JP7364242B2 - Automated expression colony assay method - Google Patents

Description

Application of Article 30, Paragraph 2 of the Patent Act (1) On May 20, 2020, the collection of lecture abstracts (electronic version) of the 71st Annual Conference of the Japan Society of Bioengineering was posted on the website (https://www.sbj.or. Distributed at jp/2019/)

Application of Article 30, Paragraph 2 of the Patent Act (2) August 9, 2020, Abstracts of the 71st Japan Society of Biotechnology Engineers Conference, page 281 (Presentation number 3Cp06), Japan Society of Biotechnology Engineers 2019 Annual Meeting Posted in committee

Application of Article 30, Paragraph 2 of the Patent Act (3) Oral presentation on September 18, 2020 at the ``71st Japan Society of Bioengineering Conference'' (held from September 16 to 18, 2020), Okayama University Tsushima Campus

The present invention is an improved colony assay method suitable for screening the expression of functional proteins that recognize targets. ``Automated colony assay method''.

Monoclonal antibodies have high affinity and specificity for antigens, and are extremely important proteins indispensable for research, diagnosis, and medicine. Therefore, monoclonal antibodies with higher affinity and specificity are required. Furthermore, there is an increasing need for monoclonal antibodies that not only have high affinity and specificity for antigens but also have functions such as neutralizing antibodies that inhibit antigen functions.
In line with the speed of research and drug development, there is a need to quickly establish monoclonal antibodies with desired properties against target antigens, and conventional antibody production methods using hybridomas cannot achieve this goal. Unable to meet needs and speed. As an alternative, antibody production methods using recombinant technology are becoming important.

Recombinant antibodies can be engineered using molecular biological techniques, such as fusion with various effector molecules and tags, antibody-drug conjugates, production of multi-recognition antibodies, humanization of antibodies, and antibody gene modification. Affinity maturation technology, which introduces mutations and improves specificity and affinity for antigens, will increase its usefulness.
In the recombinant antibody establishment method, monoclonal antibodies are established by creating and expressing an antibody gene library and screening using antigen binding as an indicator. Among recombinant antibodies, single-chain antibodies (scFv) are small and relatively easy to handle, and are often used for screening. It is established in the form of scFv and can be changed to IgG as appropriate using recombinant technology.
Compared to the conventional hybridoma method, it can handle large libraries, perform screening under various conditions, and easily add functions using engineering techniques, as well as enable the establishment of monoclonal antibodies in a shorter period of time. It has become possible.

The main methods for establishing antibodies using recombinant technology are broadly divided into display methods and colony assay methods. The former is a method in which a large library of displayed antibody fragments and genes is panned against antigens to select antibody fragments that bind to the antigen. It has the advantage of being able to handle libraries (10 ⁹ to 10 ¹¹ ) as well as artificial libraries. However, compared to antibodies, the background derived from large phages is very high, and because antigen-antibody binding is not directly observed during screening, there are many false positives in the clones obtained. Therefore, it is difficult to establish useful monoclonal antibodies just by repeating panning.
Another essential problem is that antibody fragments place a heavy burden on the growth of E. coli. In other words, clones that express antibody fragments that are nontoxic to E. coli growth grow well, so through repeated panning, selection is made based on ease of E. coli growth rather than antigen binding. It often happens that clones that are not toxic to E. coli grow selectively and become a dominant population, rather than clones with high antigen specificity being concentrated (selected and amplified).

In the phage display method, panning is repeated in an attempt to select and amplify positive clones, but during this time E. coli passes through several generations, which has the fatal drawback that unintended clones as mentioned above are very easily selected and amplified. There is. In the phage display method, positive clones cannot be concentrated without repeated panning, so this is an unavoidable problem.
Similar problems arise when, in addition to the ribosome display method and the two-hybrid method using yeast, the mRNA display method (Non-patent Document 1), which can handle even larger libraries, is particularly widely applied to the "artificial evolution" of proteins, drug discovery, etc. It also exists in in vitro viral methods.
Therefore, although these display methods have been highly anticipated, their practical application and application have not progressed as much as expected.

Colony assay (colony lift assay) is widely known as another method for antibody establishment using recombinant technology.
As shown in Figure 1, the colony assay (colony lift assay) method is a method in which an antibody gene library is expressed in Escherichia coli, yeast, etc. to form colonies, and clones with good antigen binding properties are selected ( Non-patent literature 3, 4). After the transformed E. coli is inoculated at high density on the filter on the surface of the medium and allowed to grow sufficiently to generate E. coli colonies, the filter is removed and superimposed on the membrane adsorbed with the target antigen. Transfer to the surface of a selective medium containing an expression inducer. Note that early colony lift assays employed a process in which colonies formed on the surface of a nutrient medium were transferred to a nitrocellulose membrane, and the membrane was superimposed on a target antigen adsorbent. To distinguish it from that earlier method, this method is sometimes simply referred to as a "colony assay." However, since it still includes a lift step in which the colony forming filter is removed and moved, the term "colony lift assay" is used here to refer to both.

Colony lift assay is a screening method in which colonies that produce antibody fragments with antigen-binding properties are identified, antibody genes are isolated from those colonies, and monoclonal antibodies are established. Screening is performed while directly observing the antigen-antibody reaction. Therefore, it has the advantage that there are no false positives. Also, although it is not as large as the display method, it can handle a much larger library (approximately 10 ⁶ to 10 ⁷ ) compared to the hybridoma method.
On the other hand, it requires complicated and long-time operations, the antibody often does not express or the expression is very low, contamination occurs due to the complicated operation, and E. coli bacteria die during the operation. This poses problems, such as the possibility that genes may not be recovered. Although there is a paper that shows the potential of this method, it has not been widely applied. These problems are thought to be due to the difficulty in setting the timing of expression (the growth state of E. coli is important). This colony lift assay was combined with an immunochemiluminescent labeling system to increase sensitivity, and a V _H library was created using heavy chain CDR3 binding specificity determinants and a V H library created using light chain CDR3 binding specificity determinants. A technique (Patent Document 1) has been proposed in which Fab protein screening is applied in combination with _L library.

Dreher et al. improved upon this colony-lift assay and developed a filter-sandwich assay, which eliminates the need for colony lift by allowing colonies expressing antibody fragments to form on the filter. E. coli is inoculated onto the hydrophilic filter prepared on the plate and allowed to form colonies. The filter on which these colonies have formed is placed on an antigen-coated membrane placed on a plate containing an expression inducer. If the antibody fragment produced by E. coli has antigen-binding properties, positive clones are identified by detecting binding to the antigen on the membrane. This method has made it possible to perform assays without performing the difficult and often unsuccessful colony lift operation (Non-Patent Document 4, etc.).

Furthermore, Kumada et al. have reported a method in which colonies are formed directly on the agar medium surface instead of on the filter surface in order to omit the movement of colony filters (Non-Patent Document 5, etc.). Specifically, transformed E. coli is expressed on the surface of an agar selection medium containing an expression inducer to form colonies. A membrane adsorbed with the target antigen is placed directly or via a hydrophilic membrane over the colonies on the agar surface, and reacts with antibodies secreted from the colonies. The binding characteristics with the antigen on the blotted membrane are detected using peroxidase-containing antibody-bound liposomes, and the detected spots and colonies are matched to collect positive colonies on the agar surface. Since the expression inducer is included from the beginning during culture, there is an advantage that there is no complicated process such as moving colonies. Since the entire E. coli is covered with the membrane during blotting, the growth environment of E. coli is changed from an aerobic environment to an anaerobic environment, which also causes deterioration of growth. Inhibition of E. coli growth not only prolongs the screening time, but also increases the probability that the promoter or expressed product will undergo mutations during that time, increasing the possibility that the desired antibody will not be obtained. It can be said that it is not suitable. Furthermore, this method does not involve recovery of genes.

In addition, an improved technology for obtaining a hybridoma strain that highly expresses human Fab fragments with high affinity has been developed for the CellSpot ^TM assay method, which is a type of hybridoma method described above and uses a microtiter plate coated with a capture antibody reagent. It has been proposed that this method be applied to recombinant bacteria that secrete an antibody library (Patent Document 2). Specifically, secreted antibodies from E. coli microcolonies on a plastic membrane with clearly visible holes in the top plastic membrane for E. coli colony formation are bound to a capture antibody coated membrane placed on top of the agar medium layer. It has been shown that the detection process using the "CellSpot ^TM assay method" can be applied by doing so. However, there is no explanation about the process of growing microcolonies.

The present inventors have achieved the ability to easily and quickly achieve high activity by eliminating the need for the lifting step, which can cause contamination and stress E. coli, causing inhibition of expression, while retaining the advantages of the colony lift assay, which has fewer false positives. After extensive research to develop a new colony assay that can screen antibodies with good reproducibility, we found a solution using an agar plate with a concentration gradient of expression inducers, which we named the "One-Step Colony Assay" method (patented). Reference 4).
Specifically, by changing the amount of the expression inducer in the selective medium to form a layered agar plate, the transformed cells do not come into contact with the expression inducer until they have grown sufficiently. When a colony is formed, the cells come into contact with the expression inducer that has gradually reached the surface of the medium by diffusion and initiate antibody production. As a result, it has become possible to assay in growing colonies with good expression, and it has become possible to more efficiently establish antibodies with high affinity and high selectivity. In addition, since the production of antibodies, which is a heavy burden on the growth of bacteria, begins at the stage when the bacteria have fully matured, the final concentration of the expression inducer can be set high and the amount of expression can be increased, allowing antibodies with high binding activity to be produced. However, there is also the advantage of picking up a large number of clones with low expression levels and, conversely, clones with high expression that may not be able to withstand the burden of expression and die.

The present inventors'"One-Step Colony Assay" method enables the simple and rapid screening of highly active antibodies, and has actually succeeded in establishing antibodies with high affinity and high selectivity.
However, one of the drawbacks of this method is that it is difficult to accurately adjust the concentration of the expression inducer. Since colony growth conditions vary depending on the target transformed cell library, it is necessary to prepare the concentration gradient of the expression inducer in advance, which is necessary to set the optimal expression start timing, especially when applying to newly transformed cells. Difficult to decide.
A second drawback is that it is difficult to set the timing of detection based on the antigen-antibody reaction, and good dexterity is required at the time of detection. In this method, the effect of the expression inducer becomes stronger over time, so active antibody production continues even while waiting for detection results, and some clones with particularly high expression intensity may not be able to withstand the burden of expression and die. there is a possibility. In that case, useful clones may not be collected, so it is necessary to set the optimal detection timing while visually checking the growth status of the colony, and to detect as quickly as possible to obtain the desired positive clone.
Furthermore, as another drawback, the problem of so-called "leak expression", in which antibody expression occurs in growing colonies before encountering the expression-inducing agent, remains unsolved. Immediately after plating or in the early stages of colony formation, E. coli is fragile, and if there is "leak expression" of antibodies, it may not proliferate due to the burden, or it may take a long time for colony formation. In such cases, even clones expressing antibodies with excellent antigen recognition (specificity and affinity) cannot be selected by screening, resulting in a substantial reduction in the effective library size.

The present inventors also developed a "single-step colony assay" method as a method for more reliably controlling the timing and intensity of expression induction (Non-patent Document 7). Agar plates, antigen-coated membranes, and hydrophilic filters are layered, and transformed E. coli containing the antibody gene library is spread on the filters. When the colony size is optimal, an expression inducer is sprayed to express antibodies. This is a method of inducing
However, this method cannot be said to be a general method because it requires constant observation of the colony's growth status. Moreover, even with this method, the problem of "leak occurrence" is not solved.

