RU2774352C2 - Dna vector gdtt1.8nas12-ang for increasing level of expression of target gene ang in human and animal organism, its application method - Google Patents

Abstract

FIELD: biotechnology.

SUBSTANCE: invention relates to the field of biotechnology, specifically to the production of genetically engineered therapeutic drugs; it can be used in medicine for increasing the level of expression of a target gene ANG in a human and animal organism. A DNA vector GDTT1.8NAS12-ANG is constructed with a size of 3033 bps, with a nucleotide sequence SEQ ID NO:1 and the general structure represented in the fig.1A.

EFFECT: invention provides for the achievement of a therapeutic effect by administration of a genetically therapeutic DNA vector with a target gene of angiogenin to cells of an animal and human organism, characterized by reduced or insufficient expression of protein encoded by this gene.

3 cl, 15 dwg, 20 ex

Description

Technical field

The invention relates to genetic engineering and can be used in biotechnology, medicine and agriculture to create gene therapy drugs. That is, the created gene therapy DNA vector with the target gene can be used to introduce into cells of the body of animals and humans characterized by reduced or insufficient expression of the protein encoded by this gene, thus ensuring the achievement of a therapeutic effect.

State of the art

Gene therapy is a modern medical approach to the treatment of hereditary and acquired diseases, which consists in correcting a genetic defect or compensating or suppressing the function of a mutant gene by introducing new genetic material into the patient's cells, tissues, organs. The goal of gene therapy, in most cases, is to ensure the required level of expression (transcription and subsequent translation) of the protein molecules encoded by these genes.

Vascularization of tissues is necessary when restoring blood circulation in damaged or ischemic tissues and organs and can be carried out by vasculogenesis and angiogenesis. Vasculogenesis is the formation of blood vessels from mesenchymal cells in embryogenesis (embryonic vasculogenesis) or endothelial progenitor cells migrating from the red bone marrow in the postnatal period (postnatal vasculogenesis). Angiogenesis is the process of formation of new blood vessels in an already existing vascular system, which plays an important role in the development and normal growth of tissues, wound healing, the reproductive cycle in women (development of the placenta and corpus luteum, ovulation). Vascularization is also involved in the pathogenesis of various diseases.

There is an association of insufficient concentrations of proteins such as vascular endothelial growth factor A, angiogenin, angiopoietin 1, and hypoxia-induced factor with various diseases. In turn, insufficient concentrations of these proteins are due to insufficient/absent expression of the corresponding genes - VEGFA, ANG, ANGPT1, HIF1α .

Members of the vascular endothelial growth factor (VEGF) family of proteins play a key role in the formation of the vasculature. The VEGF family includes 5 members VEGFA, VEGFB, VEGFC, VEGFD. VEGFA binds to the VEGFR-1 and VEGFR-2 receptors. VEGF-A stimulates the proliferation, migration and survival of endothelial cells. Most of its effects are associated with the activation of VEGFR-2 receptors. Inactivation of a single VEGF allele in laboratory animals leads to haplo-deficiency-related embryonic death due to anomalies in the development of blood vessels around the 9th day of pregnancy. At the same time, the differentiation of angioblasts is not disturbed, but the formation of lumen of vessels and anastomoses is impaired, and hence effective angiogenesis. VEGF inactivation during postnatal development leads to disruption of postnatal vascular development and endothelial viability, increases mortality, retards growth, and disrupts the development of the liver, heart, and kidneys (Kozyreva E.V., Davidyan L.Yu. https://www.science-education .ru/ru/article/view?id=20811). The use of VEGF in experimental animal models of lower extremity ischemia and ischemic myocardial injury showed results in the form of an increase in the density of the network of vessels in the microvasculature due to the formation of collaterals in tissues damaged by hypoxia [48–51].

The angiogenin protein encoded by the ANG gene is one of the key factors of angiogenesis, a powerful mediator of the formation of new blood vessels in normal and tumor tissues. It belongs to the ribonuclease A superfamily and, unlike other angiogenesis factors, has RNase activity. The mature peptide also has antimicrobial activity against several bacteria and fungi, including S. pneumoniae and C. albicans. Endogenous angiogenin is required for cell proliferation induced by other proteins such as VEGF. As with VEGF, angiogenin expression can be induced by a state of hypoxia. Angiogenin interacts with actin on the surface of endothelial cells and is transported to the cell nucleus by endocytosis, which further leads to stimulation of cell migration, invasion, and proliferation. Its in vivo activity is regulated by interaction with the RNH1 receptor. Angiogenin is also able to bind follistatin. The absence of the ANG allele in transgenic mice enhances certain aspects of aging, namely the level of endothelial dysfunction, vascular remodeling, and leukocyte invasion of cardiovascular tissues. Mutant lines also showed bradykinin-induced vasoconstriction [PMID: 12429206], [PMID: 11579147], [PMID: 14732290], [PMID: 10754271], [PMID: 18760274].

Angiopoietins ANGPT1 and ANGPT2 mediate their action through endothelial cell Tie-2 receptors. ANGPT1 promotes the survival of endothelial cells, the formation of contacts between them, interaction with pericytes, which stabilizes the formed vessels.

Hypoxia inducible factor (HIF1α), similar to VEGF and ANG, is activated with a decrease in oxygen tension in the blood and plays a major role in the body's systemic response to hypoxia, is synthesized in many body tissues, including nervous tissue, where its expression is maximum in neurons . HIF1α induces the transcription of more than 60 genes, including VEGF and erythropoietin, involved in both angiogenesis and erythropoiesis, which promotes and increases oxygen delivery to hypoxic regions. The HIF1α protein also induces the transcription of genes involved in cell proliferation and survival, in glucose and iron metabolism.

The role of genes selected from the group of genes ANG, ANGPT1, VEGFA, HIF1α is not limited to participation in vascularization processes. The association of low/insufficient concentrations of the corresponding proteins (vascular endothelial growth factor A, angiogenin, angiopoietin 1, and hypoxia-induced factor) with various diseases was shown, which, in some cases, was confirmed by impaired expression of the genes encoding these proteins.

In ANG knockout mice, there is an increase in the production of active oxygen species compared to the wild type, and an increased sensitivity to oxidative stress agents, hydrogen peroxide, a tendency to develop reperfusion syndrome, and cold brain damage. As well as an increased level of oxidative damage to mitochondrial DNA, structural abnormalities in myocytes and mitochondria of the heart. It is suggested that ANG plays an important role in protecting cardiac mitochondria from damage during reoxygenation in vivo [PMID: 12429206], [PMID: 11579147], [PMID: 14732290], [PMID: 10754271], [PMID: 18760274].

Inhibition of the function of the VEGFA gene can lead to infertility due to blockage of the function of the corpus luteum (Kozyreva E.V., Davidyan L.Yu. https://www.science-education.ru/ru/article/view?id=20811).

Thus, the prior art indicates that mutations in the ANG, ANGPT1, VEGFA, HIF1α genes, or insufficient expression of the proteins encoded by these genes, are associated with the development of a spectrum of diseases, including, but not limited to pathologies such as impaired hematopoiesis , infertility, ischemic lesions of the myocardium, brain and muscles of the lower extremities, cancerous tumors, disorders of ontogenesis and neurogenesis, Parkinson's disease, liver fibrosis, pulmonary hypertension, neurodegenerative diseases, in particular amyotrophic lateral sclerosis (ALS) and other pathological conditions. This is due to the association of the ANG, ANGPT1, VEGFA, HIF1α genes within the framework of this patent into a group of genes. Genetic constructs that provide the expression of proteins encoded by the ANG, ANGPT1, VEGFA, HIF1α genes, which are part of a group of genes, as part of one or another gene therapy vector, can be used to develop drugs for the treatment of various diseases, including, but not limited to pathologies such as impaired hematopoiesis, infertility, ischemic lesions of the myocardium, brain and muscles of the lower extremities, cancerous tumors, disorders of ontogenesis and neurogenesis, Parkinson's disease, liver fibrosis, pulmonary hypertension, neurodegenerative diseases, in particular amyotrophic lateral sclerosis (ALS) and other pathological states.

Moreover, these data indicate that the underexpression of proteins encoded by the ANG, ANGPT1, VEGFA, and HIF1α genes included in the group of genes is associated not only with pathological conditions, but also with a predisposition to their development. The data also indicate that the underexpression of proteins encoded by the ANG, ANGPT1, VEGFA, HIF1α genes may not manifest itself explicitly in the form of a pathology that can be unambiguously described within existing clinical practice standards (for example, using the ICD code ), but at the same time cause conditions that are unfavorable for humans and animals and are associated with a deterioration in the quality of life.

Thus, an increase in the expression of a gene selected from the group of ANG, ANGPT1, VEGFA, HIF1α genes and introduced into the body by a gene therapy method is relevant for the correction of human and animal conditions associated with impaired expression of the above genes.

For the purposes of gene therapy, gene therapy vectors are used, which are divided into viral and non-viral vectors. Among non-viral systems for the delivery of genetic material, the leading place belongs to plasmid vectors. Plasmid vectors are devoid of the shortcomings inherent in viral vectors: 1) Intracellular existence in the episomal form excludes the integration of the plasmid vector into the genome of the target cell; 2) Immunization and adverse reactions after the introduction of the plasmid vector are absent (Li L, Petrovsky N. Molecular mechanisms for enhanced DNA vaccine immunogenicity. Expert Rev Vaccines. 2016;15(3):313-29); 3) The production of the plasmid vector is economically advantageous.

At the same time, there are limitations for the use of plasmid vectors for gene therapy: 1) the presence of antibiotic resistance genes for development in carrier strains, 2) the presence of various regulatory elements represented by sequences of viral genomes, 3) the size of the therapeutic plasmid vector, which determines the efficiency of vector penetration into target cell.

When developing plasmid vectors for gene therapy, the following points should be taken into account: 1) The European Medicines Agency prescribes that it is necessary to avoid introducing antibiotic resistance markers into developed plasmid vectors for gene therapy (Reflection paper on design modifications of gene therapy medicinal products during development / 14 December 2011 EMA/CAT/GTWP/44236/2009 Committee for advanced therapies); 2) it is recommended to avoid the presence of regulatory elements in therapeutic plasmid vectors to increase the expression of target genes (promoters, enhancers, post-translational regulatory elements) that are parts of viral genomes (Guideline on the quality, non-clinical and clinical aspects of gene medicinal therapy products / 23 March 2015, EMA/CAT/80183/2014, Committee for Advanced Therapies); 3) the plasmid vector should not be overloaded with non-functional regions that increase its size and, consequently, reduce the efficiency of penetration into the target cell (Mairhofer J, Grabherr R. Rational vector design for efficient non-viral gene delivery: challenges facing the use of plasmid DNA Mol Biotechnol 2008.39(2):97-104).

There is a known method for the accumulation of plasmid vectors in Escherichia coli strains without the use of antibiotics (Cranenburgh RM, Hanak JA, Williams SG, Sherratt DJ. Escherichia coli strains that allow antibiotic-free plasmid selection and maintenance by repressor titration. Nucleic Acids Res. 2001. 29(5 ):E26). Escherichia coli strains DH1lacdapD and DH1lacP2dapD were created, in which the dapD gene encoding the enzyme 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate-N-succinyltransferase, which is involved in the biosynthesis of L-lysine, is under the control of the lac promoter. In the absence of the inducer IPTG (isopropyl-β-D-1-thiogalactopyranoside), these strains are susceptible to lysis. However, when a multicopy vector pORT containing the lac operator is introduced, expression of the dapD gene is induced and thus transformed clones can be selected and propagated. However, these strains are characterized by a low level of transformation and its instability.

A solution is known according to patent application RU2011152377A, which describes the production of an expression plasmid vector without antibiotic resistance, which contains a polynucleotide sequence encoding a repressor protein. Expression of said repressor protein regulates the expression of a toxic gene product inserted into a region of the E. coli genome. However, like all selection methods based on the use of repressor proteins, this method is notable for the instability of transformation and its low efficiency.

US9644211B2 describes the production of a minimally sized vector. This vector does not contain bacterial genomic sequences and is produced by paraA-mediated recombination in a specially prepared E. coli strain. The disadvantage of this method of obtaining the minimum size of the vector is the impossibility of its use when scaling production.

It is known to obtain gene therapy vectors, which include nucleotide sequences encoding proteins of vascularization of human tissues.

Patent RU 2678756 describes a gene therapy DNA vector VTvaf17 with a size of 3165 bp, intended for genetic modification of animal and human cells, a method for obtaining a gene therapy DNA vector VTvaf17, Escherichia coli SCS110-AF strain, a method for obtaining Escherichia coli SCS 110-AF strain for the development of the gene therapy DNA vector VTvaf17.

The disadvantage of this invention is the significant size of the vector part, which may adversely affect the efficiency of delivery of the DNA vector into cells.

RF patent 2491097 describes a pharmaceutical composition for the treatment of neurodegenerative diseases, in particular amyotrophic lateral sclerosis (ALS), containing an effective amount of an adenoviral vector made in the form of a non-replicating nanoparticle based on the genome of human adenovirus serotype 5 with an insertion of the human angiogenin ANG gene producing in the human body, angiogenin and non-replicating nanoparticles based on the genome of human adenovirus serotype 5 with the insertion of the human vascular endothelial growth factor gene VEGF, which produces vascular endothelial growth factor in the human body. At the same time, the human angiogenin gene and the human vascular endothelial growth factor gene were cloned into two expression cassettes of one non-replicating nanoparticle based on the human adenovirus serotype 5 genome. A method for treating ALS is also described, which consists in administering a therapeutically effective dose of the specified pharmaceutical composition to a person.

RF patent 2522778 describes an agent for the treatment of ischemic tissue lesions, which is a mixture with a ratio of 1 ÷ 0.5-3 from two cultures of mesenchymal stem cells, one of which is modified with a genetic construct based on a viral vector that provides hyperproduction of the vascular endothelial growth factor VEGF, and the other is modified with a genetic construct based on a viral vector that provides hyperproduction of angiopoietin ANGPT1. Also described is a method for the treatment of ischemic tissue lesions, which consists in the introduction by several injections (chopping) directly into the ischemic tissue, for example, limb muscles or myocardium, in a culture medium that does not contain serum, a mixture of cultures of modified mesenchymal stem (stromal) cells hyperproducing VEGF and ANGPT1 at concentrations from 3 to 100 million cells per 1 ml of solution.

Genetically modified mesenchymal adipose tissue stromal cells were obtained by transforming these cells with a recombinant adeno-associated viral vector serotype 2 - AAV Helper-Free System (Stratagene, USA), into which an optimized human VEGF 165 gene and an optimized ANGPT1 gene were inserted.

The invention RF 2170104 relates to a new in vivo method for the presentation and direct transfer of DNA encoding the desired healing protein in mammalian repair cells. The method involves implanting a matrix containing the desired DNA into a fresh wound. Repair cells, normally originating in viable tissue surrounding a wound, proliferate and migrate into a gene-activated matrix where they collide, engulf and express DNA. Therefore, transfected repair cells act as bioreactors in situ (localized within the wound) producing agents (RNA, encoded DNA, proteins, etc.) that heal the wound. This invention relates to pharmaceutical compositions that can be used in the implementation of the invention, i. when transferring the desired DNA. Such compositions include a suitable template in combination with the desired DNA. DNA molecules can encode various factors that promote wound healing, including extracellular, cell-surface and intracellular RNAs and proteins. As a target gene, for example, the hepatocyte growth factor (HGF) gene; platelet growth factor (PDGF) gene; genes for major fibroblast growth factors (FGF1, FGF2, etc.); vascular endothelial growth factor gene (VEGF), etc.

DNA encoding the desired translational or transcriptional products can be recombinantly inserted into numerous vector systems that allow large-scale DNA replication to generate gene-activated templates. Useful vectors include, but are not limited to, vectors derived from recombinant bacteriophage DNA, plasmid DNA, or cosmid DNA. For example, plasmid vectors such as pBR322, pUC 19/18, pUC 118, 119 and the M13 mr series of vectors can be used. Bacteriophage vectors may include in vivo gene transfer for wound healing gt10, in vivo gene transfer for wound healing gt11, in vivo gene transfer for wound healing gt18-23, in vivo gene transfer methods for wound healing, as well as a series of bacteriophage vectors EMBL. Useful cosmid vectors include, but are not limited to, pJB8, pCV 103, pCV 107, pCV 108, pTM, pMCS, pNNL, pHSG274, COS202, COS203, pWE15, pWE16, and the Charomide 9 vector series. Alternatively, recombinant viral vectors can be constructed. including, but not limited to, vectors derived from viruses such as herpesvirus, retroviruses, vaccine viruses, adenoviruses, adeno-associated viruses, or bovine papillomavirus. Although integrating viruses can be used, non-integrating systems that do not transfer the gene product to daughter cells for many generations are preferred for wound healing. Thus, the gene product is expressed during the wound healing process, and as the gene is diluted in successive generations, the amount of gene product expressed decreases.

The closest analogue of the present invention in terms of the use of recombinant DNA vectors for gene therapy is patent, US9550998 (B2), which describes a method for obtaining a recombinant vector for genetic immunization. The resulting vector is a supercoiled plasmid DNA vector designed for the expression of cloned genes in animal and human cells. The vector consists of the region of the origin of replication (origin), regulatory elements, including the promoter and enhancer of the human cytomegalovirus, regulatory elements from the human T-lymphotropic virus. The accumulation of the vector is carried out in a special strain of E. coli without the use of antibiotics due to the antisense complementation of the sacB gene introduced into the strain by means of a bacteriophage. The limitation of the use of this DNA vector for genetic therapy is the presence of regulatory elements in its composition, which are sequences of viral genomes.

Disclosure of invention

The objective of the invention is to design gene therapy DNA vectors to increase the level of expression of the ANG, ANGPT1, VEGFA, HIF1α gene group, which is necessary for the treatment of diseases characterized by impaired vasculogenesis and angiogenesis, with hypoxia and ischemia of various tissues, including the brain and spinal cord, for stimulation sprouting and formation of new blood vessels in damaged tissues, including diabetes, oncological and neurodegenerative diseases, by increasing the expression level of the target gene ANG, or ANGPT1, or VEGFA, or HIF1α, in humans and animals,

while combining the following properties:

I) the effectiveness of gene therapy DNA vector to increase the level of expression of target genes in eukaryotic cells;

II) the possibility of safe use for genetic therapy in humans and animals due to the absence of regulatory elements in the composition of the gene therapy DNA vector, which are the nucleotide sequences of viral genomes;

III) the possibility of safe use for genetic therapy in humans and animals due to the absence of antibiotic resistance genes in the gene therapy DNA vector;

IV) manufacturability and the possibility of developing a gene therapy DNA vector on an industrial scale.

Paragraphs II and III are provided for in this technical decision in accordance with the recommendations of state regulators for drugs for gene therapy, in particular, the European Medicines Agency regarding the refusal to introduce antibiotic resistance markers into developed plasmid vectors for gene therapy (Reflection paper on design modifications of gene therapy medicinal products during development / 14 December 2011, EMA/CAT/GTWP/44236/2009 Committee for advanced therapies) and regarding the refusal to introduce elements of viral genomes into the developed plasmid vectors for gene therapy (Guideline on the quality, non-clinical and clinical aspects of gene therapy medicinal products / 23 March 2015, EMA/CAT/80183/2014, Committee for Advanced Therapies).

It is also an object of the invention to design strains carrying these gene therapy DNA vectors for the development and commercial production of gene therapy DNA vectors.

The technical result is achieved due to the fact that a group of gene therapeutic DNA vectors based on the gene therapeutic DNA vector GDTT1.8NAS12 has been created for the treatment of diseases characterized by impaired vasculogenesis and angiogenesis, during hypoxia and ischemia of various tissues, including the brain and spinal cord, for stimulation sprouting and formation of new blood vessels in damaged tissues, including diabetes, oncological and neurodegenerative diseases, by increasing the expression level of the target gene ANG, or ANGPT1, or VEGFA, or HIF1α in humans and animals.

This is a gene therapy DNA vector that contains the coding portion of the target ANG gene cloned into the gene therapy DNA vector GDTT1.8NAS12 to obtain the gene therapy DNA vector GDTT1.8NAS12-ANG, with the nucleotide sequence of SEQ ID No. 1;

a gene therapy DNA vector that contains the coding portion of the target ANGPT1 gene cloned into a gene therapy DNA vector GDTT1.8NAS12 to obtain a gene therapy DNA vector GDTT1.8NAS12-ANGPT1 with the nucleotide sequence of SEQ ID No. 2;

a gene therapy DNA vector that contains the coding portion of the target VEGFA gene cloned into the gene therapy DNA vector GDTT1.8NAS12 to obtain a gene therapy DNA vector GDTT1.8NAS12-VEGFA with the nucleotide sequence of SEQ ID No. 3;

a gene therapy DNA vector that contains the coding portion of the target HIF1α gene cloned into the gene therapy DNA vector GDTT1.8NAS12 to obtain a gene therapy DNA vector GDTT1.8NAS12-HIF1α with the nucleotide sequence of SEQ ID No. 4.

