SEQ ID NO: 26)
V _L Sκ4 ATGCGCTAGCGAYATTGTGYTRACACAGTC (SEQ ID NO: 27)
V _L Sκ5 ATGCGCTAGCGAYATTGTRATGACMCAGTC (SEQ ID NO: 28)
V _L Sκ6 ATGCGCTAGCGAYATTMAGATRAMCCAGTC (SEQ ID NO: 29)
V _L Sκ7 ATGCGCTAGCGAYAYYCAGATGAYDCAGTC (SEQ ID NO: 30)
V _L Sκ8 ATGCGCTAGCGAYATYCAGATGACACAGAC (SEQ ID NO: 31)
V _L Sκ9 ATGCGCTAGCGAYATTGTTCTCAWCCAGTC (SEQ ID NO: 32)
V _L Sκ10 ATGCGCTAGCGAYATTGWGCTSACCCAATC (SEQ ID NO: 33)
V _L Sκ11 ATGCGCTAGCGAYATTSTRATGACCCARTC (SEQ ID NO: 34)
V _L Sκ12 ATGCGCTAGCGAYRTTKTGATGACCCARAC (SEQ ID NO: 35)
V _L Sκ13 ATGCGCTAGCGAYATTGTGATGACBCAGKC (SEQ ID NO: 36)
V _L Sκ14 ATGCGCTAGCGAYATTGTGATAACYCAGGA (SEQ ID NO: 37)
V _L Sκ15 ATGCGCTAGCGAYATTGTGATGACCCAGWT (SEQ ID NO: 38)
V _L Sκ16 ATGCGCTAGCGAYATTGTGATGACACAACC (SEQ ID NO: 39)
V _L Sκ17 ATGCGCTAGCGAYATTTTGCTGACTCAGTC (SEQ ID NO: 40)
V _L Sλ ATGCGCTAGCGATGCTGTTGTGACTCAGGAATC (SEQ ID NO: 41)

V _L antisense primer
V _L ASκ1 ATGCGCGGCCGCTACGTTTKATTTCCAGCTTGG (SEQ ID NO: 42)
V _L ASκ2 ATGCGCGGCCGCTACGTTTTATTTCCAACTTTG (SEQ ID NO: 43)
V _L ASκ3 ATGCGCGGCCGCTACGTTTVAGCTCCAGCTTGG (SEQ ID NO: 44)
V _L ASλ ATGCGCGGCCGCTACCTAGGACAGTCAGTTTGG (SEQ ID NO: 45)

(1-4) Preparation of _VH gene library and _VL gene library The _VH gene primer set (Synthetic cDNA prepared in (1-3) from rat spleen-derived RNA immunized with human IgG was used as a template. The respective pools of the _VH gene library and the _VL gene library of the anti-human IgG antibody amplified using the _VL gene primer set (SEQ ID NOS: 24 to 45) and the _VL gene primer set (SEQ ID NOS: 24 to 45) were prepared.

(1-5) Construction of scFv library expression vector In advance, pET-22b (+) (Novagen) having a pelB signal sequence incorporating an NcoI-KpnI-Linker-NheI-NotI-His tag was prepared. The _VL gene library of the anti-human IgG antibody amplified by PCR in 1-4) was cut with NheI and NotI to prepare a _VL gene vector library that was incorporated into pET-22b (+) as described above. DH5α competent cells (Nippon Gene) were transformed with each of the prepared _VL gene vectors, and seeded on LB agar medium containing ampicillin to form colonies. All colonies were collected and mixed, and the _VL gene vector was purified using a plasmid purification kit (Qiagen). As the Linker, a known “GGGGSGGGGSGGGGS (SEQ ID NO: 46)” linker is used.
Next, the prepared _VL gene vector library and the _VH gene library amplified by PCR were digested with NcoI and KpnI, and the _VH gene was incorporated into the _VL gene vector to construct a scFv library expression vector.

In addition to pET-22b (+), vectors containing the NcoI-KpnI-Linker-NheI-NotI-His tag were also prepared for vectors having the arabinose promoter, rhamnose promoter, and T5 promoter. Then, a _VL gene vector library and a _VH gene library were integrated to construct an scFv library expression vector.

(Example 2) Establishment of Positive Clones by Expression Controlled Colony Assay (2-1) Formation of Colonies on Plate Using the scFv library expression vector prepared in Example (1-5), BL21 (DE3) competent cells ( the Nippon Gene) was transformed using the LB medium containing the expressed inhibitor expression inducer the culture the OD ₆₀₀ reached 0.2 in the recovery medium (SOC), and diluted ¹⁰⁴ times, producing a seeding solution did. In the seeding solution, glucose was added as an expression inhibitor at a concentration of 0.05%, and IPTG as an expression inducer at a concentration of 0.1 mM. Dilute human IgG used for immunization to 100 µg / mL with PBS on an LB agar plate, and overlay an antigen membrane coated with antigen for 2 h at room temperature, and further overlay a hydrophilic porous filter (colony filter) for colony formation on it. Then, Escherichia coli (200 μl) transformed with the antibody gene dispersed in the seed solution was seeded on the colony filter. Thereafter, the mixture was kept at 30 ° C. overnight to form colonies. The colony filter having a colony formed on the filter was transferred to an LB agar plate and stored at 4 ° C. In this method, it is not necessary to prepare a concentration gradient of the expression inducing agent which is troublesome, and an agar plate used in a usual molecular biological experiment can be used, so that the preparation can be performed quickly and easily.