Therefore, the "One-Step Colony Assay" method, which can easily and quickly screen highly active antibodies, solves the problem of "leak expression" and makes it easier and more automated to set the optimal expression start time and detection time. It is an object of the present invention to provide a further improved colony assay method.

Patent No. 4782700 Special Publication No. 2009-544014 Japanese Patent Application Publication No. 2013-233096 JP 2017-73995 Publication

Keefe AD.et al, Nature. 2001 Apr 5;410(6829):715-8. J.D.Marks,et al.,J.Mol.Biol.,222,581-597(1991) Martin L. Dreher, et al., J.Immunol.Methods, 139(1991) 197-205 Giovannoni et al., Nucleic Acids Research 2001,Vol.29, No.5 e27 Y.Kumada,et al.,Biochem.Engineering J.,29(2006)98-102 M.Kato and Y.Hanyu, Journal of Immunological Methods, 2013 396,15-22 M.Kato and Y.Hanyu, Journal of Biotechnology, 2017 255, 1-8 L. Marschall, et al., Appl Microbiol Biotechnol (2017) 101:501-512

An object of the present invention is to provide an improved colony assay method that can be called an "automated expression control colony assay method" in which the optimal expression start time and detection time can be more easily set, can be automated, and "leak expression" is suppressed. It is in.

The present inventors have worked diligently to develop a method to provide a colony assay method that can automatically set the optimal expression induction time and detection time without visually observing the colony growth state, and that suppresses leakage expression. Researched. As a result, we realized that in order to achieve this goal, it is necessary not only to automatically start the induction of expression, but also to automatically suppress the expression and stop the induction of expression. We abandoned the idea of adding an expression inducer to the medium components as in the conventional various improved colony assay methods, and used an agar medium with the medium components set as normal nutrient media (such as LB medium). We came up with the idea of improving the inoculation solution used when inoculating transformed E. coli containing an antibody gene library. Specifically, we did not add any expression inducers such as glucose or sugars to the medium component side of the transformed E. coli, but added an expression inducer such as lactose together with glucose to the seeding solution for seeding, which allowed the growth of the bacteria. By using this method to control antibody expression, we came up with the idea of performing antibody screening more simply and reliably without changing the conventional colony assay procedure (Figure 3). In other words, the present inventors applied for the first time the principle of catabolite suppression, which has been conventionally adopted in mass production technology using tank culture of transformed E. coli, to an antibody screening system using the colony assay method. become.

In gene expression systems under the control of sugar metabolic promoters such as the lactose operon, transcription from the promoter is controlled not only by promoter activators such as lactose but also by cAMP dependent transcriptional activator protein (CAP). glucose inhibits cAMP synthesis. Therefore, in the presence of glucose, intracellular cAMP concentration is kept low, and transcription is suppressed (catabolite repression) even in the presence of promoter activators such as lactose.
In the present invention, by incorporating glucose into the diluent instead of the medium, only glucose is consumed immediately after the bacteria are inoculated onto the filter, and E. coli begins to grow quickly. No occurrence of "leak manifestation" occurs. When glucose is almost completely consumed, antibody expression induction dependent on promoter activation by lactose etc. begins, but at the same time, lactose itself is gradually consumed as a nutrient by E. coli, and there is no replenishment from the medium, so as a result Its expression induction is transient.
Among the expression inducers, the sugar analog IPTG (Isopropyl β-D-1-thiogalactopyranoside) is not metabolized within cells like sugar, but It is known that the ability to bind to a promoter is lost due to acetylation (Non-Patent Document 8). Therefore, when IPTG is used, it is similar to saccharides in that without replenishment from the medium, the effective concentration decreases over time and expression induction becomes transient.
Although this transient expression of an antibody was not originally intended by the present inventors, it ended up working very effectively in an antibody detection system for antibody screening. Unlike the antibody production system, the amount of expressed antibody required in the antibody detection system is extremely small, so transient expression is sufficient, and the amount of antibody expression decreases quickly after detection, which facilitates colony growth. The negative effects of the antibody were limited, and it became possible to perform assays targeting almost all clones capable of producing antibodies.

In this way, in the present invention, by adding an expression inhibitor called glucose and an expression inducer such as IPTG or lactose to the seeding solution, leakage expression can be suppressed and transient expression of the expression inducer can be achieved. This has made it possible to perform assays on growing colonies with good expression, making it possible to assay all clones capable of producing antibodies. Therefore, it has become possible to more efficiently establish antibodies with high affinity and high selectivity.

In addition, in the present invention, we have developed a detection method that simultaneously identifies and clones positive clones using an antibody expression library in which alkaline phosphatase (AP) is fused to the N-terminus. It became possible to obtain antibodies.

Prior to the present invention relating to the "automated expression control colony assay method", the present inventors have developed the above-mentioned "One-Step Colony Assay" method (Patent Document 4) and "Single-step colony assay" method (Patent Document 7). has been developed. All of these techniques can be said to be techniques in which a microorganism transformed with a gene library is used as a colony to identify positive clones that produce the target protein, and at the same time directly isolate antibodies. The newly developed method for identifying positive clones using an antibody expression library with alkaline phosphatase (AP) fused to the N-terminus can be applied to any of these techniques. Therefore, the present inventors collectively named all these techniques "antibody direct cloning (DC)."
That is, when we refer to "antibody direct cloning (DC)", we refer to "One-Step Colony Assay" method, "Single-step colony assay" method, and "automated expression control colony assay", as well as AP fusion antibody expression in these methods. Refers to all methods using detection methods using libraries.

That is, the present invention is as follows.
[1] An automated colony assay method for expression of a functional protein that recognizes a target, comprising:
(1) (a) Place a membrane adsorbed or coated with a target recognized by the protein (b) on top of a solid nutrient medium for microorganisms that does not contain glucose or an expression inducer, and further place (c) colonies on the top surface of the membrane. a step of placing a forming filter;
(2) Seeding microorganisms transformed with the protein gene library on the surface of (c),
(3) a step of binding the antibodies expressed and secreted from each colony formed on the colony filter to the target antigen on the antigen membrane;
(4) detecting the binding activity with the target antigen on the antigen membrane as a labeled spot, and (5) selecting a positive clone by overlapping the labeled spot on the antigen membrane and the colony on the colony filter.
including;
Here, a method characterized in that the seeding solution used in seeding the microorganism in step (2) contains (i) glucose and (ii) an expression inducer.
[2] The method according to [1] above, wherein the expression inducer (ii) contained in the seeding solution is lactose, arabinose, rhamnose or IPTG.
[2] can also be written as follows.
[2'] When the gene in the gene library in step (2) is under the control of the lac promoter, the expression inducer is lactose or IPTG; when the gene is under the control of the arabinose promoter, the expression inducer is arabinose. The method according to [1] above, wherein when the gene is under the control of the rhamnose promoter, the expression inducer is rhamnose.
[3] The seeding solution when seeding microorganisms in step (2) is
(i) glucose at a concentration of 0.02-0.2%, and (ii) lactose, arabinose or rhamnose at a concentration of 0.05-0.2%, or ITPG at a concentration of 0.05-0.5mM;
The method described in [2] above, characterized in that the method comprises:
[4] The protein gene library in step (2) is a protein gene library in which alkaline phosphatase (AP) is fused to the N-terminus of the protein,
The method according to any one of [1] to [3] above, wherein the labeled spot in step (4) is a labeled spot based on a color reaction of AP.
In addition, the AP expression screening method using this AP fusion protein expression library and the detection method using AP color reaction is applicable not only to the "automated expression control colony assay method" according to the present invention but also to the conventional colony assay method. It is a technique that can be applied to general direct cloning methods (DC), including direct cloning methods, so it can also be written as follows.
[4']
A direct cloning method (DC) for screening functional proteins that recognize targets,
(1) Step of placing (b) a membrane adsorbed or coated with the target recognized by the protein on the top surface of (a) a solid nutrient medium for microorganisms, and further placing (c) a colony forming filter on the top surface of the membrane. ,
(2) Seeding microorganisms transformed with a gene library in which AP is fused to the N-terminus of the protein on the surface of the colony forming filter in (c);
(3) a step of binding the antibodies expressed and secreted from each colony formed on the colony filter to the target antigen in the form of an antigen film;
(4) A step of detecting a labeled spot by an AP coloring reaction obtained by adding an AP coloring substrate onto the antigen membrane, and (5) a step of superimposing the labeled spot on the antigen membrane and the colony on the colony filter to detect a positive a step of selecting clones;
including methods.
[5] The functional protein that recognizes a target is an antibody, the target recognized by the protein is an antigen or a peptide or sugar chain that is an epitope thereof, and the recognition reaction process with the target is an antigen-antibody reaction process. The method according to any one of [1] to [4] above.
[6] The method according to [5] above, wherein the antibody is a single chain antibody (scFv) or a Fab antibody.
[7] The method according to any one of [1] to [6] above, wherein the transformed microorganism is a transformed E. coli.
[8] A seeding solution for seeding microorganisms transformed with a gene library of the protein onto a colony forming filter in an automatically controlled colony assay method for expression of a functional protein that recognizes a target, comprising the following ( A seeding solution containing i) and (ii);
(i) glucose, and (ii) an expression inducer.
[9] The seeding solution according to [8] above, wherein the expression inducer in (ii) is lactose, arabinose, rhamnose or IPTG.
[9] can also be written as follows.
[9'] When the gene in the gene library contained in the transformed microorganism is under the control of the lac promoter, the expression inducer is lactose or IPTG; when the gene is under the control of the arabinose promoter, the expression inducer is The seeding solution according to [8] above, wherein when the gene is arabinose and the gene is under the control of the rhamnose promoter, the expression inducer is rhamnose.

The colony assay method of the present invention makes it easier to set the optimal expression start time and detection time, so it is possible to automatically start and stop expression, and there is no need to monitor the colony formation status of E. coli. No need to do any work.
Furthermore, since leakage expression before colony formation can be avoided, all E. coli bacteria capable of producing antibodies can form colonies. At this time, expression can be induced with maximum efficiency, increasing the sensitivity of the assay and allowing identification of many positive clones, while also avoiding killing of E. coli during the assay and mutation/deletion of antibody genes from E. coli. This makes it possible to perform assays using large, high-quality libraries. Therefore, it has become possible to more efficiently develop antibodies with high affinity and high specificity.
Furthermore, by developing a method for identifying positive clones using an antibody expression library with alkaline phosphatase (AP) fused to the N-terminus, it has become possible to obtain target antibodies more easily and quickly.

Conventional method 1: Colony lift assay method Conventional method 2: “One-Step Colony Assay” method Procedures for the “automated expression control colony assay” method of the present invention Procedures for improved methods using AP fusion proteins Conventional detection method using secondary antibody detection Improved detection method using AP color development Structure of AP fusion scFv expression vector Positive clones detected using antibody library Characterization of positive clones screened from antibody libraries: Sequences In the figure, underlined parts indicate linkers. The N-terminal side (upstream part) of the linker is VH, and the C-terminal side (downstream part) of the linker is VL. Characterization of positive clones screened from antibody libraries: ELISA Positive clones detected using AP fusion antibody library Characterization of positive clones screened from AP fusion antibody library: Sequences In the figure, underlined parts indicate linkers. The N-terminal side (upstream part) of the linker is VH, and the C-terminal side (downstream part) of the linker is VL. Characterization of positive clones screened from AP fusion antibody library: ELISA

1. About the "Automatically Controlled Expression Colony Assay Method" The improved colony assay method of the present invention is also referred to as the "controlled expression colony assay" method or the "automatically controlled expression colony assay" method. The "automated expression control colony assay" method is basically a method similar to the colony assay method that has been widely used in the past, and therefore will be explained below, focusing on the differences from the conventional method.
The protein and peptide library to be screened in the present invention may be any protein or peptide as long as it can be expressed by transformed cells. Although the following description mainly describes antibody (scFv) libraries, the present invention is not limited to antibody (scFv) libraries.

