WO2020028686A1 - Targeting piezo1 for treatment of cancer and infectious diseases - Google Patents
Targeting piezo1 for treatment of cancer and infectious diseases Download PDFInfo
- Publication number
- WO2020028686A1 WO2020028686A1 PCT/US2019/044703 US2019044703W WO2020028686A1 WO 2020028686 A1 WO2020028686 A1 WO 2020028686A1 US 2019044703 W US2019044703 W US 2019044703W WO 2020028686 A1 WO2020028686 A1 WO 2020028686A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- piezol
- cells
- cancer
- mice
- cell
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1138—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against receptors or cell surface proteins
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/713—Double-stranded nucleic acids or oligonucleotides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
- A61K35/56—Materials from animals other than mammals
- A61K35/63—Arthropods
- A61K35/646—Arachnids, e.g. spiders, scorpions, ticks or mites
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- A61K38/1767—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering nucleic acids [NA]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2320/00—Applications; Uses
- C12N2320/30—Special therapeutic applications
Definitions
- Piezo 1 belongs to a family of evolutionary conserved non-selective cation channels that serve in mechanosensory transduction and have recently been implicated in certain biological processes (Ranade et al., Nature 87, 1162-1179, 2015); Hao et al. Methods Mol. Biol. 998, 159-170, 2013).
- Piezol has been shown to be a regulator of cell division, migration and differentiation (Gudipaty et al., Nature 543, 118-121, 2017; Pathak et al., Proc Natl Acad Sci USA 111, 16148-16153, 2014; McHugh et al., J. Cell Sci 123, 51-61, 2010).
- the broader function of Piezol in hematopoietic and immune systems is not well understood.
- Piezol promotes myeloid cell expansion by suppressing Rbl expression via upregulation of HDAC2.
- our work uncovers Piezol as a targetable immune checkpoint that vetoes T cell mediated cytotoxicity and drives immune- suppressive myelopoiesis.
- this disclosure provides a method for inhibiting the growth of cancer cells.
- the disclosure also provides a method for reducing the effects of an infection.
- the disclosure is based on the results of in vitro and in vivo studies which demonstrate that Piezol plays a significant role in cancer and infectious diseases. For example, our data shows that deletion of Piezol : activates T-cells in vitro, attenuates pancreatic tumor growth, enhances viral clearance and protects against polymicrobial sepsis. We also provide data to support that Piezol signaling limits autoimmunity. Thus, this disclosure identifies Piezol as a novel therapeutic target for cancer, infectious diseases and autoimmune diseases.
- this disclosure provides a method for inhibiting the growth of cancer cells comprising modulating the expression of, or function of, Piezol gene or protein.
- the method comprises administering to an individual in need of treatment (such as an individual who has a cancer, such as a tumor or blood cancer), a composition comprising an agent that modulates Piezol channel activity.
- the disclosure provides a method for inhibiting the growth of cancer cells comprising administering to an individual in need of treatment (such as an individual who has cancer, such as a tumor or blood cancer), a composition comprising an agent that downregulates or blocks Piezol channel activity (such as GsMTx-4).
- the disclosure provides a method for modulating the function of Piezol by administering to an individual in need of treatment (such as an individual who has an autoimmune disease), a composition comprising an agent that upregulates or activates Piezol channel activity (such as Yoda 1).
- this disclosure provides a method for treating an infectious disease (such as caused by a microbe e.g., virus or bacteria) comprising modulating the expression of, or function of Piezo 1 gene or protein.
- the method comprises administering to an individual who has been infected or is at risk of being infected with the microbe, a composition comprising an agent that modulates Piezol channel activity.
- the method comprises administering to an individual who has been infected or is at risk of being infected with the microbe, a composition comprising an agent that downregulates or blocks Piezol channel activity (such as GsMTx-4).
- FIG. 1 Piezol signaling regulates cancer progression.
- G WT mice bearing orthotopic KPC tumor were treated with GsMTx4 or vehicle and sacrificed at 3 weeks. The fraction of intra-tumoral GrUCDl lb + MDSC was determined by flow cytometry. Representative contour plots and quantitative data are shown. This experiment was performed 3 times with similar results.
- H Vav Cre Piezo P mice and littermate controls bearing orthotopic KPC tumor were sacrificed at 3 weeks and the fraction of intra-tumoral GrUCDl lb + MDSC was determined by flow cytometry.
- Intra-tumoral CD4 + and CD8 + T cells were gated by flow cytometry and tested for IFNy expression. This experiment was performed twice with similar results.
- L-O PDOTS from freshly resected human tumors were treated with GsMTx4 or vehicle for 3 days.
- the fraction of MDSC was determined.
- M CD4 + and CD8 + T cells were analyzed for expression of IFNy and
- N CD44.
- Spheroid sizes were measured. Data are presented as fold change compared to vehicle.
- P, Q PDOTS from freshly resected human tumors were treated with Yodal or vehicle for 3 days.
- P The fraction of MDSC was determined.
- Q CD4 + and CD8 + T cells were analyzed for expression of IFNy. Data are presented as fold change compared to vehicle (*p ⁇ 0.05; **p ⁇ 0.0l; ****p ⁇ 0.000l).
- FIG. 1 Piezol transduces mechanical force in T cells and mitigates tumor immunity.
- C Cohorts of Lclf re PiezolflP mice and littermate controls bearing orthotopic KPC tumor were sacrificed at 3 weeks.
- Intra-tumoral CD8 + T cells were tested for expression of an activation phenotype on flow cytometry. Data are representative of three independent experiments.
- E, F Cohorts of Cd4 Cre R ⁇ bzo R mice and littermate controls bearing orthotopic KPC tumor were sacrificed at 3 weeks.
- F Intra- tumoral CD4 + T cells were analyzed for expression of Tbet and FoxP3. Data are
- FIG. 3 Piezol signaling links mechanical pressure to immune- regulation.
- A Polyclonal splenic CD4 + T cells from Lck Cre ;Piezo and littermate control mice were activated in vitro by CD3/CD28 co-ligation for 72h and tested for expression of select activation markers and transcription factors. This experiment was repeated more than 4 times with similar results.
- B Polyclonal splenic CD8 + T cells from ck ( rc ; iezo l 1111 and littermate control mice were activated in vitro by CD3/CD28 co-ligation and tested for expression of IFNy and TNFa in l2h cell culture supernatant. This experiment was repeated twice with similar results.
- (K-N) Polyclonal splenic CD4 + and CD8 + T cells from WT mice were activated in vitro by CD3/CD28 co-ligation with application of increasing mechanical pressure (66-227 Pa). T cell activation was determined based on expression of (K, L) LFA1, and (M, N) TNFa. Data are representative of three independent experiments performed in replicates of 5.
- (O-Q) Polyclonal splenic CD4 + and CD8 + T cells from Lck Cre ;Piezo flP mice and littermate controls were activated in vitro by CD3/CD28 co-ligation with application of increasing mechanical pressure. T cell activation was determined based on expression of (O) IFNy and (P, Q) LFA1.
- FIG. 4 Piezol deletion in T cells increases cellular activation and nutrient consumption via c-Myc.
- A-F Control and ck ( ;PiezoI 1111 splenic T cells were activated by CD3/CD28 co-ligation and tested for transcriptomic changes by RNAseq.
- A A heat map depicting the 50 most differentially expressed genes and
- B an MA plot showing global differential gene expression in the control and LckP re iPiezol ⁇ A splenic T cells are shown.
- C A heat map depicting expression of chemokine-related genes and
- D GSEA for Chemokine Receptor is shown.
- Lcif re ;Piezol fl/ fl and control T cells were activated by CD3/CD28 co-ligation and tested for expression of pAkt expression by flow cytometry at serial time intervals. This experiment was performed in triplicate and repeated twice with similar results.
- Lc P ⁇ iPiezo P and control T cells were activated by CD3/CD28 co-ligation and tested for expression of pS6 expression by flow cytometry at serial time intervals. This experiment was performed in 10 replicates and repeated twice with similar results.
- M, N Lc]f re ;Piezo /fl T cells and controls were activated by CD3/CD28 co-ligation for 72h before RNAseq analysis as above.
- FIG. Piezol deletion on myeloid cells confers anti-tumor immunity and protection against polymicrobial sepsis.
- A Mice were sacrificed at 3 weeks. Representative pictures of tumors and quantitative analysis of tumor weights are shown.
- B The prevalence of intra-tumoral Grl + CDl lb + MDSC was determined.
- C Intra-tumoral CD4 + T cells were assessed for expression of CD44, CD69, and Tbet.
- FIG. 6 Piezol governs myeloid cell expansion via epigenetic regulation of Rbl.
- A-D Cohorts of Lyz2M Cre ;Rbl2 l/ fl mice and littermate controls were individualed to CLP.
- A The prevalence of MDSC in the peritoneal cavity,
- B serum levels of inflammatory mediators, and
- C rectal temperatures were measured at 24h.
- E Myeloid cells harvested from WT bone marrow were cultured on 0.2 and 50 kPa Matrigen-Softwell plates overnight and tested for expression of Rbl by qPCR.
- I z2M ( r ;Riezo I 1111 ;Rb l 1111 mice and littermate controls were challenged with orthotopic PDA and sacrificed at 3 weeks.
- I Tumor weight and (J) the frequency of tumor-infiltrating MDSC were recorded.
- K Myeloid cells harvested from bone marrow of I z2M ( rc ;Piezo I 1111 mice and controls were tested for expression of HDAC2 by western blotting. This experiment was repeated twice with similar results.
- L-O Myeloid cells harvested from bone marrow of I z2M ( rc ; Piezo l ⁇ 1111 and littermate control mice were analyzed by single cell RNAseq.
- I z2M ( rc ; Piezo l ⁇ 1111 mice and littermate controls were treated with LBH589 and individualed to CLP.
- FIG. 7 Modulation of Piezo 1 in cancer.
