WO2020153871A1

WO2020153871A1 - Gene therapy dna vector

Info

Publication number: WO2020153871A1
Application number: PCT/RU2019/000995
Authority: WO
Inventors: Natalia SAVELIEVA
Original assignee: Cell End Gene Therapy Ltd; Obschestvo S Ogranichennoi Otvetstvennostju "Proryvnye Innovatsionnye Tekhnologii"
Priority date: 2019-01-25
Filing date: 2019-12-23
Publication date: 2020-07-30
Also published as: RU2715314C1

Abstract

The invention is related to genetic engineering and can be used in biotechnology, medical science and agriculture to create plant varieties, including transgenic ones. The invention is a gene therapy DNA vector VTvafl7-Actl-Cas9 based on the gene therapy DNA vector VTvaflV carrying the Cas9 therapeutic gene for the heterologous expression of this therapeutic gene in the plant cells during the editing of plant genomes, while the gene therapy DNA vector VTvafl7-Actl-Cas9 has the nucleotide sequence SEQ ID No. 1. The invention can be used in editing of plant genomes in the plant cells.

Description

GENE THERAPY DNA VECTOR

Field of the Invention

The invention refers to genetic engineering and can be used in biotechnology, medicine, and agriculture to create the varieties of plants, including transgenic, producers of various substances based on plant cells, tissues, or organisms.

Background of the Invention

Gene therapy is an innovative approach aimed at changing inherited and acquired properties by means of delivery of new genetic material into organism cells to compensate for or suppress the function of a mutant gene and/or treat a genetic disorder and/or change the phenotype directly by inserting new and/or changing the existing genetic material. Thus, despite its widespread association with humans, the term“gene therapy” is not limited to the selection of target and can refer to any type of living organism, including plants. The final product of gene expression may be an RNA molecule or a protein molecule. However, most physiological processes in the body are associated with the functional activity of protein molecules, while RNA molecules are either an intermediate product in the synthesis of proteins or perform regulatory functions. Thus, the objective of gene therapy in most cases is to inject the organism with genes that provide transcription followed by translation of protein molecules encoded by these genes. Within the description of the invention, gene expression refers to the production of a protein molecule with amino acid sequence encoded by this gene. Mutations in genes can result in complete or partial loss of protein expression, or expression of variants of protein molecules that have adverse functional activity. Injection of gene therapy vectors into the body that encode a particular gene can provide the expression of therapeutic proteins. However, this approach is compensatory and not aimed at correcting genetic defects. Following the discovery of directed (targeted) editing of nucleotide sequences, the implementation of therapeutic genome editing approach that aims to correct mutations in the DNA sequence or insertion of new DNA sequences into specific genome regions that also constitutes targeted gene therapy was made possible by injecting various nucleases with specific properties (e.g. Cas9) into gene therapy vectors. In this case, the function is restored by correcting genetic defects or conferring new properties by inserting new genetic material.

Currently, plants and plant cell cultures are used for landscaping various territories, food production, products for biologically active substances, biotechnological and pharmaceutical substances, food stuff, biofuels, etc. The purposes of plant gene therapy include, inter alia, changes in plants appearance, metabolic activity, ability to produce or accumulate certain substances, resistance to adverse effects, including pathogens and pests, and modulation of biotechnological properties (Paolis A et al, 2019). The range of applications of plant organisms and cell cultures is constantly expanding. E.g. in biomedicine, the area of development of “edible vaccines” based on the use of plant substances expressing certain transgenic proteins as antigenic material used per os for immunisation has recently emerged (Kong Q. et al., 2002). Targeted gene therapy of plants is a tool that enables efficient solution of said tasks. The Cas9 gene encodes the CAS9 nuclease protein. The CRISPR/Cas9 system was originally discovered as a component of the bacterial immune system, which enables bacterial cells to targetedly remove the nucleotide sequences of bacteriophage. Since this system has a certain universality of the action principle, it is widely used in biomedical and biotechnological researches. Currently, the CRISPR/Cas9 system is widely used within scientific studies for genome editing in eukaryotic cultures of cells, tissues, or whole organisms and has the capacity to design drugs and methods for gene therapy. The operating principle of this system is that the CAS9 endonuclease with the help of gRNA complementary to a specific sequence in the genome cleaves the DNA chain. The DNA integrity in the breakpoints is then restored using cellular repair systems that can use a homologous DNA strand containing the therapeutic nucleotide sequence as a matrix for recovery or repair the breaks through the direct connection of adjacent nucleotides without repairing the excised DNA region. Construction of gRNA is performed in such a way that this molecule is complementary to the DNA region that contains the given mutation, or the insertion of new genetic material is planned, which allows for restoration of the DNA integrity in a specific focalised way using CAS9 nuclease that targetedly cuts out of that particular region, which determines the capacity of this mechanism of action in the correction of genetic material, i.e. genome editing.

Nevertheless, one of the main problems of using the CRISPR/Cas9 system for genome editing is the problem of delivering the endonuclease and gRNA complex to the cell nucleus and, in general, pharmacokinetic problems that limit the penetrating capability of molecules into various organs and tissues or require extremely high concentrations and use of special compositions that allow for cell penetration. The use of gene vectors for the heterologous expression of Cas9 gene helps to overcome these limitations. The most studied vectors in this field are lentiviral, adenoviral, adeno-associated, and other virus-related vectors.

The risk of non-specific endonuclease action is another problem of the usage of CRISPR/Cas9 system. In this context, the use of vectors that do not integrate into the genome and provide only transient gene expression is potentially safer than, for example, the use of lentiviral and adeno-associated vectors. However, the use of any viral vectors for the delivery of particular sequences to the organism is limited by the tropism of pseudoviral particles to various tissues, which does not always allow for efficient penetration into target cells and organs. Also, the potential for using any viral vectors is limited, including their structural properties, preexisting resistance, and risks associated with gene therapy virus- related vectors in general.

Thus, the background of the invention indicates that there is a need to develop effective and safe gene therapy approaches for delivering Cas9 to target cells, organs, and tissues of the plant body.

It is known that gene therapy vectors are divided into viral, cell, and DNA vectors (Guideline on the quality, non-clinical, and clinical aspects of gene therapy medicinal Products EMA/CAT/80183/2014). Recently, gene therapy has paid increasingly more attention to the development of non-viral gene delivery systems with plasmid vectors topping the list. Plasmid vectors are free of limitations inherent in cell and viral vectors. In the target cell, they exist as an episome without being integrated into the genome, while producing them is quite cheap, which makes them a convenient tool for gene therapy (Li L, Petrovsky N. // Expert Rev Vaccines. 2016; 15(3):313—29).

However, limitations of plasmid vectors use in gene therapy are: 1) presence of antibiotic resistance genes for the production of constructs in bacterial strains; 2) the presence of various regulatory elements represented by sequences of viral genomes; 3) length of therapeutic plasmid vector that determines the efficiency of vector delivery to the target cell.

It is known that the European Medicines Agency deems it necessary to refrain from adding antibiotic resistance marker genes to newly engineered plasmid vectors for gene therapy (Reflection paper on design modifications of gene therapy medicinal products during development / 14 December 2011 EMA/CAT/GTWP/44236/2009 Committee for advanced therapies). This recommendation is primarily related to the potential danger of the DNA vector penetration or horizontal antibiotic resistance gene transfer into the cells of bacteria. Furthermore, the presence of antibiotic resistance genes significantly increases the length of DNA vector, which reduces the efficiency of its penetration into eukaryotic cells.

It is important to note that antibiotic resistance genes also make a fundamental contribution to the method of production of DNA vectors. If antibiotic resistance genes are present, strains for the production of DNA vectors are usually cultured in medium containing a selective antibiotic, which poses risk of antibiotic traces in insufficiently purified DNA vector preparations. Thus, production of DNA vectors for gene therapy without antibiotic resistance genes is associated with the production of strains with such distinctive feature as the ability for stable amplification of therapeutic DNA vectors in the antibiotic-ffee medium.

In addition, the European Medicines Agency recommends avoiding the presence of regulatory elements in therapeutic plasmid vectors to increase the expression level of therapeutic genes (promoters, enhancers, post-translational regulatory elements) that constitute nucleotide sequences of genomes of various viruses (Draft Guideline on the quality, non-clinical and clinical aspects of gene therapy medicinal products, http://www.ema.europa.eu/docs/en_GB/document_library/Scientific_guid eline/2015/05/WC500187020.pdf). Although these sequences can increase the expression level of the therapeutic transgene, however, they pose risk of recombination with the genetic material of wild-type viruses and integration into the eukaryotic genome. Moreover, the relevance of overexpression of the particular gene for therapy remains an unresolved issue.