(1-1) Conventional colony assay method (1-1-1) Conventional colony lift assay procedure (Non-Patent Documents 2 and 3) (FIG. 1).
Conventional colony lift assays are typically performed using the following procedure, as described in Non-Patent Documents 2 and 3, for example.
(1) Step of preparing E. coli, yeast, etc. transformed with antibody (scFv) library,
(2) A step in which a hydrophilic filter is placed on the surface of a nutrient medium for growth, and the transformed E. coli and yeast are sown at high density and allowed to grow sufficiently to form colonies;
In addition, in the original colony lift assay (Patent Document 1), transformed E. coli and yeast are directly inoculated and grown on the surface of a nutrient medium, so a step of transferring colonies onto a nitrocellulose membrane or the like is additionally required. In addition, since the reaction with the antigen on the surface of the antigen membrane is the antibody secreted by the colony on the surface of the transferred membrane, it is necessary to invert the labeled spot when selecting positive clones.
(3) preparing an antigen membrane adsorbed or coated with a target antigen;
(4) removing the filter on which colonies have been formed and transferring it to the surface of a selective medium containing an expression inducer while superimposing it on the antigen membrane;
(5) After culturing in a selective medium containing an expression inducer, the antibody expressed and secreted in each colony is bound to the target antigen on the membrane by the action of the expression inducer;
(6) removing the filter on which colonies have formed and storing it on a medium;
(7) Detecting the binding activity with the target antigen on the antigen membrane as a labeled spot,
(8) A method of selecting positive clones by overlapping labeled spots on the antigen membrane and colonies on the colony filter.

(1-1-2) One-Step Colony Assay procedure (Figure 2)
The one-step colony assay method is a method developed by the present inventors as an improvement method of the conventional colony lift assay (Patent Document 4).It eliminates the need for a lifting step that causes contamination, and is a simple, quick, and highly active method. This made it possible to screen antibodies.

(1) Step of preparing E. coli, yeast, etc. transformed with antibody (scFv) library,
(2) preparing an antigen membrane adsorbed or coated with a target antigen;
(3) preparing a nutrient medium containing a concentration gradient of an expression inducer (IPTG, etc.);
(4) Place the antigen membrane from (2) on the surface of the nutrient medium containing the expression inducer from (3), and then place the transformed E. coli and yeast from (1) at high density on the colony filter placed on top of it. The process of sowing seeds;
(5) a step of binding the antibodies expressed and secreted from each colony formed on the colony filter to the target antigen on the antigen membrane;
(6) Detecting the binding activity with the target antigen on the antigen membrane as a labeled spot,
(7) A method of selecting positive clones by overlapping labeled spots on the antigen membrane and colonies on the colony filter.

Thus, the One-Step Colony Assay is as shown in (Figure 2), and is different from the previous colony lift assay method (Figure 1) in that it requires a colony lift step (4)(5). The difference is that this can be omitted. In other words, the main feature is that an appropriate concentration gradient is provided for the expression inducer (IPTG, etc.) contained in the nutrient medium for growth in order to omit the colony lift step.
Therefore, the assay process for antibody detection, such as the method for preparing a target antigen-coated membrane and the method for detecting labeled spots using the antigen membrane, is similar to the previous colony lift assay (Non-Patent Documents 2, 3, Patent Document 1, etc.), phage display, etc. All the methods used in the hybrid method etc. can be reused. Furthermore, it can be applied as is to antibody libraries prepared for these assay methods.

(1-2) Procedure for expression-controlled colony assay of the present invention (Figure 3)
The expression-controlled colony assay of the present invention involves the preparation of an inoculum of Escherichia coli, yeast, etc. transformed with an antibody (scFv) library for inoculation onto a filter. The method is characterized in that the transformed E. coli in the inoculation solution is inoculated onto the filter on the surface of the medium by adding a trace amount of an expression inducer such as lactose or IPTG in an optimal concentration range along with glucose, which acts as an agent. It is an invention. Therefore, the other procedures are almost the same as the one-step colony assay described above. That is, the following procedure shown in FIG. 3 is performed.
(1) Step of preparing E. coli, yeast, etc. transformed with antibody (scFv) library,
(2) preparing a seeding solution containing glucose and an expression inducer in a specific mixing ratio;
(3) preparing an antigen membrane adsorbed or coated with a target antigen;
(4) the step of preparing a normal nutrient solid medium (such as LB medium);
(5) Place the antigenic membrane from (2) on the surface of the nutrient medium from (3), further place a colony filter on top of it, and suspend the transformed E. coli from (1) in the seeding solution from (2). , a step of seeding yeast at high density on a colony filter;
(6) a step of binding the antibodies expressed and secreted from each colony formed on the colony filter to the target antigen on the antigen membrane;
(7) Detecting the binding activity with the target antigen on the antigen membrane as a labeled spot,
(8) A method of selecting positive clones by overlapping labeled spots on the antigen membrane and colonies on the colony filter.

Therefore, in the present invention, a method for preparing an antibody (scFv) library used in each step other than the method for preparing a seeding solution, a method for preparing a target antigen-coated membrane, a method for detecting labeled spots using the antigen membrane, a method for preserving colonies, For a series of steps leading to the acquisition of useful antibody-producing clones, such as the positive clone identification method, the procedure of the one-step colony assay method shown in (1-1-2) above can be applied mutatis mutandis.

(1-3) Procedure for improved expression-controlled colony assay of the present invention (Figure 4)
The basic procedure for the improved expression-controlled colony assay of the present invention is performed according to each step shown in (1-2) above. An AP fusion antibody (scFv) library is used, in which alkaline phosphatase (AP) is fused to the N-terminus of scFv). Note that AP can be made into a fusion protein with scFv by a method similar to that of Harper et al. (K. Harper, et al. Journal of Virological Methods 63 (1997) 237-242). K. Harper et al. fused AP to the C-terminal side of scFv, whereas we fused AP to the N-terminal side of scFv. The AP gene sequence is available as accession number EG10727. A modified AP gene in which the 153rd amino acid residue Asp is replaced with Gly and the 330th amino acid residue Asp is replaced with Asn may be used (Patent No. 3560972, WO2015056659A1).
By using an AP fusion antibody (scFv) library, it has become possible to directly detect the binding activity with the target antigen on the antigen membrane in step (7) above by a color reaction of AP. The specific procedure is as shown in FIG. 4, and the differences in the detection process from the conventional detection method using a secondary antibody are shown in FIGS. 5 and 6.

2. Preparation of the target protein of the present invention and its library (2-1) Target protein of the present invention The target protein for screening of the present invention is a "functional protein that recognizes a target", that is, a "protein with excellent binding activity". It is. Since it is typically an antibody, the term "antibody" will be mainly described herein, but it is not limited to antibodies. As long as the protein has binding activity to a target, a protein with excellent binding activity can be obtained by applying the method described below regarding "antibodies" using the binding activity. The "target antigen" that is recognized and bound by the "antibody" may be any kind of "antigen", but typically membrane proteins such as receptors and channels, physiologically active proteins such as ligands, and toxins. , pathogenic bacteria, etc.
Here, in the present invention, the term "antibody" mainly refers to antibody fragments that can be expressed in E. coli, in addition to IgG or antibodies with one or more domains deleted, such as single chain antibodies (scFv), Fab , Fv, Fab', F(ab') ² and the like are preferred, with scFv being particularly preferred. Antibodies having sequences derived from mammals such as humans are preferred, but are not limited thereto.
In addition, "proteins with excellent binding activity" other than "antibodies" include DNA-binding proteins, peptides, protein A, and the like.

(2-2) Types of transformation hosts and transformation methods Any bacteria or yeast can be used as a host as long as it is a colony-forming microorganism and is effective in suppressing catabolites. Specifically, bacteria of the genus Bacillus such as E. coli (E. coli) and B. megaterium, bacteria of the genus Brevibacillus, other bacteria, Saccharomyces cerevisiae, as well as yeast of the genus Pichia and Candida, and especially E. coli are preferred.
Note that many microorganisms have a catabolite suppression mechanism, and when glucose and other sugars are present as carbon sources in the growth environment, they preferentially metabolize glucose. Therefore, when the inducer of protein expression is a saccharide, expression is suppressed while glucose is present, and after glucose metabolism, metabolism of the saccharide of the inducer begins, and expression occurs with a delay.
Methods for transforming hosts and suitable expression vectors for each host are known to those skilled in the art.
As the transformation method, an appropriate method such as a chemical transformation method using calcium chloride or an electroporation method can be selected.
However, the expression vector used in the present invention must have a transcription mechanism under the control of a sugar metabolism promoter, which is a transcription mechanism in which a catabolite suppression mechanism operates. Preferred expression vectors include pET vectors, pGEX vectors, and the like in the case of E. coli.

(2-3) Library production method Below, we will discuss antibody libraries for screening antibodies with high affinity and specificity for the target protein of the screening of the present invention, among which scFv libraries are typical antibody libraries. Although the production method will be described in detail, the library of the present invention is not limited to an scFv library. Libraries for screening other "proteins with excellent binding activity" can also be created in the same manner. Furthermore, the host cell used to transform the library is not limited to E. coli.

(2-3-1) Collection of antibody genes from immunized animals Antibody genes can be collected from rodents such as mice, rats, rabbits, primates such as monkeys, as well as sheep, goats, cows, and camels. , large mammals such as llamas are preferred, and their spleens, peripheral blood mononuclear cells (PBMCs), lymphocytes, B cells, etc. can be used.
In this example, rat, rabbit spleen, or rabbit PBMC were used, but the present invention is not limited to these.

(2-3-2) Method for producing scFv library
To create an scFv library, a V _H gene derived from an antibody heavy chain gene and a V _L gene derived from a light chain gene are prepared, and then linked via a suitable linker and incorporated into an expression vector. When creating an scFv library, it is important to incorporate the V _H and V _L genes into the vector so that mutations, deletions, and shifts do not occur. Furthermore, since there are parts of the gene that have large diversity (antigen recognition region: CDR region), it is necessary to create an scFv library in a way that maintains this diversity and does not inhibit production. be. There are two main methods conventionally used for this purpose:
(a) Two-step cloning: V _H and V _L are each amplified by PCR method, V _L is first inserted into the vector, multiplied with E. coli to create a V _L library, and then V _H is inserted into this vector. , how to create a scFv library.
(b) One-step cloning (V _H -V _L assembly): A method in which V _H and V _L are each amplified by PCR and then ligated, and the ligated product is incorporated into a vector to create an scFv library. In particular, as a method for linking V _H and V _L genes, a linker region is added to the C-terminus of V _H and the N-terminus of V _L , and the overlap PCR reaction (SOE-PCR) utilizes the overlap of the linker regions. A widely used method is to connect V _H and V _L by splicing by overlap extension (PCR).