- B KPC tumor cells were seeded in 96-well plates with PBS, GsMTx4,
- FIG. 8 Piezol does not affect lymphopoiesis.
- B BioGPS gene portal data showing PIEZO 1 expression in human CD4 + and CD8 + T cells compared to median expression in other tissues.
- D Analysis of progenitor and mature thymic T cell populations in
- CD4 + CD8 + double positive; DP
- CD4 CD8 double negative; DN
- CD44 + CD25 CD25 + (DN2)
- CD44 CD25 + (DN3) CD44 CD25 (DN4) populations are shown.
- Data are representative of three independent experiments.
- E, F T cells in the (E) spleen or (F) lymph nodes LckF re iPiezol ⁇ fl and control mice were analyzed for the CD4/CD8 ratio and expression of fate-determining transcription factors. This experiment was performed 3 times.
- T cell activation was determined based on expression of ⁇ FNy.
- H-L Polyclonal splenic CD4+ and CD8+ T cells from WT mice were activated in vitro by CD3/CD28 co-ligation with application of low (66 Pa) or high (227 Pa) mechanical pressure and tested for (H) differences in OCR, (I) ECAR, and (J) ATP production.
- K c-Myc expression was tested by qPCR.
- L Cell viability was determined by flow cytometry. Data are representative of 3 experiments (*p ⁇ 0.0l;
- FIG. 11 Piezol senses pressure in myeloid cells.
- A BioGPS gene portal data showing PIEZO 1 expression in human monocytes compared to median expression in other tissues.
- C Bone marrow cells from I z2M ( rc ; iezo l 1111 mice and WT mice were analyzed for the frequency of CD1 l7 + CDl l5 + CDl35 + Ly6C CDl lb myeloid-derived progenitors (MDP) and
- D Splenocytes from I z2M ( rc ; iezo l 1111 mice and WT mice were analyzed for the frequency of splenic CD1 lb + CD68 + F4/80 + macrophages and CD1 lb + CDl lc + MHCII + dendritic cells. Data are representative of experiments performed 3 times.
- E, F F
- FIG. 13 Acetyl-histone H4 ChIP-sequencing of bone marrow cells.
- the present disclosure provides methods for treatment of various diseased conditions by modulation (up or down regulation) of Piezol activity.
- simple perturbations in mechanical forces translate into cellular signals that lead to T lymphocyte reprogramming.
- Piezol is expressed on both T cells and myeloid cells.
- Knocking out Piezol in T-cells results in T-cells being more sensitive to both TCR as well as TCR-bypassed activation.
- Piezol deletion in T-cells leads to a favorable Thl-phenotype with markedly increased IFNy-production.
- Piezol deletion is associated with improved antigen crosspresentation. Further, myeloid-specific deletion of Piezol is associated with tumor protection as well as a less severe outcome in sepsis. In tumor, Piezol deletion on myeloid cells is associated with decreased influx of monocytes.
- monocyte production is impaired, too. The decreased number of monocytes may be due to developmental arrest during myelogenesis. In fact, monocyte-macrophage-DC-precursors are increased in the bone marrow of myeloid-specific Piezol KO mice, suggesting that the developmental arrest is happening at an early stage during myelogenesis, not allowing further differentiation.
- this disclosure provides a method of modulation of immune response in the treatment of conditions where the cells may be exposed to increased pressure.
- this disclosure provides methods for treatment of, or ameliorating the symptoms of, cancer, infectious diseases or sepsis.
- treatment refers to reduction in one or more symptoms or features associated with the presence of the particular condition being treated. Treatment does not necessarily mean complete cure or remission, nor does it preclude recurrence or relapses.
- treatment in the present disclosure means reducing or inhibiting the growth of tumor cells, or reducing one or more symptoms associated with an infectious disease.
- terapéuticaally effective amount as used herein in reference to a single agent is the amount sufficient to achieve, in a single or multiple doses, the intended purpose of treatment.
- the exact amount desired or required will vary depending on the particular compound or composition used, its mode of administration, patient specifics and the like. Appropriate effective amounts can be determined by one of ordinary skill in the art informed by the present disclosure.
- Piezo 1 function may be modified (downregulated or up regulated) by using activators or inhibitors of Piezo 1 gene expression or Piezo 1 channel function.
- the present disclosure provides a method of treating cancer by modulation of Piezol activity.
- the method comprises administering to an individual in need of treatment, a composition comprising, or consisting essentially of, an agent which modulates Piezol expression or function.
- this disclosure provides a method of treating an infectious disease by modulation of Piezol activity.
- the method comprises administering to an individual who has an infection, or is at risk of getting an infection, a composition comprising, or consisting essentially of, an agent which modulates Piezol expression or function.
- the present disclosure provides a method for treating sepsis comprising administering to an individual in need of treatment, a composition comprising, or consisting essentially of, an agent which modulates Piezol expression or function.
- the individual is administered a composition in which the Piezol modulator is the only active agent.
- this disclosure provides a method for enhancing T cell activation in an environment of increased mechanical stress comprising administering to an individual who is afflicted with a condition that creates increased mechanical stress a composition comprising or consisting essentially of an inhibitor of Piezo 1 activity.
- RNAi-mediated reduction in Piezo 1 mRNA may be carried out.
- RNAi-based inhibition can be achieved using any suitable RNA polynucleotide that is targeted to Piezo 1 mRNA.
- a single stranded or double stranded RNA, wherein at least one strand is complementary to the target mRNA can be introduced into the cell to promote RNAi-based degradation of target mRNA.
- microRNA (miRNA) targeted to the Piezo 1 mRNA can be used.
- a ribozyme that can specifically cleave Piezo 1 mRNA can be used.
- small interfering RNA can be used.
- siRNA can be introduced directly, for example, as a double stranded siRNA complex, or by using a modified expression vector, such as a lentiviral vector, to produce an shRNA.
- shRNAs adopt a typical hairpin secondary structure that contains a paired sense and antisense portion, and a short loop sequence between the paired sense and antisense portions.
- shRNA is delivered to the cytoplasm where it is processed by DICER into siRNAs.
- siRNA is recognized by RNA- induced silencing complex (RISC), and once incorporated into RISC, siRNAs facilitate cleavage and degradation of targeted mRNA.
- RISC RNA- induced silencing complex
- shRNA polynucleotide used to suppress Piezol mRNA expression can comprise or consist of between 45-100 nucleotides, inclusive, and including all integers between 45 and 100
- modified lentiviral vectors can be made and used according to standard techniques, given the benefit of the present disclosure.
- Custom siRNAs or shRNA can be obtained from, for example Thermo-Dharmacon or Cellecta for transient transfection resulting in temporary reduction in the targeted mRNA levels.
- the lentiviruses are capable of stably and permanently infecting target cells, such as by integrating into a genome of a cell.
- the disclosure includes disrupting the target gene such that
- the Piezol gene can be disrupted by targeted mutagenesis.
- targeted mutagenesis can be achieved by, for example, targeting a CRISPR (clustered regularly interspaced short palindromic repeats) site in the target gene.
- CRISPR systems designed for targeting specific genomic sequences are known in the art and can be adapted to disrupt the target gene for making modified cells encompassed by this disclosure.
- the CRISPR system includes one or more expression vectors encoding at least a targeting RNA and a polynucleotide sequence encoding a CRISPR-associated nuclease, such as Cas9, but other Cas nucleases can alternatively be used.
- CRISPR systems for targeted disruption of mammalian chromosomal sequences are commercially available.
- this disclosure provides a method for treatment of cancer comprising deletion or mutation of the Piezol gene using CRISPR based DNA editing techniques, whereby the activity of Piezol is reduced resulting in inhibition of growth of cancer cells.
- this disclosure provides a method for treatment of cancer comprising downregulating the expression of Piezol gene using RNAi based inhibition, whereby the activity of Piezol is reduced resulting in inhibition of growth of cancer cells.
- the reduction in Piezo activity may be due to reduced protein, lack or protein, or defective protein, or interference with its activity by another molecule.
- the function of Piezol protein may be inhibited by the use of specific inhibitors.
- An example of such a compound that blocks the Piezol channel is GsMTx4 (also referred to herein as GsMTx-4), a component of tarantula venom, and/or its variants.
- the present invention comprises administering to an individual a composition comprising GsMTx4 and/or one or more of its variant to treat cancer or an infectious disease (e.g. caused by a virus or bacteria).
- the peptide GsMTx4 as used herein, has the sequence
- GCLEF W WKCNPNDDKC CRPKLKC SKLFKLCNF SF (SEQ ID NO: l).
- This peptide is a 34 mer.
- Variants can be generated from this sequence by substitutions, additions or deletions wherein the variant is at least 75%, 80%, 85%, 90%, or 95% identical to SEQ ID NO: 1, provided it still exhibits blockage of Piezol channel or one or more properties described herein.
- a sequence of GsMTx4 is also disclosed in U.S. Pat. No. 7,125,847 (incorporated herein by reference).
- U.S. Patent No. 9,211,313 provides examples of substitutions that can be made (incorporated by reference). Deletions of one or more amino acids may also be made as long as it does not affect the ability of the peptide to block Piezo 1 channel. Both L and D enantiomers of GsMTx4 and its variants can be used.
- GsMTx4 is available commercially and can also be isolated from spider venom by serial fractionation using standard chromatographic techniques. For example, fractionation of the spider venom is carried out using reverse phase high performance liquid chromatography (HPLC). Reverse phase HPLC can be performed using C-8 or C-18 silica columns and trifluoroacetic acid/acetonitrile buffer system. C-8 and C-18 silica columns are commercially available (Mac-Mod Analytical, Inc., West Chester, Pa.). [0040] The peptide GsMTx4 and its variants can also be prepared by chemical synthesis using automated or manual solid phase methods. Such technologies are well known in the art. For example, such technologies are described in E. Atherton and R. C.