Each gene therapy DNA vector based on the gene therapy DNA vector GDTT1.8NAS12 from the group carrying the target gene ANG, ANGPT1, VEGFA, HIF1α, namely, the gene therapy DNA vector GDTT1.8NAS12-ANG, or GDTT1.8NAS12-ANGPT1, or GDTT1 .8NAS12-VEGFA, or GDTT1.8NAS12-HIF1α, due to the limited size of the GDTT1.8NAS12 vector part, which does not exceed 2600 bp, has the ability to effectively penetrate into human and animal cells and express the cloned target gene ANG, or ANGPT1, or VEGFA or HIF1α.

A gene therapy DNA vector based on the GDTT1.8NAS12 gene therapy DNA vector carrying the target gene ANG, or ANGPT1, or VEGFA, HIF1α as part of each of the group of created gene therapy DNA vectors: GDTT1.8NAS12-ANG, or GDTT1.8NAS12-ANGPT1, or GDTT1.8NAS12-VEGFA, or GDTT1.8NAS12-HIF1α, has as structural elements nucleotide sequences that are not antibiotic resistance genes, viral genes and regulatory elements of viral genomes, thus ensuring the possibility of its safe use for human and animal genetic therapy.

A method for obtaining a gene therapy DNA vector based on the GDTT1.8NAS12 gene therapy DNA vector carrying a target gene from the ANG gene group, or ANGPT1, or VEGFA, or HIF1α, was also created, which consists in the fact that each of the gene therapy DNA vectors: GDTT1. 8NAS12-ANG, or GDTT1.8NAS12-ANGPT1, or GDTT1.8NAS12-VEGFA, or GDTT1.8NAS12-HIF1α is obtained as follows: the coding portion of the target gene ANG, or ANGPT1, or VEGFA, or HIF1α is cloned into the GDTT1 gene therapy DNA vector. 8NAS12 and receive a gene therapy DNA vector GDTT1.8NAS12-ANG, SEQ ID no. 1, or GDTT1.8NAS12-ANGPT1, SEQ ID no. 2 or GDTT1.8NAS12-VEGFA, SEQ ID no. No. 4, respectively, while the coding part of the target gene ANG, or ANGPT1, or VEGFA, or HIF1α is obtained by isolating total RNA from a biological sample of human tissue, followed by a reverse transcription reaction and PCR amplification using the created oligonucleotides and cleavage the amplification product with the corresponding restriction endonucleases, and cloning into the GDTT1.8NAS12 gene therapy DNA vector is carried out at the restriction sites SalI and KpnI, or BamHI and HindIII, or BamHI and KpnI, and the selection is carried out without antibiotics,

at the same time, when obtaining a gene therapy DNA vector GDTT1.8NAS12-ANG, SEQID No. 1 for carrying out the reverse transcription reaction and PCR amplification, oligonucleotides are used as the oligonucleotides created for this

AN_FTTTGTCGACCACCATGGTGATGGGCCTGGGCGTT

AN_RAATGGTACCTTACGGACGACGGAAAATTGACTG,

and cleavage of the amplification product and cloning of the coding part of the ANG gene into the gene therapy DNA vector GDTT1.8NAS12 is carried out using restriction endonucleases SalI and KpnI,

moreover, when obtaining a gene therapy DNA vector GDTT1.8NAS12-ANGPT1, SEQID No. 2 for carrying out the reverse transcription reaction and PCR amplification, oligonucleotides are used as the oligonucleotides created for this

ANPT_FTTTGTCGACCACCATGACAGTTTTCCTTTCCTTTGCTTTCC

ANPT_RAATGGTACCTCAAAAATCTAAAGGTCGAATCATCATAGTTG,

and cleavage of the amplification product and cloning of the coding part of the ANGPT1 gene into the gene therapy DNA vector GDTT1.8NAS12 is carried out using restriction endonucleases SalI and KpnI,

moreover, upon receipt of the gene therapeutic DNA vector GDTT1.8NAS12-VEGFA, SEQID No. 3 for carrying out the reverse transcription reaction and PCR amplification, oligonucleotides are used as the oligonucleotides created for this

VEG_FGGGGGATCCACCATGACGGACAGACAGACAGACACCGC

VEG_RTTTAAGCTTTCACCGCCTCGGCTTGTCACATCTG,

and the cleavage of the amplification product and cloning of the coding part of the VEGFA gene into the gene therapy DNA vector GDTT1.8NAS12 is carried out using restriction endonucleases BamHI and HindIII,

moreover, when obtaining a gene therapy DNA vector GDTT1.8NAS12-HIF1α, SEQID No. 4 for carrying out the reverse transcription reaction and PCR amplification, oligonucleotides are used as the oligonucleotides created for this

HIF_FAGGATCACCATGGAGGGCGCCGGCGGCGCGA

HIF_RAATGGTACCTCAGTTAACTTGATCCAAAGCTCTGAGTAATTC,

and cleavage of the amplification product and cloning of the coding part of the HIF1α gene into the gene therapy DNA vector GDTT1.8NAS12 is carried out using restriction endonucleases BamHI and KpnI.

The method of using the created gene therapeutic DNA vector based on the GDTT1.8NAS12 gene therapeutic DNA vector carrying the target gene from the ANG gene group, or ANGPT1, or VEGFA, or HIF1α for the treatment of diseases characterized by impaired vasculogenesis and angiogenesis, during hypoxia and ischemia of various tissues, in including the brain and spinal cord, to stimulate the germination and formation of new blood vessels in damaged tissues, including diabetes, cancer and neurodegenerative diseases, by increasing the expression level of the target gene ANG, or ANGPT1, or VEGFA, or HIF1α in humans and animals , consists in transfection with a gene therapy DNA vector selected from the group, carrying a target gene based on the gene therapy DNA vector GDTT1.8NAS12, or several gene therapy DNA vectors selected from the group, carrying target genes based on the gene therapy DNA vector GDTT1.8NAS12, of organ cells and tissues of the patient or animal, and / or in the introduction into the organs and tissues of a patient or animal of autologous cells of this patient or animal, transfected with a gene therapy DNA vector selected from the group, carrying a target gene based on the gene therapy DNA vector GDTT1.8NAS12 or several gene therapy DNA vectors selected from the group, carrying the target genes based on the gene therapy DNA vector GDTT1.8NAS12, and/or in the introduction into the organs and tissues of a patient or animal of the selected gene therapy DNA vector carrying the target gene based on the gene therapy DNA vector GDTT1.8NAS12 or several selected gene therapy DNA vectors carrying target genes based on the gene therapy DNA vector GDTT1.8NAS12, from the group of created gene therapy DNA vectors or in combination of the indicated methods.

A method for producing a strain for producing a gene therapy DNA vector for treating diseases characterized by impaired vasculogenesis and angiogenesis, during hypoxia and ischemia of various tissues, including the brain and spinal cord, to stimulate the germination and formation of new blood vessels in damaged tissues, including diabetes, oncological and neurodegenerative diseases, by increasing the expression level of the target gene from the ANG gene group, or ANGPT1, or, VEGFA, or HIF1α in humans and animals, is to obtain electrocompetent cells of the EscherichiacoliJM110-NAS strain, followed by electroporation of these cells with gene therapy DNA- vector GDTT1.8NAS12-ANG, or DNA vector GDTT1.8NAS12-ANGPT1, or DNA vector GDTT1.8NAS12-VEGFA, or DNA vector GDTT1.8NAS12-HIF1α, after which the cells are seeded on Petri dishes with agar selective medium containing yeast extract, peptone, 6% sucrose, plus 10 µg/ml chloramphe nicol to produce Escherichia coli JM110-NAS/GDTT1.8NAS12-ANG or Escherichia coli JM110-NAS/GDTT1.8NAS12-ANGPT1 or Escherichia coli JM110-NAS/GDTT1.8NAS12-VEGFA or Escherichia coli JM110 -NAS/GDTT1.8NAS12-HIF1α.

Claimed strains:

EscherichiacoliJM110-NAS/GDTT1.8NAS12-ANG,

EscherichiacoliJM110-NAS/GDTT1.8NAS12-ANGPT1, EscherichiacoliJM110-NAS/GDTT1.8NAS12-VEGFA, EscherichiacoliJM110-NAS/GDTT1.8NAS12-HIF1α obtained by the above method, carrying gene therapy DNA vector GDTT1.8NAS12-ANG, GDTT1.8NAS12-ANGPT1 , GDTT1.8NAS12-VEGFA, GDTT1.8NAS12-HIF1α, respectively, for their operating time.

A method for industrial-scale production of a gene therapy DNA vector based on the GDTT1.8NAS12 gene therapy DNA vector carrying a target from the ANG gene group, or ANGPT1, or VEGFA, or HIF1α, for the treatment of diseases characterized by impaired vasculogenesis and angiogenesis, during hypoxia and ischemia of various tissues, including the brain and spinal cord, to stimulate sprouting and formation of new blood vessels in damaged tissues, including diabetes, cancer and neurodegenerative diseases, by increasing the expression level of the target gene ANG, or ANGPT1, or VEGFA, or HIF1α in organism of humans and animals is that the gene therapy DNA vector GDTT1.8NAS12-ANG, or the gene therapy DNA vector GDTT1.8NAS12-ANGPT1, or the gene therapy DNA vector GDTT1.8NAS12-VEGFA, or the gene therapy DNA vector GDTT1.8NAS12 - HIF1α, is obtained by inoculating into a flask with a prepared medium a seed culture selected from EscherichiacoliJM110-NAS/GDTT1.8NAS12-ANG strain, or EscherichiacoliJM110-NAS/GDTT1.8NAS12-ANGPT1 strain, or EscherichiacoliJM110-NAS/GDTT1.8NAS12-VEGFA strain, or EscherichiacoliJM110-NAS/GDTT1.8NAS12-HIF1α strain, then incubated the seed medium in an incubator shaker and transferred to an industrial fermenter, after which it is grown until a stationary phase is reached, then a fraction containing the target DNA product is isolated, filtered in many stages and purified by chromatographic methods.

The invention is illustrated by drawings, where:

In Fig.1

the scheme of the GDTT1.8NAS12 gene therapy DNA vector carrying the target gene selected from the ANG gene group, or ANGPT1, or VEGFA, or HIF1α, which is a circular double-stranded DNA molecule capable of autonomous replication in cells of Escherichia coli bacteria, is shown.

Figure 1 shows diagrams corresponding to:

A - gene therapy DNA vector GDTT1.8NAS12-ANG,

B - gene therapy DNA vector GDTT1.8NAS12-ANGPT1,

C - gene therapy DNA vector GDTT1.8NAS12-VEGFA,

D - gene therapy DNA vector GDTT1.8NAS12-HIF1α.

The diagrams show the following structural elements of the vector:

EF1a pr is the promoter region of the human elongation factor EF1A gene with its own enhancer contained in the first intron of the gene. Serves to ensure a high level of transcription of the recombinant gene in most human tissues;

target gene reading frame corresponding to the coding portion of the ANG gene (Fig. 1A), or ANGPT1 (Fig. 1B), or VEGFA (Fig. 1C), or HIF1α (Fig. 1D), respectively;

hGHTA - transcription terminator;

pUCori is an origin of replication that serves for autonomous replication with a single nucleotide substitution to increase the copy number of the plasmid in cells of most Escherichiacoli strains;

Unique restriction sites are marked.

Figure 2 shows graphs of the accumulation of mRNA of the target gene, namely the human ANG gene, in the primary culture of human skeletal muscle cells (HSkMC) before their transfection and 48 hours after transfection of these cells with the DNA vector GDTT1.8NAS12-ANG, in order to confirm effectiveness of the gene therapy DNA vector GDTT1.8NAS12-ANG carrying the target ANG gene, where

21 - cDNA of the ANG gene before transfection with the gene therapy DNA vector GDTT1.8NAS12-ANG;

22 - cDNA of the ANG gene after transfection with the gene therapy DNA vector GDTT1.8NAS12-ANG;

23 - cDNA of the B2M gene before transfection with the gene therapy DNA vector GDTT1.8NAS12-ANG;

24 - cDNA of the B2M gene after transfection with the gene therapy DNA vector GDTT1.8NAS12-ANG.

The B2M (Beta-2-microglobulin) gene listed in the GenBank database under the number NM 004048.2 was used as a reference gene.

Figure 3 shows graphs of the accumulation of mRNA of the target gene, namely the human ANGPT1 gene, in human skin fibroblast culture cells (CCD-1079Sk) before transfection and 48 hours after transfection of these cells with the DNA vector GDTT1.8NAS12-ANGPT1, in order to confirmation of the effectiveness of the gene therapy DNA vector GDTT1.8NAS12-ANGPT1 carrying the target ANGPT1 gene, where

31 - cDNA of the ANGPT1 gene before transfection with the gene therapy DNA vector GDTT1.8NAS12-ANGPT1;

32 - cDNA of the ANGPT1 gene after transfection with the gene therapy DNA vector GDTT1.8NAS12-ANGPT1;

33 - cDNA of the B2M gene before transfection with the gene therapy DNA vector GDTT1.8NAS12-ANGPT1;

34 - cDNA of the B2M gene after transfection with the gene therapy DNA vector GDTT1.8NAS12-ANGPT1.

The B2M (Beta-2-microglobulin) gene listed in the GenBank database under the number NM 004048.2 was used as a reference gene.

Figure 4 shows graphs of the accumulation of mRNA of the target gene, namely the human VEGFA gene in human colon epithelial cells (FHC) before transfection and 48 hours after transfection of these cells with the DNA vector GDTT1.8NAS12-VEGFA in order to confirm the effectiveness of gene therapy DNA -vector GDTT1.8NAS12- VEGFA carrying the target VEGFA gene, where

41 - cDNA of the VEGFA gene before transfection with the gene therapy DNA vector GDTT1.8NAS12-VEGFA;

42 - cDNA of the VEGFA gene after transfection with the gene therapy DNA vector GDTT1.8NAS12-VEGFA;

43 - cDNA of the B2M gene before transfection with the gene therapy DNA vector GDTT1.8NAS12-VEGFA;

44 - cDNA of the B2M gene after transfection with the gene therapy DNA vector GDTT1.8NAS12-VEGFA.

The B2M (Beta-2-microglobulin) gene listed in the GenBank database under the number NM 004048.2 was used as a reference gene.

Figure 5 shows graphs of the accumulation of mRNA of the target gene, namely the human HIF1α gene, in a culture of human breast fibroblasts (Hs578 Bst) before transfection and 48 hours after transfection of these cells with the DNA vector GDTT1.8NAS12-HIF1α in order to confirm the effectiveness gene therapy DNA vector GDTT1.8NAS12-HIF1α carrying the target HIF1α gene, where

51 - cDNA of the HIF1α gene before transfection with the gene therapy DNA vector GDTT1.8NAS12-HIF1α;

52 – cDNA of the HIF1α gene after transfection with the gene therapy DNA vector GDTT1.8NAS12-HIF1α;

53 - cDNA of the B2M gene before transfection with the gene therapy DNA vector GDTT1.8NAS12-HIF1α;

54 - cDNA of the B2M gene in cells after transfection with the gene therapy DNA vector GDTT1.8NAS12-HIF1α.

The B2M (Beta-2-microglobulin) gene listed in the GenBank database under the number NM 004048.2 was used as a reference gene.

In FIG. Figure 6 shows a diagram of the angiogenin protein concentration in the primary culture medium of human skeletal muscle cells (HSkMC) after transfection of these cells with the DNA vector GDTT1.8NAS12-ANG, in order to assess the change in the amount of angiogenin protein in the culture medium of primary culture of human skeletal muscle cells (HSkMC) , upon transfection of these cells with the GDTT1.8NAS12-ANG DNA vector carrying the ANG gene, where

culture A 6 - primary culture of human skeletal muscle cells (HSkMC) transfected with an aqueous solution without plasmid DNA (control);

culture B 6 - primary culture of human skeletal muscle cells (HSkMC) transfected with the DNA vector GDTT1.8NAS12;

culture C6 is a primary culture of human skeletal muscle cells (HSkMC) transfected with the GDTT1.8NAS12-ANG DNA vector carrying the ANG gene.

In FIG. 7 is a graph of the concentration of angiopoietin 1 protein in the culture medium of human skin fibroblasts (CCD-1079Sk) after transfection of these cells with the DNA vector GDTT1.8NAS12-ANGPT1, in order to assess the change in the amount of angiopoietin 1 protein in the culture medium of human skin fibroblasts (CCD-1079Sk). ), upon transfection of these cells with the GDTT1.8NAS12-ANGPT1 DNA vector carrying the ANGPT1 gene, where

culture A 7 - culture of human skin fibroblasts (CCD-1079Sk) transfected with an aqueous solution without plasmid DNA (control);

culture B 7 - culture of human skin fibroblasts (CCD-1079Sk) transfected with DNA vector GDTT1.8NAS12;

culture C 7 - culture of human skin fibroblasts (CCD-1079Sk) transfected with the GDTT1.8NAS12-ANGPT1 DNA vector carrying the ANGPT1 gene.

In FIG. Figure 8 shows the concentration of vascular endothelial growth factor A protein in the culture medium of human colon epithelial cells (FHC) after transfection of these cells with the DNA vector GDTT1.8NAS12-VEGFA, in order to assess the change in the amount of vascular endothelial growth factor A protein in the culture medium of epithelial cells human colon (FHC), upon transfection of these cells with the GDTT1.8NAS12-VEGFA DNA vector carrying the VEGFA gene, where

culture A 8 - culture of human colon epithelial cells (FHC) transfected with an aqueous solution without plasmid DNA (control);

culture B 8 - culture of human colonic epithelial cells (FHC) transfected with GDTT1.8NAS12 DNA vector;

culture C 8 - culture of human colonic epithelial cells (FHC) transfected with the GDTT1.8NAS12-VEGFA DNA vector carrying the VEGFA gene.

Figure 9 shows a diagram of the concentration of hypoxia-induced factor 1α protein in the culture medium of human breast fibroblasts (Hs578 Bst) after transfection of these cells with the DNA vector GDTT1.8NAS12-HIF1α, in order to assess the change in the amount of hypoxia-induced factor 1α protein in the fibroblast culture medium human mammary gland (Hs578 Bst), upon transfection of these cells with the GDTT1.8NAS12-HIF1α DNA vector carrying the HIF1α gene, where

culture A 9 - culture of human breast fibroblasts (Hs578 Bst) transfected with an aqueous solution without plasmid DNA (control);

culture B 9 - culture of human breast fibroblasts (Hs578 Bst), transfected with DNA vector GDTT1.8NAS12;

culture C 9 - culture of human breast fibroblasts (Hs578 Bst) transfected with GDTT1.8NAS12-HIF1α DNA vector carrying the HIF1α gene.

Figure 10 shows a diagram of the concentration of angiogenin ANG protein in skin biopsies of three patients after the gene therapy DNA vector GDTT1.8NAS12-ANG was injected into the skin of these patients in order to assess the functional activity, that is, the expression of the target gene at the protein level, and the possibility of increasing the level of expression angiogenin protein using a gene therapy DNA vector based on the GDTT1.8NAS12 gene therapy DNA vector carrying the target ANG gene.

Figure 10 marked the following elements:

P1I - skin biopsy of patient P1 in the area of injection of gene therapy DNA vector GDTT1.8NAS12-ANG;

P1II - skin biopsy of patient P1 in the area of injection of gene therapy DNA vector GDTT1.8NAS12 (placebo);

P1III - skin biopsy of patient P1 from the intact area;

P2I – skin biopsy of patient P2 in the area of injection of gene therapy DNA vector GDTT1.8NAS12-ANG;

P2II - skin biopsy of patient P2 in the area of injection of gene therapy DNA vector GDTT1.8NAS12 (placebo);

P2III - skin biopsy of patient P2 from the intact area;

P3I – skin biopsy of patient P3 in the area of injection of gene therapy DNA vector GDTT1.8NAS12-ANG;

P3II - skin biopsy of patient P3 in the area of injection of gene therapy DNA vector GDTT1.8NAS12 (placebo);

P3III – skin biopsy of patient P3 from the intact area.

In FIG. 11 shows a diagram of VEGFA protein concentration in gastrocnemius muscle biopsies of three patients after injection of the GDTT1.8NAS12-VEGFA gene therapy DNA vector into the gastrocnemius muscle of these patients in order to assess the functional activity, that is, the expression of the target gene at the protein level, and the possibility of increasing the level of protein expression using a gene therapy DNA vector based on the GDTT1.8NAS12 gene therapy DNA vector carrying the target VEGFA gene.

Figure 11 marked the following elements:

P1I - biopsy of the gastrocnemius muscle of patient P1 in the area of injection of the gene therapy DNA vector GDTT1.8NAS12-VEGFA;

P1II - biopsy of the gastrocnemius muscle of patient P1 in the area of injection of the gene therapy DNA vector GDTT1.8NAS12 (placebo);

P1III – biopsy specimen of the intact area of the gastrocnemius muscle of patient P1;

P2I - biopsy of the gastrocnemius muscle of patient P2 in the area of injection of the gene therapy DNA vector GDTT1.8NAS12-VEGFA;

P2II - biopsy of the gastrocnemius muscle of patient P2 in the area of injection of the gene therapy DNA vector GDTT1.8NAS12 (placebo);

P2III – biopsy of the intact area of the gastrocnemius muscle of patient P2;

P3I - biopsy of the gastrocnemius muscle of patient P3 in the area of injection of the gene therapy DNA vector GDTT1.8NAS12-VEGFA;

P3II - biopsy of the gastrocnemius muscle of patient P3 in the area of injection of the gene therapy DNA vector GDTT1.8NAS12 (placebo);

P3III – biopsy of the intact area of the gastrocnemius muscle of patient P3.