In ordinary phage display methods and conventional colony assay methods, the simple and rapid method (b) is often adopted when constructing scFv expression vectors, but it has drawbacks such as easy introduction of genetic mutations. The present inventors recently developed the "λ exonuclease method" (Non-Patent Document 6, Patent Document 3), which corresponds to the improved method (b), as a scFv library construction method for phage display. The "λ exonuclease method" uses λ exonuclease and primers with S-terminus near the 3' and 5' ends to prevent non-specific reactions of λ exonuclease, without using SOE-PCR. .
In constructing an scFv library using the automatic expression control colony assay method of the present invention, other antibody library construction methods such as "One-step cloning" (b) using conventional SOE-PCR can also be applied; It is particularly preferable to employ the "Two-step cloning method" in a) or the "λ exonuclease method" developed by the present inventors.

(2-3-3) About the "Two-step cloning method" The procedure of the "Two-step cloning method", which is one of the methods particularly preferably employed in the automatic expression control colony assay method of the present invention, is briefly explained below. Explain.

< _VL library creation>
The V _L library and vector amplified by PCR and purified were sufficiently digested with NheI and NotI at 37° C. for 2 hours each, and after purification, the V _L library and vector were ligated. Thereafter, DH5α competent cells (Nihon Gene Co., Ltd.), which can stably store genes, were transformed with Ligation solution, and seeded on LB agar medium containing ampicillin to form colonies to create a V _L vector library. .

<scFv library preparation>
After purifying the plasmid of the V _L vector library obtained above, the V _H library and V _L vector library amplified by PCR were heated with NcoI and KpnI for at least 2 hours at 37°C. After cutting, the V _H library and V _L vector library were ligated. BL21(DE3) competent cells (Nippon Gene Co., Ltd.) were transformed with the ligation solution, and seeded on LB agar medium containing ampicillin to form colonies to produce scFv library expression vectors.

<Preparation of V _L library for AP-scFv>
The V _L library and vector that had been amplified and purified by PCR were sufficiently digested with NheI and NotI at 37° C. for at least 2 hours each, and after purification, the V _L library and the vector into which the AP gene had been inserted were ligated. Thereafter, DH5α competent cells (Nihon Gene Co., Ltd.), which can stably store genes, were transformed with Ligation solution, and seeded on LB agar medium containing ampicillin to form colonies to create a V _L vector library. .

<AP-scFv library preparation>
After purifying the plasmid of the V _L vector library obtained above, the V _H library and V _L vector library amplified by PCR were treated with NcoI and XhoI for a sufficient time of at least 2 hours at 37°C. After cutting, the V _H library and V _L vector library were ligated. BL21(DE3) competent cells (Nippon Gene Co., Ltd.) were transformed with the ligation solution, and seeded on LB agar medium containing ampicillin to form colonies to produce AP-scFv library expression vectors. Its structure is shown in FIG.

(2-3-3) λ exonuclease method The scFv library construction method using λ exonuclease recently developed by the present inventors (Non-patent Document 6, Patent Document 3) is also applicable to the scFv library of the present invention. Extremely suitable for construction.
The construction method is as described in (Non-Patent Document 6, Patent Document 3), and specifically, it is performed according to the following steps.
(1) When amplifying the V _H gene and V _L gene by PCR, a linker sequence is added to one C-terminal primer and the other N-terminal primer, and a phosphoric acid is further added to the 5' end.
(2) The phosphorylated 5' end of each of the two types of DNA fragments obtained was digested with lambda exonuclease, the linker part was made into a single strand, and V _H and V _L were connected, and then the Bst DNA A polymerase removes the remaining complementary strand in the 3' direction and synthesizes a new complementary strand (strand displacement synthesis), producing a complete double strand of V _H and V _L connected by a linker.
(3) Insert this double strand into a vector and use it as an scFv library.
This method takes advantage of the property that λ exonuclease cannot digest S-linked (phosphorothioate) DNA, and converts the 5' end of the non-phosphorylated primer into S-terminal, thereby converting the non-specific (non-phosphorothioate) DNA of λ exonuclease. (oxidized 5' end) can be prevented. In addition, by adding S near the 3' end of the phosphorylated primer, it is possible to control the length of DNA that is digested by lambda exonuclease, and avoid making CDR regions with large diversity into single strands. It has the excellent advantage of being able to dramatically reduce background reactions.
Therefore, the drawbacks of conventional "One-step cloning" using SOE-PCR, such as gene deletion, insertion, substitution, and shift, which are likely to occur, and uniform PCR reactions may be inhibited, have been resolved. Therefore, it is also extremely suitable for constructing the scFv library of the present invention.

In this example, an scFv library was actually constructed using the "λ exonuclease method" and the "automated expression control colony assay method" of the present invention was implemented, and the "One-Step Colony Assay" method was used. Similar to the case of (Patent Document 4), the same good results as when using the scFv library constructed by the "Two-step cloning method" were shown.
This "λ exonuclease method" can also be applied to the production of AP-scFv libraries, and can be carried out using exactly the same procedure.

3. Inoculation solution used in the present invention and seeding of transformed E. coli (3-1) Expression inducer used in the present invention In the present invention, expression inducers typically include sugars such as lactose, arabinose, and rhamnose, and allolactose analogs. Refers to sugar analogs such as ITPG. Lactose and IPTG increase gene expression by activating transcription in an expression vector containing a foreign gene under the control of the lac promoter, arabinose by the arabinose promoter, and rhamnose by the rhamnose promoter.
The pET system (T7 expression system), in which T7 RNA polymerase is placed under the control of the T7 promoter (L8-UV5-lac promoter), is often used for high protein expression. A system (BL21-AI) in which T7 RNA polymerase is placed under the control of an arabinose-inducible promoter (araBAD promoter) is also used for high protein expression, and since it is repressed by glucose and can be tightly controlled by arabinose, this system It is also useful as an expression vector for the invention.
In the case of rhamnose, the expression system of a rhamnose-inducible promoter (rhaPBAD promoter) is also used for high protein expression, and since it is suppressed by glucose and can be tightly controlled by rhamnose, it is also useful as an expression vector for the present invention. It is.
In the following ITPG embodiments, a case will be mainly described in which scFv expression is induced by an scFv expression vector under the control of a T7 promoter (L8-UV5-lac promoter) having a lac promoter.

(3-2) Preparation of seeding solution In the conventional colony assay method, the seeding solution for seeding transformed E. coli on a sheet is a general nutrient medium (for example, LB medium) as it is or diluted as appropriate. However, in the present invention, as the seeding solution, expression inducers such as lactose and IPTG are added to the seeding solution containing the nutrient medium in the minimum necessary amount and in the optimal amount along with glucose, which acts as an expression inhibitor. Prepare by adding in proportion. As expression inducers, sugars such as lactose, arabinose, and rhamnose, and the allolactose analog ITPG can be used alone or in combination, depending on the expression system used.
Specifically, the concentration of glucose as an expression inhibitor in the seeding solution is 0.02 to 0.2%, preferably 0.05 to 0.15%. The concentration of sugars such as lactose, arabinose, and rhamnose as expression inducers in the inoculation solution is 0.05 to 0.2%, preferably 0.07 to 0.13%, and in the case of the allolactose analogue ITPG, the concentration in the inoculation solution is 0.05%. ~0.5mM, preferably 0.07-0.15mM.
A seeding solution is prepared by adding these expression inhibitors and expression inducers to a nutrient medium solution (LB medium, TB medium, 2×YT medium, etc. or a solution containing it, or PBS) at the above concentration, and the seeding solution is seeded. A culture solution containing transformed E. coli to be cultured is cultured until the OD value becomes at least 0.1, preferably 0.2 to 0.3, and then diluted approximately 10 ⁴ times.

(3-3) Filter for colony formation The material of the filter is the same as that used in various conventional colony assay methods. For example, polyvinylidene fluoride, preferably having a thickness of 30 to 250 μm and a pore size of 0.22 μm or 0.45 μm. Place the colony filter so that there are no gaps above the antigen membrane.

(3-4) Preparation of agar medium The agar medium used in the present invention may be prepared in the same manner as the agar medium used in conventional colony lift assays, but the nutrient medium used must be glucose-free and express It is necessary to choose a medium that does not contain inducing agents.
For example, an LB medium plate containing neither glucose nor expression inducer is prepared as follows.
Pour 1L of ultrapure water into an Erlenmeyer flask, etc., add nutrients (10g Trypton and 5g Yeast Extract), sodium chloride (5g), and Agar (15g), cover with aluminum foil, etc., and autoclave (121℃). (for 20 minutes) to dissolve nutrients and Agar while sterilizing. After autoclaving, when the temperature drops to around 50°C, add antibiotics. Pour into a 10 cm sterile Petri dish on a horizontal surface to a thickness of about 5 mm. Once cooled and solidified, cover and turn upside down. If not used immediately, store in a plastic box at 4°C.

(3-5) Concentration of E. coli to be seeded and timing of seeding In the automatic expression control colony assay method of the present invention, E. coli containing about 1000 scFv expression vectors are mixed with the seeding solution prepared as described in (3-2) above. Seed onto filters for colony formation.
Regarding the timing of seeding, as in the case of the "One-Step Colony Assay" method (Patent Document 4), E. coli at the very early stage of logarithmic growth with a low OD value, specifically, OD at 600 nm of 0.1 Screening efficiency can be increased by using E. coli in the range of ~0.4, preferably 0.15 to 0.3, more preferably 0.2 to 0.25. Generally, when E. coli is inoculated onto an agar medium, E. coli in the logarithmic growth phase (OD at 600 nm of approximately 0.5 to 1.0) is used, so it is effective to inoculate at an extremely early timing.

4. Detection method utilizing binding to target antigen and establishment of clones The detection process and clone establishment process utilizing binding to target antigen in the present invention are the same as the conventional colony assay method. All methods used in conventional colony assays are applicable.
(4-1) Preparation of target antigen membrane of the present invention Target antigens of the present invention include membrane proteins such as receptors and channels, physiologically active proteins such as ligands, toxins, and pathogenic bacteria.
In this example, the experiment was conducted using human IgG as a model target antigen, but it is of course not limited to these antigens.
The target antigen may be used as is, but if it has a known peptide epitope or sugar chain epitope, for example, only that epitope may be used.
The target antigen membrane is preferably nitrocellulose or polyvinylidene fluoride and has a pore size of 0.22 μm or 0.45 μm.
For example, the target antigen is diluted to 100 μg/mL with PBS, the membrane is immersed therein, and the membrane is coated with the antigen for 2 hours at room temperature. Then, wash 3 times with PBS and place on LB agar plate so that there are no gaps.

(4-2) Detection method using secondary antibody (conventional method) (Figure 5)
In the detection method using a secondary antibody, after colony formation and expression induction, the filter on which colonies have been formed is transferred onto a storage medium, and the target antigen membrane is separated. An HRP-labeled detection antibody is added to the separated target antigen membrane and allowed to bind to the tag attached to the scFv captured on the target antigen membrane. Wash 4 times to wash away unbound HRP-labeled detection antibody, and add HRP luminescent substrate. The light emitted from the reaction with the substrate is photographed with a CCD camera, and after image processing, spot images are printed and colonies are superimposed to identify positive clones. When assaying multiple sheets, perform the process from adding the substrate to printing spot images for each sheet.

(4-3) Detection method using AP color development (improved method) (Figure 6)
In the detection method using AP coloring of AP-scFv, after colony formation and induction of expression, the filter on which colonies have been formed is transferred onto a storage medium and the target antigen membrane is separated. Add an AP coloring substrate (e.g., pNPP, BCIP/NBT, etc.) to the separated target antigen membrane, and when a colored spot appears, wash the substrate and stop coloring. Colonies are superimposed on the target antigen membrane where spots appear, and positive clones are identified. Even if multiple assays are performed, the color reaction is performed at once.