The size of the therapy vector is also essential. It is known that modern plasmid vectors often have unnecessary, non-functional regions that increase their length substantially (Mairhofer J, Grabherr R. // Mol Biotechnol. 2008.39(2):97- 104). For example, ampicillin resistance gene in pBR322 series vectors, as a rule, consists of at least 1000 bp, which is more than 20% of the length of the vector itself. At the same time, a reverse relationship between the vector length and its ability to penetrate into eukaryotic cells is observed; DNA vectors with a small length effectively penetrate into cells. For example, in a series of experiments on transfection of HeLa cells with 383—4548 bp DNA vectors it was shown that the difference in penetration efficiency can be up to two orders of magnitude (100 times different) (Homstein BD et al. // PLoS ONE. 2016;11(12): e0167537.).

Thus, when selecting a DNA vector, for reasons of safety and maximum effectiveness, preference should be given to those constructs that do not contain antibiotic resistance genes, the sequences of viral origin and length of which allows for the effective penetration into eukaryotic cells. A strain for production of such DNA vector in quantities sufficient for the purposes of gene therapy should ensure the possibility of stable DNA vector amplification using antibiotic-free nutrient media.

Example of usage of the recombinant DNA vectors for gene therapy is the method of producing a recombinant vector for genetic immunisation (Patent No. US 9550998 B2. The plasmid vector is a supercoiled plasmid DNA vector that is used for the expression of cloned genes in human and animal cells. The vector contains an origin of replication, regulatory elements comprising human cytomegalovirus promoter and enhancer, and regulatory sequences from the human T-cell lymphotropic virus.

The vector is accumulated in a dedicated E. coli strain free of antibiotics through antisense complementation of sacB gene inserted into the strain by means of bacteriophage. The disadvantage of this invention is the presence of regulatory elements in the composition of DNA vector that constitute sequences of viral genomes. However, this invention does not provide the applicability in gene therapy of plants.

The following patents are prototypes of this invention with regard to the use of gene therapy approaches for the Cas9 expression in eukaryotic plant cells.

Patent No.CN103981216B describes a plasmid vector expressing the Cas9 gene and containing regulatory elements that allow for the Cas9 gene expression in plant cells. The disadvantage of this invention is the presence of antibiotic resistance genes in the vector.

Disclosure of the Invention

The purpose of this invention is to construct gene therapy DNA vector for the heterologous expression of Cas9 gene in plant cells, combining the following properties:

I) Efficiency of gene therapy DNA vector for the heterologous expression of therapeutic genes in eukaryotic cells.

II) The possibility of safe use for the implementation of various methods of editing of plant genomes, including in the gene therapy due to the lack of regulatory elements in the gene therapy DNA vector that constitute the nucleotide sequences of viral genomes. III) The possibility of safe use for the implementation of various methods of editing of plant genomes, including in the gene therapy due to the lack of antibiotic resistance genes in the gene therapy DNA vector.

IV) Producibility and constructability of gene therapy DNA vector on an industrial scale.

Item II and III are provided for herein in line with the recommendations of regulatory authorities for gene therapy products and, specifically, the requirement of the European Medicines Agency to refrain from adding antibiotic resistance marker genes to newly engineered plasmid vectors for gene therapy (Reflection paper on design modifications of gene therapy medicinal products during development / 14 December 2011 EMA/CAT/GTWP/44236/2009 Committee for advanced therapies) and refrain from adding viral genomes to newly engineered plasmid vectors for gene therapy (Guideline on the quality, non-clinical and clinical aspects of gene therapy medicinal products / 23 March 2015,

EMA/CAT/80183/2014, Committee for Advanced Therapies).

The purpose of the invention also includes the construction of strains carrying this gene therapy DNA vector for the development and production of this gene therapy DNA vector on an industrial scale.

The specified purpose is achieved by the production of the gene therapy DNA vector VTvafl7-Actl-Cas9 based on the gene therapy DNA vector VTvafl7 carrying the Cas9 therapeutic gene for the heterologous expression of this therapeutic gene in the plant cells during the editing of plant genomes, while gene therapy DNA vector VTvafl7-Actl-Cas9 has the nucleotide sequence SEQ ID No. 1.

The constructed gene therapy DNA vector VTvafl7-Actl-Cas9 due to the limited size of VTvafl7-Actl vector part not exceeding 3200 bp has the ability to efficiently penetrate into human and animal cells and express the Cas9 therapeutic gene cloned to it.

The method of production of gene therapy DNA vector VTvafl7-Actl-Cas9 is as follows: the DNA vector VTvafl7-Actl is obtained by replacing the promoter region of the human EFla gene in the VTvafl7 vector with the promoter region of the rice actin 1 gene (actl), then the coding region of the Cas9 therapeutic gene is cloned to the DNA vector VTvafl7-Actl, and the gene therapy DNA vector VTvafl7-Actl-Cas9 is obtained.

The usage of gene therapy DNA vector VTvafl7-Actl-Cas9 is claimed for safe editing of plant genomes due to the fact that the gene therapy DNA vector VTvafl7-Actl-Cas9 contains no nucleotide sequences of viral origin and no antibiotic resistance genes.

The method of usage of gene therapy DNA vector VTvafl7-Actl-Cas9 for the heterologous expression of this therapeutic gene in plant cells in the editing of plant genomes involves injection of the constructed gene therapy DNA vector into plants cells, organs, and tissues in combination with gRNA molecules or genetic constructs that provide gRNA expression or a combination of the indicated methods.

Escherichia coli strain SCS110-AF/VTvafl7-Actl-Cas9 carrying the gene therapy DNA vector VTvafl7-Actl-Cas9 for its production that allows for antibiotic-free selection.

The method of production of Escherichia coli strain SCS 110-AF/VTvafl 7- Actl-Cas9 involves electroporation of competent cells of Escherichia coli strain SCS110-AF by the constructed gene therapy DNA vector VTvafl7-Actl-Cas9 and subsequent selection of stable clones of the strain using selective medium.

The method of gene therapy DNA vector VTvafl7-Actl-Cas9 production on an industrial scale involves scaling-up the bacterial culture of the Escherichia coli strain SCSI 10-AF/VTvafl7-Actl-Cas9 to the quantities necessary for increasing the bacterial biomass in an industrial fermenter, after which the biomass is used to extract a fraction containing the therapeutic DNA product, i.e. the gene therapy DNA vector VTvafl7-Actl-Cas9, and then multi-stage filtered, and purified by chromatographic methods.

The essence of the invention is explained in the drawings, where:

Figure 1 shows the structure of gene therapy DNA vector VTvafl7-Actl carrying the Cas9 therapeutic gene that constitutes a circular double-stranded DNA molecule capable of autonomous replication in Escherichia coli cells.

Figure 1 shows the structure of gene therapy DNA vector VTvafl7-Actl-

Cas9.

The following structural elements of the vector are indicated in the structures:

Actl is the promoter region of rice actin gene. It ensures efficient transcription of the recombinant gene in most plant tissues;

the open reading frame of the therapeutic gene corresponding to the coding region of Cas9 gene,

hGH TA - the transcription terminator and the polyadenylation site of the human growth factor gene,

ori - the origin of replication for autonomous replication with a single nucleotide substitution to increase plasmid production in the cells of most Escherichia coli strains,

RNAout - the regulatory element RNA-out of transposon Tn 10 that allows for antibiotic-free positive selection in case of the use of Escherichia coli strain SCSI 10- AF.

Unique restriction sites are marked.

Figure 2

shows diagrams of cDNA amplicon accumulation of the therapeutic gene, namely the Cas9 gene, in Nicotiana tabacum BY-2 cell line (RIKEN BRC, Cat. rpcOOOOl) tobacco cell culture before its transfection and 48 hours after transfection of these cells with gene therapy DNA vector VTvafl7-Actl-Cas9 in order to assess the ability to penetrate into eukaryotic cells and functional activity, i.e. expression of the therapeutic gene at the mRNA level.

Curves of accumulation of amplicons during the reaction are shown in Fig. 2 corresponding to:

1 - cDNA of Cas9 gene in Nicotiana tabacum BY-2 tobacco cell culture before transfection with DNA vector VTvafl7-Actl-Cas9, 2 - cDNA of Cas9 gene in Nicotiana tabacum BY-2 tobacco cell culture after transfection with DNA vector VTvafl7-Actl-Cas9,

3 - cDNA of L25 gene in Nicotiana tabacum BY-2 tobacco cell culture before transfection with DNA vector VTvafl7-Actl-Cas9,

4 - cDNA of L25 gene in Nicotiana tabacum BY-2 tobacco cell culture after transfection with DNA vector VTvafl7-Actl-Cas9.

L25 (L23a 60S ribosomal subunit protein) gene listed in the GenBank database under number LOCI 07796789 was used as a reference gene.

