WO2020050742A1 - The gene therapy dna vector gdtt1.8nas12 and the method for obtaining thereof - Google Patents

The gene therapy dna vector gdtt1.8nas12 and the method for obtaining thereof Download PDF

Info

Publication number
WO2020050742A1
WO2020050742A1 PCT/RU2019/000525 RU2019000525W WO2020050742A1 WO 2020050742 A1 WO2020050742 A1 WO 2020050742A1 RU 2019000525 W RU2019000525 W RU 2019000525W WO 2020050742 A1 WO2020050742 A1 WO 2020050742A1
Authority
WO
WIPO (PCT)
Prior art keywords
gene
gene therapy
dna vector
vector
therapy dna
Prior art date
Application number
PCT/RU2019/000525
Other languages
French (fr)
Inventor
Anton GAMOLSKI
Original Assignee
Genetic Diagnostics And Therapy 21 Ltd
Obschestvo S Ogranichennoi Otvetstvennostju "Rekombitekh"
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Genetic Diagnostics And Therapy 21 Ltd, Obschestvo S Ogranichennoi Otvetstvennostju "Rekombitekh" filed Critical Genetic Diagnostics And Therapy 21 Ltd
Priority to CN201980072473.3A priority Critical patent/CN113166771A/en
Priority to US17/273,035 priority patent/US11203760B2/en
Priority to EP19858416.1A priority patent/EP3847252A4/en
Publication of WO2020050742A1 publication Critical patent/WO2020050742A1/en

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70Vectors or expression systems specially adapted for E. coli
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20Bacteria; Culture media therefor
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/64General methods for preparing the vector, for introducing it into the cell or for selecting the vector-containing host
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00Nucleic acids vectors
    • C12N2800/90Vectors containing a transposable element