(2-2) Detection of positive clones The lower antigen membrane, excluding the colony filter, was washed twice with PBS, and HRP-labeled anti-His antibody (Roche) was diluted 5,000-fold with 2% skim milk / PBS and incubated at room temperature. The reaction was performed for 1 hour. Wash 5 times with 0.05% Tween-PBS, wash 3 times with PBS, add 6 mL with HRP luminescent substrate (Merck), perform luminescence reaction at room temperature, and use luminescence detector (Chemstage, Kurashiki Boseki). Positive clones were detected as luminescent spots. FIG. 4 shows the detection spots. When no expression inducer was contained in the above seeding solution, no spot was observed.

(2-3) Identification of positive clone On the antigen membrane where the spot of (2-2) was detected, a colony filter stored at 4 ° C was superimposed on the antigen membrane, and the colony overlapping on the spot was defined as a positive clone. Identified.

(Example 3) Analysis of established clones (3-1) Determination of gene sequence of established clones The anti-human IgG scFv positive clones identified in Example 2 (2-3) were individually cultured in an LB medium containing ampicillin. The plasmid DNA in the clone was purified using a DNA Mini prep kit (Qiagen). The gene sequence of the purified plasmid DNA was analyzed by sequencing to confirm the structure of scFv. As a result, the structure as designed was confirmed in all clones. FIG. 5 shows the sequence of the clone with the strongest signal among the clones. (FIG. 5) shows an anti-human IgG scFv sequence (Rat scFv (human IgG): SEQ ID NO: 47).

(3-2) Activity measurement of established clones by ELISA In this example, the activity of scFv obtained in (Example 2) was confirmed by ELISA. The antigen specificity and affinity of the 10 positive clones were measured. Each positive clone is cultured in 10 mL LB medium containing ampicillin at 37 ° C. until the OD ₆₀₀ reaches 0.6, 0.5 mM IPTG is added, and the expression is induced overnight at 26 ° C. After the culture, the Escherichia coli is collected by centrifugation, 0.5 mL protease inhibitor (Roche) / PBS is added to the bacterial mass, suspended, and the Escherichia coli is sonicated. The crushed solution is centrifuged at 20,000 g for 30 minutes, and the supernatant is collected.
The human IgG used as the antigen was adjusted to 10 μg / mL with a coating buffer (Na ₂ CO ₃ , NaHCO ₃ , pH 9.6), dispensed at 100 μL / well into a 96-well microtiter plate, and incubated at 4 ° C. Coat overnight. Discard the coating solution, wash once with 0.05% Tween / PBS, dispense Blocking reagent (Roche Diagnostics) at 250 μL / well, and block for 2 hours at room temperature. The blocking solution is discarded, washed once with 0.05% Tween-PBS, and the sonicated supernatant is dispensed using PBS at 100 μL / well, and the reaction is performed at room temperature for 2 hours. The reaction solution is discarded, washed three times with 0.05% Tween-PBS, and twice with PBS. The HRP-labeled high-His antibody is diluted 5000-fold with 1% BSA / PBS, and dispensed at 100 μL / well. The antibody reaction is performed for a time. The antibody reaction solution is discarded, washed 5 times with 0.05% Tween-PBS, and HRP chromogenic substrate (SIGMAFAST OPD tablets, Sigma) is dispensed at 100 μL / well, color is developed at room temperature, and a microplate reader (Bio-Rad) ) Was used to measure the absorbance at a wavelength of 450 nm. The results are shown in FIG.

(4) The binding to BSA was measured to observe the binding to human IgG as an antigen and the background reaction. Supernatant from E. coli having an empty expression vector without scFv was used as a negative control (NC). All 10 positive clones showed a binding reaction in an antigen-specific manner, and this screening method showed that it was possible to establish an antigen-specific scFv.

(Example 4) Under the optimal conditions (2-1) for performing the expression-controlled colony assay, the concentrations of the expression inhibitor and the expression inducer in the seed solution, ie, the glucose concentration and the IPTG concentration were variously changed and the same amount was used. Escherichia coli was sowed and an expression control colony assay was performed. The number of colonies and the number of positives per plate were counted (Table 1).