Figure 12 shows a diagram of the HIF1α protein concentration in skin biopsies of three patients after the gene therapy DNA vector GDTT1.8NAS12-HIF1α was injected into the skin of these patients in order to assess the functional activity, that is, the expression of the target gene at the protein level, and the possibility of increasing the level of protein expression using a gene therapy DNA vector based on the GDTT1.8NAS12 gene therapy DNA vector carrying the target HIF1α gene.

In Fig.12 the following elements are marked:

P1I - skin biopsy of patient P1 in the area of injection of gene therapy DNA vector GDTT1.8NAS12-HIF1α;

P1II - skin biopsy of patient P1 in the area of injection of gene therapy DNA vector GDTT1.8NAS12 (placebo);

P1III - skin biopsy of patient P1 from the intact area;

P2I - skin biopsy of patient P2 in the area of injection of gene therapy DNA vector GDTT1.8NAS12-HIF1α;

P2II - skin biopsy of patient P2 in the area of injection of gene therapy DNA vector GDTT1.8NAS12 (placebo);

P2III - skin biopsy of patient P2 from the intact area;

P3I - skin biopsy of patient P3 in the area of injection of gene therapy DNA vector GDTT1.8NAS12-HIF1α;

P3II - skin biopsy of patient P3 in the area of injection of gene therapy DNA vector GDTT1.8NAS12 (placebo);

P3III – skin biopsy of patient P3 from the intact area.

In FIG. 13 is a graph showing the concentration of ANGPT1 protein in human skin biopsies after injection into the skin of a culture of autologous fibroblasts transfected with the GDTT1.8NAS12-ANGPT1 gene therapy DNA vector to demonstrate the application method by introducing autologous cells transfected with the GDTT1.8NAS12-ANGPT1 gene therapy DNA vector.

On Fig marked the following elements:

P1A – skin biopsy of patient P1 in the area of injection of a culture of the patient's autogenous fibroblasts transfected with the gene therapy DNA vector GDTT1.8NAS12-ANGPT1;

P1B – skin biopsy of patient P1 in the area of injection of the patient's autogenous fibroblasts transfected with the GDTT1.8NAS12 gene therapy DNA vector;

P1C - skin biopsy of patient P1 from the intact area.

In FIG. 14 shows a diagram of protein concentrations: human ANG protein, human ANGPT1 protein, human VEGFA protein, human HIF1α protein in skin biopsy specimens of rats in the area of injection of a mixture of gene therapy DNA vector GDTT1.8NAS12-ANG, gene therapy DNA vector GDTT1.8NAS12-ANGPT1, gene therapy DNA vector GDTT1.8NAS12-VEGFA, gene therapy DNA vector GDTT1.8NAS12-HIF1α in order to evaluate the effectiveness and demonstrate the method of combined use of gene therapy DNA vectors.

On Fig marked the following elements:

K1I – skin biopsy of K1 rat in the zone of injection of a mixture of gene therapy DNA vectors: GDTT1.8NAS12-ANG, GDTT1.8NAS12-ANGPT1, GDTT1.8NAS12- VEGFA and GDTT1.8NAS12-HIF1α;

K1II - skin biopsy of K1 rat in the area of injection of gene therapy DNA vector GDTT1.8NAS12 (placebo);

K1III - biopsy of the control intact area of the skin of rat K1;

K2I – skin biopsy of K2 rat in the zone of injection of a mixture of gene therapy DNA vectors: GDTT1.8NAS12-ANG, GDTT1.8NAS12-ANGPT1, GDTT1.8NAS12-VEGFA and GDTT1.8NAS12-HIF1α;

K2II - skin biopsy of K2 rat in the area of injection of gene therapy DNA vector GDTT1.8NAS12 (placebo);

K2III - biopsy of the control intact area of the skin of the K2 rat;

K3I – skin biopsy of K3 rat in the zone of injection of a mixture of gene therapy DNA vectors: GDTT1.8NAS12-ANG, GDTT1.8NAS12-ANGPT1, GDTT1.8NAS12- VEGFA and GDTT1.8NAS12-HIF1α;

K3II – skin biopsy of K3 rat in the area of injection of gene therapy DNA vector GDTT1.8NAS12 (placebo);

K3III – biopsy of the control intact area of the skin of the K3 rat.

In FIG. 15 shows graphs of accumulation of target gene VEGFA cDNA amplicons in canine kidney epithelial cells (MDCK) before and 48 hours after transfection of these cells with the DNA vector GDTT1.8NAS12-VEGFA to demonstrate the method of application by introducing the gene therapy DNA vector into animals.

Figure 15 shows the curves of accumulation of amplicons during the reaction, corresponding to:

151 - cDNA of the VEGFA gene in canine kidney epithelial cells (MDCK) before transfection with the gene therapy DNA vector GDTT1.8NAS12-VEGFA;

152 - cDNA of the VEGFA gene in canine kidney epithelial cells (MDCK) after transfection with the gene therapy DNA vector GDTT1.8NAS12-VEGFA;

153 - cDNA of the ACT gene in canine kidney epithelial cells (MDCK) before transfection with the gene therapy DNA vector GDTT1.8NAS12-VEGFA;

154 - cDNA of the ACT gene in canine kidney epithelial cells (MDCK) after transfection with the GDTT1.8NAS12-VEGFA gene therapy DNA vector.

The dog actin gene beta listed in the GenBank database under the number AF484115.1 was used as a reference gene.

Implementation of the invention

Based on the 2591 bp GDTT1.8NAS12 DNA vector. Gene therapy DNA vectors have been created that carry target human genes and are designed to increase the level of expression of these target genes in human and animal tissues. At the same time, the method for obtaining each gene therapeutic DNA vector carrying the target genes consists in cloning the protein coding sequence of the target gene selected from the group of genes into the polylinker of the gene therapeutic DNA vector GDTT1.8NAS12: the ANG gene (encodes the ANG protein), the ANGPT1 gene (encodes ANGPT1 protein), VEGFA gene (encodes VEGFA protein), human HIF1α gene (encodes human HIF1α protein). It is known that the ability of DNA vectors to penetrate into eukaryotic cells is mainly due to the size of the vector. At the same time, DNA vectors with the smallest size have a higher penetrating ability. Thus, it is preferable that the vector contains no elements that do not carry a functional load, but at the same time increase the size of the DNA vector. These features of DNA vectors were taken into account when obtaining a gene therapeutic DNA vector based on the gene therapeutic DNA vector GDTT1.8NAS12 carrying the target gene selected from the group of ANG, ANGPT1, VEGFA, HIF1α genes due to the absence of large non-functional sequences and antibiotic resistance genes in the vector, which allowed, in addition to technological and safety advantages, to significantly reduce the size of the resulting gene therapy DNA vector GDTT1.8NAS12 carrying the target gene selected from the ANG, ANGPT1, VEGFA, HIF1α gene group. Thus, the ability of the resulting gene therapy DNA vector to penetrate into eukaryotic cells is due to its small size.

Each of the group of gene therapy DNA vectors: DNA vector GDTT1.8NAS12-ANG, or GDTT1.8NAS12-ANGPT1, or GDTT1.8NAS12-VEGFA, or GDTT1.8NAS12-HIF1α was obtained as follows: the coding part of the target gene ANG, or ANGPT1, or VEGFA or HIF1α were cloned into the gene therapy DNA vector GDTT1.8NAS12 and the gene therapy DNA vector GDTT1.8NAS12-ANG, SEQ ID No. 1, or GDTT1.8NAS12-ANGPT1, SEQ ID No. 2, or GDTT1.8NAS12-VEGFA, SEQ ID #3, or GDTT1.8NAS12-HIF1α, SEQ ID #4, respectively. The coding part of the 448 bp ANG gene, or the 1501 bp ANGPT1 gene, or the 1242 bp VEGFA gene, or the 2484 bp HIF1α gene. was obtained by isolating total RNA from a biological tissue sample of a healthy person. A reverse transcription reaction was used to obtain the first strand cDNA of the human ANG or ANGPT1 or VEGFA or HIF1α genes. Amplification was carried out using oligonucleotides created for this purpose by chemical synthesis. Cleavage of the amplification product with specific restriction endonucleases was carried out taking into account the optimal procedure for further cloning, and cloning into the GDTT1.8NAS12 gene therapy DNA vector was performed at the restriction sites SalI and KpnI, or BamHI and HindIII, or BamHI and KpnI, located in the polylinker of the GDTT1.8NAS12 vector. The choice of restriction sites was carried out so that the cloned fragment fell into the reading frame of the expression cassette of the GDTT1.8NAS12 vector, while the protein-coding sequence did not contain restriction sites for the selected endonucleases. At the same time, it is clear to specialists in the art that the methodological implementation of obtaining a gene therapy DNA vector GDTT1.8NAS12-ANG, or GDTT1.8NAS12-ANGPT1, or GDTT1.8NAS12-VEGFA, or GDTT1.8NAS12-HIF1α may vary within the framework of the choice of known methods. molecular cloning of genes, which methods fall within the scope of the present invention. For example, different oligonucleotide sequences can be used to amplify the ANG gene, or ANGPT1, or VEGFA, or HIF1α, various restriction endonucleases, or laboratory techniques such as ligase-free gene cloning.

The gene therapy DNA vector GDTT1.8NAS12-ANG, or GDTT1.8NAS12-ANGPT1, or GDTT1.8NAS12-VEGFA, or GDTT1.8NAS12-HIF1α has the nucleotide sequence of SEQ ID No. 1 or SEQ ID No. 2 or SEQ ID No. 3 or SEQ ID No. 4, respectively. At the same time, those skilled in the art are aware of the degeneracy property of the genetic code, from which it follows that the scope of the present invention also includes variants of nucleotide sequences that differ by insertion, deletion or substitution of nucleotides, which do not lead to a change in the polypeptide sequence encoded by the target gene, and/ or do not lead to the loss of functional activity of the regulatory elements of the GDTT1.8NAS12 vector. At the same time, specialists in the art are aware of the phenomenon of genetic polymorphism, from which it follows that variants of the nucleotide sequences of genes from the ANG, ANGPT1, VEGFA, HIF1α gene group, which at the same time encode different amino acid sequence variants of the ANG, ANGPT1 proteins, also fall within the scope of the present invention. , VEGFA, HIF1α, which do not differ from those given in their functional activity under physiological conditions.

The ability to enter eukaryotic cells and the functional activity, i.e. the ability to express the target gene, of the resulting gene therapy DNA vector GDTT1.8NAS12-ANG or GDTT1.8NAS12-ANGPT1 or GDTT1.8NAS12-VEGFA or GDTT1.8NAS12-HIF1α was confirmed by introducing into eukaryotic cells of the resulting vector and subsequent analysis of the expression of specific mRNA and/or protein product of the target gene. The presence of specific mRNA in cells into which the gene therapy DNA vector GDTT1.8NAS12-ANG, or GDTT1.8NAS12-ANGPT1, or GDTT1.8NAS12-VEGFA, or GDTT1.8NAS12-HIF1α was introduced, indicates both the ability of the resulting vector to penetrate into eukaryotic cells, and and its ability to express mRNA of the target gene. At the same time, as is known to specialists in the art, the presence of mRNA of the gene is a prerequisite, but not proof of the translation of the protein encoded by the target gene. Therefore, to confirm the property of the gene therapy DNA vector GDTT1.8NAS12-ANG, or GDTT1.8NAS12-ANGPT1, or GDTT1.8NAS12-VEGFA, or GDTT1.8NAS12-HIF1α to express the target gene at the protein level in eukaryotic cells into which the gene therapy DNA- vector, analyze the concentration of proteins encoded by the target genes using immunological methods. The presence of the ANG protein, or ANGPT1, or VEGFA, or HIF1α confirms the efficiency of expression of target genes in eukaryotic cells and the possibility of increasing the level of protein concentration using a gene therapy DNA vector based on the GDTT1.8NAS12 gene therapy DNA vector carrying a target gene selected from a group of genes ANG, ANGPT1, VEGFA, HIF1α. Thus, to confirm the effectiveness of the expression of the created gene therapy DNA vector GDTT1.8NAS12-ANG carrying the target gene, namely the ANG gene, the gene therapy DNA vector GDTT1.8NAS12-ANGPT1 carrying the target gene, namely the ANGPT1 gene, gene therapy DNA -vector GDTT1.8NAS12-VEGFA carrying the target gene, namely the VEGFA gene, gene therapy DNA vector GDTT1.8NAS12-HIF1α carrying the target gene, namely the HIF1α gene, the following methods were used:

A) real-time PCR - change in the accumulation of cDNA amplicons of target genes in the lysate of human and animal cells after transfection of various human and animal cell lines with gene therapy DNA vectors;

B) Enzyme immunoassay - change in the quantitative level of target proteins in the lysate of human cells after transfection of various human cell lines with gene therapy DNA vectors;

C) enzyme-linked immunosorbent assay - change in the quantitative level of target proteins in the supernatant of biopsy specimens of human and animal tissues after the introduction of gene therapy DNA vectors into these tissues;

D) Enzyme immunoassay - change in the quantitative level of target proteins in the supernatant of biopsy specimens of human tissues after the introduction into these tissues of autologous cells of this person transfected with gene therapy DNA vectors.

To confirm the feasibility of the method of using the created GDTT1.8NAS12-ANG gene therapy DNA vector carrying the target gene, namely the ANG gene, the GDTT1.8NAS12-ANGPT1 gene therapy DNA vector carrying the target gene, namely the ANGPT1 gene, of the gene therapy DNA vector GDTT1.8NAS12-VEGFA carrying the target gene, namely the VEGFA gene, gene therapy DNA vector GDTT1.8NAS12-HIF1α carrying the target gene, namely the HIF1α gene, were performed:

A) transfection with gene therapy DNA vectors of various human and animal cell lines;

B) introducing gene therapy DNA vectors into various human and animal tissues;

C) introducing into animal tissue a mixture of gene therapy DNA vectors;

D) introduction into human tissues of autologous cells transfected with gene therapy DNA vectors.

These methods of application are characterized by the absence of potential risks for human and animal genetic therapy due to the absence of regulatory elements in the DNA gene therapy vector, which are nucleotide sequences of viral genomes, and due to the absence of antibiotic resistance genes in the gene therapy DNA vector, which is confirmed by the absence regions homologous to viral genomes and antibiotic resistance genes in the nucleotide sequences of the gene therapy DNA vector GDTT1.8NAS12-ANG, or the gene therapy DNA vector GDTT1.8NAS12-ANGPT1, or the gene therapy DNA vector GDTT1.8NAS12-VEGFA, or the gene therapy DNA vector GDTT1.8NAS12 -HIF1α (SEQ ID No. 1 or SEQ ID No. 2 or SEQ ID No. 3 or SEQ ID No. 4, respectively).

As known to those skilled in the art, antibiotic resistance genes in DNA gene therapy vectors are used to obtain these vectors in preparative amounts by growing bacterial biomass in a nutrient medium containing a selective antibiotic. Within the framework of the present invention, in order to be able to safely use the GDTT1.8NAS12 gene therapy DNA vector carrying the target ANG or ANGPT1 or VEGFA or HIF1α gene, the use of selective nutrient media containing an antibiotic is not possible. As a technological solution for obtaining a gene therapy DNA vector GDTT1.8NAS12 carrying a target gene selected from the group of genes ANG, ANGPT1, VEGFA, HIF1α for the possibility of scaling up to an industrial scale for obtaining gene therapy vectors, a method is proposed for obtaining strains for the production of these gene therapy vectors based on the bacterium Escherichia coli JM110-NAS. Method for producing Escherichia coli JM110-NAS/GDTT1.8NAS12-ANG strain or Escherichia coli JM110-NAS/GDTT1.8NAS12-ANGPT1 strain or Escherichia coli JM110-NAS/GDTT1.8NAS12-VEGFA strain or Escherichia coli JM110-NAS/ strain GDTT1.8NAS12-HIF1α consists in obtaining competent cells of the Escherichia coli strain JM110-NAS with the introduction into these cells of the GDTT1.8NAS12-ANG gene therapy DNA vector, or the GDTT1.8NAS12-ANGPT1 DNA vector, or the GDTT1.8NAS12-VEGFA DNA vector, or GDTT1.8NAS12-HIF1α DNA vector, respectively, using transformation (electroporation) methods well known to those skilled in the art. The resulting strain of Escherichia coli JM110-NAS/GDTT1.8NAS12-ANG, or strain of Escherichia coli JM110-NAS/GDTT1.8NAS12-ANGPT1, or strain of Escherichia coli JM110-NAS/GDTT1.8NAS12-VEGFA, or strain of Escherichia coli JM110-NAS/ GDTT1.8NAS12-HIF1α is used to generate the gene therapy DNA vector GDTT1.8NAS12-ANG, or GDTT1.8NAS12-ANGPT1, or GDTT1.8NAS12-VEGFA, or GDTT1.8NAS12-HIF1α, respectively, with the possibility of using media without antibiotics.

To confirm the production of Escherichia coli JM110-NAS/GDTT1.8NAS12-ANG, or Escherichia coli JM110-NAS/GDTT1.8NAS12-ANGPT1, or Escherichia coli JM110-NAS/GDTT1.8NAS12-VEGFA, or Escherichia coli JM110- NAS/GDTT1.8NAS12-HIF1α were transformed, selected, and subsequently expanded to isolate plasmid DNA.

To confirm the manufacturability of obtaining and the possibility of scaling up to industrial production of the GDTT1.8NAS12-ANG gene therapy DNA vector carrying the target gene, namely the ANG gene, the GDTT1.8NAS12-ANGPT1 gene therapy DNA vector carrying the target gene, namely the ANGPT1 gene, gene therapy DNA vector GDTT1.8NAS12-VEGFA carrying the target gene, namely, the VEGFA gene gene therapy DNA vector GDTT1.8NAS12-HIF1α, carrying the target gene, namely the HIF1α gene, industrial-scale fermentation of Escherichia coli strain JM110-NAS was carried out /GDTT1.8NAS12-ANG or Escherichia coli JM110-NAS/GDTT1.8NAS12-ANGPT1 or Escherichia coli JM110-NAS/GDTT1.8NAS12-VEGFA or Escherichia coli JM110-NAS/GDTT1.8NAS12-HIF1α, each contains gene therapy DNA vector GDTT1.8NAS12 carrying the target gene, namely ANG, or ANGPT1, or VEGFA, or HIF1α.

A method for scaling up the production of a bacterial mass to an industrial scale for isolating a gene therapy DNA vector GDTT1.8NAS12 carrying a target gene selected from the group of ANG, ANGPT1, VEGFA, HIF1α genes consists in seeding a strain of Escherichia coli JM110-NAS/GDTT1. 8NAS12-ANG, or Escherichia coli JM110-NAS/GDTT1.8NAS12-ANGPT1 strain, or Escherichia coli JM110-NAS/GDTT1.8NAS12-VEGFA strain, or Escherichia coli JM110-NAS/GDTT1.8NAS12-HIF1α strain is incubated in the nutrient medium volume without the content of an antibiotic, providing a suitable dynamics of biomass accumulation, upon reaching a sufficient amount of biomass in the logarithmic growth phase, the bacterial culture is transferred to an industrial fermenter, after which it is grown until the stationary growth phase is reached, then a fraction is isolated containing the target DNA product - the GDTT1 gene therapy DNA vector .8NAS12-ANG or GDTT1 DNA gene therapy vector. 8NAS12-ANGPT1 or GD DNA gene therapy vector TT1.8NAS12-VEGFA or gene therapy DNA vector GDTT1.8NAS12-HIF1α is filtered and purified by chromatographic methods in multiple steps. At the same time, it is clear to those skilled in the art that the conditions for cultivating strains, the composition of nutrient media (excluding the content of antibiotics), the equipment used, DNA purification methods may vary within standard operating procedures depending on a single production line, but known approaches to scaling , industrial production and purification of DNA vectors using Escherichia coli JM110-NAS/GDTT1.8NAS12-ANG strain, or Escherichia coli JM110-NAS/GDTT1.8NAS12-ANGPT1 strain, or Escherichia coli JM110-NAS/GDTT1.8NAS12-VEGFA strain, or Escherichia coli strain JM110-NAS/GDTT1.8NAS12-HIF1α, or fall within the scope of the present invention.

The described disclosure of the invention is confirmed by examples of implementation of the present invention.

The invention is illustrated by the following examples.

Example 1

Obtaining a gene therapy DNA vector GDTT1.8NAS12-ANG carrying the target gene, namely the ANG gene.

The gene therapy DNA vector GDTT1.8NAS12-ANG was constructed by cloning the 448 bp coding portion of the ANG gene. into the DNA vector GDTT1.8NAS12 with a size of 2591 bp. restriction sites SalI and KpnI. The coding part of the ANG gene is 448 bp in size. was obtained by isolating total RNA from a biological sample of human tissue, followed by a reverse transcription reaction using the Mint-2 commercial kit (Evrogen, Russia) and PCR amplification using oligonucleotides:

AN_FTTTGTCGACCACCATGGTGATGGGCCTGGGCGTT

AN_RAATGGTACCTTACGGACGACGGAAAATTGACTG

and a commercial Phusion® High-Fidelity DNA Polymerase kit (New England Biolabs, USA).