Definitions

  • the invention refers to genetic engineering and can be used in biotechnology, medicine, and agriculture for the manufacture of gene therapy products.
  • the produced gene therapy DNA vector containing the therapeutic gene can be used to deliver it to the cells of human beings and animals that experience reduced or insufficient expression of that gene, thus ensuring the desired therapeutic effect.
  • Gene therapy involves introduction of nucleic acids or their derivatives for treatment of acquired or hereditary diseases.
  • the therapeutic effect is achieved either by compensation of malfunctioning or completely non-functional gene, or by production of a protein product with a therapeutic effect.
  • the main tool of gene therapy is a therapeutic genetic material carrier, a vector. All vectors used in gene therapy are divided into two main categories, viral and non-viral ones.
  • Viral gene therapy vectors are constructed on the basis of retroviruses, lentiviruses, adenoviruses, adeno-associated viruses, herpesviruses, poxviruses. (Lundstrom K. Viral Vectors in Gene Therapy. Diseases. 2018 May 21 ;6(2)).
  • Non-viral vectors include plasmid- or linear RNA-based vectors. Plasmid vectors have wider practical use due to simplified production and high stability. To enhance efficiency of therapeutic gene delivery to somatic cells, plasmid vectors are often introduced in combination with various carriers, such as lipids, cation polymers, dendrimers, polypeptides, and nanoparticles of different nature (Hidai C, Kitano H. Nonviral Gene Therapy for Cancer: A Review. Diseases. 2018 Jul 3;6(3)). A plasmid added to such molecular complex improves its penetration into cell.
  • various carriers such as lipids, cation polymers, dendrimers, polypeptides, and nanoparticles of different nature
  • a plasmid is a circle DNA molecule existing and replicating in a cell independently from the chromosome DNA. In vivo the plasmids occur mainly in bacteria and more rarely in archaea and eukaryotes. While chromosome DNA carries all genetic information required for life under normal conditions, plasmids are generally containing genes ensuring survival in specific or even adverse environment (Lipps G. (editor), (2008). Plasmids: Current Research and Future Trends. Caister Academic Press. ISBN 978-1-904455-35-6). Such genes ensure antibiotic resistance, encode virulence factors, take part in catabolism and metabolism of various substrates and detoxication of harmful compounds. Plasmids are known to participate in genetic information transfer between cells, thus enabling horizontal gene transfer.
  • Plasmid-based vectors do not share the downsides of viral vectors.
  • plasmids are a convenient carrier for therapeutic genetic material by their nature, due to simple methods of direct molecular cloning and production of required amounts. Plasmid vector introduction does not cause inflammation and immune response of the subject. Plasmids themselves are not cytotoxic, and are not integrated into the genome when they reach target cells, and thus, they do not affect genome stability. Due to those features, plasmid vectors are a promising tool for gene therapy and genetic preventive therapy (DNA vaccines) (Porter KR, Raviprakash K. DNA Vaccine Delivery and Improved Immunogenicity. Curr Issues Mol Biol. 2017;22:129-138).
  • the plasmid vectors have also some drawbacks limiting their use in the clinical practice.
  • antibiotic resistance genes shall be introduced into plasmid vectors for selection and production in carrier strains.
  • regulatory elements promoters, enhancers, posttranscriptional regulatory elements
  • are added to the vector for efficient expression of the therapeutic gene (Sun J, Li D, Hao Y, Zhang Y, Fan W, Fu J, Hu Y, Liu Y, Shao Y. Posttranscriptional regulatory elements enhance antigen expression and DNA vaccine efficiency.
  • plasmid vector size determines efficiency of penetration into target cells, i.e. the bigger the vector, the poorer its penetration into cells is. Plasmids used in gene therapy often have unnecessary, non-encoding sites that increase their length substantially (Mairhofer J, Grabherr R. Rational vector design for efficient non-viral gene delivery: challenges facing the use of plasmid DNA. Mol Biotechnol. 2008.39(2):97-104).
  • RNA I plasmid vector replication inhibitor could suppress translation of genes critical to bacteria growth (such as murA encoding UDP-N- acetylglucosamine 1-carboxyvinyl-transferase enzyme involved in biosynthesis of bacterium cell wall peptidoglycan) by forming a duplex of RNA/antisense RNA (Mairhofer J, Pfaffenzeller I, Merz D, Grabherr R. A novel antibiotic free plasmid selection system: advances in safe and efficient DNA therapy. Biotechnol J. 2008. 3(1 ):83-89).
  • the murA gene shall be controlled by tetR repressor protein and can be expressed only in the presence of constructed plasmid vector containing RNA-I gene.
  • the inhibition mechanics is still unknown in this system, and IPTG-mediated induction results in development of Escherichia coli colonies devoid of the therapeutic plasmid vector.
  • a supercoiled plasmid DNA molecule devoid of any prokaryotic nucleotide sequences has been obtained.
  • This so-called minicircle vector only contained an origin of replication and antibiotic resistance gene and was obtained by integrase-mediated intramolecular recombination using q>C31 phage (Chen ZY, He CY, Ehrhardt A, Kay MA. Minicircle DNA vectors devoid of bacterial DNA result in persistent and high-level transgene expression in vivo. Mol Ther. 2003. 8(3):495-500).
  • a gene is no viable for practical use due to extremely complex and labour-consuming industrial-scale obtainment and production processes.
  • Patent claim US 2011152377/10 proposed to use a plasmid vector devoid of antibiotic resistance genes that still encodes a repressor protein.
  • This repressor protein suppresses expression of the toxic protein encoded in the chromosome DNA of Escherichia coli.
  • the low efficiency and instability of such transformation limit production of vectors with repressor proteins on an industrial scale.
  • Patent US7521182B2 suggests a plasmid vector containing araD gene.
  • this gene encodes L-ribulose-5-phosphate-4- epimerase.
  • this enzyme itself is not critical for bacterium growth, its deficiency results in toxic product accumulation in a cell Vector encoding araD in combination with E. coli strain with this gene removed from the genome represents an antibiotic-free selection system.
  • Patent US 9,644,211 proposes a method of obtaining a minicircle plasmid vector free of prokaryotic sequences.
  • a minicircle plasmid vector free of prokaryotic sequences.
  • Such a vector is produced by parA-mediated recombination realised in a cultured E. coli strain. Since this minicircle cannot be produced on an industrial scale, it cannot be viewed as a potential gene therapy vector.
  • the prototype for a new carrier based on recombinant plasmid gene therapy vectors was the recombinant vector for genetic vaccination (US 9,550,998).
  • the new carrier is a supercoiled plasmid that is used for the expression of cloned genes in human and animal cells. It consists of replication origin, promoter, and enhancer of human cytomegalovirus and regulatory elements from human T- lymphotropic virus.
  • the new vector is selected and produced in a special-purpose Escherichia coli strain by antisense-complementation of sacB gene introduced into the strain by a bacteriophage, thus excluding antibiotic resistance genes completely.
  • the only factor limiting the use of the new vector in gene therapy is that it includes regulatory elements in the form of viral nucleotide sequences.
  • the purpose of this invention is to construct a multipurpose gene therapy DNA vector for genetic modification of human and animal cells that would reasonably combine the following:
  • Item II and III are provided for herein in line with the recommendations of the state regulators for gene therapy medicines and, specifically, the requirement of the European Medicines Agency to refrain from adding antibiotic resistance marker genes to newly engineered plasmid vectors for gene therapy (Reflection paper on design modifications of gene therapy medicinal products during development / 14 December 2011 EMA/CAT/GTWP/44236/2009 Committee for advanced therapies) and refrain from adding viral genomes to newly engineered plasmid vectors for gene therapy (Guideline on the quality, non-clinical and clinical aspects of gene therapy medicinal products / 23 March 2015, EMA/CAT/80183/2014, Committee for Advanced Therapies).
  • the purpose of the invention also includes the construction of a strain carrying this gene therapy DNA vector for the production of these gene therapy DNA vectors on an industrial scale.
  • gene therapy DNA vector GDTT1.8NAS12 in the form of a 2591 -bp circular doublestrand DNA molecule containing nucleotide sequence SEQ ID No. 1 , capable of autonomous replication in Escherichia coli cells and consisting of the following structural elements: promoter region of EF1 A human elongation factor with its own enhancer contained in the first intron of the gene, a polylinker containing a sequence of BamHI, EcoRV, Sail, Kpnl, EcoRI, Xbal, and Notl restriction sites and designed for cloning of therapeutic therapy genes, RNA-out regulatory element of transposon Tn10, enabling antibiotic-free positive selection for Escherichia coli strain JM 110-NAS; the origin of replication for autonomous replication of a gene therapy DNA vector with a single nucleotide substitution to increase plasmid production in the cells of most Escherichia coli strains.
  • Method of obtaining the 2591 -bp gene therapy DNA vector GDTT1.8NAS12 involves initial construction of a 2408-bp intermediate vector containing a 688-bp replication origin, a 467-bp transcription terminator hGH-TA, a 137-bp regulatory site RNA-out of transposon Tn10, a 1018-bp kanamycin resistance gene, and a 68-bp polylinker, further vector splitting using Sail and BamHI restriction endonucleases and ligation with promoter/regulator site containing the promoter region of human elongation factor EF1A with its own 1219-bp enhancer, and cleaving of the kanamycin resistance gene by Spel restriction sites.
  • the method of obtaining of Escherichia coli strain JM110-NAS for the production of gene therapy DNA vector GDTT1.8NAS12 involves constructing a linear DNA fragment containing a 64-bp regulatory element RNA-in of Tn10 transposon allowing for antibiotic- free positive selection, 1422-bp sacB levansucrase gene, the product of which ensures selection within a sucrose-containing medium, 763- bp catR chloramphenicol resistance gene required to pick strain clones where homologous recombination occurred, and two homologous sequences, 329 bp and 233 bp, ensuring homologous recombination in the region of recA gene concurrent with gene inactivation, where the said homologous sequences are obtained by PCR amplification of recA gene fragment using genome DNA of Escherichia coli JM110-NAS as a matrix, and a couple of LHA-F (5’- GCT G ACGCT GC AGGT G ATC) and LHA-R (5
  • Escherichia coli strain JM110-NAS obtained by the method above for production of gene therapy DNA vector GDTT1.8NAS12 with possible antibiotic-free positive selection, containing a linear fragment consisting of regulator element RNA-in of transposon Tn10, sacB levansucrase gene, and catR chloramphenicol resistance gene in the chromosome in recA gene region.
  • the method of obtaining Escherichia coli strain JM110- AF/GDTT1.8NAS12 carrying gene therapy DNA vector GDTT1.8NAS12 involves making electrocompetent cells of Escherichia coli strain JM110-NAS and subjecting these cells to electroporation with gene therapy DNA vector GDTT1.8NAS12. After that, the cells are poured into agar plates (Petri dishes) with a selective medium containing yeastrel, peptone, 6% sucrose, and 10pg/ml of chloramphenicol.
  • Escherichia coli strain JM110-NAS/GDTT1.8NAS12 obtained by the method described above, carrying gene therapy DNA vector GDTT1.8NAS12 for production of gene therapy DNA vector GDTT1.8NAS12 allowing for antibiotic-free selection
  • the method of gene therapy DNA vector GDTT1.8NAS12 production on an industrial scale involves scaling-up the bacterial culture of Escherichia coli strain JM110-NAS/GDTT1.8NAS12 to the quantities necessary for increasing the bacterial biomass in an industrial fermenter, after which the biomass is used to extract a fraction containing the therapeutic DNA product, i.e. the gene therapy DNA vector GDTT1-8NAS12, and then multi-stage filtered, and purified by chromatographic methods.
  • FIG. 1 shows the structure of gene therapy DNA vector GDTT1.8NAS12 that is a 2591 -bp circular double-strand DNA molecule capable of autonomous replication in Escherichia coli cells.
  • Figure 1 marks the following structural elements of the vector:
  • (1 ) prom (695 to 1901 bp) is a promoter region of human elongation factor EF1A with an intrinsic enhancer contained in the first intron of the gene. It ensures efficient transcription of the recombinant gene in most human tissues.
  • MCS (1902 to 1969 bp) is a polylinker (multiple cloning site) that contains a sequence of BamHI, EcoRV, Sail, Kpnl, EcoRI, Xbal, and Notl restriction enzymes and allows cloning of the therapeutic therapy genes.
  • RNA-out (2443 to 2579 bp out) is a regulatory element RNA- out of transposon Tn10 allowing for antibiotic-free positive selection in case of the use of Escherichia coli strain JM 110.
  • ori (1 to 688 bp) is an origin of replication for autonomous replication with a single nucleotide substitution to increase plasmid production in the cells of most Escherichia coli strains.
  • the linear fragment consists of a cassette carrying the regulatory element RNA-IN of transposon Tn10 for antibiotic-free selection (64 bp), sacB levansucrase gene, the product of which ensures selection within a sucrose-containing medium (1422 bp), and catR chloramphenicol resistance gene required for the picking of strain clones in which homologous recombination occurred (763 bp).
  • the cassette is flanked by two homology arms that ensure the process of recombination in the region of recA gene with concurrent gene inactivation (329 bp and 233 bp for the left arm and for the right arm, respectively).
  • FIG. 1 shows fluorescence microimaging of the MG-63 cell culture 48 hours after the transfection of the cells with pEFGP-C1 plasmid vector (Clontech) and DNA vector GDTT1.8NAS12-eGFP (A), and a diagram of fluorescence emitted by the protein extracted from MG-63 cells 48 hours after the transfection of the cells with pEFGP-C1 plasmid vector (Clontech) and DNA vector GDTT 1 8NAS12-eGFP (B) to compare the levels of accumulation of the product of the target gene, e.g. green fluorescent protein (GFP), in the MG-63 cells 48 hours after the transfection of the cells with pEFGP-C1 plasmid vector (Clontech) and DNA vector GDTT 1.8NAS12-eGFP.
  • GFP green fluorescent protein
  • FIG. 1 shows diagrams of human glutathione peroxidase 1 gene mRNA accumulation in primary culture cells of epidermal keratinocytes HEKa before transfection and 48 hours after transfection of those cells with DNA vector GDTT1.8NAS12-GPX1 carrying a human glutathione peroxidase 1 gene, in order to assess therapeutic gene mRNA accumulation, e.g. for glutathione peroxidase 1 gene, in primary culture cells of HEKa epidermal keratinocytes before transfection and 48 hours after transfection of those cells with DNA vector GDTT1.8NAS12-GPX1 carrying a human glutathione peroxidase 1 gene, where:
  • P1 I is patient P1 skin biopsy in the region of injection of gene therapy DNA vector GDTT 1.8NAS12-GPX1 ,
  • P1 II is patient P1 skin biopsy in the region of injection of gene therapy DNA vector GDTT1.8NAS 12 (placebo),
  • P1 III is patient P1 skin biopsy from intact site
  • P2I is patient P2 skin biopsy in the region of injection of gene therapy DNA vector GDTT1.8NAS12-GPX1 ,
  • P2II is patient P2 skin biopsy in the region of injection of gene therapy DNA vector GDTT1.8NAS12 (placebo),
  • P2III is patient P2 skin biopsy from intact site
  • P3I is patient P3 skin biopsy in the region of injection of gene therapy DNA vector GDTT 1.8NAS12-GPX1 ,
  • P3II is patient P3 skin biopsy in the region of injection of gene therapy DNA vector GDTT1.8NAS 12 (placebo),
  • P3III is patient P3 skin biopsy from intact site.
  • GDTT1.8NAS12 and DNA vector GDTT1.8NAS12-eGFP carrying a gene site encoding green fluorescent protein.
  • the invention is embodied as follows.
  • a 2591 -bp gene therapy DNA vector GDTT1.8NAS12 for genetic modification of animal and human cells containing nucleotide sequence SEQ ID No. 1 is constructed.
  • Method of obtaining of the 2591 -bp gene therapy DNA vector GDTT1.8NAS12 involves initial construction of a 2408-bp vector containing a 688-bp replication origin, a 467-bp transcription terminator hGH-TA, a 137-bp regulatory site RNA-out of transposon Tn10, a 1018-bp kanamycin resistance gene, and a 68-bp polylinker, further vector splitting using Sail and BamHI restriction endonucleases and ligation with promoter/regulator site containing the promoter region of EF1A human elongation factor with its own 1219-bp enhancer, and cleaving of the kanamycin resistance gene by Spel restriction sites.
  • nucleotide sequences differing by insertion, deletion, or replacement of nucleotides that do not result in a change in the polypeptide sequence encoded by the therapeutic gene, and/or do not result in a loss of functional activity of the regulatory elements of GDTT1.8NAS12 vector and/or gene therapy DNA vectors carrying therapeutic genes based on it.
  • Experts in this field realise that the methodological implementation of obtaining of gene therapy DNA vector GDTT1.8NAS12 and/or gene therapy DNA vectors carrying therapeutic genes based on it can vary within the choice of known methods of molecular gene cloning, and these methods are included in the scope of this invention.
  • different oligonucleotide sequences can be used to amplify genes, different restriction endonucleases or laboratory techniques, such as ligation independent cloning of genes.
  • Escherichia coli strain JM110-NAS is constructed.
  • the method of obtaining Escherichia coli strain JM110-NAS for production of gene therapy DNA vector GDTT1.8NAS12 and/or gene therapy DNA genes carrying therapeutic genes based on it involves construction of a linear DNA fragment containing a 64-bp regulatory element RNA-in of transposon Tn10 for antibiotic-free positive selection, a 1422-bp levansucrase gene sacB, the product of which ensures selection in sucrose- containing medium, a 763-bp chloramphenicol resistance gene catR required for selection of strain clones where homologous recombination occurred, and two homologous sequences, 329 bp and 233 bp, ensuring homologous recombination process in the region or recA gene with concurrent gene inactivation, and further transformation of Escherichia
  • the method also involves construction of Escherichia coli strain JM110-NAS/GDTT1.8NAS12 carrying gene therapy DNA vector GDTT1.8NAS12 and/or gene therapy DNA vectors containing therapeutic genes based on it for vector production allowing for antibiotic-free selection.
  • the method of obtaining Escherichia coli strain JM110-NAS/GDTT1.8NAS12 carrying gene therapy DNA vector GDTT1.8NAS12 and/or gene therapy DNA vectors containing therapeutic genes based on it involves obtainment of electrocompetent cells of Escherichia coli strain JM110-NAS and electroporation of those cells with gene therapy DNA vector GDTT1.8NAS12, with further inoculation in Petri dishes with selective agar medium containing yeastrel, peptone, 6% sucrose, and 10pg/ml of chloramphenicol.
  • the method of gene therapy DNA vector GDTT1.8NAS12 production on an industrial scale involves scaling-up the bacterial culture of the strain to the quantities necessary for increasing the bacterial biomass in an industrial fermenter, after which the biomass is used to extract a fraction containing the therapeutic DNA product, i.e. the gene therapy DNA vector GDTT1-8NAS12, and then multistage filtered, and purified by chromatographic methods.
  • Gene therapy DNA vector GDTT1.8NAS12 was constructed by consolidating six fragments of DNA derived from different sources:
  • the hGH-TA transcription terminator was produced by PCR amplification of a site of human genomic DNA using hGH-F and hGH- R oligonucleotides (List of Sequences, (3) and (4)),
  • the kanamycin resistance gene was produced by PCR amplification of a site of commercially available pET-28 plasmid using Kan-F and Kan-R oligonucleotides (List of Sequences, (10) and (1 1 )),
  • the polylinker was produced by cining and annealing of four synthetic oligonucleotides MCS1 , MCS2, MCS3, and MCS4 (List of Sequences, (12)— (15))
  • promoter/regulator site of human elongation factor gene EF1a with its own enhancer was obtained by PCR amplification of a human genome DNA site using EF1-Xho and EF1-R oligonucleotides (List of Sequences, (16)-(17)).
  • PCR amplification was performed using the commercially available kit Phusion® High-Fidelity DNA Polymerase (New England Biolabs) as per the manufacturer’s instructions.
  • the fragments (b), (c), and (d) had overlapping regions allowing for their consolidation with subsequent PCR amplification.
  • Fragments (b), (c), and (d) were joined using hGH-F and Kan-R oligonucleotides (List of Sequences, (3) and (11 )). Afterwards, the obtained DNA fragments were consolidated by restriction with subsequent ligation by BamHI and Ncol sites. This resulted in a vector still devoid of the polylinker.