(4-4) Method for obtaining positive clones The method for obtaining positive clones is similar to the conventional colony assay method. For example, before separating the colony filter and antigen membrane after colony formation, mark the two membranes with a marker. make a hole. After detecting the antigen membrane, positive clones are identified and colonies are picked up by overlapping the markers on the top of the antigen membrane.

(4-5) Establishment of clones using this method The reactivity of established clones is evaluated according to conventional methods.
In this example, the picked positive clones were cultured in a liquid medium until OD ₆₀₀ reached 0.6, IPTG was added, scFv expression was induced overnight, and E. coli was recovered. The collected E. coli was disrupted by ultrasonic waves, and the disrupted supernatant was used in ELISA to evaluate the reactivity of the scFv obtained from the established clones. As a result, compared to conventional colony assay methods, including the "One-Step Colony Assay" method developed by the present inventors (Patent Document 4), positive clones were obtained at a higher rate, and clones with extremely high activity were obtained. succeeded in obtaining.

Furthermore, when using an improved detection method using AP color development, direct detection is performed without using a secondary antibody in the detection process, simplifying the detection operation and shortening assay time (1/15 or less). Moreover, the signal was clear, reducing background and false positives due to secondary antibodies. As a result, it has become possible to quickly and accurately establish a new monoclonal antibody.
Another advantage of not using a secondary antibody is that AP-scFv can be immediately used as a detection antibody for sandwich ELISA, which is important in diagnosis and the like.

EXAMPLES Hereinafter, the present invention will be explained in more detail with reference to Examples, but the scope of the present invention is not limited to the following Examples.
Other terms and concepts used in the present invention are based on the meanings of terms commonly used in the field, and techniques used to carry out the present invention do not include techniques that specifically indicate the source thereof. can be easily and reliably carried out by a person skilled in the art based on known documents and the like. In addition, various analyzes were performed by applying the methods described in the analytical equipment or reagents used, the instruction manual of the kit, the catalog, etc.
Note that the contents of the technical documents, patent publications, and patent application specifications cited in this specification shall be referred to as the contents of the present invention.

(Example 1) Preparation of scFv library
(1-1) Immunization of rats In this example, three rats, which are often used as an immunization animal species, were used for one antigen. First, the antigen was immunized with an adjuvant containing killed tuberculosis bacteria, and then the antigen was immunized with an adjuvant that did not contain killed tuberculosis bacteria. By performing immunization twice, a sufficient immune response was stimulated.
Specifically, human IgG was mixed with FREUND Complete ADJUVANT (Sigma), and the mixture was administered into the peritoneal cavity of Wistar rats (female) at a concentration of 100 μg of antigen/animal, and primary immunization was performed for 2 weeks. Subsequently, the antigen and FREUND Incomplete ADJUVANT (Sigma) were mixed, and secondary immunization was performed in the same manner as the primary immunization. Two weeks after the last immunization, rats were given a boost by intraperitoneally administering 100 μg of the antigen.

(1-2) Removal of spleen After the spleen was removed from the immunized rat, it was treated with RNAlater (Life Technologies) to stabilize the RNA.

(1-3) Amplification of V _H (antibody heavy chain variable region) and V _L (antibody light chain variable region) An RNA purification kit is used to synthesize cDNA as a template for amplifying antibody genes. Total RNA was purified using random hexamers and oligo-dT primers to synthesize full-length cDNA, which was used as a template for antibody gene amplification. Specifically, total RNA was purified from the spleen treated with RNAlater using RNeasy (Qiagen), and cDNA was synthesized using Transcriptor First Strand cDNA Synthesis Kit (Roche).
In this example, KOD-FX polymerase (Toyobo Co., Ltd.), a highly accurate polymerase, was used for V _L and V _H gene amplification using PCR to prevent PCR errors and maintain the correct structure of scFv. It was used.
Using the synthesized cDNA as a template and a primer set for rat V _H gene and V _L gene amplification, amplification was performed at 94°C for 2 min, (98°C for 10 sec, 58°C for 30 sec, and 68°C for 1 min) using KOD-FX polymerase (Toyobo). 5, Perform PCR under the conditions of (98℃ 10sec, 63℃ 30sec, 68℃ 1min)×5, (98℃ 10sec, 68℃ 1.5min)×20, 68℃ 7min to amplify the V _H gene and V _L gene. did. Each amplified gene was electrophoresed on a 1.5% agarose gel to confirm amplification.

The primer set for each gene used in this example was based on the previously published primer set for V _H gene and V _L gene (Jorg Burmester, Andreas Pluckthun., Antibody Engineering Volume 1: 19-39, Springer). Based on the sequence, synthesize primers containing NcoI for the V _H sense primer, KpnI for the V _H antisense primer, NheI for the V _L sense primer, and NotI for the V _L antisense primer and use them as a primer set. did. Each primer is degenerate at several positions to ensure antibody gene diversity.
The primer sequences used are as follows.

V _H sense primer
V _H S1 ATGCCCATGGGAKTRMAGCTTCAGGAGTC (SEQ ID NO: 1)
V _H S2 ATGCCCATGGGAGGTBCAGCTBCAGCAGTC (SEQ ID NO: 2)
V _H S3 ATGCCCATGGCAGGTGCAGCTGAAGSARTC (SEQ ID NO: 3)
V _H S4 ATGCCCATGGGAGGTCCARCTGCAACARTC (SEQ ID NO: 4)
V _H S5 ATGCCCATGGCAGGTYCAGCTBCAGCARTC (SEQ ID NO: 5)
V _H S6 ATGCCCATGGCAGGTYVARCTGCAGCARTC (SEQ ID NO: 6)
V _H S7 ATGCCCATGGCAGGTCCACGTGAAGCARTC (SEQ ID NO: 7)
V _H S8 ATGCCCATGGGAGGTGAASSTGGTGGARTC (SEQ ID NO: 8)
V _H S9 ATGCCCATGGGAVGTGAWGSTGGTGGAGTC (SEQ ID NO: 9)
V _H S10 ATGCCCATGGGAGGTGCAGSTGGTGGARTC (SEQ ID NO: 10)
V _H S11 ATGCCCATGGGAKGTGCAMCTGGTGARTC (SEQ ID NO: 11)
V _H S12 ATGCCCATGGGAGGTGAAGCTGATGGARTC (SEQ ID NO: 12)
V _H S13 ATGCCCATGGGAGGTGCARCTTGTTGARTC (SEQ ID NO: 13)
V _H S14 ATGCCCATGGGARGTRAAGCTTCTCGARTC (SEQ ID NO: 14)
V _H S15 ATGCCCATGGGAAGTGAARSTTGAGGARTC (SEQ ID NO: 15)
V _H S16 ATGCCCATGGCAGGTTACTCTRAAAASARTC (SEQ ID NO: 16)
V _H S17 ATGCCCATGGCAGGTCCAACTVCAGCARCC (SEQ ID NO: 17)
V _H S18 ATGCCCATGGGATGTGAACTTGGAASARTC (SEQ ID NO: 18)
V _H S19 ATGCCCATGGGAGGTGAAGGTCATCGARTC (SEQ ID NO: 19)

V _H antisense primer
V _H AS1 ATGCGGTACCCGAGGAAACGGTGACCGTGGT (SEQ ID NO: 20)
V _H AS2 ATGCGGTACCCGAGGAGACTGTGAGAGTGGT (SEQ ID NO: 21)
V _H AS3 ATGCGGTACCCGCAGAGACAGTGACCAGAGT (SEQ ID NO: 22)
V _H AS4 ATGCGGTACCCGAGGAGACGGTGACTGAGGT (SEQ ID NO: 23)

V _L sense primer
V _L Sκ1 ATGCGCTAGCGAYATCCAGCTGACTCAGC (SEQ ID NO: 24)
V _L Sκ2 ATGCGCTAGCGAYATTGTTCTCWCCCAGTC (SEQ ID NO: 25)
V _L Sκ3 ATGCGCTAGCGAYATTGTGMTMACTCAGTC (SEQ ID NO: 26)
V _L Sκ4 ATGCGCTAGCGAYATTGTGYTRACACAGTC (SEQ ID NO: 27)
V _L Sκ5 ATGCGCTAGCGAYATTGTRATGACMCAGTC (SEQ ID NO: 28)
V _L Sκ6 ATGCGCTAGCGAYATTMAGATRAMCCAGTC (SEQ ID NO: 29)
V _L Sκ7 ATGCGCTAGCGAYAYYCAGATGAYDCAGTC (SEQ ID NO: 30)
V _L Sκ8 ATGCGCTAGCGAYATYCAGATGACACAGAC (SEQ ID NO: 31)
V _L Sκ9 ATGCGCTAGCGAYATTGTTCTCAWCCAGTC (SEQ ID NO: 32)
V _L Sκ10 ATGCGCTAGCGAYATTGWGCTSACCCAATC (SEQ ID NO: 33)
V _L Sκ11 ATGCGCTAGCGAYATTSTRATGACCCARTC (SEQ ID NO: 34)
V _L Sκ12 ATGCGCTAGCGAYRTTKTGATGACCCARAC (SEQ ID NO: 35)
V _L Sκ13 ATGCGCTAGCGAYATTGTGATGACBCAGKC (SEQ ID NO: 36)
V _L Sκ14 ATGCGCTAGCGAYATTGTGATAACYCAGGA (SEQ ID NO: 37)
V _L Sκ15 ATGCGCTAGCGAYATTGTGATGACCCAGWT (SEQ ID NO: 38)
V _L Sκ16 ATGCGCTAGCGAYATTGTGATGACACAACC (SEQ ID NO: 39)
V _L Sκ17 ATGCGCTAGCGAYATTTTGCTGACTCAGTC (SEQ ID NO: 40)
V _L Sλ ATGCGCTAGCGATGCTGTTGTGACTCAGGAATC (SEQ ID NO: 41)

V _L antisense primer
V _L ASκ1 ATGCGCGGCCGCTACGTTTKATTTCCAGCTTGG (SEQ ID NO: 42)
V _L ASκ2 ATGCGCGGCCGCTACGTTTTATTTCCAACTTTG (SEQ ID NO: 43)
V _L ASκ3 ATGCGCGGCCGCTACGTTTVAGCTCCAGCTTGG (SEQ ID NO: 44)
V _L ASλ ATGCGCGGCCGCTACCTAGGACAGTCAGTTTGG (SEQ ID NO: 45)

(1-4) Preparation of V _H gene library and V _L gene library
Using the synthetic cDNA prepared in (1-3) from RNA derived from the spleen of a rat immunized with human IgG as a template, the V _H gene primer set (SEQ ID NOs: 1 to 23) and the V _L gene primer set (SEQ ID NOs: 24 to 45) were prepared. ) and amplified pools of a V _H gene library and a V _L gene library of anti-human IgG antibodies were created.

(1-5) Construction of scFv library expression vector In advance, pET-22b(+) (Novagen), which has a pelB signal sequence incorporating the NcoI-KpnI-Linker-NheI-NotI-His tag, was prepared ( The V _L gene library of the anti-human IgG antibody amplified by PCR in 1-4) was cut with NheI and NotI, and integrated into pET-22b(+) as described above to create a V _L gene vector library. DH5α competent cells (Nihon Gene Co., Ltd.) were transformed with each of the V _L gene vectors prepared, and the cells were seeded in LB agar medium containing ampicillin to form colonies. All colonies were collected and mixed, and the V _L gene vector was purified using a plasmid purification kit (Qiagen). Note that the known linker "GGGGSGGGGSGGGS (SEQ ID NO: 46)" is used as the above-mentioned Linker.
Next, the prepared V _L gene vector library and the V _H gene library amplified by PCR were cut with NcoI and KpnI, and the V _H gene was integrated into the V _L gene vector to construct an scFv library expression vector.