The gene therapy DNA vector GDTT1.8NAS12 was constructed by combining six DNA fragments obtained from different sources:

(a) the origin of replication was obtained by PCR amplification of a section of the commercial plasmid pUC19 using oligonucleotides UCori-Bam, UCori-Nco (sequence listing, (1) -(2));

(b) hGH-TA transcription terminator was obtained by PCR amplification of a section of human genomic DNA using hGH-F and hGH-R oligonucleotides (sequence listing, (3) and (4));

(c) the regulatory region of the transposon Tn10 RNA-out was obtained by synthesis from oligonucleotides RO-F, RO-R, RO-1, RO-2, RO-3 (sequence listing, (5) -(9));

(d) a kanamycin resistance gene was obtained by PCR amplification of a section of commercial human plasmid pET-28 using Kan-F and Kan-R oligonucleotides (sequence listing, (10) and (11));

(e) a polylinker was obtained by kination and annealing of four synthetic oligonucleotides MCS1, MCS2, MCS3 and MCS4 (sequence listing, (12) - (15));

(e) The promoter-regulatory region of the human EF1a gene with its own enhancer was obtained by PCR amplification of a region of human genomic DNA using oligonucleotides EF1-Xho and EF1-R (sequence listing, (16) - (17)).

PCR amplification was performed using a commercial Phusion® High-Fidelity DNA Polymerase kit (New England Biolabs) according to the manufacturer's instructions. Fragments (b), (c) and (d) had overlapping regions for the possibility of their combination with subsequent PCR amplification. Fragments (b), (c) and (d) were combined using hGH-F and Kan-R oligonucleotides (sequence listing, (3) and (11)). Further, the resulting DNA fragments were combined by restriction followed by ligation at the BamHI and NcoI sites. The result was a vector that does not yet contain a polylinker. To introduce it, the plasmid was digested with restriction endonucleases at the BamHI and EcoRI sites, followed by ligation with fragment (e). As a result, an intermediate vector of 2408 bp was obtained, carrying the kanamycin resistance gene, yet not containing the promoter-regulatory region of the EF1a elongation factor gene with its own enhancer. The resulting vector was digested with restriction endonucleases at the SalI and BamHI sites, followed by ligation with fragment (e). As a result, a 3608 bp vector carrying a kanamycin resistance gene and a promoter-regulatory region of the EF1a elongation factor gene with its own enhancer was obtained. Next, the kanamycin resistance gene was cleaved at the SpeI restriction sites, after which the remaining fragment was ligated onto itself. Thus, a gene therapy DNA vector GDTT1.8NAS12 of 2591 bp was obtained, which is recombinant, with the possibility of selection without antibiotics. The cleavage of the amplification product of the coding part of the ANG gene and the DNA vector GDTT1.8NAS12 was performed with SalI and KpnI restriction endonucleases (NewEnglandBiolabs, USA).

As a result, a 3033 bp GDTT1.8NAS12-ANG DNA vector was obtained. with the nucleotide sequence of SEQID No. 1 and the general structure shown in figa.

Example 2

Obtaining a gene therapy DNA vector GDTT1.8NAS12-ANGPT1 carrying the target gene, namely the ANGPT1 gene.

The gene therapy DNA vector GDTT1.8NAS12-ANGPT1 was constructed by cloning the 1501 bp coding portion of the ANGPT1 gene. into the DNA vector GDTT1.8NAS12 with a size of 2591 bp. restriction sites SalI and KpnI. The coding part of the ANGPT1 gene is 1501 bp in size. was obtained by isolating total RNA from a biological sample of human tissue, followed by a reverse transcription reaction using the Mint-2 commercial kit (Evrogen, Russia) and PCR amplification using oligonucleotides:

ANPT_FTTTGTCGACCACCATGACAGTTTTCCTTTCCTTTGCTTTCC

ANPT_RAATGGTACCTCAAAAATCTAAAGGTCGAATCATCATAGTTG

and commercial kit Phusion® High-FidelityDNAPolymerase (NewEnglandBiolabs, USA), cleavage of the amplification product and DNA vector GDTT1.8NAS12 was performed with SalI and KpnI restriction endonucleases (NewEnglandBiolabs, USA).

As a result, a 4086 bp GDTT1.8NAS12-ANGPT1 DNA vector was obtained. with the nucleotide sequence of SEQID No. 2 and the general structure depicted in figv.

In this case, the GDTT1.8NAS12 gene therapy DNA vector was constructed according to Example 1.

Example 3

Obtaining a GDTT1.8NAS12-VEGFA DNA vector carrying the target gene, namely the human VEGFA gene.

The GDTT1.8NAS12-VEGFA gene therapy DNA vector was constructed by cloning the 1242 bp coding portion of the VEGFA gene. into the DNA vector GDTT1.8NAS12 with a size of 2591 bp. at the BamHI and HindIII restriction sites. The coding part of the VEGFA gene is 1242 bp in size. was obtained by isolating total RNA from a biological sample of human tissue, followed by a reverse transcription reaction using the Mint-2 commercial kit (Evrogen, Russia) and PCR amplification using oligonucleotides:

VEG_FGGGGGATCCACCATGACGGACAGACAGACAGACACCGC

VEG_RTTTAAGCTTTCACCGCCTCGGCTTGTCACATCTG

and commercial kit Phusion® High-FidelityDNAPolymerase (NewEnglandBiolabs, USA), digestion of the amplification product and DNA vector GDTT1.8NAS12 was performed with BamHI and HindIII restriction endonucleases (NewEnglandBiolabs, USA).

As a result, a 3821 bp GDTT1.8NAS12-VEGFA DNA vector was obtained. with the nucleotide sequence of SEQID No. 3 and the general structure shown in Fig. 1C.

In this case, the GDTT1.8NAS12 gene therapy DNA vector was constructed according to Example 1.

Example 4

Obtaining a gene therapy DNA vector GDTT1.8NAS12-HIF1α carrying the target gene, namely the HIF1α gene.

The GDTT1.8NAS12-HIF1α gene therapy DNA vector was constructed by cloning the coding portion of the 2484 bp HIF1α gene. into the DNA vector GDTT1.8NAS12 with a size of 2591 bp. at the BamHII and EcoRI restriction sites. The coding part of the HIF1α gene is 2484 bp in size. was obtained by isolating total RNA from a biological sample of human tissue, followed by a reverse transcription reaction using a commercial Mint-2 kit (Evrogen) and PCR amplification using oligonucleotides:

HIF_FAGGATCACCATGGAGGGCGCCGGCGGCGCGA

HIF_RAATGGTACCTCAGTTAACTTGATCCAAAGCTCTGAGTAATTC

and the commercial Phusion® High-FidelityDNAPolymerase kit (NewEnglandBiolabs, USA), the cleavage of the amplification product and the DNA vector GDTT1.8NAS12 was performed with restriction endonucleases BamHI and KpnI (NewEnglandBiolabs, USA).

As a result, a 5057 bp GDTT1.8NAS12-HIF1α DNA vector was obtained. with the nucleotide sequence of SEQID No. 4 and the general structure shown in Fig.1D.

In this case, the GDTT1.8NAS12 gene therapy DNA vector was constructed according to Example 1.

Example 5

Confirmation of the effectiveness of the GDTT1.8NAS12-ANG gene therapy DNA vector carrying the target ANG gene. This example also demonstrates the feasibility of using a gene therapy DNA vector carrying the target ANG gene.

To confirm the effectiveness of the gene therapy DNA vector GDTT1.8NAS12-ANG, changes in the accumulation of mRNA of the target ANG gene were evaluated in the primary culture of human skeletal muscle cells HSkMC (ATCC PCS950010) 48 hours after their transfection with the gene therapy DNA vector GDTT1.8NAS12-ANG.

Primary human skeletal muscle cells HSkMC were grown in Mesenchymal Stem Cell Basal Medium (ATCC PCS500030) supplemented with the components included in Primary Skeletal Cell MuscleGrowthKit (ATCCPCS950040) in ₅ % CO2 at 37 ^° C. To obtain 90% confluence, 24 hours prior to transfection, cells were seeded into a 24-well plate at a rate of 5×10 ⁴ cells/well.

Lipofectamine 3000 reagent (ThermoFisherScientific, USA) was used for transfection. Transfection with gene therapy DNA vector GDTT1.8NAS12-ANG was carried out as follows. reagent P3000. Gently mixed with light shaking. In tube No. 2, 1 µl of Lipofectamine 3000 solution was added to 25 µl of Opti-MEM (Gibco) medium. Gently mixed with gentle shaking. The contents of tube No. 1 were added to the contents of tube No. 2, incubated for 5 min at room temperature. The resulting solution was added dropwise to the cells in a volume of 40 µl.

Cells of the primary culture of human skeletal muscles HSkMC transfected with the gene therapy DNA vector GDTT1.8NAS12, which did not contain the target gene insert (the cDNA of the ANG gene before and after transfection with the gene therapy DNA vector GDTT1.8NAS12, which did not contain the insert of the target gene) were used as a control. shown). Preparation of the control vector GDTT1.8NAS12 for transfection was performed as described above.

Total RNA from transfected cells was isolated as follows. 1 ml of TrizolReagent (ThermoFisherScientific) was added to the well with cells and homogenized, followed by heating for 5 min at 65°C. Next, the sample was centrifuged at 14,000g for 10 min and heated again for 10 min at 65 ⁰ C. Next, 200 µl of chloroform was added, gently mixed, and centrifuged at 14,000g for 10 min. Then the aqueous phase was taken, 1/10 volume of 3 M sodium acetate pH5.2 and an equal volume of isopropyl alcohol were added to it. The sample was incubated at -20°C for 10 min followed by centrifugation at 14,000g for 10 min. The precipitate was washed with 1 ml of 70% ethanol, dried in air, and dissolved in 10 μl of RNase-free water. Real-time PCR (SYBR GreenRealTimePCR) was used to determine the level of ANG gene mRNA expression after transfection. The following oligonucleotides were used to amplify the cDNA specific for the human ANG gene:

AN_rtFCGACCCTGGCTCAGGATAAC

AN_rtRTGTCTTTGCAGGGTGAGGTC.

The length of the amplification product is 135 bp. The beta-2-microglobulin B2M gene was used as a reference gene.

PCR amplification was performed using the real-time SYBRGreenQuantitectRT-PCRKit kit (Qiagen, USA) in 20 µl of an amplification mixture containing: 25 µl of QuantiTectSYBRGreenRT-PCRMasterMix, 2.5 mM magnesium chloride, 0.5 µM of each primer, 5 µl of total RNA. The reaction was carried out on a CFX96 amplifier (Bio-Rad, USA) under the following conditions: 1 cycle of reverse transcription at 42°С for 30 minutes, denaturation at 98°С for 15 min, then 40 cycles, including denaturation at 94°С for 15 sec, primer annealing 60°C - 30 sec and elongation 72°C - 120 sec. As a positive control, amplicons obtained by PCR on matrices were used, which are plasmids in known concentrations containing cDNA sequences of the ANG and B2M genes. Deionized water was used as a negative control. The amount of PCR products - cDNA of the ANG and B2M genes, obtained as a result of amplification, was assessed in real time using the bio-RadCFXManager 2.1 cycler software.

In order to confirm the increase in the expression of the ANG gene in cells of the primary culture of human skeletal muscle HSkMC after transfection of these cells with the gene therapy DNA vector GDTT1.8NAS12-ANG, figure 2 shows graphs of the accumulation of PCR products, from which it follows that as a result of transfection of the primary culture of skeletal muscle human HSkMC gene therapy DNA vector GDTT1.8NAS12-ANG, the level of specific mRNA of the human ANG gene increased many times over. This indicates the effectiveness of the gene therapy DNA vector GDTT1.8NAS12-ANG. The presented results also confirm the feasibility of using the GDTT1.8NAS12-ANG gene therapy DNA vector to increase the level of ANG gene expression in eukaryotic cells.

Example 6

Confirmation of the effectiveness of the ANGPT1 gene therapy DNA vector carrying the target ANGPT1 gene. This example also demonstrates the feasibility of using a gene therapy DNA vector carrying the target ANGPT1 gene.

To confirm the effectiveness of the gene therapy DNA vector GDTT1.8NAS12-ANGPT1, changes in the accumulation of the target gene ANGPT1 mRNA were evaluated in human skin fibroblast cells CCD-1079Sk (ATCC ^® CRL-2097) 48 hours after their transfection with the gene therapy DNA vector GDTT1.8NAS12 - ANGPT1.

Primary human skin fibroblast cells CCD-1079Sk were grown in Minimum essential medium (Eagle) (Gibco) supplemented with 2 mM glutamine in 5% CO ₂ at 37°C. To obtain 90% confluency, 24 hours before transfection, cells were seeded in a 24-well plate at a rate of 5×104 cells/well.

Primary human skin fibroblast cells CCD-1079Sk were transfected as described in Example 5.

Transfection was performed with the gene therapy DNA vector GDTT1.8NAS12-ANGPT1.

Human skin fibroblasts CCD-1079Sk transfected with the gene therapy DNA vector ANGPT1, which did not contain the target gene insert, were used as a control (cDNA of the ANGPT1 gene before and after transfection with the gene therapy DNA vector GDTT1.8NAS12, which did not contain the target gene insert, is not shown in the figures). Preparation of the control vector GDTT1.8NAS12 for transfection was performed as described in Example 5.

Total RNA from transfected cells was isolated as described in Example 5. Real-time PCR (SYBR GreenRealTimePCR) was used to determine the level of ANGPT1 mRNA expression after transfection. The following oligonucleotides were used to amplify the cDNA specific for the human ANGPT1 gene:

ANPT_rtF TGCAGAGAGATGCTCCACAC

ANPT_rtR TGTATCTGGGCCATCTCCGA.

The length of the amplification product is 148 bp. The human beta-2-microglobulin B2M gene was used as a reference gene.

PCR amplification was carried out as described in Example 12 under the following conditions: 1 cycle of reverse transcription at 42°C for 30 minutes, denaturation 98°C - 15 min, then 40 cycles, including denaturation 94°C - 15 sec, primer annealing 60°C - 30 sec and elongation 72°C - 120 sec. As a positive control, we used amplicons obtained by PCR on matrices representing plasmids in known concentrations containing cDNA sequences of the ANGPT1 and B2M genes. Deionized water was used as a negative control. The amount of PCR products - cDNA of the ANGPT1 and B2M genes, obtained as a result of amplification, was assessed in real time using the bio-RadCFXManager 2.1 cycler software.

In order to confirm the increase in the expression of the ANGPT1 gene in the cell culture of human skin fibroblasts CCD-1079Sk after transfection of these cells with the gene therapy DNA vector GDTT1.8NAS12-ANGPT1, figure 3 shows graphs of the accumulation of PCR products, from which it follows that as a result of transfection of the primary culture human skin fibroblasts CCD-1079Sk with the gene therapy DNA vector GDTT1.8NAS12-ANGPT1, the level of specific mRNA of the human ANGPT1 gene increased many times over. This indicates the effectiveness of the gene therapy DNA vector GDTT1.8NAS12-ANGPT1. The presented results also confirm the feasibility of using the GDTT1.8NAS12-ANGPT1 gene therapy DNA vector to increase the level of ANGPT1 gene expression in eukaryotic cells.

Example 7

Confirmation of the effectiveness of the GDTT1.8NAS12-VEGFA gene therapy DNA vector carrying the target VEGFA gene. This example also demonstrates the feasibility of using a gene therapy DNA vector carrying the target VEGFA gene.

To confirm the effectiveness of the gene therapy DNA vector GDTT1.8NAS12- VEGFA, changes in the accumulation of mRNA of the target gene VEGFA were evaluated in cells in human colon epithelial cells FHC (ATCC CRL-1831) 48 hours after their transfection with the gene therapy DNA vector GDTT1.8NAS12- VEGFA.

Human colon epithelial cells FHC were grown in DMEM:F12 Medium (ATCC 30-2006 according to the manufacturer's method (https://www.lgcstandards-atcc.org/products/all/CRL-1831.aspx#culturemethod) in an atmosphere at 37°C C. To obtain 90% confluency, 24 hours prior to transfection, cells were seeded in a 24-well plate at a rate of 5×104 cells/well.

FHC human colon epithelial cells were transfected as described in Example 5.

Transfection was performed with the gene therapy DNA vector GDTT1.8NAS12-VEGFA.

Human colon epithelial cells FHC transfected with the GDTT1.8NAS12 gene therapy DNA vector not containing the target gene insert were used as a control (VEGFA gene cDNA before and after transfection with the GDTT1.8NAS12 gene therapy DNA vector not containing the target gene insert is not shown in the figures) . Preparation of the control vector GDTT1.8NAS12 for transfection was performed as described in Example 5.

Total RNA from transfected cells was isolated as described in Example 5. Real-time PCR (SYBR GreenRealTimePCR) was used to determine the level of VEGFA mRNA expression after transfection. The following oligonucleotides were used to amplify the cDNA specific for the human VEGFA gene:

VEG_rtF CTTGCCTTGCTGCTCTACCT

VEG_rtR GCAGTAGCTGCGCTGATAGA.

The length of the amplification product is 123 bp. The human beta-2-microglobulin B2M gene was used as a reference gene.

PCR amplification was carried out as described in Example 12 under the following conditions: 1 cycle of reverse transcription at 42°C for 30 minutes, denaturation 98°C - 15 min, then 40 cycles, including denaturation 94°C - 15 sec, primer annealing 60°C - 30 sec and elongation 72°C - 120 sec. As a positive control, we used amplicons obtained by PCR on matrices representing plasmids in known concentrations containing the cDNA sequences of the VEGFA and B2M genes. Deionized water was used as a negative control. The amount of PCR products - cDNA of the VEGFA and B2M genes, obtained as a result of amplification, was assessed in real time using the bio-RadCFXManager 2.1 cycler software.

In order to confirm the increase in the expression of the VEGFA gene in a culture of human colon epithelial cells FHC after transfection of these cells with a gene therapy DNA vector GDTT1.8NAS12- VEGFA, figure 4 shows graphs of the accumulation of PCR products, from which it follows that as a result of transfection of colon epithelial cells human FHC gene therapy DNA vector GDTT1.8NAS12-VEGFA, the level of specific mRNA of the human VEGFA gene increased many times over. This indicates the effectiveness of the gene therapy DNA vector GDTT1.8NAS12-VEGFA. The presented results also confirm the feasibility of using the GDTT1.8NAS12-VEGFA gene therapy DNA vector to increase the level of VEGFA gene expression in eukaryotic cells.

Example 8

Confirmation of the effectiveness of the GDTT1.8NAS12-HIF1α gene therapy DNA vector carrying the target HIF1α gene. This example also demonstrates the feasibility of using a gene therapy DNA vector carrying the target HIF1α gene.

To confirm the effectiveness of the gene therapy DNA vector GDTT1.8NAS12-HIF1α, changes in the accumulation of mRNA of the target HIF1α gene were evaluated in a culture of human breast fibroblasts Hs578 Bst (ATCC HTB-125) 48 hours after their transfection with the gene therapy DNA vector GDTT1.8NAS12-HIF1α .

Human breast fibroblasts Hs578 Bst were grown in ATCC Hybri-Care Medium (ATCC Catalog No. 46-X) according to the manufacturer's method (https://www.lgcstandards-atcc.org/products/all/HTB-125.aspx#culturemethod) in an atmosphere of 5% CO2 at 37 ⁰ C. To obtain 90% confluence, 24 hours before transfection, cells were seeded in a 24-well plate at a rate of 5×104 cells/well.

Hs578 human breast fibroblasts were transfected as described in Example 5.

Transfection was performed with the gene therapy DNA vector GDTT1.8NAS12-HIF1α.

Human breast fibroblasts Hs578 transfected with the GDTT1.8NAS12 gene therapy DNA vector not containing the target gene insert were used as a control (the HIF1α gene cDNA before and after transfection with the GDTT1.8NAS12 gene therapy DNA vector not containing the target gene insert is not shown in the figures) . Preparation of the control vector GDTT1.8NAS12 for transfection was performed as described in Example 5.

Total RNA from transfected cells was isolated as described in Example 5. Real-time PCR (SYBR GreenRealTimePCR) was used to determine the level of HIF1α mRNA expression after transfection. The following oligonucleotides were used to amplify cDNA specific for the human HIF1α gene:

HIF_rtF TTTTGGCAGCAACGACACAG

HIF_rtR GTGCAGGGTCAGCACTACTT.

The length of the amplification product is 173 bp. The human beta-2-microglobulin B2M gene was used as a reference gene.

PCR amplification was carried out as described in Example 12 under the following conditions: 1 cycle of reverse transcription at 42°C for 30 minutes, denaturation 98°C - 15 min, then 40 cycles, including denaturation 94°C - 15 sec, primer annealing 60° C - 30 sec and elongation 72°C - 120 sec. As a positive control, amplicons obtained by PCR on matrices were used, which are plasmids in known concentrations containing cDNA sequences of the HIF1α and B2M genes. Deionized water was used as a negative control. The amount of PCR products - cDNA of the HIF1α and B2M genes, obtained as a result of amplification, was assessed in real time using the Bio-RadCFXManager 2.1 cycler software.