Using the anti-human IgG scFv library constructed in (Example 1), an expression automatic control colony assay of the present invention was performed. The concentration of glucose, an expression inhibitor, and the concentration of IPTG, an expression inducer, were variously changed, and the number of colonies formed, the number of positive cells, and the positive rate were compared (Table 1).
(Condition 1) is the case where only the medium was used as the seeding solution, and (Condition 2) was the case where only glucose was added, but the number of colonies was slightly increased compared to (Condition 1). Was. The increase in the number of colonies means that, in Escherichia coli having a scFv clone having an inhibitory effect on the growth of E. coli, there is a clone in which the leak expression of scFv during colony formation is suppressed and colony formation is possible. The larger the number of colonies, the larger the size of the library, and the better the assay. Therefore, it was an unexpected effect that the number of colonies could be increased only by adding glucose.

When the concentration of the expression inducer IPTG added to the inoculum was kept constant (0.1 mM) and the concentration of the expression inhibitor glucose was increased from 0% to 0.1% (in Table 1, conditions 3 → 4 → 6 → 7 → 9), the number of colonies increases. On the other hand, the number of positive cells was drastically reduced when glucose was at a high concentration even in the presence of the expression inducer IPTG (condition 9 in Table 1). Further, when the concentration of glucose as an expression inhibitor was kept constant (0.05%) and the concentration of IPTG as an expression inducer was increased from 0.07 mM to 0.2 mM (in Table 1, conditions 2 → 5 → 6 → (Corresponding to the change from 8 to 10), the expression of scFv is more induced, and the number of positive cells increases. However, when the concentration of IPTG was increased, the number of colonies and the number of positives decreased drastically (condition 10 in Table 1). When the glucose concentration was 0.05% and the IPTG concentration was 0.1 mM (condition 6 in Table 1), the most colonies appeared and the most positive clones were observed.
Glucose inhibits the expression of scFv and appears to have an advantageous effect on the growth and colony formation of Escherichia coli. However, if the glucose concentration exceeds the optimal range and becomes too high ( conditions 7 and 9 in Table 1), It is thought that the induction of expression by IPTG will not be applied, and the number of positive cells will decrease drastically. On the other hand, if the concentration of IPTG is too high ( conditions 8 and 10 in Table 1), the inhibition of scFv expression by glucose in the early stage of colony formation is not effective, and the growth and colony formation of E. coli are inhibited. It appears that a sharp decrease in the number of colonies and the number of positives occurs. The most colonies appeared and the most positive clones were observed. (Condition 6 in Table 1) The balance between the concentration of the expression inducer IPTG and the expression inhibitor glucose was balanced. It is considered to be the optimal condition.

The results of the One-Step Colony Assay previously developed by the present inventors (Patent Document 4) are superior to the conventional Filter-sandwich colony assay, but the number of colonies is 1052, and 4 positive colonies are observed. The positive rate was 0.4%.
In the present invention, leak expression in Escherichia coli in the early stage of colony formation, which is vulnerable to the stress of expression load, can be reliably inhibited, so that Escherichia coli having an expression vector proliferates actively and forms a colony. About 1,200 (Table 1, conditions 5, 6, 7) were formed, exceeding 1052 in the step Colony Assay (Patent Document 4). The higher the number of colonies, the more diverse clones can be measured, and the higher the probability of screening for a better antibody.
The positive rate in Table 1 in the present invention (conditions 3 to 8) was dramatically improved to at least about twice or more as compared with the conventional colony assay. From these results, the automatic expression control colony assay of the present invention, in which glucose and IPTG are added to the inoculum, eliminates the need for monitoring the state of colonies as compared with the conventional method, omitting the steps, and simplifying the procedure. In addition, it was demonstrated that the method was excellent in obtaining a positive clone. In particular, it has been demonstrated that by optimizing the glucose concentration and the IPTG concentration, the positive rate can be further increased 3.5 times or more (condition 6).
Further, in the present invention, no preparation / preliminary experiment is required, and the expression is automatically induced after inoculation of Escherichia coli. Therefore, there is no need to monitor the degree of growth of the colonies, and no work of inducing the expression. In the present invention, the time required to identify a positive clone in screening one antibody library is about one day.

The addition of glucose, an expression inhibitor, increased the number of colonies. This is presumably because colony formation was enabled in Escherichia coli having a scFv clone having an inhibitory effect on the growth of E. coli by suppressing the leak expression of scFv during colony formation.
By automatic expression control colony assay, colony size was monitored successively, and controlled expression was possible even at the optimal timing without starting expression induction. Due to the increase in the number of colonies (even at the same positive rate), the number of positive clones increases, and the expression automatic control colony assay can be said to be a more excellent assay method. In fact, unexpectedly, the positivity rate also increased significantly. This is considered to be due to two points, that is, the expression induction was performed at the optimal timing, so that the expression efficiency was increased and the number of the colonies was increased. Regarding the latter, clones that leak-express scFv that have a growth-inhibiting effect on E. coli growth and colony formation are highly likely to be positive, suggesting that the positive rate may have increased. Empirically, scFv expression with antigen specificity (positive clone) often has a growth inhibitory effect on Escherichia coli, and cells are often killed and clones are lost during or after screening. This method has an unexpected effect that such a positive clone can be obtained as a positive clone without being lost during screening.