In addition to pET-22b(+), we also prepared vectors incorporating the NcoI-KpnI-Linker-NheI-NotI-His tag for vectors with arabinose promoters, rhamnose promoters, and T5 promoters. , a V _L gene vector library and a V _H gene library were integrated to construct an scFv library expression vector.

(Example 2) Establishment of positive clones by expression control colony assay
(2-1) Colony formation on the plate BL21(DE3) competent cells (Nippon Gene) were transformed using the scFv library expression vector prepared in Example (1-5), and the recovery medium (SOC) was transformed. The culture solution whose OD ₆₀₀ reached 0.2 was diluted 10 ⁴ times using LB medium containing an expression inhibitor and an expression inducer to prepare a seeding solution. Glucose was added to the seeding solution at a concentration of 0.05% as an expression inhibitor, and IPTG was added as an expression inducer at a concentration of 0.1 mM. On a LB agar plate, human IgG used for immunization was diluted to 100 μg/mL with PBS, and an antigen membrane was coated with the antigen for 2 hours at room temperature, and then a hydrophilic porous filter for colony formation (colony filter) was layered on top of that. E. coli (200 μl) transformed with the antibody gene dispersed in the inoculation solution was inoculated onto the colony filter. Thereafter, it was incubated at 30°C overnight to form colonies. The colony filter with colonies formed on the filter was transferred to an LB agar plate and stored at 4°C. This method does not require the time-consuming preparation of a concentration gradient of an expression inducer, and can be prepared quickly and easily since it can use agar plates used in ordinary molecular biology experiments.

(2-2) Detection of positive clones Wash the lower antigen membrane excluding the colony filter twice with PBS, dilute HRP-labeled anti-His antibody (Roche) 5000 times with 2% skim milk/PBS, and dilute it at room temperature. The reaction was allowed to proceed for 1 hour. Washed 5 times with 0.05% Tween-PBS and 3 times with PBS, added 6 mL of HRP luminescent substrate (Merck), performed a luminescence reaction at room temperature, and detected with a luminescence detector (Chemistage, Kurashiki Boseki). Positive clones were detected as luminescent spots. (Figure 4) shows the detection spots. No spots were observed when the above-mentioned seeding solution did not contain an expression inducer.

(2-3) Identification of positive clones Overlay the colony filter stored at 4℃ in (2-1) on the antigen membrane where the spots in (2-2) were detected, and identify the colonies that overlapped on the spots as positive clones. Identified.

(Example 3) Analysis of established clones
(3-1) Gene sequencing of established clones The anti-human IgG scFv-positive clones identified in Example 2 (2-3) were individually cultured in LB medium containing ampicillin and sequenced using the DNA Mini prep kit (Qiagen). , the plasmid DNA in the clone was purified. The gene sequence of the purified plasmid DNA was analyzed by sequencing, and the structure of the scFv was confirmed. As a result, all clones were confirmed to have the designed structure. (Figure 5) shows the sequence of the clone with the strongest signal among the clones. (Figure 5) is an anti-human IgG scFv sequence (Rat scFv (human IgG): SEQ ID NO: 47).

(3-2) Activity measurement of established clones by ELISA In this example, the activity of the scFv obtained in (Example 2) was confirmed by ELISA. The antigen specificity and affinity of 10 positive clones were determined. Each positive clone is cultured in 10 mL LB medium containing ampicillin at 37°C until OD ₆₀₀ reaches 0.6, and 0.5 mM IPTG is added to induce expression at 26°C overnight. After culturing, collect the E. coli by centrifugation, add 0.5 mL protease inhibitor (Roche)/PBS to the bacterial mass, suspend, and disrupt the E. coli by ultrasonication. Centrifuge the disruption solution at 20,000g for 30 minutes and collect the supernatant.
The human IgG used as the antigen was adjusted to 10 μg/mL with coating buffer (Na ₂ CO ₃ , NaHCO ₃ , pH 9.6), dispensed into a 96-well microtiter plate at 100 μL/well, and incubated at 4°C. Coat at night. Discard the coating solution, wash once with 0.05% Tween/PBS, dispense Blocking reagent (Roche Diagnostics) at 250 μL/well, and block at room temperature for 2 hours. Discard the blocking solution, wash once with 0.05% Tween-PBS, and dispense the ultrasonicated supernatant using PBS at 100 μL/well, then react at room temperature for 2 hours. Discard the reaction solution, wash 3 times with 0.05% Tween-PBS and 2 times with PBS, dilute HRP-labeled high His antibody 5000 times with 1% BSA/PBS, dispense at 100 μL/well, and incubate at room temperature. time, perform the antibody reaction. Discard the antibody reaction solution, wash 5 times with 0.05% Tween-PBS, dispense 100 μL/well of HRP coloring substrate (SIGMAFAST OPD tablets, Sigma), develop color at room temperature, and use a microplate reader (Bio-Rad). ) was used to measure the absorbance at a wavelength of 450 nm. The results are shown in (Figure 6).

In order to check the binding to the antigen human IgG and the background reaction, binding to BSA was measured. Supernatant from E. coli carrying an empty expression vector without scFv was used as a negative control (NC). All 10 positive clones showed antigen-specific binding reactions, indicating that it is possible to establish antigen-specific scFv by this screening method.

(Example 4) Optimal conditions for performing automatic expression control colony assay
In (2-1), the same amount of E. coli was sown with various concentrations of the expression inhibitor and expression inducer, ie, glucose concentration and IPTG concentration, in the seeding solution, and an automatic expression control colony assay was performed. The number of colonies and positive numbers per plate were counted (Table 1).

Using the anti-human IgG scFv library constructed in (Example 1), the automatic expression control colony assay of the present invention was performed. The concentration of glucose, which is an expression inhibitor, and the concentration of IPTG, which is an expression inducer, were varied, and the number of colonies formed, the number of positives, and the positive rate were compared (Table 1).
(Condition 1) is when only the medium is used as the seeding solution, and (Condition 2) is when only glucose is added, but the number of colonies has increased slightly compared to (Condition 1). Ta. An increase in the number of colonies means that among E. coli having scFv clones that have an inhibitory effect on E. coli growth, there are clones that are able to form colonies by suppressing the leakage expression of scFv during colony formation. The larger the number of colonies, the larger the library size, which is better for assays, so it was an unexpected effect that the number of colonies could be increased simply by adding glucose.

When the concentration of IPTG, an expression inducer, added to the seeding solution was kept constant (0.1mM), and the concentration of glucose, an expression inhibitor, was increased from 0% to 0.1% (in Table 1, condition 3→ 4 → 6 → 7 → 9), the number of colonies increases. On the other hand, even in the presence of IPTG, an expression inducer, the number of positives decreased dramatically when glucose was at a high concentration (Condition 9 in Table 1). In addition, when the concentration of glucose, an expression inhibitor, was kept constant (0.05%) and the concentration of IPTG, an expression inducer, was increased from 0.07mM to 0.2mM (in Table 1, conditions 2 → 5 → 6 → (corresponding to a change from 8 to 10), scFv expression is further induced and the number of positives increases. However, when the concentration of IPTG became high, the number of colonies and the number of positives decreased sharply (Table 1, condition 10). When the glucose concentration was 0.05% and the IPTG concentration was 0.1 mM (condition 6 in Table 1), the largest number of colonies appeared and the largest number of positive clones were observed.
Glucose inhibits the expression of scFv and seems to have an advantageous effect on E. coli growth and colony formation, but if the concentration of glucose exceeds the optimal range and becomes too high (conditions 7 and 9 in Table 1), It is thought that the expression induction by IPTG is no longer applied and the number of positives decreases dramatically. On the other hand, when the concentration of IPTG becomes too high (conditions 8 and 10 in Table 1), the inhibition of scFv expression by glucose at the early stage of colony formation is not effective, and E. coli growth and colony formation are inhibited. A drastic decrease in the number of colonies and positive numbers is likely to occur. The most colonies appeared and the most positive clones were observed (condition 6 in Table 1) due to the balance between the concentration of IPTG, an expression inducer, and glucose, an expression inhibitor. This is considered to be the optimal condition.

The results of the One-Step Colony Assay previously developed by the present inventors (Patent Document 4) are superior to the conventional Filter-sandwich colony assay, but the number of colonies was 1052 and 4 positive colonies were observed. The positive rate was 0.4%.
In the present invention, leak expression in E. coli in the early stage of colony formation, which is vulnerable to the stress of expression load, can be reliably inhibited, so even E. coli carrying the expression vector will actively proliferate and form colonies, so the number of colonies will be one- Approximately 1200 colonies (Table 1, conditions 5, 6, and 7) were formed, exceeding 1052 in the step colony assay (Patent Document 4). A large number of colonies means that a greater variety of clones can be measured, increasing the probability of screening for better antibodies.
In the present invention, the positive rate in (Table 1) was dramatically improved by at least about twice as much as in the conventional colony assay for all conditions 3 to 8. From these results, the automatic expression control colony assay of the present invention, in which glucose and IPTG are added to the seeding solution, eliminates the need to monitor colony status and simplifies the procedure by omitting steps, compared to conventional methods. It was demonstrated that the method was excellent not only in obtaining positive clones, but also in obtaining positive clones. In particular, it was demonstrated that by optimizing the glucose concentration and IPTG concentration, the positive rate could be further increased by 3.5 times or more (condition 6).
Furthermore, in the present invention, no preparation or preliminary experiments are required, and expression is automatically induced after E. coli is inoculated, so there is no need to monitor the degree of colony growth or work to induce expression. In the present invention, it takes about one day to identify a positive clone by screening one antibody library.

Addition of glucose, an expression inhibitor, increased the number of colonies. This seems to be because colony formation was made possible by suppressing the leakage expression of scFv during colony formation in E. coli that has scFv clones that have an inhibitory effect on E. coli growth.
Automatic control of expression Colony assay enables controlled expression without sequentially monitoring the colony size and starting expression induction even at the optimal timing. Due to the increase in the number of colonies mentioned above (even though the positive rate remains the same), the number of positive clones increases, and automatic expression control colony assay can be said to be a superior assay method. In fact, unexpectedly, the positivity rate also increased significantly. This is thought to be due to two factors: the expression efficiency was increased because expression was induced at the optimal timing, and the number of colonies was increased. Regarding the latter, it is speculated that the positive rate may have increased because clones leaking expression of scFv that has a growth-inhibitory effect on E. coli growth and colony formation are likely to be positive. Empirically, scFv expression with antigen specificity (positive clones) often has a growth inhibiting effect on E. coli, and cells often die and clones are lost during or after screening. This method had the unexpected effect that such positive clones could be obtained as positive clones without being lost during screening.

(Example 5) Automated expression control colony assay using various expression inducers and expression systems
An expression automatic control colony assay was performed using a different expression inducer and expression system from (Example 2). We investigated the optimal conditions there. An antibody library was inserted into pET-22b(+), and the number of colonies formed and the number of positive clones were examined when lactose was used as an expression inducer different from the above-mentioned IPTG. In this case, the expression inhibitor is glucose and the expression inducer is lactose.
An automatic expression control colony assay was performed by inoculating the same amount of E. coli while varying the concentrations of the expression inhibitor and expression inducer, that is, the glucose and lactose concentrations, in the inoculation solution. The number of colonies and positive numbers per plate were counted.

These results are shown below (Table 2). These results showed that the expression-controlled colony assay of the present invention is possible even with different expression-inducing agents.