  • the plasmid was split by restriction endonucleases in BamHI and EcoRI sites with further ligation to the fragment (e). This resulted in a 2408-bp intermediate vector carrying a kanamycin resistance gene, but still without promoter/regulator site of elongation factor EF1a gene with its own enhancer.
  • the vector obtained was split by restriction endonucleases in Sail and BamHI sites with further ligation to the fragment (f). This resulted in a 3608-bp vector carrying a kanamycin resistance gene and promoter/regulator site of elongation factor EF1a gene with its own enhancer.
  • the therapeutic gene e.g. the green fluorescent protein (GFP) gene
  • GFP green fluorescent protein
  • the coding region of the green fluorescent protein gene was produced by PCR amplification of commercially available plasmid pEGFP-C1 (Clontech) using MVGFP-F and MVGFP-R oligonucleotides (List of Sequences, (18) and (19)).
  • the obtained PCR fragment was cleaved by BamHI and EcoRI restriction endonucleases and ligated with a 3608-bp DNA vector carrying the kanamycin resistance gene and cleaved by the same enzymes. Further on, the kanamycin resistance gene was removed from the vector produced, as described in Example 1. This resulted in a 3268- bp DNA vector GDTT1.8NAS12-eGFP allowing for antibiotic-free selection.
  • the therapeutic gene e.g. the human glutathione peroxidase 1 (GPX1 ) gene, was cloned to a polylinker.
  • GPX1 human glutathione peroxidase 1
  • DNA vector GDTT1.8NAS12-GPX1 carrying a site of a therapeutic gene, such as GPX1 gene encoding human glutathione peroxidase 1 protein.
  • the 609-bp coding region of the GPX1 gene (SEQ ID No. 2) was produced by extracting total RNA from the patient’s skin biopsy sample with subsequent reverse transcription and PCR amplification. The material was sampled from intact skin in the forearm, using the skin biopsy device Epitheasy 3.5 (Medax SRL). The patient’s skin was preliminarily rinsed with sterile saline and anaesthetised with a lidocaine solution. Mass of the biopsy sample was about 10mg.
  • the sample was placed in 1 ml of Trizol Reagent (ThermoFisher Scientific), homogenised, and heated for 5 minutes at 65°C.
  • the sample was centrifuged at 14,000g for 10 minutes and heated again for 10 minutes at 65°C.
  • 200mI of chloroform was added, and the mixture was gently stirred and centrifuged at 14,000g for 10 minutes.
  • the water phase was isolated and mixed with 1/10 of the volume of 3M sodium acetate, pH 5.2, and an equal volume of isopropyl alcohol.
  • the sample was incubated at -20°C for 10 minutes and then centrifuged at 14,000g for 10 minutes.
  • RNA was rinsed in 1 ml of 70% ethyl alcohol, air-dried and dissolved in 10mI of RNase-free water.
  • Mint reverse transcriptase (Evrogen, Russia) was used.
  • Mint Buffer 4mI of Mint Buffer, 2mI of dithiothreitol, 2mI of dNTP Mix, 2mI of each of oligonucleotides GPX1-F and GPX1- R (List of Sequences, (20) and (21 )), and 2mI of Mint reverse transcriptase were added to 6mI of total RNA, and the mixture was incubated at 42°C for 2 hours.
  • the synthesised cDNA was used as a matrix in PCR amplification using the same oligonucleotides at 94°C for 3 minutes; 30 cycles: at 94°C for 30 seconds, at 60°C for 30 seconds and at 72°C for 45 seconds, with final elongation at 72°C for 5 minutes.
  • the obtained PCR fragment was cleaved by restriction endonucleases BamHI and EcoRI, and ligated with a 3608-bp vector carrying the kanamycin resistance gene and cleaved by the same enzymes. Further on, the kanamycin resistance gene was removed from the vector produced, as described in Example 1. This resulted in a 609-bp gene therapy DNA vector GDTT1.8NAS12-GPX1 carrying a region encoding the human glutathione peroxidase 1 gene allowing for antibiotic-free selection.
  • Escherichia coli strain JM110-NAS for the engineering of gene therapy DNA vector GDTT1.8NAS12 and/or gene therapy vectors carrying therapeutic genes based on it as produced by homologous recombination by introduction to its chromosome, specifically to the region of recA gene, of the linear fragment containing regulatory element RNA-in of transposon Tn10 allowing for antibiotic-free positive selection (64 bp), levansucrase gene sacB, the product of which ensures selection in a sucrose-containing medium (1422 bp), chloramphenicol resistance gene catR required for selection of strain clones in which homologous recombination occurred (763 bp), and two homologous sequences (homology arms) ensuring homologous recombination in the region of gene recA concurrent with gene inactivation (329 bp and 233 bp for the left arm and for the right arm, respectively).
  • RNA-IN fragment was tailed with IN-F, IN-1 , IN-2, and IN-R synthetic oligonucleotides (List of Sequences, (26), (27), (28), (29)).
  • the sacB gene was produced by PCR amplification using the genomic DNA of B.subtilis 168HT as a matrix, and SacB-F and SacB-R as primers (List of Sequences, (30) and (31 )).
  • PCR amplification was performed using Escherichia coli BL21 pLysS as a matrix, and CatR- F and CatR-R (List of Sequences, (32) and (33)) as primers.
  • PCR products LHA (the left homology arm), SacB, and RHA (the right homology arm) were amplified at 94°C for 3 minutes; 30 cycles: at 94°C for 20 seconds, at 60°C for 20 seconds, and at 72°C for 60 seconds, with final elongation at 72°C for 5 minutes.
  • PCR product RNA-IN was synthesized at 94°C for 3 minutes; 30 cycles: at 94°C for 10 seconds, at 60°C for 10 seconds, and at 72°C for 10 seconds, using oligonucleotides IN-F, IN-1 , IN-2 and IN-R (List of Sequences, (26), (27), (28), and (29)) for the assembly of the fragment.
  • primers IN-F and IN-R 10mM were used.
  • PCR amplification was performed using the commercially available kit Phusion® High-Fidelity DNA Polymerase (Thermo Fisher Scientific) as per the manufacturer’s instructions.
  • the linear fragment for homologous recombination was synthesised by consolidating five PCR products. All of the five products had overlapping areas allowing for subsequent assembly into a single fragment. All fragments were mixed in aliquots of 10ng in a volume of 50mI.
  • the PCR product was derived at 94 C for 3 minutes; 10 cycles: at 94°C for 30 seconds, at 60°C for 30 seconds, and at 72°C for 2 minutes, without primers added.
  • LHA-F and RHA-R primers (List of Sequences, (22), (25)) were added, and 25 more PCR cycles were performed: at 94°C for 30 seconds, at 60°C for 30 seconds, and at 72°C for 2 minutes, with final elongation at 72°C for 5 minutes.
  • Escherichia coli strain JM110-NAS electrocompetent cells were prepared.
  • a single colony of Escherichia coli strain JM 110 (Agilent Technologies) was used to inoculate 10ml of LB broth, and the cells were cultured overnight in an orbital shaker at 150rpm and 37°C.
  • the cells were cooled down to 0°C and centrifuged for 10 minutes at 4000g.
  • the medium was removed and the cells were rinsed with 100ml of ice-cold bidistilled water twice to remove the remaining medium and then rinsed with 20ml of 10% glycerine. After that, the cells were re-suspended in 1 ml of 10% glycerine and used for transformation.
  • Transformation with the obtained linear fragment was performed by electroporation in 1 mm cuvettes at 2kV, 200Ohm, 25pF using the Gene Pulser Xcell (Bio-Rad, USA). The duration of the pulse was 4.9ms to 5.1 ms. After that, the cells were cultivated in a SOC medium for 2.5 hours in an incubator shaker at 30°C. Then the cells were poured into LB agar plates (Petri dishes) containing 10pg/ml of chloramphenicol. The cells were cultivated for 48 hours at 30°C. The picked-out clones were tested for survival in a selective medium containing yeastrel, peptone, 6% sucrose, and 10pg/ml of chloramphenicol.
  • the genotype of the resulting strain is -recA rpsL (Strr) thr leu end A thi-1 lacY galK galT ara ton A tsx dam dcm supE44 A(lac-proAB) [F ' traD36 proAB laclq ZAM15]CmR sacB+
  • the cells were re suspended in 1 ml of 10% glycerine and used for transformation by electroporation. Electroporation was performed in 1 mm cuvettes at 2kV, 200Ohm, 25pF using the Gene Pulser Xcell (Bio-Rad, USA). The duration of the pulse was 4.9 to 5.1 ms, and 1-1 Ong of the vector was used. After that, the cells were cultivated in a SOC medium for 2.5 hours in an incubator shaker at 30°C. Then the cells were poured into agar plates (Petri dishes) with a selective medium containing yeastrel, peptone, 6% sucrose, and 10pg/nnl of chloramphenicol.
  • Escherichia coli strain JM110-NAS/GDTT1.8NAS12 carrying gene therapy DNA vector GDTT1.8NAS12 was obtained. 48 hours later, a single colony was used to inoculate 10ml of liquid selective medium containing yeastrel, peptone, 6% sucrose, and 10pg/ml of chloramphenicol, and the medium was cultivated overnight in an orbital shaker at 150rpm and 37°C. On the following day, the cells were pelleted, and DNA vector was extracted by alkaline lysis using GeneJET Plasmid Miniprep Kit (Thermo Fisher Scientific) according to the manufacturer’s instructions.
  • GeneJET Plasmid Miniprep Kit Thermo Fisher Scientific
  • Escherichia coli strain JM110-NAS/GDTT1.8NAS12 was deposited in the collection of the National Biological Resource Centre - Russian National Collection of Industrial Microorganisms (NBRC RNCIM, Russia) and NCIMB Patent Deposit Service (UK) (registration number VKPM-B-13234, date of deposit 21.08.2018; INTERNATIONAL DEPOSITARY AUTHORITY No. NCIMB 43119, date of deposit 19.07.2018).
  • a target gene e.g. the gene encoding green fluorescent protein (GFP) was cloned to a polylinker as per Example 2.
  • GFP green fluorescent protein
  • GFP green fluorescent protein
  • the cells were transfected with plasmid vector pEFGP-C1 (Clontech) and gene therapy DNA vector GDTT1.8NAS12-eGFP was performed.
  • plasmid vector pEFGP-C1 (Clontech)
  • gene therapy DNA vector GDTT1.8NAS12-eGFP was performed.
  • MG-63 cells were cultivated in the DMEM medium (Gibco) with 10% bovine embryo serum and 10pg/ml gentamycin added. To achieve 90% confluence, the cells were seeded into a 24-well plate in the quantity of 4x10 4 cells per well in 24 hours before the transfection procedure. Lipofectamine 3000 (ThermoFisher Scientific, USA) was used as a transfection reagent. In test tube 1.1 mI of the solution of plasmid vector pEFGP-C1 and gene therapy DNA vector GDTT1.8NAS12-eGFP (500ng/pl each) and 1 mI of reagent P3000 were added to 25mI of Opti-MEM medium (Gibco).
  • the preparation was mixed by gentle shaking.
  • 1 mI of solution Lipofectamine 3000 was added to 25mI of medium Opti-MEM (Gibco).
  • the preparation was mixed by gentle shaking.
  • the contents from test tube 1 were added to the contents of test tube 2, and the mixture was incubated at room temperature for 5 minutes.
  • the resulting solution was added dropwise to the cells in the volume of 40mI.
  • the cells were rinsed from the well by pipetting and pelleted at 6000rpm for 10 minutes, rinsed twice, and then the packed cells were re suspended in 1 ml of sodium phosphate buffer.
  • the cells were lysed in three freeze/thaw cycles at -70°C. Then the homogenate of lysed cells was pelleted at 13,000g for 15 minutes.
  • Supernatants were transferred into a 96-well culture plate (Grainer Bio-one) in four replicates for each sample, and then relative fluorescence of GFP was measured (absorption 455nm / emission 538nm) using Fluoroskan Ascent Microplate Fluorometer (Labsystems).
  • the resulting values were normalised according to the total protein concentration in the sample that was measured by the Bradford protein assay.
  • Coomassie Brilliant Blue R-250 (BioRad) was used as a dye.
  • Each replicate was diluted in the wells of the 96-well plate (4 replicates for each sample) with water by a factor of 100, and then the dye was added. After that, optical density of all samples was measured at 620nm using Multiskan Ascent (Thermo).
  • the resulting values were compared with the calibration curve constructed for bovine serum albumin (Bio-Rad) with a series of sequential dilutions from 20 to 2.5pg/ml.
  • ⁇ amount of protein (pg) ⁇ [x]— s] ⁇ k * M, where [x] is the mean value of OD 620 of the four replicates for each sample, s - cpedHee omKnoHeHue, k is the slope coefficient of the calibration curve for BSA, M is the dilution factor of the sample.
  • GFP fluorescence in the samples was normalized using the following formula:
  • a therapeutic gene e.g. the human glutathione peroxidase 1 (GPX1 ) gene, was cloned to a polylinker as per Example 3.
  • GPX1 human glutathione peroxidase 1
  • the cells were seeded into a 24-well plate in the quantity of 5*10 4 cells per well.
  • Lipofectamine 3000 (ThermoFisher Scientific, USA) was used as a transfection reagent.
  • the transfection with gene therapy DNA vector GDTT1.8NAS12-GPX1 carrying human glutathione peroxidase 1 gene was performed as described in Example 6.
  • HEKa cells transfected with gene therapy DNA vector GDTT1.8NAS12 were used as a reference. Extraction of total RNA from the transfected cells and construction of the first cDNA strand was performed according to the procedure described in Example 3.
  • PCR amplification was performed using QuantiTect SYBR Green RT-PCR Kit (Qiagen, USA) or another real-time PCR kit in 20mI of the amplification mixture containing: 25mI of QuantiTect SYBR Green RT- PCR Master Mix, 2.5mM of magnesium chloride, 0.5mM of each primer, and 5mI of total RNA.
  • CFX96 amplifier Bio- Rad, USA
  • 1 cycle of reverse transcription at 42°C for 30 minutes, denaturation at 98°C for 15 minutes followed by 40 cycles comprising denaturation at 94°C for 15s, annealing of primers at 60°C for 30s and elongation at 72°C for 30s.
  • Positive control included amplicons from PCR on matrices represented by plasmids in known concentrations containing cDNA sequences of human glutathione peroxidase 1 and B2M genes.
  • Negative control included deionised water.
  • the Fig. 4 shows PCR product accumulation diagrams.
  • the figure shows that transfection with gene therapy DNA vector GDTT1.8NAS12-GPX1 carrying a therapeutic gene, e.g. the human glutathione peroxidase 1 gene, causes the level of human glutathione peroxidase 1 gene-specific cDNA to rise massively.
  • a therapeutic gene e.g. the human glutathione peroxidase 1 gene
  • a therapeutic gene e.g. the glutathione peroxidase 1 gene, was cloned to a polylinker as per Example 3.
  • gene therapy DNA vector GDTT1.8NAS12- GPX1 carrying a region encoding the glutathione peroxidase 1 gene was injected into the forearm skin of three patients, with concurrent introduction of a placebo being gene therapy DNA vector GDTT1.8NAS12 without the glutathione peroxidase 1 gene cDNA.
  • Patient 1 woman, 66 y.o. (P1 ); Patient 2, woman, 65 y.o. (P2); Patient 3, man, 59 y.o. (P3).
  • Gene therapy DNA vector GDTT1.8NAS12 (placebo) and gene therapy DNA vector GDTT1.8NAS12-GPX1 carrying a region of glutathione peroxidase 1 gene were injected in the quantity of 1 mg for each genetic construct by the tunnel method with a 30G needle to the depth of 3mm.
  • the injected volume of gene therapy DNA vector GDTT1.8NAS12 (placebo) and gene therapy DNA vector GDTT1.8NAS12-GPX1 carrying a region of glutathione peroxidase 1 gene was 1-0.3ml for each genetic construct.
  • the points of introduction of each of the genetic constructs were located at 8-10cm from each other.
  • the biopsy samples were taken on the 2nd day after the injection of the gene therapy DNA vectors.
  • the biopsy samples were taken from the patients’ skin in the area of the introduction of gene therapy DNA vector GDTT1.8NAS12-GPX1 carrying a region encoding the glutathione peroxidase 1 gene (I), gene therapy DNA vector GDTT1.8NAS12 (placebo) (II), and from intact skin (III), using the skin biopsy device Epitheasy 3.5 (Medax SRL).
  • the skin of the patients was preliminarily rinsed with sterile saline and anaesthetised with a lidocaine solution.
  • the biopsy sample volume was ca. 10mm3, and the weight was ca. 15mg.
  • the sample was placed in a buffer solution containing 50mM of Tris-HCI, pH 7.6, 100mM of NaCI, 1 mM of EDTA, and 1 mM of phenylmethylsulfonyl fluoride and homogenised to obtain a homogenised suspension.
  • the resulting suspension was then centrifuged for 10 minutes at 14,000g.
  • Supernatant was collected and used to assay the therapeutic protein by enzyme-linked immunosorbent assay (ELISA) using the ELISA Kit for Glutathione Peroxidase 1 (GPX1 ) (Cloud-Clone Corp., USA) according to the manufacturer’s method with optical density detection using ChemWell Automated EIA and Chemistry Analyser (Awareness Technology Inc., USA).
  • Concentration was quantified by a calibration curve plotted using the reference samples from the kit with known concentrations of glutathione peroxidase 1 protein was used.
  • the method sensitivity is 5.2ng/ml, measurement range is 12.5-200ng/ml.
  • Diagrams resulting from the assay are shown in Figure 5.
  • the skin of each of the three patients demonstrates an increased concentration of the glutathione peroxidase 1 protein in the area of introduction of gene therapy DNA vector GDTT1.8NAS12 carrying a therapeutic gene, e.g.
  • the human glutathione peroxidase 1 gene compared to the concentration of the glutathione peroxidase 1 protein in the area of introduction of gene therapy DNA vector GDTT1.8NAS12 (placebo) devoid of the region of the human glutathione peroxidase 1 gene.
  • a target gene e.g. the gene encoding green fluorescent protein (GFP) was cloned to a polylinker as per Example 2.
  • GFP green fluorescent protein
  • GFP green fluorescent protein
  • GFP green fluorescent protein
  • the cells were cultivated with the use of Bovine Endometrial Cell Growth Media Kit (CellApplications, Inc.) as per manufacturer’s instructions. To achieve 90% confluence, 24 hours before the transfection procedure, the cells were seeded into a 24-well plate in the quantity of 3x10 4 cells per well. Lipofectamine 3000 (ThermoFisher Scientific, USA) was used as a transfection reagent. Transfection was performed according to the procedure described in Example 6. Gene therapy DNA vector GDTT1.8NAS12 free of the green fluorescent protein gene was used as a reference. The results were recorded by measuring fluorescence of the protein extracted from the transfected cell line, as described in Example 6.
  • NAS/GDTT1.8NAS12 a medium was prepared containing per 101: 100g of tryptone, 50g of yeastrel (Becton Dickinson), then the medium was diluted with water to 8,800 ml and autoclaved at 121 °C for 20 minutes, and then 1 ,200ml of 50% (w/v) sucrose was added. After that, the seed culture of Escherichia coli strain JM110- NAS/GDTT1.8NAS12 was inoculated into a culture flask in the volume of 100ml. The culture was incubated in an incubator shaker for 16 hours at 30°C. The seed culture was transferred to the Techfors S bioreactor (Infors HT, Switzerland) and grown to a stationary phase.
  • the Techfors S bioreactor Infors HT, Switzerland
  • the process was controlled by measuring optical density of the culture at 600nm.
  • the cells were pelleted for 30 minutes at 5,000-10,000g. Supernatant was removed, and the cell pellet was re-suspended in 10 vol % phosphate buffered saline. The cells were centrifuged again for 30 minutes at 5,000-10,000g. Supernatant was removed, a solution of 20mM TrisCI, 1 mM EDTA, 200g/l sucrose, pH 8.0, was added to the cell pellet in the volume of 1 ,000ml, and the mixture was stirred thoroughly to a homogenised suspension. Then egg lysozyme solution was added to the final concentration of lOOpg/ml.
  • the mixture was incubated for 20 minutes on ice while stirring gently. Then 2,500ml of 0.2M NaOH, 10g/I sodium dodecyl sulphate (SDS) was added, the mixture was incubated for 10 minutes on ice while stirring gently, then 3,500ml of 3M sodium acetate, 2M acetic acid, pH 5-5.5 was added, and the mixture was incubated for 10 minutes on ice while stirring gently. The resulting sample was centrifuged for 20-30 minutes at 15,000g or a greater value. The solution was decanted delicately, and residual precipitate was removed by passing through a coarse filter (filter paper).
  • SDS sodium dodecyl sulphate
  • RNase A (Sigma) was added to the final concentration of 20pg/ml, and the solution was incubated overnight for 16 hours at room temperature. The solution was then centrifuged for 20- 30 minutes at 15,000g and passed through a 0.45pm membrane filter (Millipore). Then ultrafiltration was performed with a membrane of 100kDa (Millipore) and the mixture was diluted to the initial volume with a buffer solution of 25mM TrisCI, pH 7.0. This manipulation was performed three to four times. The solution was applied to the column with 250ml of DEAE Sepharose HP (GE, USA), equilibrated with 25mM TrisCI, pH 7.0.
  • DEAE Sepharose HP GE, USA
  • the elution process was controlled by measuring optical density of the run-off solution at 260nm, and the fractions were analysed by agarose gel electrophoresis. Fractions containing gene therapy DNA vector GDTT1.8NAS12 were joined and stored at -20°C. These process operations were repeated three times to evaluate the process reproducibility. The process reproducibility and quantitative characteristics of final product yield confirm the producibility and constructability of gene therapy DNA vector GDTT1.8NAS12, and/or gene therapy DNA vectors carrying therapeutic genes based on it, on an industrial scale.
  • GDTT1.8NAS12 is a gene therapy vector devoid of sequences of viral genomes and antibiotic resistance markers