- the peptide GsMTx4 can be synthesized using Fmoc chemistry or an automated synthesizer. Depending upon quantitative yields, production of the linear reduced peptide can be performed in either a single process or in two different processes followed by a condensation reaction to join the fragments.
- a variety of protecting groups can be incorporated into the synthesis of linear peptide so as to facilitate isolation, purification and/or yield of the desired peptide. Protection of cysteine residues in the peptide can be accomplished using protective agents such as triphenylmethyl, acetamidomethyl and/or 4-methoxybenzyl group in any combination.
- the peptide GsMTx4 and its variants can be prepared by recombinant DNA technology.
- a DNA sequence coding for the peptide is prepared, inserted into an expression vector and expressed in an appropriate host cell.
- the expressed peptide can then be purified from the host cells and/or culture medium.
- Methods for preparing DNA coding for the peptide and expression of DNA are well known to those skilled in the art and are found for example, in Sambrook et ak, (1989) Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, N.Y., S. L. Berger and A. R.
- a suitable amount for GsMTx4 or its variants in the pharmaceutical composition can be determined by empirical methods. Those skilled in the art will recognize that the dosage administered to a particular individual will depend on a number of factors such as the route of administration, the duration of treatment, the size and physical condition of the individual, and the patient's response to the peptide. The lack of any measurable toxicity of GsMTx4 in animal studies provides flexibility for designing a broad range of dosage regimens. In one embodiment, GsMTx4 or its variants may be used at a concentration from about 0.1 to 10.0 millimolar.
- the dosage regimen can include daily administrations, weekly or other suitable administrations. Extended release mechanisms can also be used. Administration may be continuous (at desired frequency of administration) over a period of time or may be include interruptions of desired periods of time.
- the Piezol channel is a mechanosensitive channel and as such can be activated by physical stress.
- compositions comprising modulators of Piezol channel can be prepared by using pharmaceutical carriers.
- the peptide GsMTx4 of the present invention can be prepared for pharmaceutical use by incorporation with a pharmaceutically acceptable carrier or diluent.
- the peptide can be formulated into tablets, capsules, caplets and the like. Suitable carriers for tablets include calcium carbonate, starch, lactose, talc, magnesium stearate and gum acacia.
- the peptide can also be formulated for oral, parenteral or intravenous administration in aqueous solutions, aqueous alcohol, glycol or oil solutions or emulsions.
- the peptide can also be formulated for inhaling by encapsulating to facilitate alveolar absorption as has been done for insulin (Inhale Therapeutic Systems, San Carlos, Calif., inhale.com).
- Pharmaceutical compositions suitable for such routes of administration are well known in the art.
- suitable forms and compositions of pharmaceutical preparations can be found in Remington's Pharmaceutical Science, 1980, 15 th ed. Mack Publishing Co., Easton, Pa.
- the peptide GsMTx4 can be administered orally, subcutaneously, intratumorally, parenterally, intravenously, intramuscularly or intranasally.
- the peptide may also be applied to medical devices that will come into contact blood.
- the pharmaceutical carriers or diluents etc. can also be used for preparing compositions comprising activators of Piezol, such as, for example, Yoda 1.
- compositions and methods may be used in mammals including humans.
- Modulators of Piezol expression/function can be used in the treatment of cancer and infectious diseases.
- the peptide GsMTx4 and/or its variants may be used in the treatment of cancer and in the treatment of infectious diseases.
- a composition comprising one or more peptides may be administered to an individual in need of treatment.
- the individual can be a mammal, more preferably a human.
- Other mammals include, but are not limited to, farm animals, pets, primates, horses, dogs, cats, mice and rats.
- a human individual in need of treatment may be a human patient having, at risk for, or suspected of having a solid tumor, such as pancreatic duct
- adenocarcinoma (PDA), colorectal cancer (CRC), melanoma, breast cancer, lung cancer (for example, non-small cell lung cancer, NSCLC, and small cell lung cancer, SCLC), upper and lower gastrointestinal malignancies (including, but not limited to, esophageal, gastric, and hepatobiliary cancer), squamous cell head and neck cancer, genitourinary, and sarcomas as well as leukemias.
- An individual having a solid tumor can be identified by routine medical examination, e.g ., laboratory tests, organ functional tests, CT scans, or ultrasounds.
- Leukemias can also be identified by established clinical tests, such as blood based tests. An individual suspected of having any of such target disease/disorder might show one or more symptoms of the disease/disorder. An individual at risk for the disease/disorder can be an individual having one or more of the risk factors for that disease/disorder.
- the individual to be treated by the method described herein may be a human cancer patient who has undergone or is individualing to an anti-cancer therapy, for example, chemotherapy, radiotherapy, immunotherapy, or surgery.
- the modulators of Piezo 1 function may be used in the treatment of infectious diseases.
- the infectious disease may be caused by a virus, bacteria or other microorganisms, such as viral hepatitis, HIV infection or bacterial sepsis.
- a composition comprising one or more blockers of Piezol (such as GsMTx-4) may be administered to an individual in need of treatment.
- the individual can be a mammal, more preferably a human. Mammals include, but are not limited to, farm animals, pets, primates, horses, dogs, cats, mice and rats.
- An individual in need of treatment may be one that has been clinically or symptomatically diagnosed as being infected, or that is at risk of being infected. In embodiments, the individual may be also being treated with other anti-infectious medications or approaches.
- Activators of Piezol may be used in the treatment of autoimmune diseases, such as, for example, inflammatory autoimmune diseases.
- a composition comprising a therapeutically effective amount of a Piezol activator may be administered to an individual in need of treatment.
- the individual can be a mammal, more preferably a human. Mammals include, but are not limited to, farm animals, pets, primates, horses, dogs, cats, mice and rats.
- An individual in need of treatment may be one that has been clinically or symptomatically diagnosed as having an autoimmune disease, such as, for example, inflammatory bowel disease, Crohn’s disease, rheumatoid arthritis, psoriasis and the like.
- this disclosure provides a composition comprising an inhibitor of Piezol activity for use in a method of treating cancer, infection or sepsis comprising administering to an individual in need of treatment a therapeutically effective amount of an inhibitor of Piezo 1 channel activity.
- this disclosure provides a method for treatment of cancer comprising administering to an individual in need of treatment a composition comprising an agent which inhibits Piezol channel activity, wherein administration of the composition results in inhibition of growth of cancer cells.
- the agent that blocks Piezol channel activity may be a blocker of Piezol channel, such as, GsMTx4, or may be an RNAi molecule.
- the cancer may be pancreatic duct adenocarcinoma (PDA), colorectal cancer (CRC), melanoma, breast cancer, lung cancer (for example, non-small cell lung cancer (NSCLC), and small cell lung cancer (SCLC), upper and lower gastrointestinal malignancy, esophageal cancer, gastric cancer, hepatobiliary cancer, squamous cell head and neck cancer, genitourinary cancer, sarcoma, or leukemia.
- PDA pancreatic duct adenocarcinoma
- CRC colorectal cancer
- melanoma melanoma
- breast cancer for example, non-small cell lung cancer (NSCLC), and small cell lung cancer (SCLC)
- lung cancer for example, non-small cell lung cancer (NSCLC), and small cell lung cancer (SCLC)
- upper and lower gastrointestinal malignancy esophageal cancer
- gastric cancer gastric cancer
- hepatobiliary cancer he
- this disclosure provides a method for treating an infection in an individual comprising administering to an individual in need of treatment a composition comprising an agent which inhibits Piezol channel activity, wherein administration of the composition results in reducing the severity of the infection or completely treating it.
- the agent that blocks Piezol channel activity may be a blocker of Piezol channel, such as, GsMTx4, or may be an RNAi molecule.
- the infection may be caused by virus, bacteria or any other microbe or higher organism.
- this disclosure provides a method for treating microbial sepsis in an individual comprising administering to an individual in need of treatment a composition comprising an agent which inhibits Piezol channel activity, wherein
- the agent that blocks Piezol channel activity may be a blocker of Piezol channel, such as, GsMTx4, or may be an RNAi molecule.
- this disclosure provides a method for treatment of cancer comprising deletion or mutation of the Piezol gene using CRISPR based DNA editing techniques, whereby the activity of Piezol is reduced resulting in inhibition of growth of cancer cells.
- this disclosure provides a method for treatment of an infection or microbial sepsis comprising deletion or mutation of the Piezol gene using CRISPR based DNA editing techniques, whereby the activity of Piezol is reduced resulting in reducing the severity of or complete treatment of the infection or sepsis.
- CD4 + and CD8 + T cells upregulated IFNy expression in PDA tumors in WT hosts treated with GsMTx4 ( Figure 1 J), as well as in PDA tumors in Vav Cre ;Piezo P mice ( Figure 1K), indicative of adaptive immune activation.
- PDOTS patient-derived organotypic tumor spheroids
- Piezol inhibition resulted in MDSC contraction, CD4 + and CD8 + T cell activation, and attenuated spheroid growth in PDOTS ( Figures 1L-0).
- Piezol activation expanded MDSC, aggravated T cell suppression, and promoted spheroid growth in PDOTS ( Figures 1P, Q, 7D, E).
- Piezol We found that mechanical stimulation of Piezol +/+ T cells in whole-cell patch clamp configuration evoked currents characteristic of Piezol activation (Figure 2G). By contrast, Piezol T cells failed to respond to mechanical stimulation ( Figure 2H). Current-pressure relationship in Piezol +/+ T cells demonstrated maximal opening at -60 mmHg and a half- maximal activation (Pso) of -35 mmHg ( Figure 21). These pressures are below the reported fluid pressures found in PDA but well above the pressures observed in normal pancreas (DuFort et al ., Biophys J 110, 2106-2119 (2016)). By contrast, Piezol T cells again failed to exhibit a positive current-pressure relationship (Figure 2J). Collectively, these data indicate that T cells sense mechanical forces via Piezol, whereas in the context of Piezol deletion T cells fail to transduce pressure-mediated currents.