(Example 5) An expression automatic control colony assay was performed using a different expression inducer / expression system from an expression automatic control colony assay using various expression inducers / expression systems (Example 2). The optimum conditions there were examined. The antibody library was inserted into pET-22b (+), and the number of colonies formed and the number of positive clones when lactose was used as an expression inducer different from the above IPTG were examined. In this case, the expression inhibitor is glucose and the expression inducer is lactose.
The same amount of Escherichia coli was inoculated at various concentrations of the expression inhibitor and the expression inducer, ie, the glucose concentration and the lactose concentration, in the seeding solution, and an automatic expression control colony assay was performed. The number of colonies and the number of positives per plate were counted.

These results are shown below (Table 2). From these results, it was shown that the expression-controlling colony assay of the present invention can be performed using different expression inducers.

The anti-human IgG scFv library constructed in (Example 1) was inserted into a pET-22b (+) vector to prepare an expression vector library, which was used to carry out an automatic expression control colony assay of the present invention. . The concentration of glucose, which is an expression inhibitor, and the concentration of lactose, which is an expression inducer, were varied, and the number of colonies formed, the number of positives, and the positive rate were compared (Table 2). In the system using lactose as an expression inducer, when the glucose concentration was 0.05% and the lactose concentration was 0.1%, the most colonies appeared and the most positive clones were observed. In a system using a different expression inducing agent, it was shown that the automatic expression control colony assay was effective.
Compared to the positive rate of the conventional One-Step Colony Assay using the same expression vector (patent document 4), which is 0.4%, the positive rate in the present example is about twice as high, It was demonstrated that by optimizing the concentration and lactose concentration, the positive rate could be further increased by a factor of 3 or more (Table 2).
From these results, the expression automatic control colony assay of the present invention eliminates the need for monitoring the state of colonies as compared with the conventional method, simplifies the procedure by omitting the steps, and also enables the acquisition of positive clones. Has also proven to be excellent.

Furthermore, in place of the combination using IPTG or lactose as an expression inducer in the T7 expression system described above, in another experimental system using an expression system in which catabolite suppression is effective, the expression automatic control colony assay of the present invention is also used. It was confirmed that can be implemented.
Specifically, Escherichia coli transformed with an expression vector of a lactose promoter system incorporating a Lac promoter, a rhamnose promoter system incorporating a rhaPBAD promoter, and an arabinose promoter system incorporating an araBAD promoter were prepared. Screening was performed in the same procedure as in Example 2 or 5, except that lactose, rhamnose or arabinose was added as an expression inducer together with glucose.
As a result, it was confirmed that the same results (number of colonies, number of positives, positive rate) as in the case of the T7 expression system using IPTG or lactose were shown (data not shown).
In addition, as a host Escherichia coli, in addition to BL21DE3 used in (Example 2), JM109 and XL-1Blue were used and the same experiment was performed as in (Example 2), and similar results were obtained. (Data not shown).
From these results, it was shown that even when an expression system effective for catabolite suppression and a corresponding saccharide expression inducer were used, the expression-controlled colony assay of the present invention was effective.

(Example 6) Using the anti-human IgG scFv library constructed with the efficiency of obtaining an antibody gene from a positive clone (Example 1), the expression automatic control colony assay of the present invention, expression with an increased expression inducer concentration An automatic control colony assay and a conventional colony assay were respectively performed, and antigen binding properties and gene structure were examined and compared for each positive clone obtained from the results (Table 3).
In the case of the automatic expression control colony assay method, the E. coli library was dispersed in a solution having a concentration of 0.05% glucose as an expression inhibitor and 0.1 mM IPTG as an expression inducer, and plated on a plate. Under conditions of high IPTG concentration, that is, when expression induction is excessive, the E. coli library is dispersed in a solution having a concentration of 0.05% glucose as an expression inhibitor and 0.2 mM IPTG as an expression inducer, and plated on a plate. Was. When lactose was used as an expression inducer, the E. coli library was dispersed in a solution having a concentration of 0.05% glucose and 0.1% lactose as an expression inhibitor, and plated on a plate. At the time of overexpression induction conditions, the E. coli library was used as an expression inhibitor, and glucose was dispersed in a solution having a concentration of 0.05% and lactose at a concentration of 0.2%.
Positive clones were obtained using each method of Filter-sandwich Assay (Non-Patent Document 4), One-step Colony Assay (Patent Document 4), and Single-step Colony Assay (Non-patent Document 7), and Analyzed.