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Plant Pathology (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Cell Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Virology (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention can be used in biotechnology, in particular to the gene therapy DNA vector GDTT1.8NAS12, Escherichia coli strain JM 110-NAS, Escherichia coli strain JM 110-NAS/GDTT1.8NAS12, and the industrial production of the gene therapy DNA vector GDTT1.8NAS12. A method of obtaining the gene therapeutic DNA vector GDTT1.8NAS12 involves construction of a 2408-bp intermediate vector containing a 688-bp replication origin, a 467-bp transcription terminator hGH-TA, a 137-bp regulatory site RNA-out transposon TnlO, a l0l8-bp kanamycin resistance gene, and a 68-bp polylinker. Then, it is splitted using restriction endonucleases Sall and BamHI and ligated to the promoter regulatory region containing the 1219-bp promoter region of the human elongation factor EF1A with its own enhancer. The kanamycin resistance gene is cleaved at the Spel restriction sites.

Description

THE GENE THERAPY DNA VECTOR GDTT1.8NAS12 AND THE METHOD FOR OBTAINING THEREOF
Field of the Invention
The invention refers to genetic engineering and can be used in biotechnology, medicine, and agriculture for the manufacture of gene therapy products. I.e., the produced gene therapy DNA vector containing the therapeutic gene can be used to deliver it to the cells of human beings and animals that experience reduced or insufficient expression of that gene, thus ensuring the desired therapeutic effect.
Background of the Invention
Gene therapy involves introduction of nucleic acids or their derivatives for treatment of acquired or hereditary diseases. The therapeutic effect is achieved either by compensation of malfunctioning or completely non-functional gene, or by production of a protein product with a therapeutic effect. The main tool of gene therapy is a therapeutic genetic material carrier, a vector. All vectors used in gene therapy are divided into two main categories, viral and non-viral ones. Viral gene therapy vectors are constructed on the basis of retroviruses, lentiviruses, adenoviruses, adeno-associated viruses, herpesviruses, poxviruses. (Lundstrom K. Viral Vectors in Gene Therapy. Diseases. 2018 May 21 ;6(2)). Non-viral vectors include plasmid- or linear RNA-based vectors. Plasmid vectors have wider practical use due to simplified production and high stability. To enhance efficiency of therapeutic gene delivery to somatic cells, plasmid vectors are often introduced in combination with various carriers, such as lipids, cation polymers, dendrimers, polypeptides, and nanoparticles of different nature (Hidai C, Kitano H. Nonviral Gene Therapy for Cancer: A Review. Diseases. 2018 Jul 3;6(3)). A plasmid added to such molecular complex improves its penetration into cell.
Main advantage of viral vectors is fast and highly efficient delivery of therapeutic genetic material to a cell due to natural properties of viruses. However, the viral vectors have rather limited used in clinical practice. Besides purely technological issues related to obtainment, production and selection, viral vector application involves high risk of adverse medical consequences, such as inflammation and immune response to the gene therapy, cytotoxicity, mutagenesis, and carcinogenesis. Another risk of viral vectors is that specific individual features of patients can cause unpredictable consequences of gene therapy (Thomas CE, Ehrhardt A, Kay MA. Progress and problems with the use of viral vectors for gene therapy. Nat Rev Genet. 2003 May;4(5):346-58). Despite intensive research aimed to reduce risks associated with gene therapy with viral vectors, many problems remain unsolved. In this regard, both researchers and clinicians grow ever more interested in application of non-viral vectors for therapeutic gene delivery. A plasmid is a circle DNA molecule existing and replicating in a cell independently from the chromosome DNA. In vivo the plasmids occur mainly in bacteria and more rarely in archaea and eukaryotes. While chromosome DNA carries all genetic information required for life under normal conditions, plasmids are generally containing genes ensuring survival in specific or even adverse environment (Lipps G. (editor), (2008). Plasmids: Current Research and Future Trends. Caister Academic Press. ISBN 978-1-904455-35-6). Such genes ensure antibiotic resistance, encode virulence factors, take part in catabolism and metabolism of various substrates and detoxication of harmful compounds. Plasmids are known to participate in genetic information transfer between cells, thus enabling horizontal gene transfer.
Plasmid-based vectors do not share the downsides of viral vectors. Thus, plasmids are a convenient carrier for therapeutic genetic material by their nature, due to simple methods of direct molecular cloning and production of required amounts. Plasmid vector introduction does not cause inflammation and immune response of the subject. Plasmids themselves are not cytotoxic, and are not integrated into the genome when they reach target cells, and thus, they do not affect genome stability. Due to those features, plasmid vectors are a promising tool for gene therapy and genetic preventive therapy (DNA vaccines) (Porter KR, Raviprakash K. DNA Vaccine Delivery and Improved Immunogenicity. Curr Issues Mol Biol. 2017;22:129-138).
Besides, quite extensive experience in operations with plasmid vectors is accumulated since they have been the main tool of molecular cloning and recombinant protein obtaining in scientific and biotechnological laboratories for decades. (Russel, David W.; Sambrook, Joseph (2001 ), Molecular cloning: a laboratory manual. Cold Spring Harbor, N.Y; Cold Spring Harbor Laboratory.)
However, the plasmid vectors have also some drawbacks limiting their use in the clinical practice. First, antibiotic resistance genes shall be introduced into plasmid vectors for selection and production in carrier strains. Second, regulatory elements (promoters, enhancers, posttranscriptional regulatory elements) are added to the vector for efficient expression of the therapeutic gene (Sun J, Li D, Hao Y, Zhang Y, Fan W, Fu J, Hu Y, Liu Y, Shao Y. Posttranscriptional regulatory elements enhance antigen expression and DNA vaccine efficiency. DNA Cell Biol. 2009 May;28(5):233-40) that mainly constitute viral nucleotide sequences (Draft Guideline on the quality, non-clinical and clinical aspects of gene therapy medicinal products, http://www.ema.europa.eu/docs/en GB/document librarv/Scientific q uideline/2015/05/WC500187020.pdf). Finally, plasmid vector size determines efficiency of penetration into target cells, i.e. the bigger the vector, the poorer its penetration into cells is. Plasmids used in gene therapy often have unnecessary, non-encoding sites that increase their length substantially (Mairhofer J, Grabherr R. Rational vector design for efficient non-viral gene delivery: challenges facing the use of plasmid DNA. Mol Biotechnol. 2008.39(2):97-104).
The increase in antibiotic resistance of infectious agents over the past few years is a natural response to the wide-scale use of antimicrobial drugs in medicine. Increase in resistance to antibiotics is of great social and economic importance and is considered to be a threat to national security (MacPherson D.W., Gushulak B.D., Baine W.B., Bala S., Gubbins P.O., Holtom P., Segarra-Newnham M. 2009. Population mobility, globalization, and antimicrobial drug resistance. Emerg Infect Dis 15:1727-1732). In this regard, the use of plasmid vectors with antibiotic resistance genes added for selection and production bears a risk of transfer of such genes to infectious agents both directly and by horizontal transfer (San Millan A. Evolution of Plasmid-Mediated Antibiotic Resistance in the Clinical Context. Trends Microbiol. 2018 Jul 23. doi: 10.1016/j.tim.2018.06.007). For that reason, the European Medicines Agency recommends refraining from adding antibiotic resistance genes to plasmid gene therapy vectors (Reflection paper on design modifications of gene therapy medicinal products during development / 14 December 2011 EMA/CAT/GTWP/44236/2009 Committee for advanced therapies).
The issue of necessary antibiotic resistance gene introduction into a plasmid vector can be avoided by developed Escherichia coli strains (DHIIacdapD and DH1 lacP2dapD) featuring dapD gene in their genome controlled by lac promoter (Cranenburgh RM, Hanak JA, Williams SG, Sherratt DJ. Escherichia coli strains that allow antibiotic-free plasmid selection and maintenance by repressor titration. Nucleic Acids Res. 2001. 29(5):E26). That gene encodes 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate-N-succinyltransferase enzyme involved in biosynthesis of L-lysine. In the absence of inducer IPTG (isopropyl-p-D-1-thiogalactopyranoside) activating dapD expression, these strained are subject to lysis. Expression of dapD can also be induced by introduction of multicopy pORT vector, so that the transformed clones can be selected and multiplied. The disadvantage of these strains is a low transformation level and transformation instability.
Another way to avoid the use of antibiotic resistance genes involves modification of Escherichia coli cells so that RNA I plasmid vector replication inhibitor could suppress translation of genes critical to bacteria growth (such as murA encoding UDP-N- acetylglucosamine 1-carboxyvinyl-transferase enzyme involved in biosynthesis of bacterium cell wall peptidoglycan) by forming a duplex of RNA/antisense RNA (Mairhofer J, Pfaffenzeller I, Merz D, Grabherr R. A novel antibiotic free plasmid selection system: advances in safe and efficient DNA therapy. Biotechnol J. 2008. 3(1 ):83-89). The murA gene shall be controlled by tetR repressor protein and can be expressed only in the presence of constructed plasmid vector containing RNA-I gene. However, the inhibition mechanics is still unknown in this system, and IPTG-mediated induction results in development of Escherichia coli colonies devoid of the therapeutic plasmid vector.
Certain other ways to avoid application of antibiotic resistance genes in construction of plasmid gene therapy vectors have been described (Mignon C, Sodoyer R, Werle B. Antibiotic-free selection in biotherapeutics: now and forever. Pathogens. 2015 Apr 3;4(2): 157- 81 ).
In attempt to create a minimal vector without non-functional sequences, a supercoiled plasmid DNA molecule devoid of any prokaryotic nucleotide sequences has been obtained. This so-called minicircle vector only contained an origin of replication and antibiotic resistance gene and was obtained by integrase-mediated intramolecular recombination using q>C31 phage (Chen ZY, He CY, Ehrhardt A, Kay MA. Minicircle DNA vectors devoid of bacterial DNA result in persistent and high-level transgene expression in vivo. Mol Ther. 2003. 8(3):495-500). However, such a gene is no viable for practical use due to extremely complex and labour-consuming industrial-scale obtainment and production processes.
Patent claim US 2011152377/10 proposed to use a plasmid vector devoid of antibiotic resistance genes that still encodes a repressor protein. This repressor protein suppresses expression of the toxic protein encoded in the chromosome DNA of Escherichia coli. However, the low efficiency and instability of such transformation limit production of vectors with repressor proteins on an industrial scale.
Patent US7521182B2 suggests a plasmid vector containing araD gene. In E. coli, this gene encodes L-ribulose-5-phosphate-4- epimerase. Although this enzyme itself is not critical for bacterium growth, its deficiency results in toxic product accumulation in a cell Vector encoding araD in combination with E. coli strain with this gene removed from the genome represents an antibiotic-free selection system.
Patent US 9,644,211 proposes a method of obtaining a minicircle plasmid vector free of prokaryotic sequences. Such a vector is produced by parA-mediated recombination realised in a cultured E. coli strain. Since this minicircle cannot be produced on an industrial scale, it cannot be viewed as a potential gene therapy vector.
The prototype for a new carrier based on recombinant plasmid gene therapy vectors was the recombinant vector for genetic vaccination (US 9,550,998). The new carrier is a supercoiled plasmid that is used for the expression of cloned genes in human and animal cells. It consists of replication origin, promoter, and enhancer of human cytomegalovirus and regulatory elements from human T- lymphotropic virus.
The new vector is selected and produced in a special-purpose Escherichia coli strain by antisense-complementation of sacB gene introduced into the strain by a bacteriophage, thus excluding antibiotic resistance genes completely. The only factor limiting the use of the new vector in gene therapy is that it includes regulatory elements in the form of viral nucleotide sequences.
Disclosure of the Invention
The purpose of this invention is to construct a multipurpose gene therapy DNA vector for genetic modification of human and animal cells that would reasonably combine the following:
I) Efficiency of the gene therapy DNA vector in enhancing expression level of therapeutic genes in various human and animal tissue cells due to limited length not exceeding 2600 bp, ensuring efficient penetration into the target cell and availability of regulatory element sequences ensuring high expression of therapeutic genes in human and animal tissue cells.
II) Possibility of safe use in gene therapy of human beings and animals due to the absence of regulatory elements representing the nucleotide sequences of viral genomes in the gene therapy DNA vector.
III) Possibility of safe use in the gene therapy of human beings and animals due to the absence of antibiotic resistance genes in the gene therapy DNA vector.
IV) Producibility and constructability of gene therapy DNA vector on an industrial scale.
Item II and III are provided for herein in line with the recommendations of the state regulators for gene therapy medicines and, specifically, the requirement of the European Medicines Agency to refrain from adding antibiotic resistance marker genes to newly engineered plasmid vectors for gene therapy (Reflection paper on design modifications of gene therapy medicinal products during development / 14 December 2011 EMA/CAT/GTWP/44236/2009 Committee for advanced therapies) and refrain from adding viral genomes to newly engineered plasmid vectors for gene therapy (Guideline on the quality, non-clinical and clinical aspects of gene therapy medicinal products / 23 March 2015, EMA/CAT/80183/2014, Committee for Advanced Therapies).
The purpose of the invention also includes the construction of a strain carrying this gene therapy DNA vector for the production of these gene therapy DNA vectors on an industrial scale.
The specified purpose is achieved by creation of gene therapy DNA vector GDTT1.8NAS12 in the form of a 2591 -bp circular doublestrand DNA molecule containing nucleotide sequence SEQ ID No. 1 , capable of autonomous replication in Escherichia coli cells and consisting of the following structural elements: promoter region of EF1 A human elongation factor with its own enhancer contained in the first intron of the gene, a polylinker containing a sequence of BamHI, EcoRV, Sail, Kpnl, EcoRI, Xbal, and Notl restriction sites and designed for cloning of therapeutic therapy genes, RNA-out regulatory element of transposon Tn10, enabling antibiotic-free positive selection for Escherichia coli strain JM 110-NAS; the origin of replication for autonomous replication of a gene therapy DNA vector with a single nucleotide substitution to increase plasmid production in the cells of most Escherichia coli strains.