- Lymphocytic choriomeningitis virus (LCMV) infection is characterized by high interstitial pressures in multiple compartments resulting from increased vascular permeability. Since T cells are essential for antiviral immunity, including clearance of LCMV infection, we investigated if Piezol deletion would protect in this model. We observed that mice exhibited enhanced immunity against LCMV as evidenced by reduced viral titers in the serum and spleen (Figure 3R, S), increased clonal expansion of GP33- specific CTLs in PBMC and spleen ( Figure 3T, U), and evidence of higher CD8 + T cell activation (Figure 3V). The frequency of CXCR5 + PDl + BCL6 + T follicular helper cells, which are essential for controlling viral titers, was also increased in the spleen of
- GSEA Gene set enrichment analysis similarly suggested increased expression of genes regulating glycolysis in Piezol T cells (Figure 4F). Accordingly, Piezol T cells exhibited increased rates of oxygen consumption (OCR) and extracellular acidification (ECAR), indicative of increased activation-induced metabolic activity (Figure 4G, H). Activated Piezol T cells also had a higher rate of ATP production ( Figure 41). As such, mitochondria in Piezol T cells were more numerous and larger, but exhibited a less spherical morphology compared to Piezol +/+
- IPA suggested that Myc signaling was the most highly upregulated pathway in
- Piezol T cells (Figure 4E). We investigated if Piezol regulates T cell metabolism via suppression ofMyc. Accordingly, activated Piezol T cells exhibited increased pAkt and mTOR signaling (Figure 4K, L). elF signaling, which is directly promoted by mTOR, was also highly upregulated in Piezol ⁇ T cells ( Figure 4M, N). Moreover, inhibition of PI3K/Akt abrogated the elevated IFNy and upregulation of Myc expression in Piezo l T cells ( Figure 40, P). Calcium can act as a second messenger in lymphocytes to initiate PI3K/Akt activation, IFNy production, and upregulation of Myc.
- Lyz2M Cre iPiezo P mice exhibited a decreased frequency of MDSC in PBMC and reduced MDSC abundance in the peritoneum ( Figure 5J, K). Accordingly, bacteremia was markedly reduced in Lyz2M Cre , ⁇ b z o R mice ( Figure 5L). Similarly, culture of peritoneal contents yielded ⁇ l0 4 -fold lower bacterial colonies in I z2M ( rc ; Piezo l 1111 mice compared to controls ( Figure 5M). Consistent with these data, GsMTx4 treatment of WT mice also protected against CLP, resulting in preservation of core body temperature, lower clinical sepsis scores, and reduced serum levels of TNFa ( Figure 12A-C).
- Lyz2M Cre Piezol ⁇ l 1 bone marrow cells Figures 6P, 13B, C.
- HDAC2 inhibition eliminated the protection against polymicrobial sepsis and the associated reduced MDSC expansion in Lyz2M Cre ;Piezo / S l hosts ( Figure 6Q-S).
- these data indicate that deletion of Piezol in myeloid cells is protective against neoplastic and infectious disease in an Rbl -dependent manner.
- Piezol is a non-selective cation channel that serves in mechanosensory transduction.
- Piezol has not been intensively studied in inflammatory disease or in cancer.
- Our results provide direct demonstration that Piezol is a vital regulator of innate and adaptive immune responses with implications for the balance of tumor immunity and clearance of infectious viral and bacterial disease.
- Our data also indicate a potentially important role for Piezol in modulating autoimmunity.
- myeloid and lymphoid cells sense mechanical forces via Piezol as leukocytes deleted of Piezol were unable to transduce mechanosensory signals.
- Piezol links physical forces to immune regulation.
- Piezol signaling catalyzes Akt-phosphorylation and metabolic reprogramming in T cells, thereby increasing their effector function including potentiating IFNy expression and upregulating Myc.
- overexpression of Myc in Piezol _/_ T cells is dependent on the upregulation of Akt-mTOR signaling.
- Myc signaling promotes higher metabolic activity, including increased aerobic glycolysis and oxidative phosphorylation.
- Piezol ⁇ T cells exhibited increased OCR, ECAR, and ATP production rates consistent with higher metabolic activity.
- mitochondria were more numerous and exhibited a less spherical morphology in Piezol ⁇ T cells., each of which are linked to generation of long-lasting metabolic reserve and tumor clearance.
- Piezol in myeloid cells is protective against cancer and polymicrobial sepsis, and is associated with a reduced infiltrate of immature myeloid cells.
- Piezol promotes MDSC expansion by regulating Rbl expression via epigenetic silencing.
- HDAC2 abrogated protection against sepsis and muted MDSC expansion in mice with targeted Piezol deletion in myeloid cells.
- Piezol serves as an ion channel checkpoint that can markedly suppress immunological responses via both silencing of T cell effector function and enhancing myeloid cell tolerance.
- inhibition of Piezol can be used for cancer immunotherapy and treatment of viral and bacterial infections.
- mice were purchased from Jackson Labs (Bar Harbor, ME) and bred in-house. Age-matched 8 to 10-week-old mice were used in experiments. Both male and female mice were used, but animals were gender-matched within each experiment.
- mice were administered intra-pancreatic injections of FC1242 tumor cells (lxlO 5 ) derived from KPC mice. Cells were suspended in PBS with 50% Matrigel (BD Biosciences, Franklin Lakes, NJ) before administration.
- mice sub-lethally irradiated (600 cGy) mice were adoptively transferred intravenously with FACS- purified CD3 + T cells (3xl0 4 ) 3 days after orthotopic tumor injections.
- mice were serially treated with GsMTx4-D (0.8 mg/kg; Alomone Labs, Jerusalem, Israel) or Yodal (2.6 mg/kg; Tocris, Bristol, UK).
- GsMTx4-D 0.8 mg/kg; Alomone Labs, Jerusalem, Israel
- Yodal 2.6 mg/kg; Tocris, Bristol, UK.
- In vivo doses of GsMTx4-D and Yodal were based on previous reports and pharmacokinetic studies (Wang et ak, JMol Cell Cardiol 98, 83-94 (2016); Romac et ak, Nat Commun 9, 1715 (2016).
- mice were treated daily with the HDAC-inhibitor LBH589 (20 mg/kg; Selleckchem, Houston, TX).
- HDAC-inhibitor LBH589 20 mg/kg; Selleckchem, Houston, TX.
- mice were infected via the retro-orbital sinus with LCMV-C113 (2xl0 6 PFU).
- LCMV-C113 was propagated in baby hamster kidney cells and titrated using Vero African green monkey kidney cells. Mice were sacrificed on either day 8 or 21 after infection.
- CLP experiments were performed. Briefly, mice underwent laparotomy and the cecum was exteriorized and ligated at -50% distal to the ileocecal valve using absorbable 4-0 suture. The cecum was then perforated using a 23 G needle and returned to the peritoneal cavity, after which the peritoneum was closed. Temperature was serially monitored using the
- Microtherma 2 rectal probe (Thermo Works, American Fork, UT). Clinical sepsis score was assessed as follows. Points were assigned in the following categories: Appearance: normal (0), lack of grooming (1), piloerection (2), hunched up (3), above and eyes half closed (4); Behavior - unprovoked: normal (0), minor changes (1), less mobile and isolated (2), restless or very still (3); Behavior - provoked: responsive and alert (0), unresponsive and not alert (3); Clinical signs: normal respiratory rate (0), slight changes (1), decreased rate with abdominal breathing (2), marked abdominal breathing and cyanosis (3); Hydration status: normal (0), dehydrated (5).
- Serum cytokine levels were analyzed using the LegendPLEX arrays, as per the manufacturer’s protocol (BioLegend, San Diego, CA). All procedures performed on these animals were in accordance with regulations and established guidelines and were reviewed and approved by NYU School of Medicine Institutional Animal Care and Use Committee or through an ethical review process.
- Human flow cytometry antibodies included CD45 (2D1), CD3 (UCHT1), CD8 (HIT8a), CD4 (A161A1), CD44 (IM7), IFNy (4S.B3), CDl lb (CBRM1/5), CD14 (M5E2), CD15 (HI98), HLA-DR (L243; all BioLegend). Dead cells were excluded from analysis using Zombie Yellow (BioLegend). Intracellular staining for cytokines, transcription factors, and Granzyme B was performed using the Fixation/Permeabilization Solution Kit (eBioscience).
- Bone marrow derived cultures were harvested by aspiration of mouse femurs, stimulated with GM-CSF (20 ng/ml; BioLegend), and harvested on day 5. Splenocytes were prepared by manual disruption. PBMC were prepared for flow cytometry using a Ficoll-Paque PLUS gradient (GE Healthcare, Uppsala, Sweden).
- CD1 lb + cells were isolated and cells were plated at lxlO 6 cells/ml in Opti-MEM media with or without 40ng/ml phorbol l2-myristate l3-acetate (PMA) (Sigma-Aldrich). Following overnight incubation, cells were fixed in 4% paraformaldehyde and permeabilized with 0.25% Triton-X 100, blocked and then stained with Phalloidin-488 (Invitrogen, A12379) and DAPI. Images were acquired at 20x on the Celllnsight CX7 (ThermoFisher Scientific). The Cell Spreading algorithm was used to quantify cell perimeter and area. For non-adherent T cells, cell size and volume was measured using the Z2 Beckman Coulter Cell and Particle Counter (Brea, CA).
- PDOTS Patient-derived Organotypic Tumor Spheroids
- PDOTS were prepared as follows. Human surgically-resected tumor specimens were received fresh in DMEM on ice and minced to sub-millimeter pieces in 10 cm petri dishes. Minced tumors were resuspended in DMEM +10% FBS with 100 U/mL collagenase type IV to obtain spheroids. Partially digested samples were pelleted, re suspended in fresh DMEM +10% FBS, then strained over both 100 pm and 40 pm filters to generate Sl (>100 pm), S2 (40-100 pm), and S3 ( ⁇ 40 pm) spheroid fractions, which were subsequently maintained in ultra-low-attachment tissue culture plates.