Positive clones were identified using the respective colony assay methods, and 136 clones were randomly cultured from the clones. The antigen-binding activity of the antibodies produced by the clones was measured by ELISA according to the method (3-2). . At the same time, using the colonies of the 136 clones, scFv, _VH and _VL were amplified by the colony PCR method, followed by agarose gel electrophoresis. From the electrophoresis pattern, the molecular weight of the scFv gene, _VH gene and _VL gene amplified from each of the 136 clones was measured, and the original molecular weight (scFv gene was 750 bp, _VH gene was 400 bp, and _VL gene was 350 bp) Checked whether or not. the amplification of the scFv, the primer pelB-F and M13-R, the amplification of the V _H, using primers pelB-F and V _H -Linker-R, the amplification of the V _L, primer V _L -Linker- F and M13-R were used. Colony PCR was performed using EmeraldAmP PCR Master Mix (Takara Bio Inc.) at 94 ° C for 2 min, (98 ° C for 10 sec, 58 ° C for 30 sec and 68 ° C for 1 min) x 5 using a primer set for amplifying rat _VH and _VL genes. , (98 ° C 10sec, 63 ° C 30sec 68 ° C 1min) × 5, (98 ° C 10sec, 68 ° C 1.5min) × 20, 68 ° C 7min, PCR, scFv gene, _VH gene and _VL gene Was amplified. Each amplified gene was electrophoresed on a 1.5% agarose gel to confirm the amplification.
The results are shown in (Table 3). In the case of an automatic expression control colony assay using optimal glucose and rhamnose concentrations, scFv, _VH and _VL have the original molecular weight (750 bp for scFv gene, 400 bp for _VH gene, _VL gene for all clones). Has 350 bp).

In the expression-controlled colony assay of the present invention performed under optimal conditions, all the obtained clones produced scFv having antigen binding properties, and it was shown that the scFv had a complete structure. On the other hand, in the Filter-sandwich Assay and the Single-step Colony Assay and the two conventional colony assays, the positive clones isolated were 10 to 13 out of 136 clones in which the _VH gene was lost, and a functional scFv Turned out not to be produced. In the One-step Colony Assay in which the expression induction was devised, the _VH gene was lost in 4 clones, although the improvement was seen in the conventional colony assay. Also, in the expression-controlled colony assay of the present invention, when the concentration of the expression inducing agent is twice the optimum concentration, 5 to 6 clones out of 136 clones in which the above-mentioned _VH gene has dropped out are found. Thus, it was confirmed that preparation of the concentration of the expression inducing agent in the seed solution was also important.
It was shown that by using the expression-controlled colony assay of the present invention, scFV having a complete structure can be obtained with a 100% probability.

From these results, the expression automatic control colony assay of the present invention eliminates the need for monitoring the state of colonies as compared with the conventional method, simplifies the procedure by omitting steps, and also enables the acquisition of positive clones. The yield was remarkably improved and proved to be superior to the conventional method (Table 3). It was an unexpected effect that this method had the ability to identify antibody genes without losing the gene structure, that is, eliminating false positives, in addition to the simplicity of operation.

(Example 7) Preparation of scFv library (7-1) Immunization of rabbit In this example, a rabbit that is often used as an immunized animal species was used. First, the antigen was immunized with adjuvant containing the killed M. tuberculosis, and then the antigen was immunized with the adjuvant containing the killed M. tuberculosis. By performing immunization 5 times, the immune reaction was sufficiently promoted.
Specifically, human IgG was mixed with FREUND Complete ADJUVANT (Sigma) and administered subcutaneously to a Japanese white rabbit (female) at an antigen concentration of 200 μg / animal for primary immunization. Every two weeks, antigen and FREUND Incomplete ADJUVANT (Sigma) were mixed, and secondary immunization was performed in the same manner as primary immunization. Two weeks after the last immunization, 100 μg of the antigen was administered to rabbit veins and boosted.

(7-2) Removal of Spleen and Peripheral Blood Mononuclear Cells (PBMC) Peripheral blood was collected from rabbits after immunization, and the spleen was removed. Peripheral blood mononuclear cells (PBMC) were purified from peripheral blood. The spleen and PBMC were treated with RNAlater (Life Technology) to stabilize RNA.

(7-3) Amplification of V _H (variable region of antibody heavy chain) and V _L (variable region of antibody light chain) To synthesize cDNA serving as a template for amplifying and obtaining an antibody gene, an RNA purification kit was used. Total RNA was purified by using the primers of random hexamer and oligo dT, and the full length cDNA was synthesized and used as a template for antibody gene amplification. Specifically, Total RNA was purified from spleen and PBMC treated with RNAlater using RNeasy (Qiagen), and cDNA was synthesized using Transcriptor First Strand cDNA Synthesis Kit (Roche).
In this example, KOD-FX polymerase (Toyobo Co., Ltd.), a highly accurate Polymerase, was used for _VL and _VH gene amplification using PCR in order to prevent PCR errors and maintain the correct structure of scFv. It was used.
Using the synthesized cDNA as a template and a primer set for amplifying rat _VH and _VL genes, KOD-FX polymerase (Toyobo Co., Ltd.) was used. 5, (98 ° C 10sec, 63 ° C 30sec 68 ° C 1min) × 5, (98 ° C 10sec, 68 ° C 1.5min) × 20, 68 ° C 7min, perform PCR to amplify _VH and _VL genes did. Each amplified gene was electrophoresed on a 1.5% agarose gel to confirm the amplification.