Method of obtaining the 2591 -bp gene therapy DNA vector GDTT1.8NAS12 involves initial construction of a 2408-bp intermediate vector containing a 688-bp replication origin, a 467-bp transcription terminator hGH-TA, a 137-bp regulatory site RNA-out of transposon Tn10, a 1018-bp kanamycin resistance gene, and a 68-bp polylinker, further vector splitting using Sail and BamHI restriction endonucleases and ligation with promoter/regulator site containing the promoter region of human elongation factor EF1A with its own 1219-bp enhancer, and cleaving of the kanamycin resistance gene by Spel restriction sites.
The method of obtaining of Escherichia coli strain JM110-NAS for the production of gene therapy DNA vector GDTT1.8NAS12 involves constructing a linear DNA fragment containing a 64-bp regulatory element RNA-in of Tn10 transposon allowing for antibiotic- free positive selection, 1422-bp sacB levansucrase gene, the product of which ensures selection within a sucrose-containing medium, 763- bp catR chloramphenicol resistance gene required to pick strain clones where homologous recombination occurred, and two homologous sequences, 329 bp and 233 bp, ensuring homologous recombination in the region of recA gene concurrent with gene inactivation, where the said homologous sequences are obtained by PCR amplification of recA gene fragment using genome DNA of Escherichia coli JM110-NAS as a matrix, and a couple of LHA-F (5’- GCT G ACGCT GC AGGT G ATC) and LHA-R (5’-
G ACAAG AT GT GT GT CT ACCGCTT C AGGTT ACCCGCC AG ) primers, and a couple of RHA-F (5’- TGGCAGGGCGGGGCGTAACTACGCCTCTGTTCGTCTCGA) and RHA-R (5’-CTCAGCAGCAACTCACGTAC) primers, and then the Escherichia coli cells are transformed by electroporation, and clones surviving in a medium containing 10pg/ml of chloramphenicol are selected.
Escherichia coli strain JM110-NAS obtained by the method above for production of gene therapy DNA vector GDTT1.8NAS12 with possible antibiotic-free positive selection, containing a linear fragment consisting of regulator element RNA-in of transposon Tn10, sacB levansucrase gene, and catR chloramphenicol resistance gene in the chromosome in recA gene region.
The method of obtaining Escherichia coli strain JM110- AF/GDTT1.8NAS12 carrying gene therapy DNA vector GDTT1.8NAS12 involves making electrocompetent cells of Escherichia coli strain JM110-NAS and subjecting these cells to electroporation with gene therapy DNA vector GDTT1.8NAS12. After that, the cells are poured into agar plates (Petri dishes) with a selective medium containing yeastrel, peptone, 6% sucrose, and 10pg/ml of chloramphenicol.
Escherichia coli strain JM110-NAS/GDTT1.8NAS12 obtained by the method described above, carrying gene therapy DNA vector GDTT1.8NAS12 for production of gene therapy DNA vector GDTT1.8NAS12 allowing for antibiotic-free selection
The method of gene therapy DNA vector GDTT1.8NAS12 production on an industrial scale involves scaling-up the bacterial culture of Escherichia coli strain JM110-NAS/GDTT1.8NAS12 to the quantities necessary for increasing the bacterial biomass in an industrial fermenter, after which the biomass is used to extract a fraction containing the therapeutic DNA product, i.e. the gene therapy DNA vector GDTT1-8NAS12, and then multi-stage filtered, and purified by chromatographic methods.
The essence of the invention is explained in the drawings, where
Figure 1
shows the structure of gene therapy DNA vector GDTT1.8NAS12 that is a 2591 -bp circular double-strand DNA molecule capable of autonomous replication in Escherichia coli cells. Figure 1 marks the following structural elements of the vector:
(1 ) prom (695 to 1901 bp) is a promoter region of human elongation factor EF1A with an intrinsic enhancer contained in the first intron of the gene. It ensures efficient transcription of the recombinant gene in most human tissues.
(2) MCS (1902 to 1969 bp) is a polylinker (multiple cloning site) that contains a sequence of BamHI, EcoRV, Sail, Kpnl, EcoRI, Xbal, and Notl restriction enzymes and allows cloning of the therapeutic therapy genes.
(3) RNA-out (2443 to 2579 bp out) is a regulatory element RNA- out of transposon Tn10 allowing for antibiotic-free positive selection in case of the use of Escherichia coli strain JM 110.
(4) ori (1 to 688 bp) is an origin of replication for autonomous replication with a single nucleotide substitution to increase plasmid production in the cells of most Escherichia coli strains.
Figure 2
shows the structure of the DNA fragment for homologous recombination in the region of recA gene of Escherichia coli for obtaining Escherichia coli strain JM 110.
The linear fragment consists of a cassette carrying the regulatory element RNA-IN of transposon Tn10 for antibiotic-free selection (64 bp), sacB levansucrase gene, the product of which ensures selection within a sucrose-containing medium (1422 bp), and catR chloramphenicol resistance gene required for the picking of strain clones in which homologous recombination occurred (763 bp). The cassette is flanked by two homology arms that ensure the process of recombination in the region of recA gene with concurrent gene inactivation (329 bp and 233 bp for the left arm and for the right arm, respectively).
Figure 3
shows fluorescence microimaging of the MG-63 cell culture 48 hours after the transfection of the cells with pEFGP-C1 plasmid vector (Clontech) and DNA vector GDTT1.8NAS12-eGFP (A), and a diagram of fluorescence emitted by the protein extracted from MG-63 cells 48 hours after the transfection of the cells with pEFGP-C1 plasmid vector (Clontech) and DNA vector GDTT 1 8NAS12-eGFP (B) to compare the levels of accumulation of the product of the target gene, e.g. green fluorescent protein (GFP), in the MG-63 cells 48 hours after the transfection of the cells with pEFGP-C1 plasmid vector (Clontech) and DNA vector GDTT 1.8NAS12-eGFP.
Figure 4
shows diagrams of human glutathione peroxidase 1 gene mRNA accumulation in primary culture cells of epidermal keratinocytes HEKa before transfection and 48 hours after transfection of those cells with DNA vector GDTT1.8NAS12-GPX1 carrying a human glutathione peroxidase 1 gene, in order to assess therapeutic gene mRNA accumulation, e.g. for glutathione peroxidase 1 gene, in primary culture cells of HEKa epidermal keratinocytes before transfection and 48 hours after transfection of those cells with DNA vector GDTT1.8NAS12-GPX1 carrying a human glutathione peroxidase 1 gene, where:
1 - cDNA of GPX1 gene after transfection with gene therapy vector GDTT1.8NAS12, 2 - cDNA of GPX1 gene after transfection with gene therapy vector GDTT1.8NAS12-GPX1 carrying a region of human glutathione peroxidase 1 gene;
3 - cDNA of B2M gene after transfection with gene therapy vector GDTT1.8NAS12,
4 - cDNA of B2M gene after transfection with gene therapy vector GDTT1-8NAS12-GPX1 carrying a region of human glutathione peroxidase 1 gene. Figure 5
shows the plot of glutathione peroxidase 1 protein concentration in skin biopsy samples of three patients after the injection of the skin of these patients with gene therapy DNA vector GDTT1.8NAS12- GPX1 carrying a human glutathione peroxidase 1 gene encoding region for the purpose of analysing changes in glutathione peroxidase 1 protein concentrations in human skin upon injection of human skin with gene therapy DNA vector GDTT1.8NAS12-GPX1 carrying the therapeutic gene, e.g. human glutathione peroxidase 1 gene, where:
P1 I is patient P1 skin biopsy in the region of injection of gene therapy DNA vector GDTT 1.8NAS12-GPX1 ,
P1 II is patient P1 skin biopsy in the region of injection of gene therapy DNA vector GDTT1.8NAS 12 (placebo),
P1 III is patient P1 skin biopsy from intact site,
P2I is patient P2 skin biopsy in the region of injection of gene therapy DNA vector GDTT1.8NAS12-GPX1 ,
P2II is patient P2 skin biopsy in the region of injection of gene therapy DNA vector GDTT1.8NAS12 (placebo),
P2III is patient P2 skin biopsy from intact site, P3I is patient P3 skin biopsy in the region of injection of gene therapy DNA vector GDTT 1.8NAS12-GPX1 ,
P3II is patient P3 skin biopsy in the region of injection of gene therapy DNA vector GDTT1.8NAS 12 (placebo),
P3III is patient P3 skin biopsy from intact site.
Figure 6
shows a diagram of changes in fluorescence level of the green fluorescent protein in primary culture of BEnEpC bovine endometrial epithelial cells 48 hours after transfection with DNA vector
GDTT1.8NAS12 and DNA vector GDTT1.8NAS12-eGFP carrying a gene site encoding green fluorescent protein, for comparison of the target gene product accumulation level, e.g. for the green fluorescent protein (GFP) in primary culture of BEnEpC bovine endometrial epithelial cells 48 hours after transfection with DNA vector
GDTT1.8NAS12 and DNA vector GDTT1.8NAS12-eGFP carrying a gene site encoding green fluorescent protein.
Embodiment of the Invention
The invention is embodied as follows.
First, a 2591 -bp gene therapy DNA vector GDTT1.8NAS12 for genetic modification of animal and human cells containing nucleotide sequence SEQ ID No. 1 is constructed. Method of obtaining of the 2591 -bp gene therapy DNA vector GDTT1.8NAS12 involves initial construction of a 2408-bp vector containing a 688-bp replication origin, a 467-bp transcription terminator hGH-TA, a 137-bp regulatory site RNA-out of transposon Tn10, a 1018-bp kanamycin resistance gene, and a 68-bp polylinker, further vector splitting using Sail and BamHI restriction endonucleases and ligation with promoter/regulator site containing the promoter region of EF1A human elongation factor with its own 1219-bp enhancer, and cleaving of the kanamycin resistance gene by Spel restriction sites.
At the same time, degeneracy of genetic code is known to the experts in this field and means that the scope of this invention also includes variants of nucleotide sequences differing by insertion, deletion, or replacement of nucleotides that do not result in a change in the polypeptide sequence encoded by the therapeutic gene, and/or do not result in a loss of functional activity of the regulatory elements of GDTT1.8NAS12 vector and/or gene therapy DNA vectors carrying therapeutic genes based on it. Experts in this field realise that the methodological implementation of obtaining of gene therapy DNA vector GDTT1.8NAS12 and/or gene therapy DNA vectors carrying therapeutic genes based on it can vary within the choice of known methods of molecular gene cloning, and these methods are included in the scope of this invention. For example, different oligonucleotide sequences can be used to amplify genes, different restriction endonucleases or laboratory techniques, such as ligation independent cloning of genes.
To produce gene therapy DNA vector GDTT1.8NAS12 and/or gene therapy DNA vectors carrying therapeutic genes based on it with possible antibiotic-free positive selection, Escherichia coli strain JM110-NAS is constructed. The method of obtaining Escherichia coli strain JM110-NAS for production of gene therapy DNA vector GDTT1.8NAS12 and/or gene therapy DNA genes carrying therapeutic genes based on it involves construction of a linear DNA fragment containing a 64-bp regulatory element RNA-in of transposon Tn10 for antibiotic-free positive selection, a 1422-bp levansucrase gene sacB, the product of which ensures selection in sucrose- containing medium, a 763-bp chloramphenicol resistance gene catR required for selection of strain clones where homologous recombination occurred, and two homologous sequences, 329 bp and 233 bp, ensuring homologous recombination process in the region or recA gene with concurrent gene inactivation, and further transformation of Escherichia coli JM110 cells by electroporation, and selection of clones surviving in a medium containing 10pg/ml of chloramphenicol. The method also involves construction of Escherichia coli strain JM110-NAS/GDTT1.8NAS12 carrying gene therapy DNA vector GDTT1.8NAS12 and/or gene therapy DNA vectors containing therapeutic genes based on it for vector production allowing for antibiotic-free selection. The method of obtaining Escherichia coli strain JM110-NAS/GDTT1.8NAS12 carrying gene therapy DNA vector GDTT1.8NAS12 and/or gene therapy DNA vectors containing therapeutic genes based on it involves obtainment of electrocompetent cells of Escherichia coli strain JM110-NAS and electroporation of those cells with gene therapy DNA vector GDTT1.8NAS12, with further inoculation in Petri dishes with selective agar medium containing yeastrel, peptone, 6% sucrose, and 10pg/ml of chloramphenicol.
The method of gene therapy DNA vector GDTT1.8NAS12 production on an industrial scale involves scaling-up the bacterial culture of the strain to the quantities necessary for increasing the bacterial biomass in an industrial fermenter, after which the biomass is used to extract a fraction containing the therapeutic DNA product, i.e. the gene therapy DNA vector GDTT1-8NAS12, and then multistage filtered, and purified by chromatographic methods.
It is known to the experts in this field that culture conditions of producer strains, composition of nutrient media (except for antibiotic- free), equipment used, and DNA purification methods may vary within the framework of standard operating procedures depending on the particular production line, but known approaches to scaling, industrial production, and purification of DNA vectors using Escherichia coli strain JM110-NAS/GDTT1.8NAS12 fall within the scope of this invention.
The essence of the invention is explained in the following examples.
Example 1.
Obtaining of gene therapy DNA vector GDTT1.8NAS12 containing a promoter of human elongation gene EF1a with its own enhancer for improved expression of therapeutic genes in cells of the most of human and animal cells.
Gene therapy DNA vector GDTT1.8NAS12 was constructed by consolidating six fragments of DNA derived from different sources:
(a) the origin of replication was produced by PCR amplification of a region of commercially available pUC19 plasmid with UCori-Bam and UCori-Nco oligonucleotides (List of Sequences, (1 )— (2)),
(b) the hGH-TA transcription terminator was produced by PCR amplification of a site of human genomic DNA using hGH-F and hGH- R oligonucleotides (List of Sequences, (3) and (4)),
(c) the regulatory site RNA-OUT of transposon Tn10 was synthesised from RO-F, RO-R, RO-1 , RO-2, and RO-3 oligonucleotides (List of Sequences, (5)-(9)),
(d) the kanamycin resistance gene was produced by PCR amplification of a site of commercially available pET-28 plasmid using Kan-F and Kan-R oligonucleotides (List of Sequences, (10) and (1 1 )), (e) the polylinker was produced by cining and annealing of four synthetic oligonucleotides MCS1 , MCS2, MCS3, and MCS4 (List of Sequences, (12)— (15)),
(f) promoter/regulator site of human elongation factor gene EF1a with its own enhancer was obtained by PCR amplification of a human genome DNA site using EF1-Xho and EF1-R oligonucleotides (List of Sequences, (16)-(17)).