Figure 3

shows the plot of CAS 9 protein concentration in the lysate of Nicotiana tabacum BY-2 cell line (RIKEN BRC, Cat. rpcOOOOl) tobacco cell culture 48 hours after electroporation of these cells with DNA vector VTvafl7-Actl-Cas9 in order to assess the functional activity, i.e. the therapeutic gene expression at the protein level, and the possibility of increasing the protein expression level by gene therapy DNA vector based on gene therapy vector VTvafl7 carrying the Cas9 therapeutic gene.

The following elements are indicated in Figure 3:

culture A - culture of Nicotiana tabacum BY-2 tobacco cells electroporated by aqueous solution without plasmid DNA (reference),

culture B - Nicotiana tabacum BY-2 tobacco cells electroporated by DNA vector VTvaf 17-Act 1 ,

culture C - Nicotiana tabacum BY-2 tobacco cells electroporated by DNA vector VTvafl7-Actl-Cas9.

Figure 4

shows diagrams of cDNA amplicon accumulation of the therapeutic gene, namely, the Cas9 gene, in the culture of Arabidopsis thaliana T87 (ABRC, Germplasm: T87 / Stock: CCL84839) before their transfection and 48 hours after transfection of these cells with gene therapy DNA vector VTvafl7-Actl-Cas9 in order to assess the ability to penetrate into eukaryotic cells and functional activity, i.e. expression of the therapeutic gene at the mRNA level. Curves of accumulation of amplicons during the reaction are shown in Fig. 4 corresponding to:

1 - cDNA of Cas9 gene in Arabidopsis thaliana T87 cell culture before transfection with DNA vector VTvafl7-Actl-Cas9,

2 - cDNA of Cas9 gene in Arabidopsis thaliana T87 cell culture after transfection with DNA vector VTvafl7-Actl-Cas9,

3 - cDNA of Actin-2 gene in Arabidopsis thaliana T87 cell culture before transfection with DNA vector VTvafl 7-Actl -Cas9,

4 - cDNA of Actin-2 gene in Arabidopsis thaliana T87 cell culture after transfection with DNA vector VTvafl7-Actl-Cas9.

Actin-2 gene listed in the GenBank database under number Gene ID: 821411 (At3gl8780) was used as a reference gene.

Figure 5

shows the plot of CAS9 protein concentration in the lysate of Arabidopsis thaliana T87 cell culture (ABRC, Germplasm: T87 / Stock: CCL84839) 48 hours after electroporation of these cells by gene therapy DNA vector VTvafl 7-Actl - Cas9 in order to assess the functional activity, i.e. the therapeutic gene expression at the protein level, and the possibility of increasing the protein expression level by gene therapy DNA vector based on gene therapy vector VTvafl 7 carrying the Cas9 therapeutic gene.

The following elements are indicated in Figure 5:

culture A - Arabidopsis thaliana T87 cell culture electroporated by aqueous solution without plasmid DNA (negative control),

culture B - Arabidopsis thaliana T87 cell culture electroporated by DNA vector VTvafl 7-Actl (negative control),

culture C - Arabidopsis thaliana T87 cell culture electroporated by DNA vector VTvafl 7-Actl -Cas9.

Figure 6

shows the alignment of sequences obtained from microcalluses after transformation of com protoplast cells with DNA vector VTvafl 7-Actl -Cas9 and gRNA in order to assess the functional activity, i.e. expression of the therapeutic gene at the protein level, and the possibility of directed editing of plant genomes with concomitant injection of specific gRNA.

The following elements are indicated in Figure 6:

WT - parent sequence of the Zmzb7 gene region,

1-4 - identified targetedly edited sequences of the Zmzb7 gene region.

Figure 7

shows a diagram of the relative amount (percentage) of lettuce seeds sprouted at 37°C.

The following elements are indicated in Figure 7:

WT - control group of plants,

termoR - a group of plants subjected to the genome editing.

Embodiment of the Invention

Gene therapy DNA vector carrying the Cas9 therapeutic gene intended for heterologous expression of this therapeutic gene in plant cells was produced based on 3165 bp DNA vector VTvafl7. At the same time, the method of production of gene therapy DNA vector carrying the therapeutic gene involves cloning of the protein coding sequence of the Cas9 therapeutic gene (encodes the Cas9 endonuclease) to the polylinker of the gene therapy DNA vector VTvafl7-Actl . It is known that the ability of DNA vectors to penetrate into eukaryotic cells is due mainly to the vector size. At the same time, DNA vectors with the smallest size have higher penetration capability. Thus, the absence of elements in the vector that bear no functional load, but at the same time increase the vector DNA size is preferred. These features of DNA vectors were taken into account during the production of gene therapy DNA vectors based on gene therapy DNA vector VTvafl7 carrying the Cas9 therapeutic gene with no large non- functional sequences and antibiotic resistance genes in the vector, which, in addition to technological advantages and safe use, allowed for the significant reduction of size of the produced gene therapy DNA vector VTvafl7-Actl carrying the Cas9 therapeutic gene. Thus, the ability of the obtained gene therapy DNA vector to penetrate into eukaryotic cells is due to its small length. Gene therapy DNA vector VTvafl7-Actl-Cas9 was produced as follows: the coding region of the Cas9 therapeutic gene was cloned to gene therapy DNA vector VTvafl7-Actl, and gene therapy DNA vector VTvafl7-Actl-Cas9, SEQ ID No. 1, was obtained. The coding region of Cas9 gene ( 4222 bp) was produced by enzymic synthesis from oligonucleotides. The amplification product was cleaved by specific restriction endonucleases taking into account the optimal procedure for further cloning, and cloning to the gene therapy DNA vector VTvafl7-Actl was performed by restriction sites located in the VTvafl7-Actl vector polylinker. The selection of restriction sites was carried out in such a way that the cloned fragment entered the reading frame of expression cassette of the vector VTvafl7-Actl, while the protein coding sequence did not contain restriction sites for the selected endonucleases. At the same time, experts in this field realise that the methodological implementation of gene therapy DNA vector VTvafl7-Actl-Cas9 production can vary within the framework of the selection of known methods of molecular gene cloning and these methods are included in the scope of this invention. For example, different oligonucleotide sequences can be used to amplify Cas9 gene, different restriction endonucleases or laboratory techniques, such as ligation independent cloning of genes.

Gene therapy DNA vector VTvafl7-Actl-Cas9 has the nucleotide sequence SEQ ID No. 1. At the same time, degeneracy of genetic code is known to the experts in this field and means that the scope of this invention also includes variants of nucleotide sequences differing by insertion, deletion, or replacement of nucleotides that do not result in a change in the polypeptide sequence encoded by the therapeutic gene, and/or do not result in a loss of functional activity of the regulatory elements of VTvafl7-Actl vector. At the same time, genetic polymorphism is known to the experts in this field and means that the scope of this invention also includes variants of nucleotide sequences of Cas9 gene that also encode different variants of the amino acid sequences of CAS9 protein that do not differ from those listed in their functional activity under physiological conditions.

The ability to penetrate into eukaryotic cells and express functional activity, i.e. the ability to express the therapeutic gene of the obtained gene therapy DNA vector VTvafl7-Actl-Cas9 is confirmed by injecting the obtained vector into eukaryotic cells and subsequent analysis of the expression of specific mRNA and/or protein product of the therapeutic gene. The presence of specific mRNA in cells into which the gene therapy DNA vector VTvafl7-Actl-Cas9 was injected shows the ability of the obtained vector to both penetrate into eukaryotic cells and express mRNA of the Cas9 therapeutic gene. At the same time, it is known to the experts in this field that the presence of mRNA gene is a mandatory condition, but not an evidence of the translation of protein encoded by the therapeutic gene. Therefore, in order to confirm properties of the gene therapy DNA vector VTvafl7-Actl-Cas9 to express the therapeutic gene at the protein level in eukaryotic cells into which the gene therapy DNA vector was injected, analysis of the concentration of protein encoded by the therapeutic gene was carried out using immunological methods. The presence of CAS9 protein confirms the efficiency of expression of therapeutic genes in eukaryotic plant cells using the gene therapy DNA vector based on gene therapy DNA vector VTvafl7 carrying the Cas9 therapeutic gene. Thus in order to confirm the efficiency and practicability of use of the produced gene therapy DNA vector VTvafl7-Actl-Cas9 carrying the therapeutic gene, namely the Cas9 gene, the following methods were used:

A) real-time PCR, i.e. change in cDNA accumulation of therapeutic gene in plant cell lysate after transfection of different plant cell lines with gene therapy DNA vector,

B) Enzyme-linked immunosorbent assay, i.e. change in the quantitative level of therapeutic protein in the plant cell lysate after transfection of different plant cell lines with gene therapy DNA vector,

C) Sequencing of DNA region of plant cells that has undergone genome editing after combined transfection of these cells with gene therapy DNA vector and gRNA,

D) Functional test for the manifestation of phenotypic properties of the plant organism, due to directed genome editing, implemented by the combined injection of gene therapy DNA vector and gRNA.