- splenic CD3 + T cells were activated using CD3/CD28 co-ligation in 96-well plates.
- T cells were activated using PMA (200 pg/mL; Sigma-Aldrich) + Ionomycin (10 mM; Sigma-Aldrich).
- PMA 200 pg/mL; Sigma-Aldrich
- Ionomycin 10 mM; Sigma-Aldrich
- splenocytes from OT-II mice were cultured with Ova 323 - 339 peptide (10 pg/mL; Invitrogen, Carlsbad, CA). T cell activation was determined at 72 hours by flow cytometry.
- DC from BALB/c mice were co cultured with allogeneic T cells from C57BL/6 mice at a 1 :5 ratio for 5 days.
- complete RPMI medium was supplemented with plate-bound anti-CD3 (10 pg/mL), soluble anti-CD28 (2 pg/mL), IL-4 (20 ng/mL), anti-IFNy (10 pg/mL) and IL-2 (50 U/niL; all BioLegend).
- Treg polarizing conditions media was supplemented with plate-bound anti-CD3 (3 pg/mL), soluble anti-CD28 (3 pg/mL), IL-2 (5 ng/mL; BioLegend) and TGFp i (5 ng/mL; BioLegend). Cells were harvested on day 5 for analysis by flow cytometry.
- T cell effector function For analysis of T cell effector function, sorted T cells were stimulated with anti- CD3 and anti-CD28 in culture medium containing IL-2 (6000IU; BioLegend) for 4 days and were then stimulated on day 4 in the indicated conditions for 5 hours with anti-CD3 and anti- CD28 without IL-2 in the presence of Brefeldin A (5 pg/mL) and monensin (5 pg/mL; both BioLegend).
- IL-2 6000IU; BioLegend
- BKM-120 2 pM; Selleckchem
- T cells from PBMCs were enriched with a manual MACS system using anti-human-CD3 microbeads (Miltenyi Biotech, Bergisch Gladbach, Germany) per the manufacturer's protocol after Ficoll isolation (GE Healthcare, Princeton, NJ).
- CD3 + human T cells were plated with 2.5 pg/mL anti-CD3 (HIT3a, BioLegend) and various concentrations of Yodal (100 nM, I mM, 3.16 mM, 10 mM) and GsMTx4 (1 nM, 100 nM, 1 mM, 10 mM) for 48 hours in a 96-well flat-bottom plate.
- KPC-derived tumor cells (2xl0 3 ) were seeded in 96-well round- bottom plates and incubated with 100 pL of culture medium. Cells were selectively treated with GsMTx4 (2.5 mM), Yodal (10 mM), or vehicle. Tumor cell proliferation was measured using the XTT assay kit according to the manufacturer’s protocol (Sigma- Aldrich).
- T cells (2xl0 6 ) cells were attached in l2-well tissue culture plates coated in poly-l-lysine and stimulated by CD3/CD28 co-ligation using Abs placed in the media.
- a 2mm thick agarose gel was placed on the fluid phase to allow a deformable cushion.
- a l .8mm thick SYLGARD 184 PDMS pad (Newark/Elementl4, Leeds, England) was placed on top of the gel to allow for even weight distribution. 5/16 stainless steel weights (2-l5g; Midwest Fastener Corporation, Kalamazoo, MI) were then applied to this setup to apply calibrated mechanical forces to cells.
- Compressive stress was calculated as Force (N)/Area (m 2 ).
- N Force
- Area m 2
- CSE Control standard endotoxin
- T cells were isolated from spleens of Lck Cre ;Piezol fl/fl WT mice as above.
- T cells were incubated with 1 pg/mL biotinylated anti-CD3e (145-2C11, BD Biosciences) and stimulated by addition of 1 pg/mL Streptavidin (Invitrogen). Intracellular calcium measurement was performed using a FlexStation 3 multi-mode microplate reader (Molecular Devices, San Jose, CA). Fura-2 fluorescence was measured at 510 nm after excitation at 340 nm and 380 nm and plotted as the F340/F380 emission ratio.
- OCR and ECAR were measured following aCD3/aCD28 stimulation of T cells using the XFe96 extracellular analyzer (Seahorse Bioscience, North Billerica, MA). OCR and ECAR were measured in DMEM containing 25 mM glucose, 4 mM L-glutamine, no pyruvate, no bicarbonate and no phenol red. Mitostress test was performed using 1 mM oligomycin, 0.25 pM fluoro-carbonyl cyanide phenylhydrazone (FCCP), or 200 nM rotenone with 2 pM antimycin A (all Sigma).
- FCCP fluoro-carbonyl cyanide phenylhydrazone
- tissues were homogenized in ice-cold RIPA buffer.
- Total protein was quantified using the DC Protein Assay according to the manufacturer’s instructions (BioRad, Hercules, CA). Western blotting was performed as follows. 10% Bis- Tris polyacrylamide gels (NuPage, Invitrogen) were equiloaded with 10-30 pg of protein, electrophoresed at 200V, and electrotransferred to PVDF membranes. After blocking with 5% BSA, membranes were probed with primary antibodies to HDAC2, NFAT1, Lamin A/C and b-Actin (all Cell Signaling Technology). Cytosolic and nuclear fractions were collected using the NE-PER nuclear and cytoplasmic extraction kit (Thermo Scientific). Blots were developed by ECL (Thermo Fisher).
- Expression levels of target genes were normalized to the expression of GAPDH (internal control) and calculated based on the comparative cycle threshold (CT) method (2 DDa ).
- the Rbl primer sequences used in the study were F- CAGGGCTGTGTTGACATCGGAGTA (SEQ ID NO:2), R- TCCACGGGAAGGACAAATCTGTTC (SEQ ID NO:3).
- the c-Myc sequences were F-TTGAAGGCTGGATTTCCTTTGGGC (SEQ ID NO:4), R- TCGTCGCAGATGAAATAGGGCTGT (SEQ ID NO:5).
- Piezol primer sequences were F- AGCGAGGCCCCTCTGCTTGA (SEQ ID NO: 6), R-TGCCGGCGGTAGTGCTCTT (SEQ ID NO:7).
- RNA library prep after ribodepletion with Ribozero Gold kit (cat# 20020597, Illumina, San Diego, CA) starting from 500 ng of DNase I treated total RNA, following the manufacturer’s protocol, with the exception that 9 cycles of PCR were performed to amplify the libraries.
- the amplified libraries were purified using AMPure beads, quantified by Qubit and qPCR, and visualized in an Agilent Bioanalyzer (Agilent, Santa Clara, CA).
- the libraries were pooled equimolarly and sequenced on one lane of an Illumina HiSeq 2500 flow cell, v4 chemistry as paired end 50.
- the raw fastq reads were aligned to mm 10 mouse reference genome using STAR aligner.
- GSEA Gene Set Enrichment Analysis
- Marker genes for each cluster were then determined based on fold change and adjusted p- value (t-test) and average gene expression for each cluster was calculated using scSeqR. Marker genes were visualized on heatmaps, bar plots and box plots for each cluster and were used to determine the cell types using ImmGen database (https://www.immgen.org/). Cell type identities were of known population markers were assigned as follows: GMP
- bedGraphToBigWig tool v.4
- Peak calling was performed using MACS (vl.4.2) and peak count tables were created using BEDTools.
- Differential Binding (DB) analysis was performed using DESeq2.
- ChIPseeker vl.8.0
- R package and HOMER v4.8
- ChIPseeker was used for TSS binding site visualizations and quality controls.
- KEGG pathway analysis and Gene Ontology (GO) analysis was performed using the clusterProfiler R package (v3.0.0). To compare the level of similarity among the samples and their replicates, we used two methods: classical multidimensional scaling or principal-component analysis and Euclidean distance-based sample clustering. The downstream statistical analyses and generating plots were performed in R environment (v3. l.l) (r-project.org/).
- the entire surface of the specimen was then sputter coated with a thin layer of gold/palladium imaged using Gatan OnPoint BSE detector in a Zeiss GEMINI 300 VP FESEM equipped with a Gatan 3 View automatic microtome.
- the system was set to cut 50 nm slices, and images were recorded after each round of section from the block face using the
- Segmentation and video were generated by Thermo Fisher Scientific Amira 6.4 software. EM images were used to calculate mitochondrial volume (V), area (A) and sphericity (i p), defined
- Non-silencing (Cat-No. RHS4348) and Piezol (V3SM7598-00EG234839) shRNA were purchased as lentiviral particles (GE Healthcare Dharmacon, Lafayette, CO). Target cells were seeded one day prior to transduction at a density of lOxlO 3 cells per cm 2 .
- growth medium was replaced with shRNA lentivirus to 2 mL volume in DMEM containing 10% FBS and 8 pg/mL polybrene (EMD Millipore) and 2 pg/mL puromycin. After 48 hours, virus was replaced with standard growth medium. The efficacy of Piezol knockdown was measured by RT-qPCR.
- T cells were patched after magnetic isolation from murine spleens using a Pan T Cell Isolation Kit (Miltenyi Biotec, Auburn, CA) and 48 hours of CD3/CD28 co-ligation in 96-well plates supplemented with 60 IU/mL LEAF-Purified IL-2 (BioLegend, San Diego, CA). Cells were plated on l5-mm round glass 0.01% poly-L-lysine- coated coverslips for 30 minutes, then washed thoroughly with extracellular solution immediately prior to patching. Patch clamp experiments were performed in whole-cell configuration using an Axon MultiClamp 700A amplifier and Axon Digidata 1550A digitizer (Molecular Devices) at room temperature.
- Sarasota, FL had tip resistances of 2.5-3.5 MW when filled with (in mmol/L): 133 CsCl, 10 HEPES, 5 EGTA, 1 CaCk, 1 MgCk, 4 MgATP, and 0.4 NaiGTP (pH 7.3 with CsOH osmolarity 280 ⁇ 10 mOsm).