PCR amplification was performed using the commercially available kit Phusion® High-Fidelity DNA Polymerase (New England Biolabs) as per the manufacturer’s instructions. The fragments (b), (c), and (d) had overlapping regions allowing for their consolidation with subsequent PCR amplification. Fragments (b), (c), and (d) were joined using hGH-F and Kan-R oligonucleotides (List of Sequences, (3) and (11 )). Afterwards, the obtained DNA fragments were consolidated by restriction with subsequent ligation by BamHI and Ncol sites. This resulted in a vector still devoid of the polylinker. To introduce it, the plasmid was split by restriction endonucleases in BamHI and EcoRI sites with further ligation to the fragment (e). This resulted in a 2408-bp intermediate vector carrying a kanamycin resistance gene, but still without promoter/regulator site of elongation factor EF1a gene with its own enhancer. The vector obtained was split by restriction endonucleases in Sail and BamHI sites with further ligation to the fragment (f). This resulted in a 3608-bp vector carrying a kanamycin resistance gene and promoter/regulator site of elongation factor EF1a gene with its own enhancer. Then the kanamycin resistance gene was cleaved by Spel restriction sites, and the remaining fragment was ligated to itself. Thus, a 2591 -bp recombinant gene therapy DNA vector GDTT1.8NAS12 enabling antibiotic-free selection and expression of therapeutic genes cloned into it in the most types of human and animal tissues was obtained (SEQ ID No. 1 ).
Example 2.
To prove the efficiency of DNA vector GDTT1.8NAS12, the therapeutic gene, e.g. the green fluorescent protein (GFP) gene, was cloned to the polylinker.
Obtaining of gene therapy DNA vector GDTT1.8NAS12-eGFP carrying the target gene, e.g. the gene coding green fluorescent protein (GFP).
The coding region of the green fluorescent protein gene was produced by PCR amplification of commercially available plasmid pEGFP-C1 (Clontech) using MVGFP-F and MVGFP-R oligonucleotides (List of Sequences, (18) and (19)). The obtained PCR fragment was cleaved by BamHI and EcoRI restriction endonucleases and ligated with a 3608-bp DNA vector carrying the kanamycin resistance gene and cleaved by the same enzymes. Further on, the kanamycin resistance gene was removed from the vector produced, as described in Example 1. This resulted in a 3268- bp DNA vector GDTT1.8NAS12-eGFP allowing for antibiotic-free selection.
Example 3.
To prove the efficiency of DNA vector GDTT1.8NAS12, the therapeutic gene, e.g. the human glutathione peroxidase 1 (GPX1 ) gene, was cloned to a polylinker.
Obtaining of DNA vector GDTT1.8NAS12-GPX1 carrying a site of a therapeutic gene, such as GPX1 gene encoding human glutathione peroxidase 1 protein. The 609-bp coding region of the GPX1 gene (SEQ ID No. 2) was produced by extracting total RNA from the patient’s skin biopsy sample with subsequent reverse transcription and PCR amplification. The material was sampled from intact skin in the forearm, using the skin biopsy device Epitheasy 3.5 (Medax SRL). The patient’s skin was preliminarily rinsed with sterile saline and anaesthetised with a lidocaine solution. Mass of the biopsy sample was about 10mg. The sample was placed in 1 ml of Trizol Reagent (ThermoFisher Scientific), homogenised, and heated for 5 minutes at 65°C. The sample was centrifuged at 14,000g for 10 minutes and heated again for 10 minutes at 65°C. Then 200mI of chloroform was added, and the mixture was gently stirred and centrifuged at 14,000g for 10 minutes. Then the water phase was isolated and mixed with 1/10 of the volume of 3M sodium acetate, pH 5.2, and an equal volume of isopropyl alcohol. The sample was incubated at -20°C for 10 minutes and then centrifuged at 14,000g for 10 minutes. The precipitated RNA was rinsed in 1 ml of 70% ethyl alcohol, air-dried and dissolved in 10mI of RNase-free water. To synthesize the first strand of cDNA of the human glutathione peroxidase 1 gene, Mint reverse transcriptase (Evrogen, Russia) was used. 4mI of Mint Buffer, 2mI of dithiothreitol, 2mI of dNTP Mix, 2mI of each of oligonucleotides GPX1-F and GPX1- R (List of Sequences, (20) and (21 )), and 2mI of Mint reverse transcriptase were added to 6mI of total RNA, and the mixture was incubated at 42°C for 2 hours. The synthesised cDNA was used as a matrix in PCR amplification using the same oligonucleotides at 94°C for 3 minutes; 30 cycles: at 94°C for 30 seconds, at 60°C for 30 seconds and at 72°C for 45 seconds, with final elongation at 72°C for 5 minutes. The obtained PCR fragment was cleaved by restriction endonucleases BamHI and EcoRI, and ligated with a 3608-bp vector carrying the kanamycin resistance gene and cleaved by the same enzymes. Further on, the kanamycin resistance gene was removed from the vector produced, as described in Example 1. This resulted in a 609-bp gene therapy DNA vector GDTT1.8NAS12-GPX1 carrying a region encoding the human glutathione peroxidase 1 gene allowing for antibiotic-free selection.
Example 4.
Obtaining of Escherichia coli strain JM110-NAS for production of gene therapy DNA vector GDTT1.8NAS12 and/or gene therapy vectors carrying therapeutic genes based on it.
Escherichia coli strain JM110-NAS for the engineering of gene therapy DNA vector GDTT1.8NAS12 and/or gene therapy vectors carrying therapeutic genes based on it as produced by homologous recombination by introduction to its chromosome, specifically to the region of recA gene, of the linear fragment containing regulatory element RNA-in of transposon Tn10 allowing for antibiotic-free positive selection (64 bp), levansucrase gene sacB, the product of which ensures selection in a sucrose-containing medium (1422 bp), chloramphenicol resistance gene catR required for selection of strain clones in which homologous recombination occurred (763 bp), and two homologous sequences (homology arms) ensuring homologous recombination in the region of gene recA concurrent with gene inactivation (329 bp and 233 bp for the left arm and for the right arm, respectively).
To synthesise the left and the right homology arms, fragments of gene recA were amplified by PCR using the genomic DNA of Escherichia coli JM110 (Agilent Technologies, cat. No. 200239) as a matrix. To synthesise the left homology arm, LHA-F and LHA-R primers (List of Sequences, (22) and (23)) were used, while for synthesising the right homology arm, RHA-F and RHA-R primers (List of Sequences, (24) and (25)) were used. The RNA-IN fragment was tailed with IN-F, IN-1 , IN-2, and IN-R synthetic oligonucleotides (List of Sequences, (26), (27), (28), (29)). The sacB gene was produced by PCR amplification using the genomic DNA of B.subtilis 168HT as a matrix, and SacB-F and SacB-R as primers (List of Sequences, (30) and (31 )). To synthesise the catR gene, PCR amplification was performed using Escherichia coli BL21 pLysS as a matrix, and CatR- F and CatR-R (List of Sequences, (32) and (33)) as primers. PCR products LHA (the left homology arm), SacB, and RHA (the right homology arm) were amplified at 94°C for 3 minutes; 30 cycles: at 94°C for 20 seconds, at 60°C for 20 seconds, and at 72°C for 60 seconds, with final elongation at 72°C for 5 minutes. PCR product RNA-IN was synthesized at 94°C for 3 minutes; 30 cycles: at 94°C for 10 seconds, at 60°C for 10 seconds, and at 72°C for 10 seconds, using oligonucleotides IN-F, IN-1 , IN-2 and IN-R (List of Sequences, (26), (27), (28), and (29)) for the assembly of the fragment. For this, 10mM of primers IN-F and IN-R, and 5mM of primers IN-1 and IN-2 were used. PCR amplification was performed using the commercially available kit Phusion® High-Fidelity DNA Polymerase (Thermo Fisher Scientific) as per the manufacturer’s instructions.
The linear fragment for homologous recombination was synthesised by consolidating five PCR products. All of the five products had overlapping areas allowing for subsequent assembly into a single fragment. All fragments were mixed in aliquots of 10ng in a volume of 50mI. The PCR product was derived at 94 C for 3 minutes; 10 cycles: at 94°C for 30 seconds, at 60°C for 30 seconds, and at 72°C for 2 minutes, without primers added. Then LHA-F and RHA-R primers (List of Sequences, (22), (25)) were added, and 25 more PCR cycles were performed: at 94°C for 30 seconds, at 60°C for 30 seconds, and at 72°C for 2 minutes, with final elongation at 72°C for 5 minutes. This resulted in a 2811 -bp long PCR fragment having the following structure: LHA-RNA-IN-SacB-CatR-RHA. This fragment was recovered preparatively from agarose gel using the DNA Elution Kit (BioSilica, Russia) according to the manufacturer’s instructions.
For obtaining Escherichia coli strain JM110-NAS, electrocompetent cells were prepared. For this purpose, a single colony of Escherichia coli strain JM 110 (Agilent Technologies) was used to inoculate 10ml of LB broth, and the cells were cultured overnight in an orbital shaker at 150rpm and 37°C. On the following day, 1/20 was re-plated into 100ml of LB broth and cultured in an orbital shaker at 150rpm and 37°C to reach OD60o = 0.5. Upon reaching the required optical density, the cells were cooled down to 0°C and centrifuged for 10 minutes at 4000g. Then the medium was removed and the cells were rinsed with 100ml of ice-cold bidistilled water twice to remove the remaining medium and then rinsed with 20ml of 10% glycerine. After that, the cells were re-suspended in 1 ml of 10% glycerine and used for transformation.
Transformation with the obtained linear fragment was performed by electroporation in 1 mm cuvettes at 2kV, 200Ohm, 25pF using the Gene Pulser Xcell (Bio-Rad, USA). The duration of the pulse was 4.9ms to 5.1 ms. After that, the cells were cultivated in a SOC medium for 2.5 hours in an incubator shaker at 30°C. Then the cells were poured into LB agar plates (Petri dishes) containing 10pg/ml of chloramphenicol. The cells were cultivated for 48 hours at 30°C. The picked-out clones were tested for survival in a selective medium containing yeastrel, peptone, 6% sucrose, and 10pg/ml of chloramphenicol. The genotype of the resulting strain is -recA rpsL (Strr) thr leu end A thi-1 lacY galK galT ara ton A tsx dam dcm supE44 A(lac-proAB) [F' traD36 proAB laclq ZAM15]CmR sacB+
Example 5.
Obtaining of Escherichia coli strain JM110-NAS/GDTT1.8NAS12 carrying gene therapy DNA vector GDTT1.8NAS12 and/or gene therapy DNA vectors containing therapeutic genes based on it for production of the gene.
To prepare electrocompetent cells of Escherichia coli strain JM110-NAS, a single colony was used to infect 10ml of LB broth, and the cells were cultured overnight in an orbital shaker at 150rpm and 37°C. On the following day, 1/20 was re-plated into 100ml of LB broth and cultured in an orbital shaker at 150rpm and 37°C to reach OD6OO=0-5. Upon reaching the required optical density, the cells were cooled down to 0°C and centrifuged for 10 minutes at 4000g. Then the medium was removed and the cells were rinsed with 100ml of ice- cold bidistilled water twice to remove the remaining medium and then rinsed with 20ml of 10% glycerine. After that, the cells were re suspended in 1 ml of 10% glycerine and used for transformation by electroporation. Electroporation was performed in 1 mm cuvettes at 2kV, 200Ohm, 25pF using the Gene Pulser Xcell (Bio-Rad, USA). The duration of the pulse was 4.9 to 5.1 ms, and 1-1 Ong of the vector was used. After that, the cells were cultivated in a SOC medium for 2.5 hours in an incubator shaker at 30°C. Then the cells were poured into agar plates (Petri dishes) with a selective medium containing yeastrel, peptone, 6% sucrose, and 10pg/nnl of chloramphenicol. Thus, Escherichia coli strain JM110-NAS/GDTT1.8NAS12 carrying gene therapy DNA vector GDTT1.8NAS12 was obtained. 48 hours later, a single colony was used to inoculate 10ml of liquid selective medium containing yeastrel, peptone, 6% sucrose, and 10pg/ml of chloramphenicol, and the medium was cultivated overnight in an orbital shaker at 150rpm and 37°C. On the following day, the cells were pelleted, and DNA vector was extracted by alkaline lysis using GeneJET Plasmid Miniprep Kit (Thermo Fisher Scientific) according to the manufacturer’s instructions.
Escherichia coli strain JM110-NAS/GDTT1.8NAS12 was deposited in the collection of the National Biological Resource Centre - Russian National Collection of Industrial Microorganisms (NBRC RNCIM, Russia) and NCIMB Patent Deposit Service (UK) (registration number VKPM-B-13234, date of deposit 21.08.2018; INTERNATIONAL DEPOSITARY AUTHORITY No. NCIMB 43119, date of deposit 19.07.2018).
Example 6.
Proof of DNA vector GDTT1.8NAS12 efficiency.
To prove the efficiency of gene therapy DNA vector GDTT1.8NAS12, a target gene, e.g. the gene encoding green fluorescent protein (GFP), was cloned to a polylinker as per Example 2.
Comparison of levels of accumulation of a therapeutic gene, e.g. the green fluorescent protein (GFP), in human osteosarcoma cells MG-63 (ATCC CRL-1427) 48 hours after cell transfection with plasmid vector pEFGP-C1 (Clontech) and gene therapy DNA vector GDTT 1.8NAS12-eGFP.
To evaluate the level of accumulation of the green fluorescent protein (GFP) in human osteosarcoma cells, the cells were transfected with plasmid vector pEFGP-C1 (Clontech) and gene therapy DNA vector GDTT1.8NAS12-eGFP was performed.
MG-63 cells were cultivated in the DMEM medium (Gibco) with 10% bovine embryo serum and 10pg/ml gentamycin added. To achieve 90% confluence, the cells were seeded into a 24-well plate in the quantity of 4x104 cells per well in 24 hours before the transfection procedure. Lipofectamine 3000 (ThermoFisher Scientific, USA) was used as a transfection reagent. In test tube 1.1 mI of the solution of plasmid vector pEFGP-C1 and gene therapy DNA vector GDTT1.8NAS12-eGFP (500ng/pl each) and 1 mI of reagent P3000 were added to 25mI of Opti-MEM medium (Gibco). The preparation was mixed by gentle shaking. In the test tube 2, 1 mI of solution Lipofectamine 3000 was added to 25mI of medium Opti-MEM (Gibco). The preparation was mixed by gentle shaking. The contents from test tube 1 were added to the contents of test tube 2, and the mixture was incubated at room temperature for 5 minutes. The resulting solution was added dropwise to the cells in the volume of 40mI.
The results were recorded 48 hours later using the Olympus ix53 fluorescence microscope (Japan) with a 485/535nm filter set (Fig. 3A). These results demonstrate that the transfection of HEK-293 cells with gene therapy DNA vector GDTT1.8NAS12-eGFP causes a significant increase in the accumulation of the green fluorescent protein as opposed with the transfection of the same cells with plasmid vector pEFGP-C1 (Clontech).
The results were recorded by measuring fluorescence of the protein extracted from the transfected cell line. For this purpose, the cells were rinsed from the well by pipetting and pelleted at 6000rpm for 10 minutes, rinsed twice, and then the packed cells were re suspended in 1 ml of sodium phosphate buffer. The cells were lysed in three freeze/thaw cycles at -70°C. Then the homogenate of lysed cells was pelleted at 13,000g for 15 minutes. Supernatants were transferred into a 96-well culture plate (Grainer Bio-one) in four replicates for each sample, and then relative fluorescence of GFP was measured (absorption 455nm / emission 538nm) using Fluoroskan Ascent Microplate Fluorometer (Labsystems). The resulting values were normalised according to the total protein concentration in the sample that was measured by the Bradford protein assay. For this purpose, Coomassie Brilliant Blue R-250 (BioRad) was used as a dye. Each replicate was diluted in the wells of the 96-well plate (4 replicates for each sample) with water by a factor of 100, and then the dye was added. After that, optical density of all samples was measured at 620nm using Multiskan Ascent (Thermo). The resulting values were compared with the calibration curve constructed for bovine serum albumin (Bio-Rad) with a series of sequential dilutions from 20 to 2.5pg/ml. Calculations were made using the following formula: åamount of protein (pg) = {[x]— s] ÷ k * M, where [x] is the mean value of OD620 of the four replicates for each sample, s - cpedHee omKnoHeHue, k is the slope coefficient of the calibration curve for BSA, M is the dilution factor of the sample.