In order to confirm the practicability of use of the constructed gene therapy DNA vector VTvafl7-Actl-Cas9 carrying the therapeutic gene, namely the Cas9 gene, the following was performed:

A) transfection of different plant cell lines with gene therapy DNA vector, B) combined transfection with gene therapy DNA vector and gRNA of different plant cell lines,

C) demonstration of changes in the sequence of the edited gene region in the plant cell line subjected to the targeted genome editing,

D) Demonstration of the phenotypic properties of the plant organism, due to directed genome editing, implemented by the combined injection of gene therapy DNA vector and gRNA.

These methods of use lack potential risks due to the absence of regulatory elements in the gene therapy DNA vector that constitute the nucleotide sequences of viral genomes and absence of antibiotic resistance genes in the gene therapy DNA vector as confirmed by the lack of regions homologous to the viral genomes and antibiotic resistance genes in the nucleotide sequences of gene therapy DNA vector VTvafl7-Actl-Cas9 (SEQ ID No. 1).

It is known to the experts in this field that antibiotic resistance genes in the gene therapy DNA vectors are used to obtain these vectors in preparative quantities by increasing bacterial biomass in a nutrient medium containing a selective antibiotic. Within the framework of this invention, in order to ensure the safe use of gene therapy DNA vector VTvafl7-Actl carrying Cas9 therapeutic gene, the use of selective nutrient media containing an antibiotic is not possible. A method for obtaining strains for the production of these gene therapy vectors based on Escherichia coli strain SCS110-AF is proposed as a technological solution for obtaining the gene therapy DNA vector VTvafl7-Actl carrying the Cas9 therapeutic gene in order to scale up the production of gene therapy vectors to an industrial scale. The method of production of Escherichia coli strain SCSI 10- AF/VTvafl 7-Act 1 -Cas9 involves production of competent cells of Escherichia coli strain SCS110-AF with the injection of gene therapy DNA vector VTvafl7-Actl- Cas9 into these cells using transformation (electroporation) methods widely known to the experts in this field. The obtained Escherichia coli strain SCSI 10- AF/VTvafl7-Actl-Cas9 is used to produce the gene therapy DNA vector VTvafl7- Actl-Cas9 that allows for the use of antibiotic-free media.

In order to confirm the production of Escherichia coli strain SCSI 10- AF/VTvafl 7-Actl -Cas9 transformation, selection, and subsequent biomass growth with extraction of plasmid DNA were performed. To confirm the producibility and constructability of gene therapy DNA vector VTvafl7-Actl-Cas9 carrying the therapeutic gene, namely the Cas9 gene, on an industrial scale, large-scale fermentation of Escherichia coli strain SCS 110- AF/VTvafl 7-Actl -Cas9 containing gene therapy DNA vector VTvafl7-Actl carrying the Cas9 therapeutic gene was performed.

The method of scaling the production of bacterial mass to an industrial scale for the isolation of gene therapy DNA vector VTvafl7-Actl carrying the Cas9 therapeutic gene involves incubation of the seed culture of Escherichia coli strain SCS 1 10-AF/VTvafl 7-Actl -Cas9 in the antibiotic-free nutrient medium that provides suitable biomass accumulation dynamics. Upon reaching a sufficient amount of biomass in the logarithmic phase, the bacterial culture is transferred to an industrial fermenter and then grown to a stationary phase, then the fraction containing the therapeutic DNA product, i.e. the gene therapy DNA vector VTvafl7-Actl-Cas9 is extracted, multi-stage filtered, and purified by chromatographic methods. At the same time, it is known to the experts in this field that culture conditions of strains, composition of nutrient media (except for antibiotic-free), equipment used, and DNA purification methods may vary within the framework of standard operating procedures depending on the particular production line, but known approaches to scaling, industrial production, and purification of DNA vectors using Escherichia coli strain SCS 110-AF/VTvafl 7- Actl-Cas9 fall within the scope of this invention.

The described disclosure of the invention is illustrated by examples of the embodiment of this invention.

The essence of the invention is explained in the following examples.

Example 1.

Production of gene therapy DNA vector VTvafl7-Actl-Cas9 carrying the therapeutic gene, namely the gene encoding Cas9 proteins.

The gene therapy DNA vector VTvafl 7-Actl -Cas9 was constructed based on the VTvafl 7 vector (CELL and Gene Therapy Ltd., OOO PIT) by replacing the promoter region of the human EFla gene with the promoter region of the rice actin 1 gene (actl) and injecting the DNA region encoding Cas9 protein. For this purpose, a part of the VTvafl7 vector (fragment (a)), including the origin of replication, hGH-TA transcription terminator, regulatory region of TnlO RNA-out transposon obtained by PCR amplification of the VTvafl7 plasmid region was combined with DNA fragments (b) and (c), obtained from different sources, where

(b) promoter region of rice actin 1 gene Actl, obtained by PCR amplification of the rice genomic DNA region,

(c) the coding region of Cas9 gene (4222 bp) produced by enzymic synthesis from oligonucleotides.

PCR amplification was performed using the commercially available kit Phusion® High-Fidelity DNA Polymerase (New England Biolabs, USA) as per the manufacturer’s instructions.

Fragment (a) was produced by PCR amplification of the VTvafl7 vector using the VTvaf-Xho and VTvaf-Sal oligonucleotides:

VTvaf-Xho GACCTCGAGGGAGTCAGGCAACTATGGATG,

VTvaf-Sal ATAGTCGACCCTGTGACCCCTCCCCAG.

Fragment (b) (the promoter region of Actl) was produced by PCR amplification of a region of rice genomic DNA using PAct-F and PAct-R oligonucleotides:

PAct-F T AT CTCG AGGTC ATT CAT AT GCTT G AG AAG AG,

PAct-R

AGGGTCGACTATAAGCTTACAAAAAAGCTCCGCACGAGGCT.

Afterwards, the produced fragments (a) and (b) were consolidated by restriction with subsequent ligation by Sail and Xhol sites. This resulted in a 3162 bp gene therapy DNA vector VTvafl7-Actl that is recombinant and allows for antibiotic-free selection.

Gene therapy DNA vector VTvafl7-Actl-Cas9 was constructed by cloning a 4222 bp Cas9 gene coding region and DNA vector VTvafl7-Actl cleaved by Hindlll and Sail endonucleases.

The coding region of Cas9 gene (4222 bp) was produced by enzymic synthesis from nucleotides followed by amplification using Cas9_F and Cas9_R oligonucleotides:

Cas9_F TGTAAGCTTGTAGAAGATGGCCCCAAAGAAGAAG, Cas9_R AT AGT CG ACTTACTTTTT CTTTTTT GCCTGG.

The amplification product of the coding region of Cas9 gene and DNA vector VTvafl7-Actl was cleaved by Hindlll and Sail restriction endonucleases (New England Biolabs, USA). This resulted in a 7369 bp DNA vector VTvafl7- Actl-Cas9 with the nucleotide sequence SEQ ID No. 1 and general structure shown in Fig. 1.

Example 2.

Proof of the ability of gene therapy DNA vector VTvafl7-Actl-Cas9 carrying the therapeutic gene, namely Cas9 gene, to penetrate eukaryotic cells and its functional activity at the level of therapeutic gene mRNA expression. This example also demonstrates practicability of use of gene therapy DNA vector carrying the therapeutic gene.

Changes in the mRNA accumulation of the Cas9 therapeutic gene were assessed in the lysate of Nicotiana tabacum BY-2 cell line (RIKEN BRC, Cat. RpcOOOOl) tobacco cell culture after electroporation of these cells by gene therapy DNA vector VTvafl7-Actl-Cas9 carrying the Cas9 gene. Cells were grown in mLS medium, 0.2mg/L 2,4-D, pH 5.8, under standard conditions (27°C, 130rpm).

The amount of mRNA was determined by the dynamics of accumulation of cDNA amplicons in the real-time PCR.

The injection of gene therapy DNA vector VTvafl7-Actl-Cas9 was performed by electroporation using the BTX Electro Square Porator T820 Electropolation System (BTX, T 820) device as previously described in the literature (Koscianska E, Wypijewski K., 2001). Water without DNA vector and DNA vector VTvafl7-Actl devoid of cDNA of Cas9 gene were used as a reference, and DNA vector VTvafl7-Actl-Cas9 carrying the human Cas9 gene was used as electroporated agents. After electroporation, the cells were cultured for 48 hours in mLS medium, 0.2mg/L 2,4-D, pH 5.8, under standard conditions (27°C, 130rpm).