In order to confirm the increase in the expression of the HIF1α gene in human breast fibroblasts Hs578 after transfection of these cells with the GDTT1.8NAS12-HIF1α gene therapy DNA vector, Fig. 5 shows graphs of the accumulation of PCR products, from which it follows that as a result of transfection of human breast fibroblasts Hs578 gene therapy DNA vector GDTT1.8NAS12-HIF1α, the level of specific mRNA of the human HIF1α gene increased many times over. This indicates the effectiveness of the gene therapy DNA vector GDTT1.8NAS12-HIF1α. The presented results also confirm the feasibility of using the GDTT1.8NAS12-HIF1α gene therapy DNA vector to increase the level of HIF1α gene expression in eukaryotic cells.

Example 9

Confirmation of the effectiveness of the GDTT1.8NAS12-ANG gene therapy DNA vector carrying the target gene, namely the ANG gene, and the feasibility of its use.

To confirm the effectiveness of the gene therapy DNA vector GDTT1.8NAS12-ANG carrying the target gene, namely the ANG gene, and the feasibility of the method of its use, the change in the amount of angiogenin protein in the culture medium of primary human skeletal muscle culture (HSkMC) after transfection of these cells with the GDTT1 DNA vector was evaluated. .8NAS12-ANG carrying the human ANG gene as described in Example 5.

To assess the change in the amount of angiogenin protein, human skeletal muscle primary culture cells (HSkMC) were used, which were grown according to example 5.

After transfection, 0.1 ml of 1NHCl was added to 0.5 ml of the culture liquid, thoroughly mixed and incubated for 10 minutes at room temperature. The mixture was then neutralized by adding 0.1 ml of 1.2N NaOH/0.5M HEPES (pH 7-7.6) and thoroughly mixed. The supernatant was collected and used to quantify the target protein.

The ANG gene cDNA product was quantified by enzyme-linked immunosorbent assay (ELISA) using the ELISA Kit for Angiogenin (ANG) (Cloud-CloneCorp., USA) according to the manufacturer's protocol (http://cloud-clone.com/products/SEA007Hu. html). The optical density of the samples was measured at a wavelength of 450 nm using an automatic biochemical and enzyme immunoassay analyzer ChemWell (Awareness TechNology Inc., USA) and is proportional to the concentration of the ANG protein in the sample. The numerical value of the concentration is determined using a calibration curve built using calibrators with a known concentration of the ANG protein included in the kit. The difference between the optical density (OD) values of the calibrators delivered in triplicate did not exceed 10%.

Statistical processing of the obtained results was carried out using the software for statistical processing and data visualization R, version 3.0.2 (https://www.r-project.org/).

The diagram resulting from the analysis is shown in Fig. 6, from which it follows that transfection of human skeletal muscle primary culture cells (HSkMC) with the GDTT1.8NAS12-ANG gene therapy DNA vector carrying the ANG gene leads to an increase in the amount of angiogenin protein compared to control samples, which indicates the effectiveness of gene therapy DNA- vector GDTT1.8NAS12-ANG and confirms the ability of the vector to penetrate into eukaryotic cells and express the ANG gene at the protein level. The presented results also confirm the feasibility of using the gene therapy DNA vector GDTT1.8NAS12-ANG to increase the level of ANG expression in eukaryotic cells.

Example 10

Confirmation of the effectiveness of the GDTT1.8NAS12-ANGPT1 gene therapy DNA vector carrying the target gene, namely the ANGPT1 gene, and the feasibility of its use.

To confirm the effectiveness of the gene therapy DNA vector GDTT1.8NAS12-ANGPT1 carrying the target gene, namely, the ANGPT1 gene and the feasibility of the method of its use, the change in the amount of angiopoietin 1 protein in the culture medium of human skin fibroblasts (CCD-1079Sk) after transfection of these cells with DNA- vector GDTT1.8NAS12-ANGPT1 carrying the human ANGPT1 gene as described in Example 5.

To assess the change in the amount of angiopoietin 1 protein, human skin fibroblast cells (CCD-1079Sk) were used, which were grown according to example 5.

Quantitative determination of the cDNA product of the ANGPT1 gene was performed by enzyme-linked immunosorbent assay (ELISA) using the ELISA Kit for Angiopoietin 1 (Cloud-CloneCorp., USA) according to the manufacturer's method (http://cloud-clone.com/products/SEA008Hu.html)

The optical density of the samples was measured at a wavelength of 450 nm using an automatic biochemical and enzyme immunoassay analyzer ChemWell (Awareness TechNology Inc., USA) and is proportional to the concentration of the ANGPT1 protein in the sample. The numerical value of the concentration is determined using a calibration curve built using calibrators with a known concentration of the ANGPT1 protein included in the kit. The difference between the optical density (OD) values of the calibrators delivered in triplicate did not exceed 10%.

Statistical processing of the obtained results was carried out using the software for statistical processing and data visualization R, version 3.0.2 (https://www.r-project.org/).

The diagram resulting from the analysis is shown in Fig. 7, from which it follows that transfection of human skin fibroblasts (CCD-1079Sk) with the gene therapy DNA vector GDTT1.8NAS12-ANGPT1 carrying the ANGPT1 gene leads to an increase in the amount of angiopoietin protein compared with control samples, which indicates the effectiveness of the gene therapy DNA vector GDTT1 .8NAS12-ANGPT1 and confirms the ability of the vector to penetrate into eukaryotic cells and express the ANGPT1 gene at the protein level. The presented results also confirm the feasibility of using the gene therapy DNA vector GDTT1.8NAS12-ANGPT1 to increase the expression level of ANGPT1 in eukaryotic cells.

Example 11

Confirmation of the effectiveness of the GDTT1.8NAS12-VEGFA gene therapy DNA vector carrying the target gene, namely the VEGFA gene, and the feasibility of the method of its use.

To confirm the effectiveness of the GDTT1.8NAS12-VEGFA gene therapy DNA vector carrying the target gene, namely the VEGFA gene, and the feasibility of its use, we assessed the change in the amount of vascular endothelial growth factor protein in the culture medium of human colon epithelial cells (FHC) after transfection of these cells. GDTT1.8NAS12-VEGFA DNA vector carrying the human VEGFA gene as described in Example 5.

To assess the change in the amount of vascular endothelial growth factor protein, human colonic epithelial cells (FHC) were used, which were grown according to example 5.

Quantitative determination of the cDNA product of the VEGFA gene was performed by enzyme-linked immunosorbent assay (ELISA) using the ELISA Kit for Vascular Endothelial Growth Factor A (Cloud-CloneCorp., USA) according to the manufacturer's method (http://cloud-clone.com/products/SEA143Hu .html). The optical density of the samples was measured at a wavelength of 450 nm using an automatic biochemical and enzyme immunoassay analyzer ChemWell (Awareness TechNology Inc., USA) and is proportional to the VEGFA protein concentration in the sample. The numerical value of the concentration is determined using a calibration curve built using calibrators with a known concentration of the VEGFA protein included in the kit. The difference between the optical density (OD) values of the calibrators delivered in triplicate did not exceed 10%.

Statistical processing of the obtained results was carried out using the software for statistical processing and data visualization R, version 3.0.2 (https://www.r-project.org/).

The diagram resulting from the analysis is shown in FIG. 8, from which it follows that transfection of human colon epithelial cells (FHC) with the GDTT1.8NAS12-VEGFA gene therapy DNA vector carrying the VEGFA gene leads to an increase in the amount of vascular endothelial growth factor protein compared with control samples, which indicates the effectiveness of the gene therapy. DNA vector GDTT1.8NAS12-VEGFA and confirms the ability of the vector to penetrate into eukaryotic cells and express the VEGFA gene at the protein level. The presented results also confirm the feasibility of using the gene therapy DNA vector GDTT1.8NAS12-VEGFA to increase the level of VEGFA expression in eukaryotic cells.

Example 12

Confirmation of the effectiveness of the GDTT1.8NAS12-HIF1α gene therapy DNA vector carrying the target gene, namely the HIF1α gene, and the feasibility of its use.

To confirm the effectiveness of the GDTT1.8NAS12-HIF1α gene therapy DNA vector carrying the target gene, namely the HIF1α gene, and the feasibility of its use, we assessed the change in the amount of hypoxia-induced factor alpha protein in the culture medium of human breast fibroblasts (Hs578 Bst) after transfection of these cells. GDTT1.8NAS12-HIF1α DNA vector carrying the human HIF1α gene as described in Example 5.

To assess the change in the amount of hypoxia-induced factor alpha protein, human breast fibroblasts (Hs578 Bst) were used, which were grown according to example 5.

Quantification of the cDNA product of the HIFα gene was performed by enzyme-linked immunosorbent assay (ELISA) using the ELISA Kit for Hypoxia Inducible Factor 1 Alpha (Cloud-CloneCorp., USA) according to the manufacturer's method (http://cloud-clone.com/products/SEA798Hu .html).

The optical density of the samples was measured at a wavelength of 450 nm using an automatic biochemical and enzyme immunoassay analyzer ChemWell (Awareness TechNology Inc., USA) and is proportional to the HIF1α protein concentration in the sample. The numerical value of the concentration is determined using a calibration curve built using calibrators with a known concentration of the HIF1α protein included in the kit. The difference between the optical density (OD) values of the calibrators delivered in triplicate did not exceed 10%.

Statistical processing of the obtained results was carried out using the software for statistical processing and data visualization R, version 3.0.2 (https://www.r-project.org/).

The diagram resulting from the analysis is shown in Fig. 9, from which it follows that transfection of human breast fibroblasts (Hs578 Bst) with the GDTT1.8NAS12-HIF1α gene therapy DNA vector carrying the HIF1α gene leads to an increase in the amount of hypoxia-induced alpha factor protein compared to control samples, which indicates the effectiveness of the gene therapy DNA vector GDTT1.8NAS12-HIF1α and confirms the ability of the vector to penetrate into eukaryotic cells and express the HIF1α gene at the protein level. The presented results also confirm the feasibility of using the GDTT1.8NAS12-HIF1α gene therapy DNA vector to increase the level of HIF1α expression in eukaryotic cells.

Example 13

Confirmation of the effectiveness and feasibility of the method of using the GDTT1.8NAS12-ANG gene therapy DNA vector carrying the ANG gene to increase the expression of the ANG protein in human tissues.

To confirm the effectiveness of the gene therapy DNA vector GDTT1.8NAS12-ANG carrying the target gene, namely, the ANG gene and the feasibility of the method of its application, changes in the amount of the ANG protein in human skin were evaluated when the gene therapy DNA vector GDTT1.8NAS12-ANG carrying the gene human ANG.

In order to analyze the change in the amount of angiogenin protein, three patients were injected into the skin of the forearm with the gene therapy DNA vector GDTT1.8NAS12-ANG carrying the ANG gene and simultaneously injected with a placebo, which is a gene therapy DNA vector GDTT1.8NAS12 that does not contain the ANG gene.

Patient 1, female, 47 years old, (P1); patient 2, female, 65 years old, (P2); patient 3, male, 52 years old, (P3). Transfection reagent cGMP grade in-vivo-jetPEI (Polyplus Transfection, France) was used as a transport system. The gene therapy DNA vector GDTT1.8NAS12-ANG, which contains the ANG gene and the gene therapy DNA vector GDTT1.8NAS12 used as a placebo, were dissolved in Nuclease-Free sterile water. DNA-cGMP grade in-vivo-jetPEI complexes were prepared according to the manufacturer's recommendations.

Gene therapy DNA vector GDTT1.8NAS12 (placebo) and gene therapy DNA vector GDTT1.8NAS12-ANG were administered in an amount of 1 mg for each genetic construct by tunneling with a 30G needle to a depth of 3 mm. The volume of the injected solution of the gene therapy DNA vector GDTT1.8NAS12 (placebo) and the gene therapy DNA vector GDTT1.8NAS12-ANG is 0.3 ml for each genetic construct. The foci of introduction of each genetic construct were located on the forearm at a distance of 8-10 cm from each other.

Biopsy samples were taken on the 2nd day after the introduction of genetic constructs of gene therapy DNA vectors. A biopsy was taken from the skin areas of patients in the area of injection of the gene therapy DNA vector GDTT1.8NAS12-ANG carrying the ANG gene (I), the gene therapy DNA vector GDTT1.8NAS12 (placebo) (II), as well as from intact skin areas (III), using the Epitheasy 3.5 biopsy device (Medax SRL, Italy). The skin of patients in the biopsy area was pre-washed with sterile saline and anesthetized with lidocaine solution. The size of the biopsy sample was about 10 cc. mm, weight - about 11 mg. The sample was placed in a buffer solution containing 50 mM Tris-HCl pH 7.6, 100 mM NaCl, 1 mM EDTA, and 1 mM phenylmethylsulfonyl fluoride and homogenized until a homogeneous suspension was obtained. The resulting suspension was centrifuged for 10 min at 14000g. The supernatant was collected and used to quantify the target angiogenin protein by enzyme-linked immunosorbent assay (ELISA) using the ELISA Kit for Angiopoietin 1 (Cloud-CloneCorp., USA) as described in Example 10 with optical density detection at a wavelength of 450 nm at using an automatic biochemical and enzyme immunoassay analyzer ChemWell (Awareness Technology Inc., USA).

The numerical value of the concentration was determined using a calibration curve constructed from standard samples with a known concentration of the angiogenin protein included in the kit. The diagrams obtained as a result of the analysis are presented in Fig. ten.

From figure 10 it follows that in the skin of all three patients in the area of injection of the gene therapy DNA vector GDTT1.8NAS12-ANG carrying the target human ANG gene, an increase in the amount of angiogenin protein occurred in comparison with the amount of angiogenin protein in the area of injection of the gene therapy DNA vector GDTT1.8NAS12 (placebo) that does not contain the human ANG gene, which indicates the effectiveness of the gene therapy DNA vector GDTT1.8NAS12-ANG and confirms the feasibility of the method of its use, in particular when the gene therapy DNA vector is introduced into human organs.

Example 14

Confirmation of the effectiveness and feasibility of the method of using the GDTT1.8NAS12-VEGFA gene therapy DNA vector carrying the VEGFA gene to increase the expression of the VEGFA protein in human tissues.

To confirm the effectiveness of the gene therapy DNA vector GDTT1.8NAS12-VEGFA carrying the target VEGFA gene and the feasibility of the method of its application, the change in the amount of VEGFA protein in human muscle tissue was evaluated when the gene therapy DNA vector GDTT1.8NAS12-VEGFA carrying the target gene was introduced, namely, the human VEGFA gene.

In order to analyze the change in the amount of VEGFA protein, three patients were injected into the tissue of the gastrocnemius muscle with a gene therapy DNA vector GDTT1.8NAS12-VEGFA carrying the VEGFA gene with a transport molecule, and in parallel, a placebo was injected, which is a gene therapy DNA vector GDTT1.8NAS12 that does not contain cDNA of the VEGFA gene with a transport molecule.

Patient 1, male, 52 years old, (P1); patient 2, female, 52 years old (P2); patient 3, male, 63 years old, (P3). Transfection reagent cGMP grade in-vivo-jetPEI (Polyplus Transfection, France) was used as a transport system; sample preparation was performed in accordance with the manufacturer's recommendations.

The gene therapy DNA vector GDTT1.8NAS12 (placebo) and the gene therapy DNA vector GDTT1.8NAS12-VEGFA carrying the VEGFA gene were injected in an amount of 1 mg for each genetic construct by tunneling with a 30G needle to a depth of about 10 mm. The volume of the injected solution of the gene therapy DNA vector GDTT1.8NAS12 (placebo) and the gene therapy DNA vector GDTT1.8NAS12-VEGFA carrying the VEGFA gene is 0.3 ml for each genetic construct. The sites of introduction of each genetic construct were located medially at a distance of 8-10 cm from each other.

Biopsy samples were taken on the 2nd day after the introduction of genetic constructs of gene therapy DNA vectors. A biopsy was taken from sections of the patient's muscle tissue in the area of injection of the gene therapy DNA vector GDTT1.8NAS12-VEGFA carrying the VEGFA gene (I), the gene therapy DNA vector GDTT1.8NAS12 (placebo) (II), as well as from an intact section of the gastrocnemius muscle (III) using the MAGNUM biopsy device (BARD, USA). The skin of patients in the biopsy area was pre-washed with sterile saline and anesthetized with lidocaine solution. The size of the biopsy sample was about 20 cc. mm, weight - about 22 mg. The sample was placed in a buffer solution containing 50 mM Tris-HCl pH 7.6, 100 mM NaCl, 1 mM EDTA, and 1 mM phenylmethylsulfonyl fluoride and homogenized until a homogeneous suspension was obtained. The resulting suspension was centrifuged for 10 min at 14000g. The supernatant was collected and used to quantify the target protein.

Quantitative determination of the VEGFA protein was carried out by enzyme-linked immunosorbent assay (ELISA) using a kit using the ELISA Kit for Vascular Endothelial Growth Factor A (Cloud-CloneCorp., USA) according to the manufacturer's method with detection of optical density using an automatic biochemical and enzyme immunoassay analyzer ChemWell ( Awareness Technology Inc., USA).

The numerical value of the concentration was determined using a calibration curve built using standard samples with a known concentration of the VEGFA protein included in the kit. Statistical processing of the obtained results was carried out using the software for statistical processing and data visualization R, version 3.0.2 (https://www.r-project.org/). The graphs resulting from the analysis are shown in Fig. eleven.

From figure 11 it follows that in the gastrocnemius muscle of all three patients in the area of injection of the gene therapy DNA vector GDTT1.8NAS12-VEGFA carrying the target gene, namely the human VEGFA gene, there was an increase in the amount of VEGFA protein in comparison with the amount of VEGFA protein in the area of gene therapy injection. DNA vector GDTT1.8NAS12 (placebo) that does not contain the human VEGFA gene, which indicates the effectiveness of the GDTT1.8NAS12-VEGFA gene therapy DNA vector and confirms the feasibility of its method of application, in particular, with intramuscular injection of the gene therapy DNA vector into human tissues.

Example 15

Confirmation of the effectiveness and feasibility of the method of using the GDTT1.8NAS12-HIF1α gene therapy DNA vector carrying the HIF1α gene to increase the expression of the HIF1α protein in human tissues.

To confirm the effectiveness of the GDTT1.8NAS12-HIF1α gene therapy DNA vector carrying the target gene, namely the HIF1α gene, and the feasibility of the method of its application, changes in the amount of HIF1α protein in human skin were evaluated when the GDTT1.8NAS12-HIF1α gene therapy DNA vector was introduced into human skin, carrying the human HIF1α gene.

In order to analyze the change in the amount of HIF1α protein, three patients were injected into the skin of the forearm with the GDTT1.8NAS12-HIF1α gene therapy DNA vector carrying the HIF1α gene and simultaneously injected with a placebo, which is the GDTT1.8NAS12 gene therapy DNA vector that does not contain the HIF1α gene cDNA.

Patient 1, female, 45 years old (P1); patient 2, male, 59 years old (P2); patient 3, male, 47 years old (P3). Transfection reagent cGMP grade in-vivo-jetPEI (Polyplus Transfection, France) was used as a transport system. The gene therapy DNA vector GDTT1.8NAS12-HIF1α, which contains the cDNA of the HIF1α gene, and the gene therapy DNA vector GDTT1.8NAS12, used as a placebo, which does not contain the cDNA of the HIF1α gene, each of which was dissolved in Nuclease-Free sterile water. To obtain a genetic construct, DNA-cGMP grade in-vivo-jetPEI complexes were prepared in accordance with the manufacturer's recommendations.

The gene therapy DNA vector GDTT1.8NAS12 (placebo) and the gene therapy DNA vector GDTT1.8NAS12-HIF1α carrying the HIF1α gene were injected in an amount of 1 mg for each genetic construct by tunneling with a 30G needle to a depth of 3 mm. The volume of the injected solution of the GDTT1.8NAS12 gene therapy DNA vector (placebo) and the GDTT1.8NAS12-HIF1α gene therapy DNA vector carrying the HIF1α gene is 0.3 ml for each genetic construct. The foci of introduction of each genetic construct were located on the forearm at a distance of 8-10 cm from each other.

Biopsy samples were taken on the 2nd day after the introduction of genetic constructs of gene therapy DNA vectors. Biopsies were taken from the skin areas of patients in the area of injection of the gene therapy DNA vector GDTT1.8NAS12-HIF1α carrying the HIF1α gene (I), the gene therapy DNA vector GDTT1.8NAS12 (placebo) (II), as well as from intact skin areas (III), using biopsy device Epitheasy 3.5 (Medax SRL, Italy). The skin of patients in the biopsy area was pre-washed with sterile saline and anesthetized with lidocaine solution. The size of the biopsy sample was about 10 cc. mm, weight - about 11 mg. The sample was placed in a buffer solution containing 50 mM Tris-HCl pH 7.6, 100 mM NaCl, 1 mM EDTA, and 1 mM phenylmethylsulfonyl fluoride and homogenized until a homogeneous suspension was obtained. The resulting suspension was centrifuged for 10 min at 14000g. The supernatant was collected and used for quantitative determination of the target protein by enzyme-linked immunosorbent assay (ELISA) using a kit using the ELISA Kit for Hypoxia Inducible Factor 1 Alpha (Cloud-CloneCorp., USA) according to the manufacturer's method with detection of optical density using automatic biochemical and enzyme immunoassay analyzer ChemWell (Awareness Technology Inc., USA).