The anti-human IgG scFv library constructed in (Example 1) was put into the pET-22b(+) vector to create an expression vector library, and this was used to perform the automatic expression control colony assay of the present invention. . The concentration of glucose, which is an expression inhibitor, and the concentration of lactose, which is an expression inducer, were varied, and the number of colonies formed, the number of positives, and the positive rate were compared (Table 2). In the system using lactose as an expression inducer, the largest number of colonies appeared and the largest number of positive clones were observed when the glucose concentration was 0.05% and the lactose concentration was 0.1%. The automatic expression control colony assay was shown to be effective even in systems using different expression inducers.
Compared to the positive rate of 0.4% in the conventional One-Step Colony Assay (Patent Document 4) using the same expression vector, the positive rate in this example was approximately twice as high, dramatically improving the glucose It was demonstrated that by optimizing the concentration and lactose concentration, it was possible to further increase the positive rate by more than 3 times (Table 2).
From these results, the automatic expression control colony assay of the present invention not only eliminates the need to monitor colony status and simplifies the procedure by omitting steps, but also makes it easier to obtain positive clones than conventional methods. has also been proven to be excellent.

Furthermore, instead of the combination of the T7 expression system described above using IPTG or lactose as an expression inducer, the automatic expression control colony assay of the present invention can also be used in an experimental system in which other expression systems in which catabolite suppression is effective are used. It was confirmed that it can be implemented.
Specifically, E. coli transformed with expression vectors of a lactose promoter system incorporating a Lac promoter, a rhamnose promoter system incorporating a rhaPBAD promoter, and an arabinose promoter system incorporating an araBAD promoter is prepared, and an expression inhibitor is added to the inoculation solution. Screening was conducted in the same manner as in Example 2 or 5, except that lactose, rhamnose, or arabinose was added as an expression inducer along with glucose.
As a result, it was confirmed that the results (number of colonies, number of positives, positive rate) were similar to those of the T7 expression system using IPTG or lactose (data not shown).
In addition, in addition to BL21DE3 used in (Example 2) as host E. coli, we conducted an experiment similar to (Example 2) using JM109 and XL-1Blue, and found similar results. (data not shown).
These results showed that the automatic expression control colony assay of the present invention is effective even when using an expression system that is effective in suppressing catabolites and a corresponding saccharide expression inducer.

(Example 6) Efficiency of antibody gene acquisition from positive clones
Using the anti-human IgG scFv library constructed in Example 1, the automatic expression control colony assay of the present invention, the automatic expression control colony assay with a high concentration of expression inducer, and the conventional colony assay method were performed. The antigen binding properties and gene structures of each positive clone obtained from the results were investigated and compared (Table 3).
In the case of the automatic expression control colony assay method, the E. coli library was dispersed in a solution with a concentration of 0.05% glucose as an expression inhibitor and 0.1 mM IPTG as an expression inducer, and plated. Under conditions of high IPTG concentration, that is, when expression is excessively induced, disperse the E. coli library in a solution containing 0.05% glucose as an expression inhibitor and 0.2mM IPTG as an expression inducer, and plate it. Ta. When lactose was used as an expression inducer, the E. coli library was dispersed in a solution containing 0.05% glucose and 0.1% lactose as expression inhibitors, and the solution was plated. For overexpression induction conditions, the E. coli library was dispersed in a solution containing 0.05% glucose and 0.2% lactose as expression inhibitors, and the solution was plated on a plate.
Positive clones were obtained using each method of Filter-sandwich Assay (Non-Patent Document 4), One-step Colony Assay (Patent Document 4), and Single-step Colony Assay (Non-Patent Document 7), and Analyzed.

Positive clones were identified using each colony assay method, 136 clones were randomly cultured from among them, and the antigen-binding activity of the antibodies produced by the clones was measured by ELISA according to the method (3-2). . At the same time, using the 136 clones, scFv, V _H and V _L were amplified by colony PCR method, and then subjected to agarose gel electrophoresis. The molecular weights of the scFv gene, V _H gene, and V _L gene amplified from each of the 136 clones were measured based on the electrophoresis pattern, and the molecular weights were determined to have the original molecular weight (750 bp for the scFv gene, 400 bp for the V _H gene, and 350 bp for the V _L gene). I checked to see if it was. Primers pelB-F and M13-R were used to amplify scFv, primers pelB-F and V _H -Linker-R were used to amplify V _H , and primer V _L -Linker- was used to amplify V _L. F and M13-R were used. Colony PCR was performed using primer sets for rat V _H gene and V _L gene amplification using EmeraldAmP PCR Master Mix (Takara Bio Inc.) at 94°C 2 min, (98°C 10 sec, 58°C 30 sec 68°C 1 min) x 5 , (98℃ 10sec, 63℃ 30sec, 68℃ 1min) x 5, (98℃ 10sec, 68℃ 1.5min) x 20, 68℃ 7min. Perform PCR under the conditions of scFv gene, V _H gene and V _L gene. amplified. Each amplified gene was electrophoresed on a 1.5% agarose gel to confirm amplification.
The results are shown in (Table 3). In the case of the automated expression control colony assay method using optimal glucose and rhamnose concentrations, scFv, V _H and V _L of all clones were determined to have the same molecular weight (750 bp for the scFv gene, 400 bp for the V _H gene, and 400 bp for the V _L gene) in all clones. 350bp).

The automatic expression control colony assay of the present invention performed under optimal conditions showed that all the clones obtained produced scFv with antigen-binding properties, and that the scFv had a complete structure. On the other hand, in the two conventional colony assays, Filter-sandwich Assay and Single-step Colony Assay, 10 to 13 isolated positive clones out of 136 clones lost the V _H gene, and the functional scFv It turns out that it is no longer in production. In the One-step Colony Assay, in which expression induction was modified, V _H gene was lost in 4 clones, although this was an improvement over the conventional colony assay. Furthermore, in the automatic expression control colony assay of the present invention, when the concentration of the expression inducer was twice the optimal concentration, 5 to 6 clones out of 136 clones were found to have the V _H gene shedding as described above. This confirmed that adjusting the concentration of the expression inducer in the seeding solution is also important.
It was shown that by using the automatically controlled expression colony assay of the present invention, scFV with a complete structure can be obtained with 100% probability.

From these results, compared to conventional methods, the automatic expression control colony assay of the present invention not only eliminates the need to monitor colony status and simplifies the procedure by omitting steps, but also makes it easier to obtain positive clones. It was demonstrated that the yield was significantly improved and superior to the conventional method (Table 3). An unexpected benefit of this method was that it was not only easy to operate, but also had the ability to identify antibody genes without losing the genetic structure, that is, with zero false positives.

(Example 7) Preparation of scFv library
(7-1) Immunization of rabbits In this example, rabbits, which are often used as immunized animal species, were used. First, the antigen was immunized with an adjuvant containing killed tuberculosis bacteria, and then the antigen was immunized with an adjuvant that did not contain killed tuberculosis bacteria. By performing immunization five times, a sufficient immune response was stimulated.
Specifically, human IgG was mixed with FREUND Complete ADJUVANT (Sigma) and administered subcutaneously to Japanese white rabbits (female) at an antigen concentration of 200 μg/rabbit for primary immunization. Every two weeks, the antigen and FREUND Incomplete ADJUVANT (Sigma) were mixed and secondary immunization was performed in the same manner as the primary immunization. Two weeks after the last immunization, the rabbits were given a boost by intravenously administering 100 μg of the antigen.

(7-2) Extraction of spleen and peripheral blood mononuclear cells (PBMC) Peripheral blood was collected from the immunized rabbit, and the spleen was removed. Peripheral blood mononuclear cells (PBMCs) were purified from peripheral blood. Spleen and PBMC were treated with RNAlater (Life Technologies) to stabilize RNA.

(7-3) Amplification of V _H (antibody heavy chain variable region) and V _L (antibody light chain variable region) An RNA purification kit is used to synthesize cDNA as a template for amplifying antibody genes. Total RNA was purified using random hexamers and oligo dT primers, and full-length cDNA was synthesized and used as a template for antibody gene amplification. Specifically, total RNA was purified from spleen and PBMC treated with RNAlater using RNeasy (Qiagen), and cDNA was synthesized using Transcriptor First Strand cDNA Synthesis Kit (Roche).
In this example, KOD-FX polymerase (Toyobo Co., Ltd.), a highly accurate polymerase, was used for V _L and V _H gene amplification using PCR to prevent PCR errors and maintain the correct structure of scFv. It was used.
Using the synthesized cDNA as a template and a primer set for amplifying the rat V _H gene and V _L gene, 94°C 2 min, (98°C 10 sec, 58°C 30 sec, 68°C 1 min) × KOD-FX polymerase (Toyobo Co., Ltd.) 5, Perform PCR under the conditions of (98℃ 10sec, 63℃ 30sec, 68℃ 1min) x 5, (98℃ 10sec, 68℃ 1.5min) x 20, 68℃ 7min to amplify the V _H gene and V _L gene. did. Each amplified gene was electrophoresed on a 1.5% agarose gel to confirm amplification.

The primer set for each gene used in this example was based on the base sequence of the previously published primer set for V _H gene and V _L gene (Rudiger Ridder and Hermann Gram, Antibody Engineering Volume 1: 115-137, Springer). Based on this, primers were synthesized with NcoI added to the V _H sense primer, XhoI added to the V _H antisense primer, NheI added to the V _L sense primer, and NotI added to the V _L antisense primer, and used as a primer set. . Each primer is degenerate at several positions to ensure antibody gene diversity.
The primer sequences used are as follows.

V _H sense primer
V _H S1 ATGCCCATGGCAGTCGGTGGAGGAGTCCRGG (SEQ ID NO: 48)
V _H S2 ATGCCCATGGCAGTCGGTGAAGGAGTCCGAG (SEQ ID NO: 49)
V _H S3 ATGCCCATGGCAGTCGYTGGAGGAGTCCGGG (SEQ ID NO: 50)
V _H S4 ATGCCCATGGCAGSAGCAGCTGGWGGAGTCCGG (SEQ ID NO: 51)

V _H antisense primer
V _H AS1 ATGCCTCGAGGACTGAYGGAGCCTTAGGTTGC (SEQ ID NO: 52)

V _L sense primer
V _L Sκ1 ATGCGCTAGCGTGMTGACCCAGACTCCA (SEQ ID NO: 53)
V _L Sκ2 ATGCGCTAGCGATMTGACCCAGACTCCA (SEQ ID NO: 54)

V _L antisense primer
V _L ASκ1 ATGCGCGGCCGCTTTGACGACCACCTCGGTCCC (SEQ ID NO: 55)
V _L ASκ2 ATGCGCGGCCGCTAGGATCTCCAGCTCGGTCCC (SEQ ID NO: 56)

(7-4) Preparation of V _H gene library and V _L gene library
The V _H gene primer set (SEQ ID NO: 48 to 52) and the V _L gene primer set (SEQ ID NO: 53) were prepared using the synthetic cDNA prepared in (7-3) from RNA derived from rabbit spleen and PBMC immunized with human IgG as templates. A pool of a V _H gene library and a V _L gene library of an anti-human IgG antibody amplified using 56) was created.