- the pipette solution was supplemented with 30 mM Yodal in order to maximize pressure sensitivity during patch clamp recordings.
- the extracellular solution consisted of (in mM) 127 NaCl, 3 KC1, 1 MgCk, 10 HEPES, 2.5 CaCk, and 10 glucose (pH 7.3 with NaOH, osmolarity 300 ⁇ 10 mOsm).
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Public Health (AREA)
- Genetics & Genomics (AREA)
- Medicinal Chemistry (AREA)
- Veterinary Medicine (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- Organic Chemistry (AREA)
- Biomedical Technology (AREA)
- Epidemiology (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Immunology (AREA)
- General Chemical & Material Sciences (AREA)
- Tropical Medicine & Parasitology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Insects & Arthropods (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Plant Pathology (AREA)
- Microbiology (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
Provided are methods for modulation of immune system function comprising activating or inhibiting Piezo1 channel activity. For example, GsMTx4 may be used for inhibition of Piezo1 channel activity. The activators or inhibitors of Piezo1 channel activity can be used for augmenting immunity or limiting autoimmunity.
Description
TARGETING PIEZOl FOR TREATMENT OF CANCER AND INFECTIOUS
DISEASES
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application claims priority to ET.S. Provisional Application No.
62/713,344, filed on August 1, 2018, the disclosure of which is incorporated herein by reference.
BACKGROUND OF THE INVENTION
[0002] Cells that reside in the interstitium or migrate to targets are subject to individual to bi-directional cell-matrix interactions. For example, stochastic and deterministic events differentially shape the fates of T-lymphocytes (Plumlee et al., Immunity, 2013, 39(2): p. 347-561). Among these signals, immune checkpoints refer to negative regulators of T-cell function that tumors and many chronic viral infections co-opt as a major strategy of immune evasion (Pardoll, Nat Rev Cancer, 2012. 12(4): p. 252-64; Day et al., Nature, 2006.
443(7109): p. 350-4). However, not much is known about how subtle changes in the physicochemical environment of the interstitial milieu can affect immunological response to conditions like cancer or infections.
[0003] Piezo 1 belongs to a family of evolutionary conserved non-selective cation channels that serve in mechanosensory transduction and have recently been implicated in certain biological processes (Ranade et al., Nature 87, 1162-1179, 2015); Hao et al. Methods Mol. Biol. 998, 159-170, 2013). Piezol has been shown to be a regulator of cell division, migration and differentiation (Gudipaty et al., Nature 543, 118-121, 2017; Pathak et al., Proc Natl Acad Sci USA 111, 16148-16153, 2014; McHugh et al., J. Cell Sci 123, 51-61, 2010). However, the broader function of Piezol in hematopoietic and immune systems is not well understood.
SUMMARY OF THE DISCLOSURE
[0004] This disclosure provides data to demonstrate that Piezol plays a significant role in the modulation of immune system function and provides compositions and methods for modulating Piezol activity in the treatment of diseased conditions.
[0005] We discovered signal transduction via Piezol in both myeloid and T cells and establish this channel as the primary sensor of mechanical stress in leukocytes. Global inhibition of Piezol was protective against both cancer and septic shock and resulted in a
diminution in monocyte infiltration and expanded T cell activation in situ. Conditional deletion oiPiezol in T cells accentuated T cell activation in settings of increased mechanical stress. Deletion of Piezol in T cells resulted in higher IFNy responses, tumor-protection in vivo , and enhanced clearance of LCMV infection. Piezol deletion activated Akt-mTOR signaling in T cells resulting in Myc-dependent increased nutrient consumption and accentuation of immunogenic responses. In parallel, selective deletion oiPiezol in myeloid cells protected against cancer and increased survival in poly-microbial sepsis.
Mechanistically, we show that Piezol promotes myeloid cell expansion by suppressing Rbl expression via upregulation of HDAC2. Collectively, our work uncovers Piezol as a targetable immune checkpoint that vetoes T cell mediated cytotoxicity and drives immune- suppressive myelopoiesis.
[0006] In an aspect, this disclosure provides a method for inhibiting the growth of cancer cells. The disclosure also provides a method for reducing the effects of an infection. The disclosure is based on the results of in vitro and in vivo studies which demonstrate that Piezol plays a significant role in cancer and infectious diseases. For example, our data shows that deletion of Piezol : activates T-cells in vitro, attenuates pancreatic tumor growth, enhances viral clearance and protects against polymicrobial sepsis. We also provide data to support that Piezol signaling limits autoimmunity. Thus, this disclosure identifies Piezol as a novel therapeutic target for cancer, infectious diseases and autoimmune diseases.
[0007] In an embodiment, this disclosure provides a method for inhibiting the growth of cancer cells comprising modulating the expression of, or function of, Piezol gene or protein. The method comprises administering to an individual in need of treatment (such as an individual who has a cancer, such as a tumor or blood cancer), a composition comprising an agent that modulates Piezol channel activity. In an embodiment, the disclosure provides a method for inhibiting the growth of cancer cells comprising administering to an individual in need of treatment (such as an individual who has cancer, such as a tumor or blood cancer), a composition comprising an agent that downregulates or blocks Piezol channel activity (such as GsMTx-4).
[0008] In an embodiment, the disclosure provides a method for modulating the function of Piezol by administering to an individual in need of treatment (such as an individual who has an autoimmune disease), a composition comprising an agent that upregulates or activates Piezol channel activity (such as Yoda 1).
[0009] In one aspect, this disclosure provides a method for treating an infectious disease (such as caused by a microbe e.g., virus or bacteria) comprising modulating the
expression of, or function of Piezo 1 gene or protein. The method comprises administering to an individual who has been infected or is at risk of being infected with the microbe, a composition comprising an agent that modulates Piezol channel activity. In an embodiment, the method comprises administering to an individual who has been infected or is at risk of being infected with the microbe, a composition comprising an agent that downregulates or blocks Piezol channel activity (such as GsMTx-4).
BRIEF DESCRIPTION OF THE FIGURES
[0010] Figure 1. Piezol signaling regulates cancer progression. (A) WT mice bearing orthotopic KPC tumor were treated with GsMTx4 or vehicle and sacrificed at 3 weeks. Representative images and quantitative analysis of tumor weights are shown (scale bar = 1 cm). This experiment was performed 3 times with similar results. (B) WT mice bearing orthotopic KPC tumor were treated with Yodal or vehicle and sacrificed at 3 weeks. Representative images and quantitative analysis of tumor weights are shown (scale bar = 1 cm). This experiment was performed 3 times with similar results. (C) Five-year Kaplan- Meier survival curve of human PDA patients stratified by high (n=42) versus low (n=l35) PIEZO 1 expression based on TCGA data. (D) WT mice were administered orthotopic KPC tumor cells treated with either Piezol -targeting shRNA or control scramble shRNA. Tumors were harvested on day 21 and weighed. Data are representative of two independent experiments. (E) Splenocytes from Piezo lpl~tdT reporter mice were co-stained with DAPI and aCD45 (scale bar = 20 pm). Representative immunofluorescent images are shown. (F)
Vav< n'J iezol1111 mice and littermate controls bearing orthotopic KPC tumor were sacrificed at 3 weeks. Representative tumor images and quantitative analysis of tumor weights are shown (scale bar = 1 cm). This experiment was performed 3 times with similar results. (G) WT mice bearing orthotopic KPC tumor were treated with GsMTx4 or vehicle and sacrificed at 3 weeks. The fraction of intra-tumoral GrUCDl lb+ MDSC was determined by flow cytometry. Representative contour plots and quantitative data are shown. This experiment was performed 3 times with similar results. (H) VavCre Piezo P mice and littermate controls bearing orthotopic KPC tumor were sacrificed at 3 weeks and the fraction of intra-tumoral GrUCDl lb+ MDSC was determined by flow cytometry. This experiment was performed twice with similar results. (I) WT mice bearing orthotopic KPC tumor were treated with Yodal or vehicle and sacrificed at 3 weeks, and the fraction of GrUCDl lb+ MDSC was determined by flow cytometry. Representative contour plots and quantitative data are shown. This experiment was performed 3 times with similar results. (J) WT mice bearing orthotopic
KPC tumor were treated with GsMTx4 or vehicle and sacrificed at 3 weeks. Intra-tumoral CD4+ and CD8+ T cells were gated by flow cytometry and tested for IFNy expression. This experiment was performed 3 times with similar results. (K) VavCre r Piezo flP mice and littermate controls bearing orthotopic KPC tumor were sacrificed at 3 weeks. Intra-tumoral CD4+ and CD8+ T cells were gated by flow cytometry and tested for IFNy expression. This experiment was performed twice with similar results. (L-O) PDOTS from freshly resected human tumors were treated with GsMTx4 or vehicle for 3 days. (L) The fraction of MDSC was determined. (M) CD4+ and CD8+ T cells were analyzed for expression of IFNy and (N) CD44. (O) Spheroid sizes were measured. Data are presented as fold change compared to vehicle. (P, Q) PDOTS from freshly resected human tumors were treated with Yodal or vehicle for 3 days. (P) The fraction of MDSC was determined. (Q) CD4+ and CD8+ T cells were analyzed for expression of IFNy. Data are presented as fold change compared to vehicle (*p<0.05; **p<0.0l; ****p<0.000l).