The numerical value of the concentration was determined using a calibration curve built using standard samples with a known concentration of the HIF1α protein included in the kit. Statistical processing of the obtained results was carried out using the software for statistical processing and data visualization R, version 3.0.2 (https://www.r-project.org/). The graphs resulting from the analysis are shown in Fig. 12.

From figure 12 it follows that in the skin of all three patients in the area of injection of the gene therapy DNA vector GDTT1.8NAS12-HIF1α, carrying the target human HIF1α gene, there was an increase in the amount of HIF1α protein in comparison with the amount of HIF1α protein in the area of injection of the gene therapy DNA vector GDTT1.8NAS12 (placebo) that does not contain the human HIF1α gene, which indicates the effectiveness of the GDTT1.8NAS12-HIF1α gene therapy DNA vector and confirms the feasibility of its method of application, in particular, when the gene therapy DNA vector is intradermally injected into human tissues.

Example 16

Confirmation of the effectiveness of the GDTT1.8NAS12-ANGPT1 gene therapy DNA vector carrying the ANGPT1 gene and the feasibility of its application for increasing the level of ANGPT1 protein expression in human tissues by introducing autologous fibroblasts transfected with the GDTT1.8NAS12-ANGPT1 gene therapy DNA vector.

To confirm the effectiveness of the gene therapy DNA vector GDTT1.8NAS12-ANGPT1 carrying the ANGPT1 gene and the feasibility of the method of its use, changes in the amount of the ANGPT1 protein in human skin were evaluated when a culture of autologous fibroblasts of this patient transfected with the gene therapy DNA vector GDTT1.8NAS12-ANGPT1 was introduced into the skin of a patient. .

The patient was injected into the skin of the forearm with an appropriate culture of autologous fibroblasts transfected with the GDTT1.8NAS12-ANGPT1 gene therapy DNA vector carrying the ANGPT1 gene, and in parallel, a placebo was injected, which is a culture of the patient's autogenous fibroblasts transfected with the GDTT1.8NAS12 gene therapy DNA vector that does not carry the ANGPT1 gene .

A primary culture of human fibroblasts was isolated from patient skin biopsies. Using the Epitheasy 3.5 skin biopsy device (Medax SRL, Italy), a skin biopsy sample was taken from the zone protected from ultraviolet radiation, namely behind the auricle or from the lateral inner surface in the area of the elbow joint, about 10 square meters in size. mm, weighing about 11 mg. The patient's skin was previously washed with sterile saline and anesthetized with lidocaine solution. Cultivation of the primary cell culture was carried out at 37 0C in an atmosphere containing 5% CO ₂ in DMEM medium with 10% fetal calf serum and ampicillin 100 U/ml. Reseeding culture and changing the culture medium was carried out every 2 days. The total duration of culture growth did not exceed 25-30 days. An aliquot containing 5×10 ⁴ cells was taken from the cell culture. The patient's fibroblast culture was transfected with the GDTT1.8NAS12-ANGPT1 gene therapy DNA vector carrying the ANGPT1 gene or with a placebo GDTT1.8NAS12 vector that did not carry the target ANGPT1 gene.

Transfection was performed using JETPEI cationic polyethyleneimine polymer (Polyplus Transfection, France) according to the manufacturer's instructions. The cells were cultured for 72 hours and then injected into the patient. Introduction to the patient of a culture of autologous fibroblasts of this patient, transfected with the gene therapy DNA vector GDTT1.8NAS12-ANGPT1, and a placebo, which is a culture of autogenous fibroblasts of the patient, transfected with the gene therapy DNA vector GDTT1.8NAS12, was carried out by tunneling into the forearm area with a 30G needle 13 mm long. depth about 3 mm. The concentration of modified autogenous fibroblasts in the injected suspension was approximately 5 million cells per 1 ml of suspension, the number of injected cells did not exceed 15 million. The foci of introducing the autogenous fibroblast culture were located at a distance of 8-10 cm from each other.

Biopsy samples were taken on the 4th day after the introduction of a culture of autologous fibroblasts transfected with the GDTT1.8NAS12-ANGPT1 gene therapy DNA vector carrying the target gene, namely the ANGPT1 gene and placebo. A biopsy was taken from the patient's skin areas in the injection zone of a culture of autologous fibroblasts transfected with a gene therapy DNA vector GDTT1.8NAS12-ANGPT1 carrying a target gene, namely, the ANGPT1 gene (C), a culture of autogenous fibroblasts transfected with a gene therapy DNA vector GDTT1.8NAS12 not carrying the target ANGPT1 gene (placebo) (B) and from intact skin (A) using an Epitheasy 3.5 biopsy device (Medax SRL, Italy). The skin in the biopsy area of patients was pre-washed with sterile saline and anesthetized with lidocaine solution. The size of the biopsy sample was about 10 cc. mm, weight - about 11 mg. The sample was placed in a buffer solution containing 50 mM Tris-HCl pH 7.6, 100 mM NaCl, 1 mM EDTA, and 1 mM phenylmethylsulfonyl fluoride and homogenized until a homogeneous suspension was obtained. The resulting suspension was centrifuged for 10 min at 14000g. The supernatant was collected and used to quantify the target protein as described in Example 10.

The graphs resulting from the analysis are shown in Fig. 13.

From figure 13 it follows that in the patient's skin in the area of injection of the culture of autogenous fibroblasts transfected with the gene therapy DNA vector GDTT1.8NAS12-ANGPT1 carrying the ANGPT1 gene, there was an increase in the amount of ANGPT1 protein compared to the amount of ANGPT1 protein in the area of injection of the culture of autogenous fibroblasts transfected gene therapeutic DNA vector GDTT1.8NAS12 that does not carry the ANGPT1 gene (placebo), which indicates the effectiveness of the gene therapeutic DNA vector GDTT1.8NAS12-ANGPT1 and confirms the feasibility of the method of its use to increase the level of expression of ANGPT1 in human tissues, in particular, when autologous fibroblasts are injected transfected with the gene therapy DNA vector GDTT1.8NAS12-ANGPT1.

Example 17

Confirmation of the effectiveness and feasibility of the method of combined use of the gene therapy DNA vector GDTT1.8NAS12-ANG carrying the ANG gene, the gene therapy DNA vector GDTT1.8NAS12-ANGPT1 carrying the ANGPT1 gene, the gene therapy DNA vector GDTT1.8NAS12-VEGFA carrying the VEGFA gene, gene therapy DNA vector GDTT1.8NAS12-HIF1α carrying the HIF1α gene to increase the level of expression of ANG, ANGPT1, VEGFA and HIF1α proteins in mammalian tissues.

To confirm the effectiveness and feasibility of the method of combined use of the GDTT1.8NAS12-ANG gene therapy DNA vector carrying the ANG gene, the GDTT1.8NAS12-ANGPT1 gene therapy DNA vector carrying the ANGPT1 gene, and the GDTT1.8NAS12-VEGFA gene therapy DNA vector carrying the VEGFA gene, gene therapy DNA vector GDTT1.8NAS12-HIF1α carrying the HIF1α gene, the change in the amount of ANG, ANGPT1, VEGFA and HIF1α proteins in the intradermal injection zones of Wistar rats (males, aged 22-24 weeks) was evaluated when a mixture of gene therapy vectors was introduced into this zone.

A mixture of gene therapy DNA vectors was prepared in a ratio of 1:1:1:1 (by weight) from a lyophilisate of DNA vectors GDTT1.8NAS12-ANG, GDTT1.8NAS12-ANGPT1, GDTT1.8NAS12-VEGFA, GDTT1.8NAS12-HIF1α. Transfection reagent cGMP grade in-vivo-jetPEI (Polyplus Transfection, France) was used as a transport system. An equimolar mixture of gene therapy DNA vectors was dissolved in Nuclease-Free sterile water. To obtain a genetic construct, DNA-cGMP grade in-vivo-jetPEI complexes were prepared in accordance with the manufacturer's recommendations.

3 groups of animals were formed, 10 animals each. All animals under anesthesia were given intradermal injections of:

in the 1st group (KI) with a mixture of gene therapy DNA vectors GDTT1.8NAS12-ANG, GDTT1.8NAS12-ANGPT1, GDTT1.8NAS12-VEGFA, GDTT1.8NAS12-HIF1α in a volume of 200 µl (the concentration of each gene therapy DNA vector is 1 µg/µl );

in the 2nd group (KII) - with a solution of the DNA vector GDTT1.8NAS12 in a volume of 200 µl, with a concentration of the DNA vector 1 µg/µl, (placebo);

in the 3rd group (KIII) - saline in a volume of 200 μl.

Biopsy samples were taken 72 hours after administration of a mixture of gene therapy DNA vectors and placebo. Biopsy was taken after necropsy of animals from the injection sites in the injection zone of a mixture of four gene therapy DNA vectors carrying target genes: ANG, ANGPT1, VEGFA, HIF1α (zone I), gene therapy DNA vector GDTT1.8NAS12 (placebo) (zone II), and in the saline injection site (Zone III) using the Epitheasy 3.5 skin biopsy device (Medax SRL). The biopsy sampling area was pre-washed with sterile saline and anesthetized with lidocaine solution. The size of each biopsy sample was about 10 cc. mm, weight - about 11 mg. Each sample was placed in a buffer solution containing 50 mM Tris-HCl pH 7.6, 100 mM NaCl, 1 mM EDTA and 1 mM phenylmethylsulfonyl fluoride and homogenized until a homogeneous suspension was obtained. The resulting suspension was centrifuged for 10 min at 14000g. The supernatant was collected and used for target protein quantitation, measurement and processing as described in Example 9 (ANG protein quantification), Example 10 (ANGPT1 protein quantitation), Example 11 (VEGFA protein quantitation), Example 12 (VEGFA quantitation), determination of HIF1α protein). The graphs resulting from the analysis are shown in Fig. fourteen.

From figure 14 it follows that in the injection zone in the skin of animals (zone I), into which a mixture of gene therapy vectors was introduced: the GDTT1.8NAS12-ANG gene therapy DNA vector carrying the target ANG gene, the GDTT1.8NAS12-ANGPT1 gene therapy DNA vector, carrying the target gene ANGPT1, the gene therapy DNA vector GDTT1.8NAS12-VEGFA carrying the target gene VEGFA, the gene therapy DNA vector GDTT1.8NAS12-HIF1α carrying the target gene HIF1α, there was an increase in the amount of ANG, ANGPT1, VEGFA and HIF1α proteins compared to zone II ( placebo zone) and zone III (intact zone). The results obtained indicate the effectiveness of the combined use of gene therapy DNA vectors and confirm the feasibility of the method of application to increase the level of expression of target proteins in mammalian tissues.

Example 18

Confirmation of the effectiveness of the GDTT1.8NAS12-VEGFA gene therapy DNA vector carrying the VEGFA gene and the feasibility of its use to increase the level of VEGFA protein expression in mammalian cells.

To confirm the effectiveness of the gene therapy DNA vector GDTT1.8NAS12-VEGFA carrying the VEGFA gene, the change in the accumulation of mRNA of the target VEGFA gene in canine kidney epithelial cells (MDCK) was evaluated 48 hours after their transfection with the gene therapy DNA vector GDTT1.8NAS12-VEGFA carrying the VEGFA gene. person.

Canine kidney epithelial cells (MDCK) were grown in DMEM (Gibco) supplemented with 10% fetal bovine serum. Transfection with the GDTT1.8NAS12-VEGFA gene therapy DNA vector carrying the human VEGFA gene and GDTT1.8NAS12 DNA vector not carrying the human VEGFA gene (Control), RNA isolation, reverse transcription reaction, PCR amplification, and data analysis were performed as described in Example 5. B The canine beta-actin (ACT) gene listed in the GenBank database under the number AF484115.1 was used as a reference gene. As a positive control, amplicons obtained by PCR on matrices were used, which are plasmids in known concentrations containing the sequences of the VEGFA and ACT genes. Deionized water was used as a negative control. The amount of PCR products - cDNA of the VEGFA and ACT genes, obtained as a result of amplification, was assessed in real time using the bio-RadCFXManager 2.1 cycler software. (BioRad, USA).

The graphs obtained as a result of the analysis are presented in Fig.15.

It follows from figure 15 that as a result of transfection of canine kidney epithelial cells (MDCK) with the gene therapy DNA vector GDTT1.8NAS12-VEGFA, the level of specific mRNA of the human VEGFA gene increased many times, which confirms the ability of the vector to penetrate into eukaryotic cells and express the VEGFA gene at the mRNA level. The presented results confirm the feasibility of using the gene therapy DNA vector GDTT1.8NAS12-VEGFA to increase the expression level of the VEGFA gene in mammalian cells.

Example 19

Escherichia coli strain JM110-NAS/GDTT1.8NAS12-ANG or Escherichia coli strain JM110-NAS/GDTT1.8NAS12-ANGPT1 or Escherichia coli strain JM110-NAS/GDTT1.8NAS12-VEGFA or Escherichia coli strain JM110-NAS/GDTT1.8NAS12- HIF1α carrying a gene therapy DNA vector and method for its production.

Construction of a strain for commercial production of a gene therapeutic DNA vector based on the gene therapeutic DNA vector GDTT1.8NAS12 carrying a target gene selected from the group of genes: ANG, ANGPT1, VEGFA, HIF1α, namely the Escherichia coli JM110-NAS/GDTT1.8NAS12 strain -ANG, or Escherichia coli JM110-NAS/GDTT1.8NAS12-ANGPT1 strain, or Escherichia coli JM110-NAS/GDTT1.8NAS12-VEGFA strain, or Escherichia coli JM110-NAS/GDTT1.8NAS12-HIF1α strain carrying gene therapy DNA vector GDTT1.8NAS12-ANG, or GDTT1.8NAS12-ANGPT1, or GDTT1.8NAS12-VEGFA, or GDTT1.8NAS12-HIF1α, respectively, for its production with the possibility of selection without the use of antibiotics is to obtain electrocompetent cells of the Escherichia coli strain JM110-NAS with electroporation of these cells with the GDTT1.8NAS12-ANG gene therapy DNA vector, or the GDTT1.8NAS12-ANGPT1 DNA vector, or the GDTT1.8NAS12-VEGFA DNA vector, or the GDTT1.8NAS12-HIF1α DNA vector, after which the cells are seeded for an hour Petri dishes with agar selective medium containing yeast extract, peptone, 6% sucrose, and 10 µg/ml chloramphenicol. At the same time, the Escherichia coli JM110-NAS strain for the production of the GDTT1.8NAS12 gene therapy DNA vector or gene therapy DNA vectors based on it with the possibility of positive selection without the use of antibiotics was obtained by constructing a linear DNA fragment containing the regulatory element RNA-in of the Tn10 transposon for selection without use of antibiotics 64 bp in size, the sacB levan sucrose gene, the product of which provides selection on a sucrose-containing medium with a size of 1422 bp, the catR chloramphenicol resistance gene, which is necessary for the selection of strain clones in which homologous recombination of 763 bp has taken place. n. and two homologous sequences that ensure the process of homologous recombination in the region of the recA gene with its simultaneous inactivation of 329 bp. and 233 bp, after which Escherichia coli cells were transformed by electroporation, and clones that survived on a medium containing 10 μg/ml chloramphenicol were selected.

Example 20

A method for scaling up the production of a gene therapy DNA vector based on the GDTT1.8NAS12 gene therapy DNA vector carrying a target gene selected from the group of genes: ANG, ANGPT1, VEGFA, HIF1α to an industrial scale.

To confirm the manufacturability of obtaining and the possibility of industrial production of the gene therapy DNA vector GDTT1.8NAS12-ANG (SEQ ID No. 1), or GDTT1.8NAS12-ANGPT1 (SEQ ID No. 2), or GDTT1.8NAS12-VEGFA (SEQ ID No. 3 ), or GDTT1.8NAS12-HIF1α (SEQ ID No. 4), or carried out large-scale fermentation of Escherichia coli strain JM110-NAS/GDTT1.8NAS12-ANG, or Escherichia coli strain JM110-NAS/GDTT1.8NAS12-ANGPT1, or Escherichia coli strain JM110-NAS/GDTT1.8NAS12-VEGFA, or Escherichia coli JM110-NAS/GDTT1.8NAS12-HIF1α, each containing a GDTT1.8NAS12 gene therapy DNA vector carrying the target gene, namely ANG, or ANGPT1, or VEGFA, or HIF1α. Each strain of Escherichia coli JM110-NAS/GDTT1.8NAS12-ANG or Escherichia coli JM110-NAS/GDTT1.8NAS12-ANGPT1 or Escherichia coli JM110-NAS/GDTT1.8NAS12-VEGFA or Escherichia coli JM110-NAS/GDTT1.8NAS12 -HIF1α was obtained on the basis of Escherichia coli JM110-NAS strain (GeneticDiagnosticsandTherapy21 Ltd, UK) according to example 19 by electroporation of competent cells of this strain with gene therapy DNA vector GDTT1.8NAS12-ANG, or GDTT1.8NAS12-ANGPT1, or GDTT1.8NAS12-VEGFA, or GDTT1.8NAS12-HIF1α carrying the target gene, namely, ANG, or ANGPT1, or VEGFA, or HIF1α, followed by seeding of the transformed cells on Petri dishes with agar selective medium containing yeast extract, peptone, 6% sucrose, and selection of individual clones.

Fermentation of the obtained Escherichia coli JM110-NAS/GDTT1.8NAS12-ANG strain carrying the GDTT1.8NAS12-ANG gene therapy DNA vector was carried out in a 10 L fermenter, followed by isolation of the GDTT1.8NAS12-ANG gene therapy DNA vector.

For the fermentation of the Escherichia coli JM110-NAS/GDTT1.8NAS12-ANG strain, a medium was prepared containing 10 L of tryptone, 50 g of yeast extract (Becton Dickinson, USA), adjusted to 8800 ml with water and autoclaved at 121°C for 20 min. then 1200 ml of 50% (w/v) sucrose was added. Next, a seed culture of the strain Escherichia coli JM110-NAS/GDTT1.8NAS12-ANG was inoculated into a flask in a volume of 100 ml. Incubated in a shaker-incubator for 16 h at 30°C. The seed culture was transferred to a Techfors S fermenter (Infors HT, Switzerland) and grown until the stationary phase was reached. The control was carried out by measuring the optical density of the culture at a wavelength of 600 nm. Cells were besieged by centrifugation for 30 min at 5000-10000 g. The supernatant was removed, the cell mass was resuspended in 10% by volume of phosphate-buffered saline. Centrifuged again for 30 min at 5000-10000g. The supernatant was removed, a solution of 20 mm TrisCl, 1 mm EDTA, 200 g/l sucrose, pH 8.0 in a volume of 1000 ml was added to the cell mass, thoroughly mixed until a homogeneous suspension was formed. A solution of egg lysozyme was added to a final concentration of 100 μg/ml. Incubated for 20 min on ice with gentle stirring. Next, 2500 ml of a solution of 0.2 M NaOH, 10 g/l sodium dodecyl sulfate was added, incubated for 10 min on ice with gentle stirring, then 3500 ml of a solution of 3 M sodium acetate, 2 M acetic acid, pH 5-5.5 was added, incubated for 10 min on ice with gentle stirring. The resulting sample was centrifuged for 20-30 min at 15,000 g or more. The solution was carefully decanted, and the remaining precipitate was removed by filtration through a coarse filter (filter paper). RNase A (Sigma, USA) was added to a final concentration of 20 ng/mL, and incubated overnight for 16 h at room temperature. The solution was centrifuged for 20-30 min at 15000g, then filtered through a membrane filter with 0.45 µm pores (Millipore, USA). Next, ultrafiltration was performed through a 100 kDa membrane (Millipore, USA) and diluted to the initial volume with 25 mM TrisCl buffer, pH 7.0. The operation was repeated three to four times. The solution was applied to a column with 250 ml of sorbent DEAE sepharose HP (GE, USA) equilibrated with a solution of 25 mM TrisCl, pH 7.0. After applying the sample, the column was washed with three volumes of the same solution, and then the gene therapy DNA vector GDTT1.8NAS12-ANG was eluted with a linear gradient from a solution of 25 mM TrisCl, pH 7.0 to a solution of 25 mM TrisCl, pH 7.0, 1 M NaCl in a volume of five column volumes . The elution was controlled by the optical density of the descending solution at 260 nm. Chromatographic fractions containing the gene therapy DNA vector GDTT1.8NAS12-ANG were pooled and gel-filtered on a Superdex 200 sorbent (GE, USA). The column was equilibrated with phosphate-buffered saline. The elution was controlled by the optical density of the descending solution at 260 nm, the fractions were analyzed by agarose gel electrophoresis. Fractions containing gene therapy DNA vector GDTT1.8NAS12-ANG were pooled and stored at -20°C. To assess the reproducibility of the technical process, the indicated technological operations were repeated five times. All technological operations for Escherichia coli JM110-NAS/GDTT1.8NAS12-ANGPT1, or Escherichia coli JM110-NAS/GDTT1.8NAS12-VEGFA, or Escherichia coli JM110-NAS/GDTT1.8NAS12-HIF1α strains were carried out in a similar way.