(7-5) Construction of AP-scFv library expression vector In advance, pET-22b(+) (Novagen) containing the pelB signal sequence incorporating the NcoI-XhoI-Linker-NheI-NotI-His tag was prepared. A vector was prepared in which alkaline phosphatase (AP, SEQ ID NO: 57) was inserted upstream of NcoI.
The V _L gene library of the anti-human IgG antibody amplified by PCR in (1-4) was cut with NheI and NotI, and integrated into pET-22b(+) as described above to create a V _L gene vector library. DH5α competent cells (Nihon Gene Co., Ltd.) were transformed with each of the V _L gene vectors prepared, and the cells were seeded in LB agar medium containing ampicillin to form colonies. All colonies were collected and mixed, and the V _L gene vector was purified using a plasmid purification kit (Qiagen). Note that the known linker "GGGGSGGGGSGGGS (SEQ ID NO: 46)" is used as the above-mentioned Linker.
Next, the prepared V _L gene vector library and the V _H gene library amplified by PCR were cut with NcoI and XhoI, and the V _H gene was integrated into the V _L gene vector to construct an AP-scFv library expression vector. did.

In addition to pET-22b(+), vectors with AP-NcoI-XhoI-Linker-NheI-NotI-His tags can also be used for vectors with arabinose promoters, rhamnose promoters, and vectors with T5 promoters. A scFv library expression vector was constructed by integrating the V _L gene vector library and the V _H gene library.

(Example 8) Establishment of positive clones by expression control colony assay
(8-1) Colony formation on plate BL21(DE3) competent cells (Nippon Gene Co., Ltd.) were transformed using the AP-scFv library expression vector prepared in Example (7-5), and the recovery medium ( The culture solution whose OD ₆₀₀ reached 0.2 (SOC) was diluted 10 ⁴ times using LB medium containing an expression inhibitor and an expression inducer to prepare a seeding solution. Glucose was added to the seeding solution at a concentration of 0.05% as an expression inhibitor, and IPTG was added as an expression inducer at a concentration of 0.1 mM. On a LB agar plate, human IgG used for immunization was diluted to 100 μg/mL with PBS, and an antigen membrane coated with the antigen for 2 hours at room temperature was further layered with a hydrophilic porous filter for colony formation (colony filter). E. coli (200 μl) transformed with the antibody gene dispersed in the inoculation solution was inoculated onto the colony filter. Thereafter, it was incubated at 30°C overnight to form colonies. The colony filter with colonies formed on the filter was transferred to an LB agar plate and stored at 4°C. This method does not require the time-consuming preparation of a concentration gradient of an expression inducer, and can be prepared quickly and easily because it can use agar plates used in ordinary molecular biology experiments.

(8-2) Detection of positive clones The lower antigen membrane excluding the colony filter was washed twice with PBS, immersed in AP coloring substrate solution (Sigma-fast BCIP-NBT), and positive clones were detected as colored spots. (Figure 11) shows the detection spots. No spots were observed when the above-mentioned seeding solution did not contain an expression inducer.

(8-3) Identification of positive clones Overlay the colony filter stored at 4°C in (8-1) on the antigen membrane where the spots in (8-2) were detected, and identify the colonies that overlapped on the spots as positive clones. Identified.

(Example 9) Analysis of established clones
(9-1) Gene sequencing of established clones The anti-human IgG scFv-positive clones identified in Example 8 (8-3) were individually cultured in LB medium containing ampicillin and sequenced using the DNA Mini prep kit (Qiagen). , the plasmid DNA in the clone was purified. The gene sequence of the purified plasmid DNA was analyzed by sequencing, and the structure of the scFv was confirmed. As a result, all clones were confirmed to have the designed structure. (FIG. 12) shows the sequence of the clone with the strongest signal among the clones. (Figure 4) is an anti-human IgG scFv sequence (SEQ ID NO: 58).

(9-2) Activity measurement of established clones by ELISA In this example, the activity of the scFv obtained in (Example 2) was confirmed by ELISA. Antigen specificity and affinity of 24 positive clones were determined. Each positive clone is cultured in 10 mL LB medium containing ampicillin at 37°C until OD ₆₀₀ reaches 0.6, and 0.5mM IPTG is added to induce expression overnight at 26°C. After culturing, collect E. coli by centrifugation, add 0.5 mL protease inhibitor (Roche)/PBS to the bacterial mass, suspend, and disrupt E. coli by ultrasonication. Centrifuge the disruption solution at 20,000g for 30 minutes and collect the supernatant.
The human IgG used as the antigen was adjusted to 10 μg/mL with coating buffer (Na ₂ CO ₃ , NaHCO ₃ , pH 9.6), dispensed into a 96-well microtiter plate at 100 μL/well, and incubated at 4°C. Coat at night. Discard the coating solution, wash once with 0.05% Tween/PBS, dispense Blocking reagent (Roche Diagnostics) at 250 μL/well, and block at room temperature for 2 hours. Discard the blocking solution, wash once with 0.05% Tween-PBS, and dispense the ultrasonicated supernatant using PBS at 100 μL/well, and react at room temperature for 2 hours. Discard the reaction solution, wash 3 times with 0.05% Tween-PBS and 2 times with PBS, dispense 100 μL/well of AP chromogenic substrate (SIGMAFAST pNPP tablets, Sigma), develop at room temperature, and use a microplate reader. (Bio-Rad) to measure the absorbance at a wavelength of 405 nm. The results are shown in (Figure 13).

In order to check the binding to the antigen human IgG and the background reaction, the binding to BSA was measured. Supernatant from E. coli carrying an empty expression vector without scFv was used as a negative control (NC). All 10 positive clones showed antigen-specific binding reactions, indicating that it is possible to establish antigen-specific scFv by this screening method.

Furthermore, similar experiments were conducted using known highly active modified APs (Asp ₁₅₃ → Gly ₁₅₃ , Asp ₃₃₀ → Asn ₃₃₀ ; Patent No. 3560972), and similarly good antibodies were successfully established (data (not shown).

(Example 10) Comparison of two types of detection methods
In the case of scFv and AP-scFv, monoclonal antibodies were established by automatic expression control colony assay according to the procedures described in Examples 8 and 9, respectively, and the results were compared (Table 4).
Specifically, peripheral blood was collected from rabbits immunized with human IgG, peripheral blood mononuclear cells (PBMCs) were isolated, and an antibody gene library was created. An scFv library and an AP-scFV library were created from the same antibody gene library, and each library was seeded on 10 90 mm dishes. Positive clones were identified using the same procedure as in Example 8). After identifying each positive clone, it was cultured, the expression vector was purified, and the antibody gene (scFv) was analyzed. In very rare cases, the identified positive clones may have mutations or deletions in their antibody genes during culture. The percentage of complete gene sequences recovered was determined. Table 1 shows the detection work time required for 10 dishes, the average number of colonies per dish, the average number of positives, and the average number of clones with complete genes recovered. Ap-scFV had a positive rate more than three times higher and the final antibody gene recovery rate was also superior.

The time required from collecting the antigen-coated membrane to detection was reduced to less than 1/15 by expressing it in the form of AP-scFv. In the case of scFv, data is captured using a luminescent reaction using a secondary antibody, and the data needs to be digitally processed, which takes a long time. Luminescent reactions are highly sensitive, but because the reactions are instantaneous, they are difficult to detect, making it impossible to treat many membranes at the same time. Membrane replacement was a bottleneck for speed and accuracy. In the case of luminescence detection, the luminescence from the membrane is captured by a cooled CCD, the data is processed, and the data is printed on paper to identify it as an actual colony. In the case of AP-scFv, by using a chromogenic reaction, it became possible to process multiple membranes simultaneously, eliminating detection sensitivity errors between membranes. In the case of color development, the membrane itself is placed in a color former solution to develop color, so more membranes can be treated at once than in the case of light emission. Colonies can be easily identified by simply overlapping the colored membranes as they are, allowing colonies and labeled spots to be accurately overlaid, increasing sensitivity, reducing background, and improving S/N. The number has increased.

In addition, when identifying positive clones, it has become possible to identify them by directly comparing the colony with the coloring membrane. At the time of scFv, the data was processed after capturing the luminescence data from the optical lens. With this method, optical aberrations inevitably occur at the periphery (particularly in order to efficiently capture weak light, it is essential to use a lens with a small F number, which is likely to cause aberrations). As a result, the yield was increased and the mispicking that occurred around the scFv membrane was completely eliminated.
In the case of AP-scFV, there is no need for washing, antibody reactions, data acquisition, etc., and the detection procedure has been simplified, reducing the time required for detection to less than 1/15. Thanks to this, mutations were not carried over to the antibody gene. (Antibody genes are a burden on the host E. coli, so if there is even a small amount of leaked expression, expression may be inhibited to reduce the burden). Therefore, by using this detection method, antibody genes could be recovered from all of the identified positive clones.

(Example 11) Comparison of two types of guidance methods
DC was generated using different induction methods, monoclonal antibodies were established, and the results were compared (Table 5). Peripheral blood was collected from rabbits immunized with human IgG, peripheral blood mononuclear cells (PBMC) were isolated, and an antibody gene library was created. An AP-scFV library was created from the antibody gene library, each library was seeded on 10 90 mm dishes, and colony assays were performed using two types of induction methods (spray and automatic induction). After identifying positive clones, they were cultured, the expression vector was purified, and the antibody gene (scFv) was analyzed. In very rare cases, the identified positive clones may have mutations or deletions in the antibody gene during culture. The percentage of complete gene sequences recovered was determined. The average number of colonies, average positive number, and average number of complete gene recovery clones per dish are shown in (Table 5). Automatic induction of expression had a positive rate more than three times higher, and the final positive gene recovery rate was also superior.

Claims (9)

An automated colony assay method for expression of a functional protein that recognizes a target, the method comprising:
(1) (a) Place a membrane adsorbed or coated with a target recognized by the protein (b) on top of a solid nutrient medium for microorganisms that does not contain glucose or an expression inducer, and further place (c) colonies on the top surface of the membrane. a step of placing a forming filter;
(2) Seeding microorganisms transformed with the protein gene library on the surface of (c);
(3) a step of binding the antibodies expressed and secreted from each colony formed on the colony filter to the target antigen on the antigen membrane;
(4) detecting the binding activity with the target antigen on the antigen membrane as a labeled spot;
(5) selecting positive clones by overlapping the labeled spot on the antigen membrane and the colony on the colony filter;
including;
Here, a method characterized in that the seeding solution used in seeding the microorganism in step (2) contains (i) glucose and (ii) an expression inducer. 2. The method according to claim 1, wherein the expression inducer (ii) contained in the seeding solution is lactose, arabinose, rhamnose, or IPTG. The seeding solution when seeding microorganisms in step (2) is
(i) glucose at a concentration of 0.02-0.2%, and (ii) lactose, arabinose or rhamnose at a concentration of 0.05-0.2%, or ITPG at a concentration of 0.05-0.5mM;
The method according to claim 2, characterized in that it contains. The protein gene library in step (2) is a protein gene library in which alkaline phosphatase (AP) is fused to the N-terminus of the protein,
The method according to any one of claims 1 to 3, wherein the labeled spot in step (4) is a labeled spot based on a color reaction of AP. Claim 1: The functional protein that recognizes a target is an antibody, the target that the protein recognizes is an antigen or a peptide or sugar chain that is an epitope thereof, and the recognition reaction step with the target is an antigen-antibody reaction step. 4. The method according to any one of 4. 6. The method according to claim 5, wherein the antibody is a single chain antibody (scFv) or a Fab antibody. The method according to any one of claims 1 to 6, wherein the transformed microorganism is transformed E. coli. A seeding solution for seeding a microorganism transformed with a gene library of the protein onto a colony forming filter in an automatically controlled colony assay method for expression of a functional protein that recognizes a target, comprising the following (i) and (ii) A seeding solution containing;
(i) glucose, and (ii) an expression inducer. The seeding solution according to claim 8, wherein the expression inducer (ii) is lactose, arabinose, rhamnose or IPTG.

Images