Total RNA from BY-2 cells was extracted using Trizol Reagent (Invitrogen, USA) according to the manufacturer’s recommendations. 0.5ml of cell culture was centrifuged, and the supernatant was collected. 1ml of Trizol Reagent was added to the cell precipitate, homogenised and heated for 5 minutes at 65 °C. The sample was centrifuged at 14,000g for 10 minutes and heated again for 10 minutes at 65°C. Then, 200m1 of chloroform was added, and the mixture was gently stirred and centrifuged at 14,000g for 10 minutes. Then the water phase was isolated and mixed with 1/10 of the volume of 3M sodium acetate, pH 5.2, and an equal volume of isopropyl alcohol. The sample was incubated at -20°C for 10 minutes and then centrifuged at 14,000g for 10 minutes. The precipitated RNA were rinsed in 1ml of 70% ethyl alcohol, air-dried and dissolved in 10m1 of RNase-free water. The level of Cas9 mRNA expression after transfection was determined by assessing the dynamics of the accumulation of cDNA amplicons by real-time PCR. For the production and amplification of cDNA specific for the Cas9 gene, the following hCas9_SF and hCas9_SR oligonucleotides were used:

hCas9_SF CATCGAGCAGATCAGCGAGT,

hCas9_SR CGATCCGTGTCTCGTACAGG.

The length of amplification product is 275 bp.

Reverse transcription reaction and PCR amplification was performed using SYBR GreenQuantitect RT-PCR Kit (Qiagen, USA) for real-time PCR. The reaction was carried out in a volume of 20m1, containing: 25m1 of QuantiTect SYBR Green RT-PCR Master Mix, 2.5mM of magnesium chloride, 0.5mM of each primer, and 5m1 of RNA. For the reaction, CFX96 amplifier (Bio-Rad, USA) was used under the following conditions: 1 cycle of reverse transcription at 42°C for 30 minutes, denaturation at 98°C for 15 minutes, followed by 40 cycles comprising denaturation at 94°C for 15s, annealing of primers at 60°C for 30s and elongation at 72°C for 30s. L25 (L23a 60S ribosomal subunit protein) gene listed in the GenBank database under number LOCI 07796789 was used as a reference gene. Positive control included amplicons from PCR on matrices represented by plasmids in known concentrations containing cDNA sequences of Cas9 and L25 genes. Negative control included deionised water. Real-time quantification of the dynamics of accumulation of cDNA amplicons of Cas9 and L25 genes was conducted using the Bio-Rad CFX Manager 2.1 software (Bio-Rad, USA). Diagrams resulting from the assay are shown in Figure 2.

Figure 2 shows that the level of specific mRNA of Cas9 gene has grown massively as a result of transfection of Nicotiana tabacum BY-2 cell line culture with gene therapy DNA vector VTvafl7-Actl-Cas9, which confirms the ability of the vector to penetrate eukaryotic cells and express the Cas9 gene at the mRNA level. The presented results also confirm the practicability of use of gene therapy DNA vector VTvafl7-Actl-Cas9 in order to increase the expression level of Cas9 gene in plant cells.

Example 3.

Proof of the efficiency and practicability of use of gene therapy DNA vector VTvafl7-Actl-Cas9 carrying the Cas9 gene for the expression of CAS9 protein in plant cells.

The change in the CAS 9 protein concentration in the lysate of Nicotiana tabacum BY-2 cell line (RIKEN BRC, Cat. rpcOOOOl) tobacco cell culture was assessed after transfection of these cells with DNA vector VTvafl7-Actl-Cas9 carrying the Cas9 gene. Cells were grown in mLS medium, 0.2mg/L 2,4-D, pH 5.8, under standard conditions (27°C, 130rpm).

The injection of gene therapy DNA vector VTvafl7-Actl-Cas9 was performed by electroporation using the BTX Electro Square Porator T820 Electropolation System (BTX, T 820) device as previously described in (Kosciahska E, Wypijewski K., 2001). Water without DNA vector (A) and DNA vector VTvafl7-Actl devoid of cDNA of Cas9 (B) gene were used as a reference, and DNA vector VTvafl7-Actl-Cas9 carrying the human Cas9 (C) gene was used as electroporated agents.

After electroporation, the cells were grown in mLS medium, 0.2mg/L 2,4-D, pH 5.8, under standard conditions (27°C, 130rpm). After 48 hours, cells were precipitated by centrifugation, and the supernatant was collected. 0.5ml of 0.9% NaCl and 0.1ml of IN HC1 were added to the cell precipitate obtained from 0.5ml of cell culture, mixed thoroughly, and incubated for 10 minutes at room temperature. Then, the mixture was neutralised by adding 0.1ml of 1.2M NaOH/0.5M HEPES (pH 7-7.6) and stirred thoroughly. Supernatant was collected and used to assay the therapeutic protein. The CAS9 protein was assayed by enzyme-linked immunosorbent assay (ELISA) using the Cas9 (CRISPR Associated Protein 9) ELISA Kit (Cell Biolabs Inc, Cat. PRB-5079) according to the manufacturer’s method with optical density detection using ChemWell Automated EIA and Chemistry Analyser (Awareness Technology Inc., USA). To measure the numerical value of concentration, the calibration curve constructed using the reference samples from the kit with known concentrations of CAS9 protein was used. The sensitivity was at least 1.5ng/ml, measurement range - from 1.56ng/ml to lOOng/ml. R-3.0.2 was used for the statistical treatment of the results and data visualization (https://www.r-project.org/). Diagrams resulting from the assay are shown in Figure 3.

Figure 3 shows that the Cas9 protein was found compared to its lack in reference samples after electroporation of the BY-2 cell culture with gene therapy DNA vector VTvafl7-Actl-Cas9, which confirms the ability of the vector to penetrate eukaryotic plant cells and express the Cas9 gene at the protein level. The presented results also confirm the practicability of use of gene therapy DNA vector VTvafl7-Actl-Cas9 for expression of Cas9 gene in eukaryotic plant cells.

Example 4.

Changes in the mRNA accumulation of the Cas9 therapeutic gene were assessed in the lysate of Arabidopsis thaliana T87 cell culture (ABRC, Germplasm: T87 / Stock: CCL84839) after transfection of these cells with DNA vector VTvafl7-Actl-Cas9 carrying the Cas9 gene. Cells were grown in NT-1 medium (medium formulation per 11: 4.3g MS, 30g of sucrose, 0.18g KH2P04, lmg of thiamine, 500mg 2,4-D, lOOmg of myoinositol), pH 5.8 at 24°C, 130rpm.

The injection of gene therapy DNA vector VTvafl7-Actl-Cas9 was performed by electroporation using the BTX Electro Square Porator T820 Electropolation System (BTX, T 820) device similar to the method previously described in the literature (Kosciaftska E, Wypijewski K., 2001). Water without DNA vector and DNA vector VTvafl7-Actl devoid of cDNA of Cas9 gene were used as a reference, and DNA vector VTvafl7-Actl-Cas9 carrying the human Cas9 gene was used as electroporated agents. After electroporation, the cells were cultured for 48 hours in NT-1 medium, pH 5.8, at 24°C, 130 rpm.

Total RNA from T87 cells was extracted using Trizol Reagent (Invitrogen, USA) according to the manufacturer’s recommendations. 0.5ml of cell culture was centrifuged, and the supernatant was collected. 1ml of Trizol Reagent was added to the cell precipitate, homogenised and heated for 5 minutes at 65 °C. The sample was centrifuged at 14,000g for 10 minutes and heated again for 10 minutes at 65°C. Then, 200m1 of chloroform was added, and the mixture was gently stirred and centrifuged at 14,000g for 10 minutes. Then the water phase was isolated and mixed with 1/10 of the volume of 3M sodium acetate, pH 5.2, and an equal volume of isopropyl alcohol. The sample was incubated at -20°C for 10 minutes and then centrifuged at 14,000g for 10 minutes. The precipitated RNA were rinsed in 1ml of 70% ethyl alcohol, air-dried and dissolved in 10m1 of RNase-free water. The level of Cas9 mRNA expression after transfection was determined by assessing the dynamics of the accumulation of cDNA amplicons by real-time PCR. For the production and amplification of cDNA specific for the Cas9 gene, the following hCas9_SF and hCas9_SR oligonucleotides were used:

hCas9_SF CATCGAGCAGATCAGCGAGT,

hCas9_SR CGATCCGTGTCTCGTACAGG.

The length of amplification product is 275 bp.