The primer set of each gene used in this example is a nucleotide sequence of a previously published primer set of _VH gene and _VL gene (Rudiger Ridder and Hermann Gram, Antibody Engineering Volume 1: 115-137, Springer). based on, the V _H sense primers were used NcoI, the V _H antisense primers XhoI, the V _L sense primer NheI, as a primer set by synthesizing primers plus NotI to V _L antisense primer . Each primer is degenerate at several positions to ensure antibody gene diversity.
The primer sequences used are as follows.

V _H sense primer
V _H S1 ATGCCCATGGCAGTCGGTGGAGGAGTCCRGG (SEQ ID NO: 48)
V _H S2 ATGCCCATGGCAGTCGGTGAAGGAGTCCGAG (SEQ ID NO: 49)
V _H S3 ATGCCCATGGCAGTCGYTGGAGGAGTCCGGG (SEQ ID NO: 50)
V _H S4 ATGCCCATGGCAGSAGCAGCTGGWGGAGTCCGG (SEQ ID NO: 51)

V _H antisense primer
V _H AS1 ATGCCTCGAGGACTGAYGGAGCCTTAGGTTGC (SEQ ID NO: 52)

_VL sense primer
V _L Sκ1 ATGCGCTAGCGTGMTGACCCAGACTCCA (SEQ ID NO: 53)
V _L Sκ2 ATGCGCTAGCGATMTGACCCAGACTCCA (SEQ ID NO: 54)

V _L antisense primer
V _L ASκ1 ATGCGCGGCCGCTTTGACGACCACCTCGGTCCC (SEQ ID NO: 55)
V _L ASκ2 ATGCGCGGCCGCTAGGATCTCCAGCTCGGTCCC (SEQ ID NO: 56)

(7-4) Preparation of _VH gene library and _VL gene library The above _VH gene primers were prepared using the synthetic cDNA prepared in (7-3) from spleen and PBMC-derived RNA of rabbits immunized with human IgG as a template. Pools of the _VH gene library and the _VL gene library of the anti-human IgG antibody amplified using the set (SEQ ID NOs: 48 to 52) and the _VL gene primer set (SEQ ID NOs: 53 to 56) did.

(7-5) Construction of AP-scFv library expression vector In advance, pET-22b (+) (Novagen) having a pelB signal sequence incorporating an NcoI-XhoI-Linker-NheI-NotI-His tag was prepared. A vector was prepared in which alkaline phosphatase (AP, SEQ ID NO: 57) was inserted upstream of NcoI.
The _VL gene library of the anti-human IgG antibody amplified by PCR in (1-4) was digested with NheI and NotI to prepare a _VL gene vector library that was incorporated into pET-22b (+) as described above. DH5α competent cells (Nippon Gene) were transformed with each of the prepared _VL gene vectors, and seeded on LB agar medium containing ampicillin to form colonies. All colonies were collected and mixed, and the _VL gene vector was purified using a plasmid purification kit (Qiagen). As the Linker, a known “GGGGSGGGGSGGGGS (SEQ ID NO: 46)” linker is used.
Next, the prepared _VL gene vector library and the _VH gene library amplified by PCR were digested with NcoI and XhoI, the _VH gene was incorporated into the _VL gene vector, and an AP-scFv library expression vector was constructed. did.

In addition to pET-22b (+), vectors incorporating the AP-NcoI-XhoI-Linker-NheI-NotI-His tag are also used for vectors having an arabinose promoter, a rhamnose promoter, and a vector having a T5 promoter. The scFv library expression vector was constructed by incorporating the _VL gene vector library and the _VH gene library.

(Example 8) Establishment of positive clones by expression control colony assay (8-1) Colony formation on plate BL21 (DE3) competent was prepared using the AP-scFv library expression vector prepared in Example (7-5). cell (Nippon Gene) was transformed using the LB medium containing the expressed inhibitor expression inducer the culture the OD ₆₀₀ reached 0.2 in the recovery medium (SOC), and diluted 10 ⁴ fold, seeded solution Was prepared. In the seeding solution, glucose was added as an expression inhibitor at a concentration of 0.05%, and IPTG as an expression inducer at a concentration of 0.1 mM. Dilute human IgG used for immunization to 100 µg / mL with PBS on an LB agar plate, and overlay an antigen membrane coated with antigen for 2 h at room temperature, and further overlay a hydrophilic porous filter (colony filter) for colony formation on it. Then, Escherichia coli (200 μl) transformed with the antibody gene dispersed in the seed solution was seeded on the colony filter. Thereafter, the mixture was kept at 30 ° C. overnight to form colonies. The colony filter having a colony formed on the filter was transferred to an LB agar plate and stored at 4 ° C. In this method, it is not necessary to prepare a concentration gradient of the expression inducing agent which is troublesome, and an agar plate used in a usual molecular biological experiment can be used, so that the preparation can be performed quickly and easily.