[0011] Figure 2. Piezol transduces mechanical force in T cells and mitigates tumor immunity. (A) Cohorts of LckP^ Piezo P mice and littermate controls bearing orthotopic KPC tumor were sacrificed at 3 weeks. Representative tumor images and quantitative analysis of tumor weights are shown (scale bar = lcm). Data are representative of experiments performed three times. (B) Cohorts of LckP^ Piezo P (n=5) mice and littermate controls (n=7) bearing orthotopic KPC tumor were analyzed in a survival experiment using the Kaplan-Meier estimator (p=0.04). This experiment was repeated twice. (C) Cohorts of Lclfre PiezolflP mice and littermate controls bearing orthotopic KPC tumor were sacrificed at 3 weeks. Intra-tumoral CD8+ T cells were tested for expression of an activation phenotype on flow cytometry. Data are representative of three independent experiments. (D) WT mice were administered orthotopic KPC tumor cells concurrent with single i.v. adoptive transfer of naive splenic T cells from Lclfre PiezolflP mice or littermate controls. Mice were sacrificed at 3 weeks. Representative tumor images and quantitative analysis of tumor weights are shown (scale bar = 1 cm). Data are representative of two independent experiments. (E, F) Cohorts of Cd4Cre Rίbzo R mice and littermate controls bearing orthotopic KPC tumor were sacrificed at 3 weeks. (E) Representative images of tumors and quantitative analysis of tumor weights are shown (scale bar = 1 cm). (F) Intra- tumoral CD4+ T cells were analyzed for expression of Tbet and FoxP3. Data are
representative of three independent experiments. (G, H) Mechanically-activated currents were elicited from activated (G) Piezol+/+ and (H) Piezol splenic T cells in the whole-cell
patch clamp configuration with negative pressure (0 to -60 mmHg, D20 mmHg) pulses delivered through the patch pipette at a holding potential of +40 mV. Representative currents at varying pressures are shown. In addition, the cumulative whole-cell currents during a 400 ms pressure pulse to +60 mmHg were normalized to cell membrane capacitance and averaged based on 6 independent experiments. (I, J) Normalized current-pressure relationship of mechanically-activated currents in representative (I) Piezol+/+ and (J) Piezo l T cells at +50 mV fitted to a Boltzmann equation (*p<0.05; **p<0.0l; ***p<0.00l).
[0012] Figure 3. Piezol signaling links mechanical pressure to immune- regulation. (A) Polyclonal splenic CD4+ T cells from LckCre ;Piezo
and littermate control mice were activated in vitro by CD3/CD28 co-ligation for 72h and tested for expression of select activation markers and transcription factors. This experiment was repeated more than 4 times with similar results. (B) Polyclonal splenic CD8+ T cells from ck( rc; iezo l1111 and littermate control mice were activated in vitro by CD3/CD28 co-ligation and tested for expression of IFNy and TNFa in l2h cell culture supernatant. This experiment was repeated twice with similar results. (C) Polyclonal splenic CD8+ T cells from ck( n';Piezol1111 and littermate control mice were activated in vitro with increasing concentrations of aCD3 and tested for expression of IFNy expression at 6h. This experiment was repeated twice in quadruplicate with similar results. (D, E) Polyclonal splenic (D) CD4+ and (E) CD8+ T cells from ck( n';Piezol1111 and littermate control mice were stimulated in vitro in a mixed lymphocyte reaction using dendritic cells derived from BALB/c mice. T cells were tested for activation by expression of TNFa, T-bet, and IFNy. This experiment was repeated twice with similar results. (F) CD8+ T cells from the spleen of Lck( ;PiezoI1111 mice and littermate controls were stimulated in vitro using PMA/Ionomycin. IFNy and IL-2 production were measured by flow cytometry. This experiment was repeated twice with similar results. (G) CD4+ splenic T cells from Cd4Cn J’iezo I1111 mice and littermate controls were cultured under Thl or Treg polarizing conditions and tested for expression of T-bet and FoxP3, respectively. This experiment was repeated twice with similar results. (H) Splenocytes from
Lcifre;Piezo P OT-II and control OT-II mice were cultured with Ova323-339 peptide for 96h. Antigen-restricted T cell activation was determined by expression of surface markers, cytokines, and transcription factors. This experiment was repeated twice in replicates of 5 with similar results. (i, J) Human PBMC-derived T cells were treated with aCD3 and increasing doses of (J) GsMTx4 or (K) Yodal and tested for levels of IFNy in cell culture supernatant at 48h. These experiments were repeated twice in replicates of 5 with similar
results. (K-N) Polyclonal splenic CD4+ and CD8+ T cells from WT mice were activated in vitro by CD3/CD28 co-ligation with application of increasing mechanical pressure (66-227 Pa). T cell activation was determined based on expression of (K, L) LFA1, and (M, N) TNFa. Data are representative of three independent experiments performed in replicates of 5. (O-Q) Polyclonal splenic CD4+ and CD8+ T cells from LckCre ;Piezo flP mice and littermate controls were activated in vitro by CD3/CD28 co-ligation with application of increasing mechanical pressure. T cell activation was determined based on expression of (O) IFNy and (P, Q) LFA1. (R-W) I.ck( n' ;Piezol/! i! mice and littermate controls (n=4 mice/group) were infected via the retro-orbital sinus with LCMV-C113. On day 8 LCMV viral titers were measured in mouse (R) serum and (S) spleen. (T) The frequency of GP33 Tetramer+ CD8+ T cells was measured in PBMC and (U) spleen. (V) Splenic CD8+ T cells were gated and tested for expression of markers of cellular activation. (W) The prevalence of CXCR5+PDl+BCL6+ follicular T helper cells in murine spleen was determined by flow cytometry on day 21. Data are representative of three independent experiments (*p<0.05; **r<0.01; ***p<0.00l;
****p<0.000l).
[0013] Figure 4. Piezol deletion in T cells increases cellular activation and nutrient consumption via c-Myc. (A-F) Control and ck( ;PiezoI1111 splenic T cells were activated by CD3/CD28 co-ligation and tested for transcriptomic changes by RNAseq. (A) A heat map depicting the 50 most differentially expressed genes and (B) an MA plot showing global differential gene expression in the control and LckPre iPiezol^A splenic T cells are shown. (C) A heat map depicting expression of chemokine-related genes and (D) GSEA for Chemokine Receptor is shown. (E) Ingenuity pathway analysis was performed and top ranking upregulated and downregulated pathways by z-score are shown. (F) GSEA for Regulation of Glucokinase Regulatory Protein is shown. (G-I) Control and LckPre ;Rίbzo R splenic T cells were activated by CD3/CD28 co-ligation for 72h and tested for (G) differences in oxygen consumption rate (OCR), (H) extracellular acidification rate (ECAR), and (I) ATP production. Data are representative of three independent experiments. (J)
Representative 2-D and 3-D electron microscopy images of mitochondria in control and Lclfre ;Piezo P T cells activated by CD3/CD28 co-ligation (scale bars = 0.5 pm). (K)
Lcifre ;Piezolfl/fl and control T cells were activated by CD3/CD28 co-ligation and tested for expression of pAkt expression by flow cytometry at serial time intervals. This experiment was performed in triplicate and repeated twice with similar results. (L) Lc P^iPiezo P and control T cells were activated by CD3/CD28 co-ligation and tested for expression of pS6 expression by flow cytometry at serial time intervals. This experiment was performed in 10
replicates and repeated twice with similar results. (M, N) Lc]fre;Piezo /fl T cells and controls were activated by CD3/CD28 co-ligation for 72h before RNAseq analysis as above. (M) A heat map depicting expression of elF-related genes and (N) GSEA for the elF Pathway are shown. (O, P) Lclfve ; Piezol^ and control T cells were activated by CD3/CD28 co-ligation in the presence of a PI3K inhibitor or vehicle and tested for IFNy and c-Myc expression. This experiment was performed in triplicate and repeated twice with similar results. (Q) Calcium flux in LcbP^iPiezo P and control T cells loaded with Fura2-AM was measured after stimulation with aCD3 -Biotin and cross-linking with streptavidin in 2 mM extracellular Ca2+ medium (*p<0.05; **p<0.0l; ***p<0.00l; ****p<0.000l).
[0014] Figure 5. Piezol deletion on myeloid cells confers anti-tumor immunity and protection against polymicrobial sepsis. (A-D) Cohorts of Lyz2MCre ; Piezo ft® mice and littermate controls were administered orthotopic KPC-derived tumor cells (scale bar = 1 cm). (A) Mice were sacrificed at 3 weeks. Representative pictures of tumors and quantitative analysis of tumor weights are shown. (B) The prevalence of intra-tumoral Grl+CDl lb+ MDSC was determined. (C) Intra-tumoral CD4+ T cells were assessed for expression of CD44, CD69, and Tbet. (D) Intra-tumoral CD8+ T cells were assessed for expression of CD69, LFA-l, LAG3, and Granzyme B. Tumor experiments in
mice were performed 4 times. (E-M) Cohorts of I z2M( rc; iezo /// // mice and littermate controls were individualed to CLP. (E) Rectal temperature was serially measured and (F) mice were assigned a clinical sepsis score over the first 24h (n=5 mice/group). (G) Additional cohorts of mice were individualed to survival analysis using the Kaplan-Meier estimator (h=10 mice/group). (H) Pulmonary edema and (I) serum levels of select inflammatory mediators were measured at 24 hours. (J) The prevalence of Grl+CDl lb+ MDSC in PBMC and (K) the number of peritoneal MDSC were determined at 24 hours. (L) Bacterial titers were measured in the blood and (M) peritoneal cavity. CLP experiments in I z2M( rc; iezo /// // mice were performed 4 times with similar results (*p<0.05; **p<0.0l; ***p<0.00l).