The reproducibility of the technological process and the quantitative characteristics of the final product yield confirm the manufacturability and the possibility of industrial production of the gene therapy DNA vector GDTT1.8NAS12-ANG, or GDTT1.8NAS12-ANGPT1, or GDTT1.8NAS12-VEGFA, or GDTT1.8NAS12-HIF1α.

Thus, the problem posed in this invention,

namely:

construction of gene therapy DNA vectors to increase the level of expression of the ANG, ANGPT1, VEGFA, HIF1α gene group, which is necessary for the treatment of diseases characterized by impaired vasculogenesis and angiogenesis, during hypoxia and ischemia of various tissues, including the brain and spinal cord, to stimulate germination and the formation of new blood vessels in damaged tissues, including diabetes, oncological and neurodegenerative diseases, by increasing the expression level of the target gene ANG, or ANGPT1, or VEGFA, or HIF1α, in humans and animals,

while combining the following properties:

I) the effectiveness of increasing the expression of target genes in eukaryotic cells due to the obtained gene therapy vectors with a minimum size;

II) the possibility of safe use for genetic therapy in humans and animals due to the absence of regulatory elements in the gene therapy DNA vector, which are nucleotide sequences of viral genomes and antibiotic resistance genes;

III) manufacturability and the possibility of production in strains on an industrial scale;

IV) also the task of constructing strains carrying these gene therapy DNA vectors for the production of these gene therapy DNA vectors has been solved, as evidenced by the examples:

for item I - example 1, 2, 3, 4, 5; 6; 7; eight; 9; ten; eleven; 12; 13; fourteen; fifteen; 16; 17; eighteen

for item II - example 1, 2, 3, 4

for p. III and p. IV - example 19, 20.

Industrial Applicability

All the above examples confirm the industrial applicability of the proposed gene therapy DNA vector based on the GDTT1.8NAS12 gene therapy DNA vector carrying the target gene selected from the group of genes: ANG gene, ANGPT1 gene, VEGFA gene, HIF1α gene to increase the expression level of these target genes, Escherichia coli strain JM110-NAS/GDTT1.8NAS12-ANG or Escherichia coli JM110-NAS/GDTT1.8NAS12-ANGPT1 or Escherichia coli JM110-NAS/GDTT1.8NAS12-VEGFA or Escherichia coli JM110-NAS/GDTT1.8NAS12-HIF1α carrying gene therapy DNA- vector, a method for producing a gene therapy DNA vector, a method for industrial scale production of a gene therapy DNA vector.

Oligonucleotide Sequence Listing

(1) Oligonucleotide UCori-BamGGATCCAGATCTACTCGAGGTAGAAAAGATCAAAGGATCTTC

(2) Oligonucleotide UCori-Nco AGTCCATGGATAACGCAGGAAAGAACATGTG

(3) Oligonucleotide hGH-F AGGATCCGAATTCCCTGTGACCCCTCCCCAG

(4) Oligonucleotide hGH-R CTCTTTACCAATTCTACGCGTAAGGACAGGGAAGGGAGCA

(5) Oligonucleotide RO-F CTTCCCTGTCCTTACGCGTAGAATTGGTAAAAGAGAGTCGT

(6) Oligonucleotide RO-R CCGTAGAAAACTAGTTAATGATTTTTATCAAAATCATTAAG

(7) Oligonucleotide RO-1 GAATTGGTAAAAGAGAGTCGTGTAAAATATCGAGTTCGCACATCTTGTTG

(8) Oligonucleotide RO-2 GATTTTTGGCGAAACCATTTGATCATATGACAAGATGTGTATCTACC

(9) Oligonucleotide RO-3 ATGATTTTTATCAAAATCATTAAGTTAAGGTAGATACACATCTTGTC

(10) Kan-F oligonucleotide AAATCATTAACTAGTTTTCTACGGGGTCTGACGC

(11) Kan-R oligonucleotide CAGCCATGGACTAGTGGTGGCACTTTTCGGGGA

(12) Oligonucleotide MCS1 GATCCGATATCGTCGACAAGCTTGGTACCT

(13) Oligonucleotide MCS2 CAAGCTTGTCGACGATATCG

(14) Oligonucleotide MCS3 CCGGAGCGGCCGCTCTAGAGCTAGCGAGTCG

(15) Oligonucleotide MCS4 AATTCGACGTCGCTAGCTCTAGAGCGGCCGCTCCGGAGGTAC

(16) Oligonucleotide EF1-Xho ATCTCGAGCGTGAGGCTCCGGTGCC

(17) Oligonucleotide EF1-R TCGGATCCTGGCTTTTAGGGGTAGTTTTC

(18) Oligonucleotide AN_FTTTGTCGACCACCATGGTGATGGGCCTGGGCGTT

(19) Oligonucleotide AN_RAATGGTACCTTACGGACGACGGAAAATTGACTG

(20) Oligonucleotide AN_rtFCGACCCTGGCTCAGGATAAC

(21) Oligonucleotide AN_rtRTGTCTTTGCAGGGTGAGGTC

(22) Oligonucleotide ANPT_FTTTGTCGACCACCATGACAGTTTTCCTTTCCTTTGCTTTCC

(23) Oligonucleotide ANPT_RAATGGTACCTCAAAAATCTAAAGGTCGAATCATCATAGTTG

(24) Oligonucleotide ANPT_rtFTGCAGAGAGATGCCTCCACAC

(25) Oligonucleotide ANPT_rtRTGTATCTGGGCCATCTCCGA

(26) Oligonucleotide VEG_FGGGGGATCCACCATGACGGACAGACAGACAGACACCGC

(27) Oligonucleotide VEG_RTTTAAGCTTTCACCGCCTCGGCTTGTCACATCTG

(28) Oligonucleotide VEG_rtFCTTGCCTTGCTGCTCTACCT

(29) Oligonucleotide VEG_rtRGCAGTAGCTGCGCTGATAGA

(30) Oligonucleotide HIF_FAGGATCCACCATGGAGGGCGCCGGCGGCGCGA

(31) Oligonucleotide HIF_RAATGGTACCTCAGTTAACTTGATCCAAAGCTCTGAGTAATTC

(32) Oligonucleotide HIF_rtFTTTTGGCAGCAACGACACAG

(33) Oligonucleotide HIF_rtRGTGCAGGGTCAGCACTT

List of abbreviations

GDTT1.8NAS12 is a gene therapy vector that does not contain viral genome sequences and antibiotic resistance markers (vectortherapeuticvirus-antibiotic-free)

DNA - deoxyribonucleic acid

cDNA - complementary deoxyribonucleic acid

RNA - ribonucleic acid

mRNA - messenger ribonucleic acid

b.s. - pairs of nucleotides

PCR - polymerase chain reaction

ml - milliliter, µl - microliter

cube mm - cubic millimeter

l - liter

mcg - microgram

mg - milligram

g - gram

µM - micromole

mM - millimole

min - minute

sec - second

rpm - revolutions per minute

nm - nanometer

cm - centimeter

mW - milliwatt

o.u. f-relative unit of fluorescence

PBC - phosphate-buffered saline

--->

SEQUENCE LIST

<110>GENETIC DIAGNOSTICS AND THERAPY 21 LTD (GENETIC DIAGNOSTICS AND THERAPY)

21 LTD), Limited Liability Company "RECOMBITEH"

<120>Genotherapeutic DNA vector based on gene therapy DNA-

vector GDTT1.8NAS12 carrying the target gene selected from the ANG gene group,

ANGPT1, VEGFA, HIF1α to increase the level of expression of these target genes,

method for its preparation and use, strain EscherichiacoliJM110-

NAS/GDTT1.8NAS12-ANG or EscherichiacoliJM110-NAS/GDTT1.8NAS12-ANGPT1 or

EscherichiacoliJM110-NAS/GDTT1.8NAS12-VEGFA or EscherichiacoliJM110-

NAS/GDTT1.8NAS12-HIF1α carrying a gene therapy DNA vector, method for

obtaining, a method of production on an industrial scale of a gene therapy

vector DNA.