(8-2) Detection of Positive Clones The lower antigen membrane from which the colony filter had been removed was washed twice with PBS, immersed in an AP color substrate solution (Sigma-fast BCIP-NBT), and the positive clones were detected as color spots. FIG. 11 shows the detection spots. When no expression inducer was contained in the above seeding solution, no spot was observed.

(8-3) Identification of positive clone On the antigen membrane from which the spot of (8-2) was detected, a colony filter stored at 4 ° C in (8-1) was overlapped, and the colony overlapping on the spot was defined as a positive clone. Identified.

(Example 9) Analysis of established clones (9-1) Determination of gene sequence of established clones The anti-human IgG scFv positive clones identified in Example 8 (8-3) were individually cultured in an LB medium containing ampicillin. The plasmid DNA in the clone was purified using a DNA Mini prep kit (Qiagen). The gene sequence of the purified plasmid DNA was analyzed by sequencing to confirm the structure of scFv. As a result, the structure as designed was confirmed in all clones. FIG. 12 shows the sequence of the clone having the strongest signal among the clones. (FIG. 4) is the anti-human IgG scFv sequence (SEQ ID NO: 58).

(9-2) Activity measurement of established clones by ELISA In this example, the activity of scFv obtained in (Example 2) was confirmed by ELISA. The antigen specificity and affinity of the 24 positive clones were measured. Each positive clone is cultured in 10 mL LB medium containing ampicillin at 37 ° C. until the OD ₆₀₀ reaches 0.6, 0.5 mM IPTG is added, and the expression is induced overnight at 26 ° C. After the culture, the Escherichia coli is collected by centrifugation, 0.5 mL protease inhibitor (Roche) / PBS is added to the bacterial mass, suspended, and the Escherichia coli is sonicated. The crushed solution is centrifuged at 20,000 g for 30 minutes, and the supernatant is collected.
The human IgG used as the antigen was adjusted to 10 μg / mL with a coating buffer (Na ₂ CO ₃ , NaHCO ₃ , pH 9.6), dispensed at 100 μL / well into a 96-well microtiter plate, and incubated at 4 ° C. Coat overnight. Discard the coating solution, wash once with 0.05% Tween / PBS, dispense Blocking reagent (Roche Diagnostics) at 250 μL / well, and block for 2 hours at room temperature. The blocking solution is discarded, washed once with 0.05% Tween-PBS, and the sonicated supernatant is dispensed using PBS at 100 μL / well, and the reaction is performed at room temperature for 2 hours. The reaction solution is discarded, washed three times with 0.05% Tween-PBS and twice with PBS, dispensed 100 μL / well of an AP chromogenic substrate (SIGMAFAST pNPP tablets, Sigma), and allowed to develop color at room temperature. (Bio-Rad) was used to measure the absorbance at a wavelength of 405 nm. The results are shown in FIG.

The binding to BSA was measured to observe the binding to human IgG as an antigen and the background reaction. Supernatant from E. coli having an empty expression vector without scFv was used as a negative control (NC). All 10 positive clones showed a binding reaction in an antigen-specific manner, and this screening method showed that it was possible to establish an antigen-specific scFv.

Furthermore, the same experiment was carried out using a known high-activity type modified AP (Asp ₁₅₃ → Gly ₁₅₃ , Asp ₃₃₀ → Asn ₃₃₀ ; Patent No. 3560972), and a good antibody was successfully established (data not shown).

(Example 10) Comparison of two types of detection methods In the case of scFv and AP-scFv, a monoclonal antibody was established by an automatic expression control colony assay according to the procedure of (Examples 8 and 9), and the results were compared. (Table 4).
Specifically, peripheral blood was collected from rabbits immunized with human IgG, and peripheral blood mononuclear cells (PBMC) were separated to prepare an antibody gene library. From the same antibody gene library, a scFv library and an AP-scFV library were prepared, and each library was seeded on 10 90 mm dishes. The scFv was prepared in the same procedure as in (Example 2). Positive clones were identified in the same procedure as in Example 8). After identifying each positive clone, the cells were cultured, the expression vector was purified, and the antibody gene (scFv) was analyzed. In rare cases, the identified positive clones may have mutations or deletions in the antibody gene due to culture. The rate at which complete gene sequences could be recovered was determined. Table 1 shows the detection operation time required for 10 dishes, the average number of colonies per dish, the average number of positive cells, and the average number of clones from which the complete gene was recovered. Ap-scFV had more than three times the positive rate and the final antibody gene recovery rate was better.