Reverse transcription reaction and PCR amplification was performed using SYBR GreenQuantitect RT-PCR Kit (Qiagen, USA) for real-time PCR. The reaction was carried out in a volume of 20m1, containing: 25m1 of QuantiTect SYBR Green RT-PCR Master Mix, 2.5mM of magnesium chloride, 0.5mM of each primer, and 5m1 of RNA. For the reaction, CFX96 amplifier (Bio-Rad, USA) was used under the following conditions: 1 cycle of reverse transcription at 42°C for 30 minutes, denaturation at 98°C for 15 minutes, followed by 40 cycles comprising denaturation at 94°C for 15 seconds, the annealing of primers at 60°C for 30 seconds and elongation 72°C at for 30 seconds. Actin-2 (At3gl8780) was used as a reference gene, amplification was performed using the commercially available kit Control primer set for Arabidopsis Actin-2 gene (Sigma, cat. C3615). Positive control included amplicons from PCR on matrices represented by plasmids in known concentrations containing cDNA sequence of Cas9 gene. Negative control included deionised water. Real-time quantification of the dynamics of accumulation of cDNA amplicons of Cas9 and Actin-2 genes was conducted using the Bio-Rad CFX Manager 2.1 software (Bio-Rad, USA). Diagrams resulting from the assay are shown in Figure 4.

Figure 4 shows that the level of specific mRNA of Cas9 gene has grown massively as a result of transfection of Arabidopsis thaliana T87 cell culture with gene therapy DNA vector VTvafl7-Actl-Cas9, which confirms the ability of the vector to penetrate eukaryotic plant cells and express the Cas9 gene at the mRNA level. The presented results also confirm the practicability of use of gene therapy DNA vector VTvafl7-Actl-Cas9 in order to increase the expression level of Cas9 gene in plant cells.

Example 5.

The change in the CAS9 protein concentration was assessed in the lysate of Arabidopsis thaliana T87 cell culture (ABRC, Germplasm: T87 / Stock: CCL84839) after transfection of these cells with DNA vector VTvafl7-Actl-Cas9 carrying the Cas9 gene. Cells were grown as described in Example 4.

The injection of gene therapy DNA vector VTvafl7-Actl-Cas9 was performed by electroporation using the BTX Electro Square Porator T820 Electropolation System (BTX, T 820) device by a method similar to the described in (Kosciahska E, Wypijewski K., 2001). Water without DNA vector and DNA vector VTvafl7-Actl devoid of cDNA of Cas9 gene were used as a reference, and DNA vector VTvafl7-Actl-Cas9 carrying the human Cas9 gene was used as electroporated agents.

After electroporation, the cells were cultured for 48 hours in NT-1 medium, pH 5.8, at 24°C, 130 rpm. After 48 hours, cells were precipitated by centrifugation, and the supernatant was collected. 0.5ml of 0.9% NaCl and 0.1ml of IN HC1 were added to the cell precipitate obtained from 0.5ml of cell culture, mixed thoroughly, and incubated for 10 minutes at room temperature. Then, the mixture was neutralised by adding 0.1ml of 1.2M NaOH/0.5M HEPES (pH 7—7.6) and stirred thoroughly. Supernatant was collected and used to assay the therapeutic protein. The CAS9 protein was assayed by enzyme-linked immunosorbent assay (ELISA) using the Cas9 (CRISPR Associated Protein 9) ELISA Kit (Cell Biolabs Inc, Cat. PRB-5079) according to the manufacturer’s method with optical density detection using ChemWell Automated EIA and Chemistry Analyser (Awareness Technology Inc., USA).

To measure the numerical value of concentration, the calibration curve constructed using the reference samples from the kit with known concentrations of CAS9 protein was used. The sensitivity was at least 1.5ng/ml, measurement range - from 1.56ng/ml to lOOng/ml. R-3.0.2 was used for the statistical treatment of the results and data visualization (https://www.r-project.org/). Diagrams resulting from the assay are shown in Figure 5.

Figure 5 shows that the CAS 9 protein was found compared to its lack in reference samples after electroporation of the T87 cell culture with gene therapy DNA vector VTvafl7-Actl-Cas9, which confirms the ability of the vector to penetrate eukaryotic plant cells and express the Cas9 gene at the protein level. The presented results also confirm the practicability of use of gene therapy DNA vector VTvafl7-Actl-Cas9 for expression of Cas9 gene in eukaryotic plant cells.

Example 6

Proof of the efficiency and practicability of use of gene therapy DNA vector VTvafl7-Actl-Cas9 carrying the Cas9 gene for the expression of Cas9 protein in plant cells and its functional activity for editing of plant genomes with concomitant injection of gRNA.

The change in the DNA sequence of the Zmzb7 com gene ( GRMZM2G027059 ) was assessed by sequencing method after transfection of com protoplast cells with the DNA vector VTvafl7-Actl-Cas9 carrying the Cas9 gene, in combination with gRNA, to the Zmzb7 gene region.

Com seeds (Zea mays) were treated with 2% sodium hypochloride for 10 minutes, then rinsed with sterile water 5 times and placed in MS medium (Sigma, M5524), germinated for 3-5 days in the dark at 37°C, then grown for another 7 days at 25 °C. After 5-7 days 10-15 leaves were cut into l-2mm pieces in a small volume of sterile water. Cut leaves were placed in 30ml of Plant Protoplast Digest/Wash Solution (Sigma, D9692) and incubated for 2 hours while stirring every 20 minutes. The resulting suspension was screened through a 40pm nylon sieve, the suspension was centrifuged at lOOg for 5 minutes. The supernatant was removed and the precipitate was resuspended in 1ml of MMG buffer, prepared as follows: 0.8 M mannitol - 2.5ml, 300mM MgC12 - 0.25ml, 200mM MES (pH 5.7) - 0.1ml, sterile water to 10ml. 200m1 of the suspension of protoplasts at a concentration of 2*10⁵ cells/ml was placed in eppendorf. Protoplast lipofection was performed using Lipofectamine 3000 (Invitrogen, USA). A mixture for lipofection was prepared as follows: 50m1 of Lipofectamine 3000 was mixed with 50m1 of aqueous solution containing lOOpg of DNA vector VTvafl7-Actl-Cas9 and lpg of gRNA selected for the Zmzb7 gene region, where mutations result in albinism in plants. The gRNA sequence was collected from (Feng et al, 2015).

The finished mixture for lipofection was incubated for 30 minutes at room temperature, then added to the suspension of protoplasts and gently mixed, incubated for 30 minutes on the table. Then the protoplasts were transferred to 0.5ml Protoplast Induction Media (PIM) (For the preparation of 1 litre of medium, the following ingredients are used: 1/2 B5 medium - 1.58g, sucrose - 103g, 2.4-D - 0.2mg, BAP - 0.3mg, MES - 0.1 g, CaC12-2H20 - 375mg, NaFe-EDTA - 18.35mg, sodium succinate - 270mg) and were cultured for 48h at 25°C. Protoplasts were then plated in a 6-well culture plate and 0.5ml of medium with 2.4% agarose coating was added. Formed microcalluses were extracted from the agar medium, genomic DNA was isolated using the Wizard® Genomic DNA Purification Kit (Promega, Cat. A1620) as per the manufacturer’s instructions and used for PCR amplification of the Zmzb7 (GRMZM2G027059) gene region with primers:

ZB7-F CACTTCATGGCCTTCAATAC,

ZB7-R GCTGATCCTGTTTCCTGGTC,

and subsequent sequencing of the obtained amplicons.

Sequencing data was compared to the parent sequence obtained from control calluses that were only transformed by gRNA solution without the addition of DNA vector VTvafl7-Actl-Cas9. As a result, 4 samples from 20 analysed sequences contained the edited sequence. Diagrams resulting from the assay are shown in Figure 6. Figure 6 shows the data on alignment of 4 edited sequences relative to the control DNA sequence.

Figure 6 shows that due to the lipofection of corn protoplasts (Zea mays) with gene therapy DNA vector VTvafl7-Actl-Cas9 and gRNA complementary to the Zmzb7 (GRMZM2G027059) gene region, directed editing of gene sequence occurred in 20% of microcalluses, which confirms the ability of the vector to penetrate into eukaryotic plant cells and express the Cas9 gene and directly edit the sequence of selected gene using gRNA. The presented results also confirm the practicability of use of gene therapy DNA vector VTvafl7-Actl-Cas9 for targeted genome editing in plant cells.

Example 7

The ability to targetedly change the plant phenotypic properties was evaluated by performing the directed genome editing procedure by concomitant lipofection of lettuce protoplasts ( Lactuca sativa var. Chungchima) with the gene therapy DNA vector VTvafl7-Actl-Cas9 and gRNA.