<160>37

<170> BiSSAP 1.3.6

<210> 1

<211>3033

<212> DNA

<213> Homo sapiens

<400> 1

ataacgcagg aaagaacatg tgagcaaaag gccagcaaaa ggccagggac cgtaaaaagg 60

ccgcgttgct ggcgtttttc cataggctcc gcccccctga cgagcatcac aaaaatcgac 120

gctcaagtca gaggtggcga aacccgacag gactataaag ataccaggcg tttccccctg 180

gaagctccct cgtgcgctct cctgttccga ccctgccgct taccggatac ctgtccgcct 240

ttctcccttc gggaagcgtg gcgctttctc atagctcacg ctgtaggtat ctcagttcgg 300

tgtaggtcgt tcgctccaag ctgggctgtg tgcacgaacc ccccgttcag cccgaccgct 360

gcgccttatc cggtaactat cgtcttgagt ccaacccggt aagacacgac ttatcgccac 420

tggcagcagc cactggtaac aggattagca gagcgaggta tgtaggcggt gctacagagt 480

tcttgaagtg gtggcctaac tacggctaca ctagaagaac agtatttggt atctgcgctc 540

tgctgaagcc agttaccttc ggaaaaagag ttggtagctc ttgatccggc aaacaaacca 600

660

ctcaagaaga tcctttgatc ttttctacct cgaccgtgag gctccggtgc ccgtcagtgg 720

gcagagcgca catcgcccac agtccccgag aagttggggg gaggggtcgg caattgaacc 780

ggtgcctaga gaaagtggcg cggggtaaac tgggaaagtg atgtcgtgta ctggctccgc 840

ctttttcccg agggtggggg agaaccgtat ataagtgcag tagtcgccgt gaacgttctt 900

tttcgcaacg ggtttgccgc cagaacacag gtaagtgccg tgtgtggttc ccgcgggcct 960

ggcctcttta cgggttatgg cccttgcgtg ccttgaatta cttccacgcc cctggctgca 1020

1080

cgcttaagga gccccttcgc ctcgtgcttg agttgaggcc tggcctaggc gctggggccg 1140

ccgcgtgcga atctggtggc accttcgcgc ctgtctcgct gctttcgata agtctctagc 1200

catttaaaat ttttgatgac ctgctgcgac gctttttttc tggcaagata gtcttgtaaa 1260

tgcgggccaa gatctgcaca ctggtatttc ggtttttgggg gccgcggggcg gcgacggggc 1320

ccgtgcgtcc cagcgcacat gttcggcgag gcggggcctg cgagcgcggc caccgagaat 1380

cggacgggggg tagtctcaag ctggccggcc tgctctggtg cctggcctcg cgccgccgtg 1440

tatcgccccg ccctgggcgg caaggctggc ccggtcggca ccagttgcgt gagcggaaag 1500

atggccgctt cccggccctg ctgcagggag ctcaaaatgg aggacgcggc gctcgggaga 1560

1620

atgtgactcc acggagtacc gggcgccgtc caggcacctc gattagttct cgagcttttg 1680

gagtacgtcg tctttaggtt ggggggaggg gttttatgcg atggagtttc cccacactga 1740

gtgggtggag actgaagtta ggccagcttg gcacttgatg taattctcct tggaatttgc 1800

1860

tcttccattt caggtgtcgt gaaaactacc cctaaaagcc aggatccgat atcgtcgacc 1920

accatggtga tgggcctggg cgttttgttg ttggtcttcg tgctgggtct gggtctgacc 1980

ccaccgaccc tggctcagga taactccagg tacacacact tcctgaccca gcactatgat 2040

gccaaaccac agggccggga tgacagatac tgtgaaagca tcatgaggag acggggcctg 2100

acctcaccct gcaaagacat caacacattt attcatggca acaagcgcag catcaaggcc 2160

atctgtgaaa acaagaatgg aaaccctcac agagaaaacc taagaataag caagtcttct 2220

ttccaggtca ccacttgcaa gctacatgga gggtccccct ggcctccatg ccagtaccga 2280

gccacagcgg ggttcagaaa cgttgttgtt gcttgtgaaa atggcttacc tgtccacttg 2340

gatcagtcaa ttttccgtcg tccgtaaggt acctccggag cggccgctct agagctagcg 2400

acgtcgaatt ccctgtgacc cctccccagt gcctctcctg gccctggaag ttgccactcc 2460

agtgcccacc agccttgtcc taataaaatt aagttgcatc attttgtctg actaggtgtc 2520

cttctataat attatggggt ggaggggggt ggtatggagc aaggggcaag ttgggaagac 2580

aacctgtagg gcctgcgggg tctattggga accaagctgg agtgcagtgg cacaatcttg 2640

gctcactgca atctccgcct cctgggttca agcgattctc ctgcctcagc ctcccgagtt 2700

gttgggattc caggcatgca tgaccaggct cagctaattt ttgttttttt ggtagagacg 2760

gggtttcacc atattggcca ggctggtctc caactcctaa tctcaggtga tctacccacc 2820

ttggcctccc aaattgctgg gattacaggc gtgaaccact gctcccttcc ctgtccttac 2880

gcgtagaatt ggtaaagaga gtcgtgtaaa atatcgagtt cgcacatctt gttgtctgat 2940

tattgatttt tggcgaaacc atttgatcat atgacaagat gtgtatctac cttaacttaa 3000

tgattttgat aaaaatcatt aactagtcca tgg 3033

<210> 2

<211>4086

<212> DNA

<213> Homo sapiens

<400> 2

ataacgcagg aaagaacatg tgagcaaaag gccagcaaaa ggccagggac cgtaaaaagg 60

ccgcgttgct ggcgtttttc cataggctcc gcccccctga cgagcatcac aaaaatcgac 120

gctcaagtca gaggtggcga aacccgacag gactataaag ataccaggcg tttccccctg 180

gaagctccct cgtgcgctct cctgttccga ccctgccgct taccggatac ctgtccgcct 240

ttctcccttc gggaagcgtg gcgctttctc atagctcacg ctgtaggtat ctcagttcgg 300

tgtaggtcgt tcgctccaag ctgggctgtg tgcacgaacc ccccgttcag cccgaccgct 360

gcgccttatc cggtaactat cgtcttgagt ccaacccggt aagacacgac ttatcgccac 420

tggcagcagc cactggtaac aggattagca gagcgaggta tgtaggcggt gctacagagt 480

tcttgaagtg gtggcctaac tacggctaca ctagaagaac agtatttggt atctgcgctc 540

tgctgaagcc agttaccttc ggaaaaagag ttggtagctc ttgatccggc aaacaaacca 600

660

ctcaagaaga tcctttgatc ttttctacct cgaccgtgag gctccggtgc ccgtcagtgg 720

gcagagcgca catcgcccac agtccccgag aagttggggg gaggggtcgg caattgaacc 780

ggtgcctaga gaaagtggcg cggggtaaac tgggaaagtg atgtcgtgta ctggctccgc 840

ctttttcccg agggtggggg agaaccgtat ataagtgcag tagtcgccgt gaacgttctt 900

tttcgcaacg ggtttgccgc cagaacacag gtaagtgccg tgtgtggttc ccgcgggcct 960

ggcctcttta cgggttatgg cccttgcgtg ccttgaatta cttccacgcc cctggctgca 1020

1080

cgcttaagga gccccttcgc ctcgtgcttg agttgaggcc tggcctaggc gctggggccg 1140

ccgcgtgcga atctggtggc accttcgcgc ctgtctcgct gctttcgata agtctctagc 1200

catttaaaat ttttgatgac ctgctgcgac gctttttttc tggcaagata gtcttgtaaa 1260

tgcgggccaa gatctgcaca ctggtatttc ggtttttgggg gccgcggggcg gcgacggggc 1320

ccgtgcgtcc cagcgcacat gttcggcgag gcggggcctg cgagcgcggc caccgagaat 1380

cggacgggggg tagtctcaag ctggccggcc tgctctggtg cctggcctcg cgccgccgtg 1440

tatcgccccg ccctgggcgg caaggctggc ccggtcggca ccagttgcgt gagcggaaag 1500

atggccgctt cccggccctg ctgcagggag ctcaaaatgg aggacgcggc gctcgggaga 1560

1620

atgtgactcc acggagtacc gggcgccgtc caggcacctc gattagttct cgagcttttg 1680

gagtacgtcg tctttaggtt ggggggaggg gttttatgcg atggagtttc cccacactga 1740

gtgggtggag actgaagtta ggccagcttg gcacttgatg taattctcct tggaatttgc 1800

cctttttgag tttggatctt ggttcattct caagcctcag acagtggttc aaagtttttt 1860

tcttccattt caggtgtcgt gaaaactacc cctaaaagcc aggatccgat atcgtcgacc 1920

accatgacag ttttcctttc ctttgctttc ctcgctgcca ttctgactca catagggtgc 1980

agcaatcagc gccgaagtcc agaaaacagt gggagaagat ataaccggat tcaacatggg 2040

caatgtgcct acactttcat tcttccagaa cacgatggca actgtcgtga gagtacgaca 2100

gaccagtaca acacaaacgc tctgcagaga gatgctccac acgtggaacc ggatttctct 2160

tcccagaaac ttcaacatct ggaacatgtg atggaaaatt atactcagtg gctgcaaaaa 2220

cttgagaatt acattgtgga aaacatgaag tcggagatgg cccagataca gcagaatgca 2280

gttcagaacc acacggctac catgctggag ataggaacca gcctcctctc tcagactgca 2340

gagcagacca gaaagctgac agatgttgag acccaggtac taaatcaaac ttctcgactt 2400

gagatacagc tgctggagaa ttcattatcc acctacaagc tagagaagca acttcttcaa 2460

cagacaaatg aaatcttgaa gatccatgaa aaaaacagtt tattagaaca taaaatctta 2520

2580

caaggcttgg ttactcgtca aacatatata atccaggagc tggaaaagca attaaacaga 2640

gctaccacca acaacagtgt ccttcagaag cagcaactgg agctgatgga cacagtccac 2700

aaccttgtca atctttgcac taaagaaggt gttttactaa agggaggaaa aagagaggaa 2760

gagaaaccat ttagagactg tgcagatgta tatcaagctg gttttaataa aagtggaatc 2820

tacactattt atattaataa tatgccagaa cccaaaaagg tgttttgcaa tatggatgtc 2880

aatgggggag gttggactgt aatacaacat cgtgaagatg gaagtctaga tttccaaaga 2940

ggctggaagg aatataaaat gggttttggga aatccctccg gtgaatattg gctggggaat 3000

3060

tgggaaggga accgagccta ttcacagtat gacagattcc acataggaaa tgaaaagcaa 3120

aactataggt tgtatttaaa aggtcacact gggacagcag gaaaacagag cagcctgatc 3180

ttacacggtg ctgatttcag cactaaagat gctgataatg acaactgtat gtgcaaatgt 3240

gccctcatgt taacaggagg atggtggttt gatgcttgtg gcccctccaa tctaaatgga 3300

atgttctata ctgcgggaca aaaccatgga aaactgaatg ggataaagtg gcactacttc 3360

3420

ggtacctccg gagcggccgc tctagagcta gcgacgtcga attccctgtg acccctcccc 3480

agtgcctctc ctggccctgg aagttgccac tccagtgccc accagccttg tcctaataaa 3540

attaagttgc atcattttgt ctgactaggt gtccttctat aatattatgg ggtggagggg 3600

ggtggtatgg agcaaggggc aagttgggaa gacaacctgt agggcctgcg gggtctattg 3660

ggaaccaagc tggagtgcag tggcacaatc ttggctcact gcaatctccg cctcctgggt 3720

tcaagcgatt ctcctgcctc agcctcccga gttgttggga ttccaggcat gcatgaccag 3780

3840

ctccaactcc taatctcagg tgatctaccc accttggcct cccaaattgc tgggattaca 3900

ggcgtgaacc actgctccct tccctgtcct tacgcgtaga attggtaaag agagtcgtgt 3960

aaaatatcga gttcgcacat cttgttgtct gattattgat ttttggcgaa accatttgat 4020

catatgacaa gatgtgtatc taccttaact taatgatttt gataaaaatc attaactagt 4080

ccatgg 4086

<210> 3

<211>3821

<212> DNA

<213> Homo sapiens

<400> 3

ataacgcagg aaagaacatg tgagcaaaag gccagcaaaa ggccagggac cgtaaaaagg 60

ccgcgttgct ggcgtttttc cataggctcc gcccccctga cgagcatcac aaaaatcgac 120

gctcaagtca gaggtggcga aacccgacag gactataaag ataccaggcg tttccccctg 180

gaagctccct cgtgcgctct cctgttccga ccctgccgct taccggatac ctgtccgcct 240

ttctcccttc gggaagcgtg gcgctttctc atagctcacg ctgtaggtat ctcagttcgg 300

tgtaggtcgt tcgctccaag ctgggctgtg tgcacgaacc ccccgttcag cccgaccgct 360

gcgccttatc cggtaactat cgtcttgagt ccaacccggt aagacacgac ttatcgccac 420

tggcagcagc cactggtaac aggattagca gagcgaggta tgtaggcggt gctacagagt 480

tcttgaagtg gtggcctaac tacggctaca ctagaagaac agtatttggt atctgcgctc 540

tgctgaagcc agttaccttc ggaaaaagag ttggtagctc ttgatccggc aaacaaacca 600

660

ctcaagaaga tcctttgatc ttttctacct cgaccgtgag gctccggtgc ccgtcagtgg 720

gcagagcgca catcgcccac agtccccgag aagttggggg gaggggtcgg caattgaacc 780

ggtgcctaga gaaagtggcg cggggtaaac tgggaaagtg atgtcgtgta ctggctccgc 840

ctttttcccg agggtggggg agaaccgtat ataagtgcag tagtcgccgt gaacgttctt 900

tttcgcaacg ggtttgccgc cagaacacag gtaagtgccg tgtgtggttc ccgcgggcct 960

ggcctcttta cgggttatgg cccttgcgtg ccttgaatta cttccacgcc cctggctgca 1020

1080

cgcttaagga gccccttcgc ctcgtgcttg agttgaggcc tggcctaggc gctggggccg 1140

ccgcgtgcga atctggtggc accttcgcgc ctgtctcgct gctttcgata agtctctagc 1200

catttaaaat ttttgatgac ctgctgcgac gctttttttc tggcaagata gtcttgtaaa 1260

tgcgggccaa gatctgcaca ctggtatttc ggtttttgggg gccgcggggcg gcgacggggc 1320

ccgtgcgtcc cagcgcacat gttcggcgag gcggggcctg cgagcgcggc caccgagaat 1380

cggacgggggg tagtctcaag ctggccggcc tgctctggtg cctggcctcg cgccgccgtg 1440

tatcgccccg ccctgggcgg caaggctggc ccggtcggca ccagttgcgt gagcggaaag 1500

atggccgctt cccggccctg ctgcagggag ctcaaaatgg aggacgcggc gctcgggaga 1560

1620

atgtgactcc acggagtacc gggcgccgtc caggcacctc gattagttct cgagcttttg 1680

gagtacgtcg tctttaggtt ggggggaggg gttttatgcg atggagtttc cccacactga 1740

gtgggtggag actgaagtta ggccagcttg gcacttgatg taattctcct tggaatttgc 1800

1860

tcttccattt caggtgtcgt gaaaactacc cctaaaagcc aggatccacc atgacggaca 1920

gacagacaga caccgccccc agccccagct accacctcct ccccggccgg cggcggacag 1980

tggacgcggc ggcgagccgc gggcaggggc cggagcccgc gcccgggaggc ggggtggagg 2040

gggtcggggc tcgcggcgtc gcactgaaac ttttcgtcca acttctgggc tgttctcgct 2100

2160

gctcgggccg ggaggagccg cagccgggagg agggggagga ggaagaagag aaggaagagg 2220

agaggggggcc gcagtggcga ctcggcgctc ggaagccggg ctcatggacg ggtgaggcgg 2280

2340

gccgggggagg aagagtagct cgccgaggcg ccgaggagag cgggccgccc cacagcccga 2400

gccggagagg gagcgcgagc cgcgccggcc ccggtcgggc ctccgaaacc atgaactttc 2460

tgctgtcttg ggtgcattgg agccttgcct tgctgctcta cctccaccat gccaagtggt 2520

cccaggctgc acccatggca gaaggaggag ggcagaatca tcacgaagtg gtgaagttca 2580

tggatgtcta tcagcgcagc tactgccatc caatcgagac cctggtggac atcttccagg 2640

agtaccctga tgagatcgag tacatcttca agccatcctg tgtgcccctg atgcgatgcg 2700

ggggctgctg caatgacgag ggcctggagt gtgtgcccac tgaggagtcc aacatcacca 2760

tgcagattat gcggatcaaa cctcaccaag gccagcacat aggagagatg agcttcctac 2820

agcacaacaa atgtgaatgc agaccaaaga aagatagagc aagacaagaa aaaaaatcag 2880

ttcgaggaaa gggaaagggg caaaaacgaa agcgcaagaa atcccggtat aagtcctgga 2940

gcgtgtacgt tggtgcccgc tgctgtctaa tgccctggag cctccctggc ccccatccct 3000

3060

gttcctgcaa aaacacagac tcgcgttgca aggcgaggca gcttgagtta aacgaacgta 3120

cttgcagatg tgacaagccg aggcggtgaa agcttggtac ctccggagcg gccgctctag 3180

agctagcgac gtcgaattcc ctgtgacccc tccccagtgc ctctcctggc cctggaagtt 3240

gccactccag tgcccaccag ccttgtccta ataaaattaa gttgcatcat tttgtctgac 3300

taggtgtcct tctataatat tatggggtgg aggggggtgg tatggagcaa ggggcaagtt 3360

gggaagacaa cctgtagggc ctgcggggtc tattgggaac caagctggag tgcagtggca 3420

caatcttggc tcactgcaat ctccgcctcc tgggttcaag cgattctcct gcctcagcct 3480

cccgagttgt tgggattcca ggcatgcatg accaggctca gctaattttt gttttttgg 3540

tagagacggg gtttcaccat attggccagg ctggtctcca actcctaatc tcaggtgatc 3600

tacccacctt ggcctcccaa attgctggga ttacaggcgt gaaccactgc tcccttccct 3660

gtccttacgc gtagaattgg taaagagagt cgtgtaaaat atcgagttcg cacatcttgt 3720

tgtctgatta ttgatttttg gcgaaaccat ttgatcatat gacaagatgt gtatctacct 3780

taacttaatg attttgataa aaatcattaa ctagtccatg g 3821

<210> 4

<211>5057

<212> DNA

<213> Homo sapiens

<400> 4

ataacgcagg aaagaacatg tgagcaaaag gccagcaaaa ggccagggac cgtaaaaagg 60

ccgcgttgct ggcgtttttc cataggctcc gcccccctga cgagcatcac aaaaatcgac 120

gctcaagtca gaggtggcga aacccgacag gactataaag ataccaggcg tttccccctg 180

gaagctccct cgtgcgctct cctgttccga ccctgccgct taccggatac ctgtccgcct 240

ttctcccttc gggaagcgtg gcgctttctc atagctcacg ctgtaggtat ctcagttcgg 300

tgtaggtcgt tcgctccaag ctgggctgtg tgcacgaacc ccccgttcag cccgaccgct 360

gcgccttatc cggtaactat cgtcttgagt ccaacccggt aagacacgac ttatcgccac 420

tggcagcagc cactggtaac aggattagca gagcgaggta tgtaggcggt gctacagagt 480

tcttgaagtg gtggcctaac tacggctaca ctagaagaac agtatttggt atctgcgctc 540

tgctgaagcc agttaccttc ggaaaaagag ttggtagctc ttgatccggc aaacaaacca 600

660

ctcaagaaga tcctttgatc ttttctacct cgaccgtgag gctccggtgc ccgtcagtgg 720

gcagagcgca catcgcccac agtccccgag aagttggggg gaggggtcgg caattgaacc 780

ggtgcctaga gaaagtggcg cggggtaaac tgggaaagtg atgtcgtgta ctggctccgc 840

ctttttcccg agggtggggg agaaccgtat ataagtgcag tagtcgccgt gaacgttctt 900

tttcgcaacg ggtttgccgc cagaacacag gtaagtgccg tgtgtggttc ccgcgggcct 960

ggcctcttta cgggttatgg cccttgcgtg ccttgaatta cttccacgcc cctggctgca 1020

1080

cgcttaagga gccccttcgc ctcgtgcttg agttgaggcc tggcctaggc gctggggccg 1140

ccgcgtgcga atctggtggc accttcgcgc ctgtctcgct gctttcgata agtctctagc 1200

catttaaaat ttttgatgac ctgctgcgac gctttttttc tggcaagata gtcttgtaaa 1260

tgcgggccaa gatctgcaca ctggtatttc ggtttttgggg gccgcggggcg gcgacggggc 1320

ccgtgcgtcc cagcgcacat gttcggcgag gcggggcctg cgagcgcggc caccgagaat 1380

cggacgggggg tagtctcaag ctggccggcc tgctctggtg cctggcctcg cgccgccgtg 1440

tatcgccccg ccctgggcgg caaggctggc ccggtcggca ccagttgcgt gagcggaaag 1500

atggccgctt cccggccctg ctgcagggag ctcaaaatgg aggacgcggc gctcgggaga 1560

1620

atgtgactcc acggagtacc gggcgccgtc caggcacctc gattagttct cgagcttttg 1680

gagtacgtcg tctttaggtt ggggggaggg gttttatgcg atggagtttc cccacactga 1740

gtgggtggag actgaagtta ggccagcttg gcacttgatg taattctcct tggaatttgc 1800

1860

tcttccattt caggtgtcgt gaaaactacc cctaaaagcc aggatccacc atggagggcg 1920

ccggcggcgc gaacgacaag aaaaagataa gttctgaacg tcgaaaagaa aagtctcgag 1980

atgcagccag atctcggcga agtaaagaat ctgaagtttt ttatgagctt gctcatcagt 2040

tgccacttcc acataatgtg agttcgcatc ttgataaggc ctctgtgatg aggcttacca 2100

tcagctattt gcgtgtgagg aaacttctgg atgctggtga tttggatatt gaagatgaca 2160

tgaaagcaca gatgaattgc ttttatttga aagccttgga tggttttgtt atggttctca 2220

cagatgatgg tgacatgatt tacatttctg ataatgtgaa caaatacatg ggattaactc 2280

agtttgaact aactggacac agtgtgtttg attttactca tccatgtgac catgaggaaa 2340

tgagagaaat gcttacacac agaaatggcc ttgtgaaaaa gggtaaagaa caaaacacac 2400

agcgaagctt ttttctcaga atgaagtgta ccctaactag ccgaggaaga actatgaaca 2460

taaagtctgc aacatggaag gtattgcact gcacaggcca cattcacgta tatgatacca 2520

acagtaacca acctcagtgt gggtataaga aaccacctat gacctgcttg gtgctgattt 2580

gtgaacccat tcctcaccca tcaaatattg aaattccttt agatagcaag actttcctca 2640

gtcgacacag cctggatatg aaattttctt attgtgatga aagaattacc gaattgatgg 2700

gatatgagcc agaagaactt ttaggccgct caatttatga atattatcat gctttggact 2760

ctgatcatct gaccaaaact catcatgata tgtttactaa aggacaagtc accacaggac 2820

agtacaggat gcttgccaaa agaggtggat atgtctgggt tgaaactcaa gcaactgtca 2880

tatataacac caagaattct caaccacagt gcattgtatg tgtgaattac gttgtgagtg 2940

gtattattca gcacgacttg attttctccc ttcaacaaac agaatgtgtc cttaaaccgg 3000

3060

gtagcctctt tgacaaactt aagaaggaac ctgatgcttt aactttgctg gccccagccg 3120

ctggagacac aatcatatct ttagattttg gcagcaacga cacagaaact gatgaccagc 3180

aacttgagga agtaccatta tataatgatg taatgctccc ctcacccaac gaaaaattac 3240

agaatataaa tttggcaatg tctccattac ccaccgctga aacgccaaag ccacttcgaa 3300

3360

cactggaact ttcttttacc atgccccaga ttcaggatca gacacctagt ccttccgatg 3420

gaagcactag acaaagttca cctgagccta atagtcccag tgaatattgt ttttatgtgg 3480

atagtgatat ggtcaatgaa ttcaagttgg aattggtaga aaaacttttt gctgaagaca 3540

cagaagcaaa gaacccattt tctactcagg acacagattt agacttggag atgttagctc 3600

cctatatccc aatggatgat gacttccagt tacgttcctt cgatcagttg tcaccattag 3660

aaagcagttc cgcaagccct gaaagcgcaa gtcctcaaag cacagttaca gtattccagc 3720

agactcaaat acaagaacct actgctaatg ccaccactac cactgccacc actgatgaat 3780

taaaaacagt gacaaaagac cgtatggaag acattaaaat attgattgca tctccatctc 3840

ctacccacat acataaagaa actacaagtg ccacatcatc accatataga gatactcaaa 3900

3960 gtcggacagc ctcaccaaac agagcaggaa aaggagtcat

atccaagaag ccctaacgtg ttatctgtcg ctttgagtca aagaactaca gttcctgagg 4020

aagaactaaa tccaaagata ctagctttgc agaatgctca gagaaagcga aaaatggaac 4080

atgatggttc actttttcaa gcagtaggaa ttggaacatt attacagcag ccagacgatc 4140

atgcagctac tacatcactt tcttggaaac gtgtaaaagg atgcaaatct agtgaacaga 4200

atggaatgga gcaaaagaca attattttaa taccctctga tttagcatgt agactgctgg 4260

ggcaatcaat ggatgaaagt ggattaccac agctgaccag ttatgattgt gaagttaatg 4320

ctcctataca aggcagcaga aacctactgc agggtgaaga attactcaga gctttggatc 4380

aagttaactg aggtacctcc ggagcggccg ctctagagct agcgacgtcg aattccctgt 4440

gacccctccc cagtgcctct cctggccctg gaagttgcca ctccagtgcc caccagcctt 4500

gtcctaataa aattaagttg catcattttg tctgactagg tgtccttcta taatattatg 4560

gggtggaggg gggtggtatg gagcaagggg caagttggga agacaacctg tagggcctgc 4620

ggggtctatt gggaaccaag ctggagtgca gtggcacaat cttggctcac tgcaatctcc 4680

gcctcctggg ttcaagcgat tctcctgcct cagcctcccg agttgttggg attccaggca 4740

tgcatgacca ggctcagcta atttttgttt ttttggtaga gacggggttt caccatattg 4800

gccaggctgg tctccaactc ctaatctcag gtgatctacc caccttggcc tcccaaattg 4860

ctgggattac aggcgtgaac cactgctccc ttccctgtcc ttacgcgtag aattggtaaa 4920

gagagtcgtg taaaatatcg agttcgcaca tcttgttgtc tgattattga tttttggcga 4980

5040

cattaactag tccatgg 5057

<210>5

<211>42

<212> DNA

<213>Artificial sequence

<220>

<223>UCori-Bam oligonucleotide

<400>5

ggatccagat ctactcgagg tagaaaagat caaaggatct tc 42

<210>6

<211>31

<212>DNA

<213>Artificial sequence

<220>

<223> Oligonucleotide UCori-Nco

<400>6

agtccatggataacgcaggaaagaacatgtg31

<210>7

<211>31

<212>DNA

<213>Artificial sequence

<220>

<223> Oligonucleotide hGH-F

<400>7

aggatccgaattccctgtgacccctccccag31

<210>8

<211>40

<212>DNA

<213>Artificial sequence

<220>

<223>hGH-R oligonucleotide

<400>8

ctctttacca attctacgcg taaggacagg gaagggagca40

<210>9

<211> 40

<212>DNA

<213> Artificial sequence

<220>

<223> Oligonucleotide RO-F

<400>9

cttccctgtccttacgcgtagaattggtaaagagagtcgt40

<210>10

<211> 41

<212>DNA

<213> Artificial sequence

<220>

<223> Oligonucleotide RO-R

<400>10

ccgtagaaaactagttaatgatttttatcaaaatcattaag41

<210>11

<211> 49

<212>DNA

<213> Artificial sequence

<220>

<223> Oligonucleotide RO-1

<400>11

gaattggtaaagagagtcgtgtaaaatatcgagttcgcacatcttgttg49

<210>12

<211> 47

<212>DNA

<213> Artificial sequence

<220>

<223> Oligonucleotide RO-2

<400>12

gatttttggc gaaaccattt gatcatatga caagatgtgt atctacc 47

<210>13

<211> 47

<212>DNA

<213> Artificial sequence

<220>

<223> Oligonucleotide RO-3

<400> 13

atgatttttatcaaaatcattaagttaaggtagatacacatcttgtc 47

<210>14

<211>34

<212>DNA

<213> Artificial sequence

<220>

<223> Kan-F Oligonucleotide

<400> 14

aaatcattaactagttttctacggggtctgacgc34

<210>15

<211>33

<212>DNA

<213> Artificial sequence

<220>

<223> Kan-R oligonucleotide

<400> 15

cagccatggactagtggtggcactttcgggga33

<210>16

<211>30

<212>DNA

<213> Artificial sequence

<220>

<223> Oligonucleotide MCS1

<400> 16

gatccgatatcgtcgacaagcttggtacct30

<210>17

<211>20

<212>DNA

<213> Artificial sequence

<220>

<223> Oligonucleotide MCS2

<400> 17

caagcttgtc gacgatatcg20

<210>18

<211>32

<212>DNA

<213> Artificial sequence

<220>

<223> Oligonucleotide MCS3

<400> 18

ccggagcggccgctctagagctagcgacgtcg32

<210> 19

<211>42

<212>DNA

<213> Artificial sequence

<220>

<223> Oligonucleotide MCS4

<400> 19

aattcgacgtcgctagctctagagcggccgctccgggaggtac42

<210>20

<211>25

<212>DNA

<213> Artificial sequence

<220>

<223> Oligonucleotide EF1-Xho

<400>20

atctcgagcgtgaggctccggtgcc25

<210>21

<211>29

<212>DNA

<213> Artificial sequence

<220>

<223> Oligonucleotide EF1-R

<400>21

tcggatcctggcttttagggggtagttttc29

<210>22

<211>34

<212>DNA

<213> Artificial sequence

<220>

<223> Oligonucleotide AN_F

<400>22

tttgtcgaccaccatggtgatgggcctgggcgtt34

<210>23

<211>33

<212>DNA

<213> Artificial sequence

<220>

<223> Oligonucleotide AN_R

<400>23

aatggtaccttacggacgacggaaaattgactg33

<210> 24

<211>20

<212>DNA

<213> Artificial sequence

<220>

<223> Oligonucleotide AN_rtF

<400> 24

cgaccctggctcaggataac 20

<210> 25

<211> 20

<212>DNA

<213> Artificial sequence

<220>

<223> Oligonucleotide AN_rtR

<400> 25

tgtctttgcagggtgaggtc 20

<210> 26

<211>41

<212>DNA

<213> Artificial sequence

<220>

<223> Oligonucleotide ANPT_F

<400> 26

tttgtcgaccaccatgacagttttccttttccttttgctttcc 41

<210> 27

<211> 41

<212>DNA

<213> Artificial sequence

<220>

<223> Oligonucleotide ANPT_R

<400> 27

aatggtacct caaaaatcta aaggtcgaat catcatagtt g 41

<210> 28

<211>20

<212>DNA

<213> Artificial sequence

<220>

<223> Oligonucleotide ANPT_rtF

<400> 28

tgcagagagatgctccacac20

<210> 29

<211>20

<212>DNA

<213> Artificial sequence

<220>

<223> Oligonucleotide ANPT_rtR

<400> 29

tgtatctggg ccatctccga20

<210>30

<211>38

<212>DNA

<213> Artificial sequence

<220>

<223> Oligonucleotide VEG_F

<400> 30

gggggatccaccatgacggacagacagacagacaccgc 38

<210>31

<211>34

<212>DNA

<213> Artificial sequence

<220>

<223> Oligonucleotide VEG_R

<400> 31

tttaagctttcaccgcctcggcttgtcacatctg 34

<210>32

<211>20

<212>DNA

<213> Artificial sequence

<220>

<223> Oligonucleotide VEG_rtF

<400> 32

cttgccttgctgctctacct20

<210>33

<211>20

<212>DNA

<213> Artificial sequence

<220>

<223> Oligonucleotide VEG_rtR

<400> 33

gcagtagctg cgctgataga20

<210> 34

<211>32

<212>DNA

<213> Artificial sequence

<220>

<223> HIF_F oligonucleotide

<400> 34

aggatccacc atggagggcg ccggcggcgc ga32

<210> 35

<211>42

<212>DNA

<213> Artificial sequence

<220>

<223> HIF_R oligonucleotide

<400> 35

aatggtacctcagttaacttgatccaaagctctgagtaattc42

<210> 36

<211>20

<212>DNA

<213> Artificial sequence

<220>

<223> Oligonucleotide HIF_rtF

<400> 36

ttttggcagcaacgacacag20

<210> 37

<211> 20

<212>DNA

<213> Artificial sequence

<220>

<223> Oligonucleotide HIF_rtR

<400> 37

gtgcagggtcagcactactt20

<---

Claims (3)

1. DNA vector GDTT1.8NAS12-ANG to increase the level of expression of the target ANG gene in humans and animals, 3033 bp in size, with the nucleotide sequence of SEQ ID NO: 1 and the general structure shown in figa. 2. DNA vector GDTT1.8NAS12-ANG according to claim 1, characterized in that nucleotide sequences that are not antibiotic resistance genes, viral genes and regulatory elements of viral genomes are used as structural elements, ensuring the possibility of its safe use for humans and animals . 3. The method of using the DNA vector GDTT1.8NAS12-ANG according to claim 1 to increase the level of expression of the target ANG gene in humans and animals, which consists in transfection with the DNA vector GDTT1.8NAS12-ANG, SEQ ID NO:1, cells of organs and tissues of a patient or animal, and/or in the introduction into the organs and tissues of a patient or animal of autologous cells of this patient or animal, transfected with the DNA vector GDTT1.8NAS12-ANG, SEQ ID NO:1, and/or in the introduction into the organs and tissues of a patient or animal DNA vector GDTT1.8NAS12-ANG, SEQ ID NO:1, or a combination of the indicated methods.

Images