時間 The time required from the recovery of the antigen-coated membrane to the detection was reduced to 1/15 or less due to expression in the form of AP-scFv. In the case of scFv, data is captured by a luminescence reaction using a secondary antibody, and digital processing of the data is required, so that it takes a long time. Although the luminescence reaction was highly sensitive, it was not possible to process many membranes simultaneously because the reaction was instantaneous and difficult to detect. Replacing the membrane was a bottleneck for speed and accuracy. In the case of luminescence detection, luminescence from the membrane is taken in by a cooled CCD, data processing is performed, and the data is stamped out on paper to identify an actual colony. In the case of AP-scFv, simultaneous processing of multiple membranes was enabled by using a color reaction, and the detection sensitivity error between the membranes was eliminated. In the case of color development, since the membrane itself is placed in a color former solution to develop color, more membranes can be processed at once than light emission. Colonies can be identified by simply overlaying the colored membrane as it is, which facilitates accurate overlay of colonies and labeled spots, increases sensitivitysensit, reduces background, and improves S / N, resulting in positive The number has increased.

In addition, at the time of identification of a positive clone, identification was possible by directly comparing the chromogenic membrane and the colony. At the time of scFv, data processing was performed after capturing light emission data from the optical lens. In this method, optical aberrations are inevitably generated in the peripheral portion (especially, in order to efficiently capture weak light, it is necessary to use a lens with a small F value, and aberrations are likely to occur). As a result, there was no yielding error in the vicinity of the scFv membrane due to a yield up.
In the case of AP-scFV, the time required for detection was reduced to 1/15 or less due to simplification of the detection operation, since washing, antibody reaction, data acquisition, and the like became unnecessary. As a result, mutations in the antibody gene have been eliminated. (Because the antibody gene is a burden on the host Escherichia coli, any leak expression may cause expression inhibition to reduce the load.) Therefore, by using this detection method, antibody genes could be recovered from all of the identified positive clones.

(Example 11) Comparison of two types of induction methods DC was performed by different induction methods, a monoclonal antibody was established, and the results were compared (Table 5). Peripheral blood was collected from rabbits immunized with human IgG, and peripheral blood mononuclear cells (PBMC) were separated to prepare an antibody gene library. An AP-scFV library was prepared from the antibody gene library, each library was seeded on 10 90 mm dishes, and a colony assay was performed using two types of induction methods (Spray and automatic induction). After identifying positive clones, the cells were cultured, the expression vector was purified, and the antibody gene (scFv) was analyzed. In rare cases, the identified positive clones may have mutations or deletions in the antibody gene due to culture. The rate at which complete gene sequences could be recovered was determined. The average number of colonies, the average number of positives, and the average number of clones with complete gene recovery per dish are shown in (Table 5). In the case of automatic expression induction, the positive rate was three times or more, and the final positive gene recovery rate was also excellent.

Claims (9)

1. An automatic control colony assay for expression of a functional protein that recognizes a target,
   (1) (a) A membrane on which a target recognized by the protein is adsorbed or coated is placed on the upper surface of a solid nutrient medium for microorganisms that does not contain glucose and an expression inducer, and (c) a colony is further placed on the upper surface. Mounting a forming filter,
   (2) seeding a microorganism transformed with the protein gene library on the surface of (c),
   (3) binding the antibody expressed and secreted from each colony formed on the colony filter to a target antigen in the form of an antigen membrane;
   (4) detecting the binding activity to the target antigen on the antigen membrane as a labeled spot;
   (5) superimposing the labeled spot on the antigen membrane and the colony on the colony filter to select a positive clone;
   Including
   Here, the method is characterized in that the seeding solution for seeding the microorganism in step (2) contains (i) glucose and (ii) an expression inducer.
2. 方法 The method according to claim 1, wherein the expression inducer (ii) contained in the seeding solution is lactose, arabinose, rhamnose or IPTG.
3. The seeding liquid for seeding the microorganism in step (2)
   (I) glucose at a concentration of 0.02-0.2%, and (ii) lactose, arabinose or rhamnose at a concentration of 0.05-0.2%, or ITPG at a concentration of 0.05-0.5 mM;
   3. The method according to claim 2, comprising:
4. The gene library of the protein in the step (2) is a gene library of a protein obtained by fusing alkaline phosphatase (AP) to the N-terminal of the protein,
   The method according to any one of claims 1 to 3, wherein the labeled spot in the step (4) is a labeled spot based on a coloring reaction of AP.
5. 2. The functional protein recognizing a target is an antibody, the target recognized by the protein is an antigen or a peptide or a sugar chain that is an epitope thereof, and the step of recognizing the target is an antigen-antibody reaction step. The method according to any one of claims 4 to 4.
6. 方法 The method according to claim 5, wherein the antibody is a single-chain antibody (scFv) or a Fab antibody.
7. The method according to any one of claims 1 to 6, wherein the transformed microorganism is transformed Escherichia coli.
8. A seeding solution for seeding a microorganism transformed with a gene library of the protein on a filter for colony formation in an automatic control colony assay for expression of a functional protein recognizing a target, comprising: A seeding solution containing (ii);
   (I) glucose, and (ii) an expression inducer.
9. The method according to claim 8, wherein the expression inducer of 剤 (ii) is lactose, arabinose, rhamnose or IPTG.

Images