For this purpose, lettuce seeds {Lactuca sativa var. Chungchima) were treated with 2% sodium hypochloride for 10 minutes, then rinsed with sterile water 5 times and placed in MS medium (Sigma, M5524). After the formation of leaf rosette, 10-15 lettuce leaves were cut into l-2mm pieces in a small volume of sterile water. Cut leaves were placed in 30ml of Plant Protoplast Digest/Wash Solution (Sigma, D9692) and incubated for 2 hours while stirring every 20 minutes. The resulting suspension was screened through a 100pm sieve, the suspension was centrifuged at lOOg for 5 minutes. The supernatant was removed and the precipitate was resuspended in 1ml MMG buffer: 0.8 M mannitol - 2.5ml, 300mM MgC12 - 0.25ml, 200mM MES (pH 5.7) - 0.1 ml, sterile water to 10ml. 200m1 of the suspension of protoplasts at a concentration of 2*10⁵ cells/ml was placed in eppendorf. Protoplast lipofection was performed using Lipofectamine 3000 (Invitrogen, USA). A mixture for lipofection was prepared as follows: 50m1 of Lipofectamine 3000 was mixed with 50m1 of aqueous solution containing 100pg of DNA vector VTvafl7-Actl-Cas9 and lpg of gRNA mixture selected for the LsNCED4 (LOCI 11879595) gene region that controls the thermal inhibition of seed germination.

gRNA sequences complementary to LsNCED4 were generated using http://www.e-crisp.org and represented a set of oligonucleotides:

a) GGCC A A AGTT G ACTT GG AG A NGG,

b) GAT GGTT GT ACG AGGGGGC A NGG,

c) GAT GT CGGTTTT AT CTT AGG NGG,

d) GCTGAACCGCTGGATCAACC NGG,

e) GACCAAATCATTGTAGTAAT NGG,

f) GCT A AT GGG A AACTTT GCGC NGG,

g) GTGATCTCGCAACAGATGGA NGG,

h) GAGGTGTCCATTGGAGGCGG NGG,

i) GTGTCCGGTCCATCATGGTC NGG,

j) GCCGGTTTGGTTTATTTTAA NGG.

The finished mixture for lipofection was incubated for 30 minutes at room temperature, then added to the suspension of protoplasts and gently mixed, incubated for 30 minutes on the table. Then the protoplasts were transferred to 0.5ml Protoplast Induction Media (PIM) (For the preparation of 1 litre of medium, the following ingredients are used: 1/2 B5 medium - 1.58g, sucrose - 103g, 2,4-D - 0.2mg, BAP - 0.3mg, MES - O.lg, CaC12-2H20 - 375mg, NaFe-EDTA - 18.35mg, Sodium succinate - 270mg). Protoplasts were then plated in a 6-well culture plate and 0.5ml of medium with 2.4% low melt point agarose was added. Formed microcalluses were transplanted into the Shoot Induction Media (SIM) medium (For the preparation of 1 litre of SIM, the following ingredients were used: 4.4g Sucrose 30g, O.lmg NAA 100pL (lmg/ml stock), 0.5mg BAP 500pL (O.lmg/ml stock), Plant agar 6g). After 4 weeks, calluses were transplanted into MS media and grown in the standard light regime (16 hours of light, 8 hours of darkness). Formed plants were transplanted into the soil. Seeds from each plant were collected and 10 pieces were placed in an individual Petri dish with MS medium; dishes were kept in the oven at 35°C for 7 days. After 7 days, germinated seeds were counted. The seeds of plants obtained from protoplasts with directed editing of the genome germinated at elevated temperatures, while seeds from the control groups did not germinate at 35°C. Drawings resulting following the results of the analysis are shown in Fig. 7.

Figure 7 shows that due to the lipofection of lettuce protoplasts ( Lactuca sativa var. Chungchima) with the gene therapeutic DNA vector VTvafl7-Actl- Cas9 and gRNA, 50% of the seeds were germinated at the temperature of 35°C in the region of the LsNCED4 gene compared to 1% in the reference samples, which confirms the ability of the vector to penetrate eukaryotic plant cells and express the Cas9 gene and targetedly edit the sequence of selected gene using gRNA, thereby directly changing the plant phenotypic properties. The presented results also confirm the practicability of use of gene therapy DNA vector VTvafl7-Actl-Cas9 for targeted genome editing in plant cells.

Example 8.

Escherichia coli strain SCSI 10-AF/VTvafl7-Actl-Cas9 carrying the gene therapy DNA vector, and the method of its production.

The strain construction for the production of gene therapy DNA vector based on gene therapy DNA vector VTvafl7 carrying Cas9 therapeutic gene on an industrial scale, namely, Escherichia coli strain SCSI 10-AF/VTvafl7-Actl-Cas9 carrying the gene therapy DNA vector VTvafl7-Actl-Cas9 for its production that allows for antibiotic-free selection involves making electrocompetent cells of Escherichia coli strain SCS110-AF and subjecting these cells to electroporation with gene therapy DNA vector VTvafl7-Actl-Cas9. After that, the cells were poured into agar plates (Petri dishes) with a selective medium containing yeastrel, peptone, 6% sucrose, and 10pg/ml of chloramphenicol. At the same time, production of Escherichia coli strain SCS110-AF for the production of gene therapy DNA vector VTvafl7-Actl-Cas9 or gene therapy DNA vectors based on it that allows for antibiotic-free positive selection involves constructing a 64 bp linear DNA fragment that contains regulatory element RNA-in of transposon TnlO that allows for antibiotic-free positive selection, a 1422 bp levansucrase gene sacB, the product of which ensures selection within a sucrose-containing medium, a 763 bp chloramphenicol resistance gene catR required for the selection of strain clones in which homologous recombination occurs, and two homologous sequences, 329 bp and 233 bp, ensuring homologous recombination in the region of gene recA concurrent with gene inactivation, and then the Escherichia coli cells are transformed by electroporation, and clones surviving in a medium containing lOpg/ml of chloramphenicol are selected.

Example 9.

The method for scaling up of the gene therapy DNA vector VTvafl7-Actl- Cas9 based on gene therapy DNA vector VTvafl7 carrying the Cas9 therapeutic gene to an industrial scale.

To confirm the producibility and constructability of gene therapy DNA vector VTvafl7-Actl-Cas9 (SEQ ID No. 1) on an industrial scale, a large-scale fermentation of Escherichia coli strain SCSI 10-AF/VTvafl7-Actl-Cas9 containing gene therapy DNA vector VTvafl7-Actl-Cas9 carrying the therapeutic gene, namely Cas9 gene, was performed. Escherichia coli strain SCSI 10-AF/VTvafl7- Actl-Cas9 was produced based on Escherichia coli strain SCS110-AF (Cell and Gene Therapy Ltd, United Kingdom) as per Example 8 by electroporation of competent cells of this strain by gene therapy DNA vector VTvafl7-Actl-Cas9 carrying the therapeutic gene, namely Cas9 gene, followed by inoculation of transformed cells into agar plates (Petri dishes) with a selective medium containing yeastrel, peptone, and 6% sucrose, and selection of individual clones.

Fermentation of Escherichia coli strain SCSI 10-AF/VTvafl7-Actl-Cas9 carrying gene therapy DNA vector VTvafl7-Actl-Cas9 was performed in a 101 fermenter with subsequent extraction of gene therapy DNA vector VTvafl7-Actl- Cas9.

For the fermentation of Escherichia coli strain SCSI 10-AF/VTvafl7-Actl- Cas9, medium containing the following ingredients per 101 of volume was prepared: lOOg of tryptone and 50g of yeastrel (Becton Dickinson, USA); then the medium was diluted with water to 8800ml and autoclaved at 121 °C for 20 minutes, and then 1200ml of 50% (w/v) sucrose was added. After that, the seed culture of Escherichia coli strain SCSI 10-AF/VTvafl7-Actl-Cas9 was inoculated into a culture flask in the volume of 100ml. The culture was incubated in an incubator shaker for 16 hours at 30°C. The seed culture was transferred to the Techfors S bioreactor (Infors HT, Switzerland) and grown to a stationary phase. The process was controlled by measuring optical density of the culture at 600nm. The cells were precipitated by centrifugation for 30 minutes at 5,000-10,000g. Supernatant was removed, and the cell precipitate was re-suspended in 10% (by volume) phosphate buffered saline. The cells were centrifuged again for 30 minutes at 5,000-10,000g. Supernatant was removed, a solution of 20mM TrisCl, ImM EDTA, 200g/l sucrose, pH 8.0 was added to the cell precipitate in the volume of 1000ml, and the mixture was stirred thoroughly to a homogenised suspension. Then egg lysozyme solution was added to the final concentration of lOOpg/ml. The mixture was incubated for 20 minutes on ice while stirring gently. Then 2500ml of 0.2M NaOH, lOg/1 sodium dodecyl sulphate (SDS) was added, the mixture was incubated for 10 minutes on ice while stirring gently, then 3500ml of 3M sodium acetate, 2M acetic acid, pH 5-5.5 was added, and the mixture was incubated for 10 minutes on ice while stirring gently. The resulting sample was centrifuged for 20-30 minutes at 15,000g or a greater value. The solution was decanted delicately, and residual precipitate was removed by passing through a coarse filter (filter paper). Then, RNase A (Sigma, USA) was added to the final concentration of 20pg/ml, and the solution was incubated overnight for 16 hours at room temperature. The solution was then centrifuged for 20-30 minutes at 15,000g and passed through a 0.45pm membrane filter (Millipore, USA). Then, ultrafiltration was performed with a lOOkDa membrane (Millipore, USA) and the mixture was diluted to the initial volume with a buffer solution of 25mM TrisCl, pH 7.0. This manipulation was performed three to four times. The solution was applied to the column with 250ml of DEAE Sepharose HP (GE, USA), equilibrated with 25mM TrisCl, pH 7.0. After the application of the sample, the column was washed with three volumes of the same solution and then gene therapy DNA vector VTvafl7-Actl-Cas9 was eluted using a linear gradient of 25mM TrisCl, pH 7.0, to obtain a solution of 25mM TrisCl, pH 7.0, 1M NaCl, five times the volume of the column. The elution process was controlled by measuring optical density of the run-off solution at 260nm. Chromatographic fractions containing gene therapy DNA vector VTvafl7-Actl- Cas9 were joined together and subjected to gel filtration using Superdex 200 (GE, USA). The column was equilibrated with phosphate buffered saline. The elution process was controlled by measuring optical density of the run-off solution at 260nm, and the fractions were analysed by agarose gel electrophoresis. The fractions containing gene therapy DNA vector VTvafl7-Actl-Cas9 were joined together and stored at -20°C. To assess the process reproducibility, the indicated processing operations were repeated five times.