Based on the values of the total concentration of protein extracted from the cells, GFP fluorescence in the samples was normalized using the following formula:
OEn = [ OE ] ÷ åamount of protein ( mg )
Where [OE] is the average of the four replicates for each sample, in relative fluorescence units.
The results are shown in Fig. 3B and demonstrate that the transfection of HEK-293 cells with gene therapy DNA vector GDTT1.8NAS12-eGFP increases the level of accumulation of the green fluorescent protein as opposed to the transfection of the same cells with plasmid vector pEFGP-C1 (Clontech).
Example 7.
Proof of DNA vector GDTT 1.8NAS12 efficiency.
To prove the efficiency of gene therapy DNA vector GDTT1.8NAS12, a therapeutic gene, e.g. the human glutathione peroxidase 1 (GPX1 ) gene, was cloned to a polylinker as per Example 3.
Changes in therapeutic gene mRNA accumulation, e.g. for glutathione peroxidase gene, in the primary culture cells of epidermal keratinocytes HEKa (PCS-200-011 ) 48 hours after transfection with the gene therapy DNA vector GDTT1.8NAS12-GPX1 carrying a human glutathione peroxidase 1 gene site.
Primary culture cells of epidermal keratinocytes HEKa were cultivated in the Dermal Cell Basal Medium (ATCC PCS-200-030) using Keratinocyte Growth Kit (ATCC PCS-200-040).
To achieve 90% confluence, 24 hours before the transfection procedure, the cells were seeded into a 24-well plate in the quantity of 5*104 cells per well. Lipofectamine 3000 (ThermoFisher Scientific, USA) was used as a transfection reagent. The transfection with gene therapy DNA vector GDTT1.8NAS12-GPX1 carrying human glutathione peroxidase 1 gene was performed as described in Example 6. HEKa cells transfected with gene therapy DNA vector GDTT1.8NAS12 were used as a reference. Extraction of total RNA from the transfected cells and construction of the first cDNA strand was performed according to the procedure described in Example 3. To measure the level of mRNA expression in glutathione peroxidase 1 gene after transfection, real-time PCR (SYBR Green Real Time PCR) method was used. For the amplification of human GPX1 -specific cDNA, GPX1-sf and GPX1-sR oligonucleotides were used (List of Sequences, (34), (35)). The length of amplification product is 241 bp. Beta-2 microglobulin (B2M) was used as a reference gene.
PCR amplification was performed using QuantiTect SYBR Green RT-PCR Kit (Qiagen, USA) or another real-time PCR kit in 20mI of the amplification mixture containing: 25mI of QuantiTect SYBR Green RT- PCR Master Mix, 2.5mM of magnesium chloride, 0.5mM of each primer, and 5mI of total RNA. For the reaction, CFX96 amplifier (Bio- Rad, USA) was used under the following conditions: 1 cycle of reverse transcription at 42°C for 30 minutes, denaturation at 98°C for 15 minutes followed by 40 cycles comprising denaturation at 94°C for 15s, annealing of primers at 60°C for 30s and elongation at 72°C for 30s. Positive control included amplicons from PCR on matrices represented by plasmids in known concentrations containing cDNA sequences of human glutathione peroxidase 1 and B2M genes. Negative control included deionised water. Real-time quantification of the PCR products, i.e. GPX-1 and B2M gene cDNA obtained by amplification, was conducted using the Bio-Rad CFX Manager 2.1 software.
To confirm increased expression of glutathione peroxidase 1 gene in the primary culture cells of epidermal keratinocytes HEKa after transfection with the gene therapy DNA vector GDTT1.8NAS12- GPX1 carrying a human glutathione peroxidase 1 gene site, the Fig. 4 shows PCR product accumulation diagrams.
The figure shows that transfection with gene therapy DNA vector GDTT1.8NAS12-GPX1 carrying a therapeutic gene, e.g. the human glutathione peroxidase 1 gene, causes the level of human glutathione peroxidase 1 gene-specific cDNA to rise massively.
Example 8.
Proof of DNA vector GDTT1.8NAS12 efficiency
To prove the efficiency of gene therapy DNA vector GDTT1.8NAS12, a therapeutic gene, e.g. the glutathione peroxidase 1 gene, was cloned to a polylinker as per Example 3.
Measurements were made of the changes in the concentration of the glutathione peroxidase 1 protein in human skin upon injection of gene therapy DNA vector GDTT1.8NAS12-GPX1 carrying a therapeutic gene, e.g. the human glutathione peroxidase 1 gene, into human skin.
To analyse changes in the concentration of the glutathione peroxidase 1 protein, gene therapy DNA vector GDTT1.8NAS12- GPX1 carrying a region encoding the glutathione peroxidase 1 gene was injected into the forearm skin of three patients, with concurrent introduction of a placebo being gene therapy DNA vector GDTT1.8NAS12 without the glutathione peroxidase 1 gene cDNA. Patient 1 , woman, 66 y.o. (P1 ); Patient 2, woman, 65 y.o. (P2); Patient 3, man, 59 y.o. (P3).
Gene therapy DNA vector GDTT1.8NAS12 (placebo) and gene therapy DNA vector GDTT1.8NAS12-GPX1 carrying a region of glutathione peroxidase 1 gene were injected in the quantity of 1 mg for each genetic construct by the tunnel method with a 30G needle to the depth of 3mm. The injected volume of gene therapy DNA vector GDTT1.8NAS12 (placebo) and gene therapy DNA vector GDTT1.8NAS12-GPX1 carrying a region of glutathione peroxidase 1 gene was 1-0.3ml for each genetic construct. The points of introduction of each of the genetic constructs were located at 8-10cm from each other.
The biopsy samples were taken on the 2nd day after the injection of the gene therapy DNA vectors. The biopsy samples were taken from the patients’ skin in the area of the introduction of gene therapy DNA vector GDTT1.8NAS12-GPX1 carrying a region encoding the glutathione peroxidase 1 gene (I), gene therapy DNA vector GDTT1.8NAS12 (placebo) (II), and from intact skin (III), using the skin biopsy device Epitheasy 3.5 (Medax SRL). The skin of the patients was preliminarily rinsed with sterile saline and anaesthetised with a lidocaine solution. The biopsy sample volume was ca. 10mm3, and the weight was ca. 15mg. The sample was placed in a buffer solution containing 50mM of Tris-HCI, pH 7.6, 100mM of NaCI, 1 mM of EDTA, and 1 mM of phenylmethylsulfonyl fluoride and homogenised to obtain a homogenised suspension. The resulting suspension was then centrifuged for 10 minutes at 14,000g. Supernatant was collected and used to assay the therapeutic protein by enzyme-linked immunosorbent assay (ELISA) using the ELISA Kit for Glutathione Peroxidase 1 (GPX1 ) (Cloud-Clone Corp., USA) according to the manufacturer’s method with optical density detection using ChemWell Automated EIA and Chemistry Analyser (Awareness Technology Inc., USA).
Concentration was quantified by a calibration curve plotted using the reference samples from the kit with known concentrations of glutathione peroxidase 1 protein was used. The method sensitivity is 5.2ng/ml, measurement range is 12.5-200ng/ml. Diagrams resulting from the assay are shown in Figure 5. The skin of each of the three patients demonstrates an increased concentration of the glutathione peroxidase 1 protein in the area of introduction of gene therapy DNA vector GDTT1.8NAS12 carrying a therapeutic gene, e.g. the human glutathione peroxidase 1 gene, compared to the concentration of the glutathione peroxidase 1 protein in the area of introduction of gene therapy DNA vector GDTT1.8NAS12 (placebo) devoid of the region of the human glutathione peroxidase 1 gene.
Example 9.
Proof of DNA vector GDTT1.8NAS12 efficiency.
To prove the efficiency of gene therapy DNA vector GDTT1.8NAS12, a target gene, e.g. the gene encoding green fluorescent protein (GFP), was cloned to a polylinker as per Example 2.
The levels of accumulation of a target gene, e.g. the green fluorescent protein (GFP), in primary culture cells of bovine endometrial epithelium (BEnEpC, CellApplications, Inc.) in 48 hours after cell transfection with gene therapy DNA vector GDTT1.8NAS12- eGFP were compared.
To quantify the level of accumulation of the green fluorescent protein (GFP) in primary culture cells of bovine endometrial epithelium, the cells were transfected with gene therapy DNA vector GDTT1.8NAS12-eGFP.
The cells were cultivated with the use of Bovine Endometrial Cell Growth Media Kit (CellApplications, Inc.) as per manufacturer’s instructions. To achieve 90% confluence, 24 hours before the transfection procedure, the cells were seeded into a 24-well plate in the quantity of 3x104 cells per well. Lipofectamine 3000 (ThermoFisher Scientific, USA) was used as a transfection reagent. Transfection was performed according to the procedure described in Example 6. Gene therapy DNA vector GDTT1.8NAS12 free of the green fluorescent protein gene was used as a reference. The results were recorded by measuring fluorescence of the protein extracted from the transfected cell line, as described in Example 6.
The results are shown in Figure 6 and allow us to conclude that the transfection of the primary cell line of bovine endometrial epithelium with gene therapy DNA vector GDTT1.8NAS12-eGFP carrying the green fluorescent protein gene leads to a higher level of accumulation of the green fluorescent protein comparing with the transfection of the same cells with gene therapy vector GDTT1.8NAS12 devoid of the green fluorescent protein gene.
Example 10.
To confirm the producibility and constructability of gene therapy DNA vector GDTT1.8NAS12 and/or gene therapy DNA vectors carrying therapeutic genes based on it, a large-scale fermentation of Escherichia coli strain JM110-NAS/GDTT 1.8NAS12 was performed.
Fermentation of Escherichia coli strain JM110- NAS/GDTT1.8NAS12 carrying gene therapy DNA vector GDTT1.8NAS12 was performed in a 101 fermenter with subsequent extraction of gene therapy DNA vector GDTT1.8NAS12.
For the fermentation of Escherichia coli strain JM110-
NAS/GDTT1.8NAS12, a medium was prepared containing per 101: 100g of tryptone, 50g of yeastrel (Becton Dickinson), then the medium was diluted with water to 8,800 ml and autoclaved at 121 °C for 20 minutes, and then 1 ,200ml of 50% (w/v) sucrose was added. After that, the seed culture of Escherichia coli strain JM110- NAS/GDTT1.8NAS12 was inoculated into a culture flask in the volume of 100ml. The culture was incubated in an incubator shaker for 16 hours at 30°C. The seed culture was transferred to the Techfors S bioreactor (Infors HT, Switzerland) and grown to a stationary phase. The process was controlled by measuring optical density of the culture at 600nm. The cells were pelleted for 30 minutes at 5,000-10,000g. Supernatant was removed, and the cell pellet was re-suspended in 10 vol % phosphate buffered saline. The cells were centrifuged again for 30 minutes at 5,000-10,000g. Supernatant was removed, a solution of 20mM TrisCI, 1 mM EDTA, 200g/l sucrose, pH 8.0, was added to the cell pellet in the volume of 1 ,000ml, and the mixture was stirred thoroughly to a homogenised suspension. Then egg lysozyme solution was added to the final concentration of lOOpg/ml. The mixture was incubated for 20 minutes on ice while stirring gently. Then 2,500ml of 0.2M NaOH, 10g/I sodium dodecyl sulphate (SDS) was added, the mixture was incubated for 10 minutes on ice while stirring gently, then 3,500ml of 3M sodium acetate, 2M acetic acid, pH 5-5.5 was added, and the mixture was incubated for 10 minutes on ice while stirring gently. The resulting sample was centrifuged for 20-30 minutes at 15,000g or a greater value. The solution was decanted delicately, and residual precipitate was removed by passing through a coarse filter (filter paper). Then RNase A (Sigma) was added to the final concentration of 20pg/ml, and the solution was incubated overnight for 16 hours at room temperature. The solution was then centrifuged for 20- 30 minutes at 15,000g and passed through a 0.45pm membrane filter (Millipore). Then ultrafiltration was performed with a membrane of 100kDa (Millipore) and the mixture was diluted to the initial volume with a buffer solution of 25mM TrisCI, pH 7.0. This manipulation was performed three to four times. The solution was applied to the column with 250ml of DEAE Sepharose HP (GE, USA), equilibrated with 25mM TrisCI, pH 7.0. After the application of the sample, the column was washed with three volumes of the same solution, and then gene therapy DNA vector GDTT1-8NAS12 was eluted using a linear gradient of 25mM Tris-HCI, pH 7.0, to obtain a solution of 25mM Tris- HCI, pH 7.0, 1 M NaCI, five times the volume of the column. The elution process was controlled by measuring optical density of the run-off solution at 260nm. Chromatographic fractions containing gene therapy DNA vector GDTT1.8NAS12 were joined together and subjected to gel filtration by Superdex 200 sorbent (GE, USA). The column was equilibrated with phosphate buffered saline. The elution process was controlled by measuring optical density of the run-off solution at 260nm, and the fractions were analysed by agarose gel electrophoresis. Fractions containing gene therapy DNA vector GDTT1.8NAS12 were joined and stored at -20°C. These process operations were repeated three times to evaluate the process reproducibility. The process reproducibility and quantitative characteristics of final product yield confirm the producibility and constructability of gene therapy DNA vector GDTT1.8NAS12, and/or gene therapy DNA vectors carrying therapeutic genes based on it, on an industrial scale.
Therefore, the purpose of this invention, specifically the construction of a multipurpose gene therapy DNA vector for genetic modification of human and animal cells that would reasonably combine:
I) Efficiency of the gene therapy DNA vector in enhancing expression level of therapeutic genes in various human and animal tissue cells due to limited length not exceeding 2600 bp, namely 2591 bp, ensuring efficient penetration into a target cell and availability of regulatory element sequences ensuring high expression of therapeutic genes in the most human and animal tissue cells.
II) Possibility of safe use in gene therapy of human beings and animals due to the absence of regulatory elements representing the nucleotide sequences of viral genomes in the gene therapy DNA vector.
III) Possibility of safe use in the gene therapy of human beings and animals due to the absence of antibiotic resistance genes in the gene therapy DNA vector.
IV) Producibility and constructability of gene therapy DNA vector and/or gene therapy DNA vectors carrying therapeutic genes based on it, on an industrial scale
has been achieved, which is supported by the following examples: 1 , 6, 7, 8, 9 for Item (I); Example 1 for Item (II); Example 1 for Item (III); Examples 4, 5, 10 for Item (IV).
Industrial Applicability All examples listed above prove industrial applicability of the proposed gene therapy DNA vector GDTT1.8NAS12, method for obtaining thereof, Escherichia coli strain JM110-NAS for production of DNA vector GDTT1.8NAS12, method of obtaining of Escherichia coli strain JM110-NAS, Escherichia coli strain JM1 IQ- NAS/GDTT1.8NAS12 including gene therapy DNA vector GDTT1.8NAS12 for their production, method of obtaining of Escherichia coli strain JM110-NAS/GDTT1.8NAS12, and method of industrial-scale production of the gene therapy DNA vector. List of Abbreviations
GDTT1.8NAS12 is a gene therapy vector devoid of sequences of viral genomes and antibiotic resistance markers
DNA - Deoxyribonucleic acid
cDNA - Complementary deoxyribonucleic acid
RNA - Ribonucleic acid
mRNA - Messenger ribonucleic acid
bp - base pair
PCR - Polymerase chain reaction
ml - millilitre, pi - microliter
I - litre
pg - microgram
mg - milligram
g - gram
mM - micromol
mM - millimol
min - minute
s - second
rpm - rotations per minute
nm - nanometre
cm - centimetre
mW - milliwatt
RFU - Relative fluorescence unit
PBS - Phosphate buffered saline