The process reproducibility and quantitative characteristics of final product yield confirm the producibility and constructability of gene therapy DNA vector VTvafl7-Actl-Cas9 on an industrial scale.

Thus, the constructed gene therapy DNA vector with therapeutic gene can be used for the injection into plant cells, providing heterologous expression of Cas9 endonuclease, which can be used for the plant genome sequence editing in the presence of specific gRNA.

Thus the purpose specified in this invention, namely, the construction of gene therapy DNA vector for the heterologous expression of Cas9 gene in plant cells, combining the following properties:

I) Efficiency of gene therapy DNA vector for the heterologous expression of therapeutic genes in eukaryotic plant cells.

II) The possibility of safe use for the implementation of various methods of editing of plant genomes, including due to the lack of regulatory elements in the gene therapy DNA vector that constitute the nucleotide sequences of viral genomes.

III) The possibility of safe use for the implementation of various methods of editing of plant genomes, including due to the lack of antibiotic resistance genes in the gene therapy DNA vector.

The purpose of the construction of strains carrying gene therapy DNA vector is also achieved.

The achievement of specified purposes is confirmed by examples as follows:

for Item I - Example 1, 2, 3, 4, 5; 6; 7; 8; 9;

for Item II - Example 1, 6, 7;

for Item III and Item IV - Example 1, 8, 9.

Industrial Applicability All of the examples listed above confirm the industrial applicability of the proposed gene therapy DNA vector based on the gene therapy DNA vector VTvafl7 carrying the Cas9 therapeutic gene for heterologous expression of the Cas9 gene in plant cells; Escherichia coli strain SCSI 10-AF/VTvafl7-Actl-Cas9 carrying the gene therapy DNA vector; the method of gene therapy DNA vector production; the method of gene therapy DNA vector production on an industrial scale.

List of Abbreviations

VTvafl7-Actl - Gene therapy vector devoid of sequences of viral genomes and antibiotic resistance markers (vector therapeutic virus-antibiotic-free)

gRNA - guided RNA

DNA - Deoxyribonucleic acid

cDNA - Complementary deoxyribonucleic acid

RNA - Ribonucleic acid

mRNA - Messenger ribonucleic acid

bp - base pair

PCR - Polymerase chain reaction

ml - millilitre, mΐ - microlitre

mm3 - cubic millimetre

1— litre

pg - microgram

mg - milligram

g - gram

mM - micromol

mM - millimol

min - minute

s - second

rpm - rotations per minute

nm - nanometre

cm - centimetre

mW - milliwatt

RFU - Relative fluorescence unit

PBS - Phosphate buffered saline List of references

1. Draft Guideline on the quality, non-clinical and clinical aspects of gene therapy medicinal products, http://www.ema.europa.eu/docs/en_GB/document_library/Scientific_guideline/201 5/05/WC500187020.pdf.

2. Guideline on the quality, non-clinical and clinical aspects of gene therapy medicinal Products EMA/C AT/80183/2014.

3. Homstein BD, Roman D, Arevalo-Soliz LM, Engevik MA, Zechiedrich L. Effects of Circular DNA Length on Transfection Efficiency by Electroporation into HeLa Cells. Cena V, ed. PLoS ONE. 2016;1 l(12):e0167537.

4. Kong, Q. et al. Oral immunization with hepatitis B surface antigen expressed in transgenic plants. Proceedings of the National Academy of Sciences 98, 11539 - 11544 (2002).

5. Kosciahska E, Wypijewski K. Electroporated intact BY-2 tobacco culture cells as a model of transient expression study. Acta Biochim Pol. 2001;48(3):657-61.

6. Li L, Petrovsky N. Molecular mechanisms for enhanced DNA vaccine immunogenicity. Expert Rev Vaccines. 2016;15(3):313-29.

7. Mairhofer J, Grabherr R. Rational vector design for efficient non- viral gene delivery: challenges facing the use of plasmid DNA. Mol Biotechnol. 2008.39(2):97-104.

8. Paolis A, Frugis G, Giannino D, Iannelli MA, Mele G, Rugini E, Silvestri C, Sparvoli F, Testone G, Mauro ML, Nicolodi C, Caretto S. Plant Cellular and Molecular Biotechnology: Following Mariotti's Steps. Plants (Basel). 2019 Jan 10;8(1).

9. Reflection paper on design modifications of gene therapy medicinal products during development / 14 December 2011 EMA/CAT/GTWP/44236/2009 Committee for advanced therapies.

10. Molecular Biology, 2011, Vol. 45, No. 1, p. 44-55

Claims

1. Gene therapy DNA vector VTvafl7-Actl-Cas9 based on the gene therapy DNA vector VTvafl7 carrying the Cas9 therapeutic gene for the heterologous expression of this therapeutic gene in the plant cells during the editing of plant genomes, while gene therapy DNA vector VTvafl7-Actl-Cas9 has the nucleotide sequence SEQ ID No. 1.

2. Gene therapy DNA vector VTvafl7-Actl-Cas9 as per claim 1. Said gene therapy DNA vector is unique due to the fact that due to the limited size of VTvafl7-Actl vector part not exceeding 3200 bp it has the ability to efficiently penetrate into human and animal cells and express the Cas9 therapeutic gene cloned to it.

3. A method of production of gene therapy DNA vector VTvafl7-Actl- Cas9 as per claim 1 that involves obtaining the DNA vector VTvafl7-Actl by replacing the promoter region of the human EFla gene in the VTvafl7 vector with the promoter region of the rice actin 1 gene (Actl). Then the coding region of the therapeutic Cas9 gene is cloned to the DNA vector VTvafl7-Actl, and gene therapy DNA vector VTvafl7-Actl-Cas9 is produced.

4. The use of gene therapy DNA vector VTvafl7-Actl-Cas9 as per claim 1 for safe editing of plant genomes due to the fact that the gene therapy DNA vector VTvafl7-Actl-Cas9 contains no nucleotide sequences of viral origin and no antibiotic resistance genes.

5. A method of usage of gene therapy DNA vector VTvafl7-Actl-Cas9 as per claim 1, 4 for the heterologous expression of said therapeutic gene in plant cells in the genome editing of plants that involves injection of the gene therapy DNA vector as per claim 1 into cells, organs, and tissues of plants together with gRNA molecules or gene constructs providing gRNA expression or a combination of the indicated methods.

6. Escherichia coli strain SCSI 10-AF/VTvafl7-Actl-Cas9 carrying the gene therapy DNA vector VTvafl7-Actl-Cas9 as per claim 1 for its production that allows for antibiotic-free selection.

7. A method of production of Escherichia coli strain SCSI 10-AF/VTvafl7- Actl-Cas9 as per claim 6 that involves electroporation of competent cells of

Escherichia coli strain SCS110-AF by the gene therapy DNA vector VTvafl7- Actl-Cas9 as per claim 1 and subsequent selection of stable clones of the strain using selective medium.

8. A method of production on an industrial scale of gene therapy DNA vector VTvafl7-Actl-Cas9 as per claim 1 that involves scaling-up the bacterial culture of Escherichia coli strain SCSI 10-AF/VTvafl7-Actl-Cas9 as per claim 7 to the quantities necessary for increasing the bacterial biomass in an industrial fermenter, after which the biomass is used to extract a fraction containing the therapeutic DNA product, i.e. the gene therapy DNA vector VTvafl7-Actl-Cas9 as per claim 1, and then multi-stage filtered, and purified by chromatographic methods.