Claims

1. Gene therapy DNA vector GDTT1.8NAS12 in the form of a 2591 -bp circular double-strand DNA molecule containing nucleotide sequence SEQ ID No. 1 , capable of autonomous replication in Escherichia coli cells and consisting of the following structural elements: promoter region of EF1A human elongation factor with its own enhancer contained in the first intron of the gene, a polylinker containing a sequence of BamHI, EcoRV, Sail, Kpnl, EcoRI, Xbal, and Notl restriction sites and designed for cloning of therapeutic therapy genes, RNA-out regulatory element of transposon Tn10, enabling antibiotic-free positive selection for Escherichia coli strain JM 110-NAS; the origin of replication for autonomous replication of a gene therapy DNA vector with a single nucleotide substitution to increase plasmid production in the cells of most Escherichia coli strains.
2. Method of obtaining of the 2591 -bp gene therapy DNA vector GDTT1.8NAS12 as per Claim 1 involving initial construction of a 2408-bp intermediate vector containing a 688-bp replication origin, a
467-bp transcription terminator hGH-TA, a 137-bp regulatory site RNA-out of transposon Tn10, a 1018-bp kanamycin resistance gene, and a 68-bp polylinker, further vector splitting using Sail and BamHI restriction endonucleases and ligation with promoter/regulator site containing the promoter region of human elongation factor EF1A with its own 1219-bp enhancer, and cleaving of the kanamycin resistance gene by Spel restriction sites.
3. The method of obtaining Escherichia coli strain JM110-NAS for the production of gene therapy DNA vector GDTT1.8NAS12 as per Claim 1 involving constructing a linear DNA fragment containing a regulatory element RNA-in of Tn10 transposon allowing for antibiotic- free positive selection (64 bp), levansucrase gene sacB, the product of which ensures selection within a sucrose-containing medium (1422 bp), chloramphenicol resistance gene catR required to pick strain clones where homologous recombination occurred (763 bp), and two homologous sequences (329 bp and 233 bp) ensuring homologous recombination in the region of gene recA concurrent with gene inactivation, where the said homologous sequences are obtained by PCR amplification of gene recA fragment using genome DNA of Escherichia coli JM110-NAS as a matrix, and a couple of LHA-F (5’- GCTGACGCTGCAGGTGATC) and LHA-R (5’-
GACAAGATGTGTGTCTACCGCTTCAGGTTACCCGCCAG) primers, and a couple of RHA-F (5’-
TGGCAGGGCGGGGCGTAACTACGCCTCTGTTCGTCTCGA) and RHA-R (5’-CT C AGCAGC AACT CACGT AC) primers, and then the Escherichia coli cells are transformed by electroporation, and clones surviving in a medium containing 10pg/nnl of chloramphenicol are selected.
4. Escherichia coli strain JM110-NAS obtained via the method described in Claim 3 for production of gene therapy DNA vector GDTT1.8NAS12 allowing for possible antibiotic-free positive selection and containing a linear fragment consisting of regulator element RNA-in of transposon Tn10, levansucrase gene sacB, and chloramphenicol resistance gene catR in the chromosome in recA gene region.
5. The method of obtaining Escherichia coli strain JM110- NAS/GDTT1.8NAS12 carrying gene therapy DNA vector GDTT1.8NAS12 as per Claim 1 involving making electrocompetent cells of Escherichia coli strain JM110-NAS as per Claim 3 and subjecting these cells to electroporation with gene therapy DNA vector GDTT1.8NAS12. After that, the cells are poured into agar plates (Petri dishes) with a selective medium containing yeastrel, peptone, 6% sucrose, and 10pg/ml of chloramphenicol.
6. Escherichia coli strain JM110-NAS/GDTT1.8NAS12 obtained as per Claim 5, carrying gene therapy DNA vector
GDTT1.8NAS12 for production of gene therapy DNA vector
GDTT1.8NAS12 allowing for antibiotic-free selection.
7. The method of gene therapy DNA vector production on an industrial scale as per Claim 1 that involves scaling-up the bacterial culture of the strain as per Claim 6 to the quantities necessary for increasing the bacterial biomass in an industrial fermenter, after which the biomass is used to extract a fraction containing the therapeutic DNA product, i.e. the gene therapy DNA vector GDTT1.8NAS12 as per Claim 1 , and then multi-stage filtered, and purified by chromatographic methods.
PCT/RU2019/000525 2018-09-04 2019-07-26 The gene therapy dna vector gdtt1.8nas12 and the method for obtaining thereof WO2020050742A1 (en)

Priority Applications (3)

Application Number Priority Date Filing Date Title
CN201980072473.3A CN113166771A (en) 2018-09-04 2019-07-26 Gene therapy DNA vector GDTT1.8NAS12 and method for obtaining the same
US17/273,035 US11203760B2 (en) 2018-09-04 2019-07-26 Gene therapy DNA vector GDTT1.8NAS12 and the method for obtaining thereof
EP19858416.1A EP3847252A4 (en) 2018-09-04 2019-07-26 The gene therapy dna vector gdtt1.8nas12 and the method for obtaining thereof

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
RU2018131705 2018-09-04
RU2018131705A RU2712838C1 (en) 2018-09-04 2018-09-04 Gene-therapeutic dna-vector gdtt1.8nas12, method for its preparation, escherichia coli jm110-nas strain, a method for its preparation, escherichia coli jm110-nas/gdtt1.8nas12 strain, carrying a gene-therapeutic dna-vector gdtt1.8nas12, a method for production thereof, a method for industrial production of a gene-therapeutic dna vector

Publications (1)

Publication Number Publication Date
WO2020050742A1 true WO2020050742A1 (en) 2020-03-12

Family

ID=69625146

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/RU2019/000525 WO2020050742A1 (en) 2018-09-04 2019-07-26 The gene therapy dna vector gdtt1.8nas12 and the method for obtaining thereof

Country Status (5)

Country Link
US (1) US11203760B2 (en)
EP (1) EP3847252A4 (en)
CN (1) CN113166771A (en)
RU (1) RU2712838C1 (en)
WO (1) WO2020050742A1 (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
RU2759227C2 (en) * 2020-04-10 2021-11-11 Генетик Диагностикс Энд Терапи 21 Лтд Dna vaccine against sars-cov-2 virus based on gene therapy dna vector gdtt1.8nas12, method for its preparation, strains carrying gene-therapy dna vectors, method for their preparation, method for production on industrial scale of gene-therapy dna vectors

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6573100B1 (en) * 1994-08-11 2003-06-03 Roche Diagnostics Gmbh DNA vectors without a selection marker gene

Family Cites Families (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
SE0102204D0 (en) * 2001-06-21 2001-06-21 Leif Isaksson New method
CN100532544C (en) * 2006-06-12 2009-08-26 山东省医药生物技术研究中心 Retrovirus encapsulated cell line and liver cell targeted introduction method
RU2408607C2 (en) * 2008-12-25 2011-01-10 ООО "ДжинАрт" Method for directed delivery of dna into tumor and stem cells
PL2432884T3 (en) * 2009-05-22 2017-01-31 Merial, Inc. Antibiotic-free plasmid
US9550998B2 (en) * 2012-08-29 2017-01-24 Nature Technology Corporation DNA plasmids with improved expression
RU2678756C1 (en) * 2017-08-25 2019-01-31 Селл энд Джин Терапи Лтд Vtvaf17 gene-therapy dna vector, method for producing thereof, escherichia coli scs110-af strain, method for producing thereof, escherichia coli scs110-af/vtvaf17 strain, bearing vtvaf17 gene-therapy dna vector, method for producing thereof

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6573100B1 (en) * 1994-08-11 2003-06-03 Roche Diagnostics Gmbh DNA vectors without a selection marker gene

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
BORJA GHEORGE M. ET AL.: "Engineering Escherichia coli to increase plasmid DNA production in high cell -density cultivations in batch mode", MICROBIAL CELL FACTORIES, vol. 11, no. 132, 2012, pages 1 - 9, XP021121347 *
NIEROP GIJSBERT P. ET AL.: "Stimulation of homology-directed gene targeting at an endogenous human locus by a nicking endonuclease", NUCLEIC ACIDS RESEARCH, vol. 37, no. 17, 2009, pages 5725 - 5736, XP055692676 *
See also references of EP3847252A4 *

Also Published As

Publication number Publication date
RU2712838C1 (en) 2020-01-31
EP3847252A1 (en) 2021-07-14
US20210310011A1 (en) 2021-10-07
EP3847252A4 (en) 2022-08-03
US11203760B2 (en) 2021-12-21
CN113166771A (en) 2021-07-23

Similar Documents

Publication Publication Date Title
EP3673061B1 (en) Gene therapy dna vector vtvaf17, method of production; escherichia coli strain scs110-af, method of production; escherichia coli strain scs110-af/vtvaf17 bearing gene therapy dna vector vtvaf17, method of production
CN109072207A (en) Improved method for modifying target nucleic acid
JP5374584B2 (en) Improved protein expression system
US20230287439A1 (en) Pathway integration and expression in host cells
TWI408228B (en) Nucleic acid construct, recombinant vector and method for producing a target protein
CN102703424B (en) A kind of method of genome of E.coli point mutation of recombined engineering mediation
JP2020535805A (en) Non-integrated DNA vector for gene modification of cells
WO2012126367A1 (en) Nitrogen fixation gene island suitable for expressing in prokaryotic and eukaryotic systems
CN112941107B (en) Gene editing application of prokaryotic Argonaute protein
CA3233336A1 (en) Circular rna and preparation method thereof
Kim et al. mCherry protein as an in vivo quantitative reporter of gene expression in the chloroplast of Chlamydomonas reinhardtii
US11203760B2 (en) Gene therapy DNA vector GDTT1.8NAS12 and the method for obtaining thereof
KR101765255B1 (en) Method for Preparing Recombinant Proteins Through Reduced Expression of rnpA
CN111051509A (en) Composition for dielectric calibration containing C2CL endonuclease and method for dielectric calibration using the same
WO2021206587A1 (en) Sars-cov-2 dna vaccine based on gene therapy dna vector gdtt1.8nas12
WO2020139152A1 (en) Gene therapy dna vector and its application
US20210308282A1 (en) Gene therapy dna vectors based on vtvaf17
US20180179548A1 (en) Molecular biology tools for algal engineering
US20220008556A1 (en) Dna vector for targeted gene therapy
WO2020139151A1 (en) Gene therapy dna vector based on gene therapy dna vector vtvaf17
Piliang et al. Transformation and cloning of dengue virus’s rE gene using pEGFP-C1 as vector in Escherichia coli DH5α
RU2730663C2 (en) Gene-therapeutic dna-vector based on gene-therapeutic dna-vector vtvaf17, carrying target gene cas9 for heterologous expression of this target gene in human and animal cells in implementing various methods of genomic editing, method of producing and using gene-therapeutic dna vector, escherichia coli scs110-af/vtvaf17-cas9 strain, carrying gene-therapeutic dna vector, method for preparing thereof, method for production on industrial scale of gene-therapeutic dna vector
RU2793971C1 (en) Dna vector gdtt1.8nas12-angpt1 to increase the expression level of the target angpt1 gene, the method for its preparation and application
WO2020153871A1 (en) Gene therapy dna vector
RU2774352C2 (en) Dna vector gdtt1.8nas12-ang for increasing level of expression of target gene ang in human and animal organism, its application method

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 19858416

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2019858416

Country of ref document: EP

Effective date: 20210406