[0015] Figure 6. Piezol governs myeloid cell expansion via epigenetic regulation of Rbl. (A-D) Cohorts of Lyz2MCre;Rbl2l/fl mice and littermate controls were individualed to CLP. (A) The prevalence of MDSC in the peritoneal cavity, (B) serum levels of inflammatory mediators, and (C) rectal temperatures were measured at 24h. (D) Additional cohorts of mice were individual to survival analysis (n=l 1). (E) Myeloid cells harvested from WT bone marrow were cultured on 0.2 and 50 kPa Matrigen-Softwell plates overnight and tested for expression of Rbl by qPCR. (F) Myeloid cells harvested from WT bone marrow were treated overnight with Yodal or vehicle and tested for expression of Rbl by qPCR. (G) Myeloid
cells harvested from WT bone marrow were treated overnight with GsMTx4 or vehicle and assayed for expression of Rbl by qPCR. (H) Myeloid cells harvested from bone marrow of I z2M( rL';Piezo I1111 mice and littermate controls were assayed for expression of Rbl by qPCR. All qPCR experiments were performed in biologic replicates of 3. (I, J)
I z2M( r ;Riezo I1111 ;Rb l1111 mice and littermate controls were challenged with orthotopic PDA and sacrificed at 3 weeks. (I) Tumor weight and (J) the frequency of tumor-infiltrating MDSC were recorded. (K) Myeloid cells harvested from bone marrow of I z2M( rc;Piezo I1111 mice and controls were tested for expression of HDAC2 by western blotting. This experiment was repeated twice with similar results. (L-O) Myeloid cells harvested from bone marrow of I z2M( rc; Piezo l·1111 and littermate control mice were analyzed by single cell RNAseq. (L) 3- dimensional t-SNE plot of myeloid gene clusters and expression analysis based on genes that showed >2-fold difference are shown. (M) Expression of Rbl and Hdac2 in GMP and MDP from I z2M( rc; Piezo l1111 mice normalized to control GMP and MDP. (N) IPA indicating top 5 canonical pathway alterations based on z-score in GMP and (O) MDP from
Lyz2MCre PiezolEfl mice vs control. (P) ChIP-seq analysis in Piezol+/+ and Piezol_/_ bone marrow cells demonstrating binding of acetyl -hi stone H4 to the Rbl promotor. (Q-S)
I z2M( rc; Piezo l·1111 mice and littermate controls were treated with LBH589 and individualed to CLP. (Q) Rectal temperature was serially measured, (R) mice were assigned a clinical sepsis score over the first 24h, and (S) the volume of peritoneal MDSC were measured at 24h (n=4/group; *p<0.05; **p<0.0l; ***p<0.00l; ****p<0.000l).
[0016] Figure 7. Modulation of Piezo 1 in cancer. (A) KPC tumor cells were seeded on cover slips and tested for expression of Piezo 1 by immunofluorescence microscopy (scale bar = 20 pm). (B) KPC tumor cells were seeded in 96-well plates with PBS, GsMTx4,
DMSO, and Yodal. Cellular proliferation was measured at serial time points using the XTT assay. This experiment was repeated twice (n=5/group). (C) KPC tumor cells were treated with shRNA directed against Piezol or control scramble shRNA. Knockdown efficacy was tested by qPCR. (D, E) PDOTS from freshly resected human tumors were treated with Yodal or vehicle for 3 days. (D) CD4+ and CD8+ T cells were analyzed for expression of CD44. (E) Spheroid sizes were measured. Representative images and quantitative data are shown (scale bar = 100 pm; *p<0.05; ****p<0.000l).
[0017] Figure 8. Piezol does not affect lymphopoiesis. (A) Splenocytes obtained from Piezo lpl~tdT reporter mice were co-stained with DAPI and aCD3. Representative immunofluorescent images are shown (scale bar = 20 pm). (B) BioGPS gene portal data showing PIEZO 1 expression in human CD4+ and CD8+ T cells compared to median
expression in other tissues. (C) Representative H&E-stained thymic cortex and medulla of Lck( ;PiezoI1111 mice and littermate controls at lOx and 40x magnification (n=3/group; scale bars = 20 pm). (D) Analysis of progenitor and mature thymic T cell populations in
LckPre ;Piezo P and control mice. Quantitative analysis of CD4+CD8 , CD4 CD8+,
CD4+CD8+ (double positive; DP), CD4 CD8 (double negative; DN) and CD44+CD25 (DN1), CD44+CD25 +(DN 2), CD44 CD25+(DN3), CD44 CD25 (DN4) populations are shown. Data are representative of three independent experiments. (E, F) T cells in the (E) spleen or (F) lymph nodes LckFre iPiezol^fl and control mice were analyzed for the CD4/CD8 ratio and expression of fate-determining transcription factors. This experiment was performed 3 times.
[0018] Figure 9. Piezol delimits T cell activation in mouse and human systems.
(A) Polyclonal splenic CD8+ T cells from ck( rL’;PiezoI1111 and littermate control mice were activated in vitro by CD3/CD28 co-ligation for 72h and tested for expression of select activation markers, transcription factors, and cytokines. Data are representative of four independent experiments with similar results. (B) T cells from human PBMC were activated in an MLR for 96h in the presence of GsMTx4 or vehicle. This experiment was repeated twice in replicates of 6. (C) T cells from human PBMC were activated in an MLR for 96h in the presence of Yodal or vehicle. This experiment was performed three times in replicates of 4. (D, E) Polyclonal splenic CD4+ and CD8+ T cells from WT mice were activated in vitro by CD3/CD28 co-ligation with application of increasing mechanical pressure. T cell activation was determined based on expression of åFNy. (F, G) T cell diameter (F) and volume (G) were measured in splenic T cells from LckCre;Piezol fl mice and littermate controls (n=3/group). (*p<0.05; **p<0.0l; ***p<0.00l; ****p<0.000l).
[0019] Figure 10. Piezol and mechanical stimulation regulate T cell
inflammatory signaling and metabolism. (A-C) Quantification of mitochondrial (A) volume, (B) surface area, and (C) sphericity based on electron microscopy images of mitochondria in Piezol+/+ and Piezol T cells activated by CD3/CD28 co-ligation. Data are representative of three separate experiments measured from > 10 images from each group.
(D) Quantification of calcium influx in Piezo 1+/+ and
T cells following TCR crosslinking (n=4/group). (E) Network analysis showing ontology relationship between pathways based on RNAseq of Piezol T cells. (F) Western blot analysis of NFAT in
cells. Cytoplasmic and nuclear extract were analyzed for the presence of NFAT. b-actin and Lamin were used as markers for cytoplasmic and nuclear proteins, respectively. (G) Schematic depicting changes in T cell activation and metabolism in the context of deletion or inhibition of Piezol . (H-L) Polyclonal splenic CD4+ and CD8+
T cells from WT mice were activated in vitro by CD3/CD28 co-ligation with application of low (66 Pa) or high (227 Pa) mechanical pressure and tested for (H) differences in OCR, (I) ECAR, and (J) ATP production. (K) c-Myc expression was tested by qPCR. (L) Cell viability was determined by flow cytometry. Data are representative of 3 experiments (*p<0.0l;
**p<0.0l; ***p<0.00l).
[0020] Figure 11. Piezol senses pressure in myeloid cells. (A) BioGPS gene portal data showing PIEZO 1 expression in human monocytes compared to median expression in other tissues. (B) Splenocytes from Piezolpl tdT reporter mice were co-stained with DAPI and aCDl lb. Representative immunofluorescent images are shown (scale bar = 20 pm). (C) Bone marrow cells from I z2M( rc; iezo l1111 mice and WT mice were analyzed for the frequency of CD1 l7+CDl l5+CDl35+Ly6C CDl lb myeloid-derived progenitors (MDP) and
CD1 l7+CDl l5+CDl35 Ly6C+CDl lb common monocyte progenitors (cMoP) in Lin- (CD3-CDl9-NKl. l-Ly6G-) cells. Data are representative of experiments performed 3 times. (D) Splenocytes from I z2M( rc; iezo l1111 mice and WT mice were analyzed for the frequency of splenic CD1 lb+CD68+F4/80+ macrophages and CD1 lb+CDl lc+MHCII+ dendritic cells. Data are representative of experiments performed 3 times. (E, F)
Mechanically-activated currents were elicited from activated (E) Piezol+/+ (n=3) and (F) Piezol (n=5) myeloid cells in whole-cell patch clamp configuration with pressure applied to the patch pipette (0 to -140 mmHg, D20 mmHg) at a holding potential of +70 mV. (G) Piezol ^ CD1 lb+ myeloid cells purified from Vav( re; Piezo l/! /I or LyzMCre; Piezo flP mice and Piezol+/+ myeloid cells from control mice were treated with CSE on plates of 0.2kPa and 50kPa stiffness and assayed for TNFa expression at 18h. Data are representative of two independent experiments. (H, I) Piezol+/+ (n=l75) and Piezo / (n=l88) myeloid cells were assessed for (H) cellular area and (I) perimeter by high content analysis.
[0021] Figure 12. Inhibition of Piezol protects against polymicrobial sepsis. (A-
C) WT mice were individualed to CLP and treated with GsMTx4 or vehicle. (A) Rectal temperature, (B) clinical sepsis score, and (C) serum levels of select inflammatory mediators were measured at 24 hours. Data are representative of experiments performed 3 times (*p<0.05; ***p<0.00l).
[0022] Figure 13. Acetyl-histone H4 ChIP-sequencing of bone marrow cells. (A)
Piezol+/+ and Piezo / bone marrow myeloid cells were assayed for expression of Rbl by qPCR after overnight culture on plates of 0.2kPa stiffness. This experiment was performed twice in 3 replicates. (B) Metagene profiles of normalized ChIP-seq reads around
transcriptional start sites for Piezo 1+/+ and Piezo l bone marrow cells. (C) Heat map showing transcriptional start site data presented in (B) in single gene-resolution. Profiles were sorted for decreasing signal of acetyl -hi stone H4 ChIP-seq.
DESCRIPTION OF THE DISCLOSURE
[0023] The present disclosure provides methods for treatment of various diseased conditions by modulation (up or down regulation) of Piezol activity. In this disclosure, we investigated whether simple perturbations in mechanical forces translate into cellular signals that lead to T lymphocyte reprogramming. We show that Piezol is expressed on both T cells and myeloid cells. Knocking out Piezol in T-cells results in T-cells being more sensitive to both TCR as well as TCR-bypassed activation. Similarly, Piezol deletion in T-cells leads to a favorable Thl-phenotype with markedly increased IFNy-production. These in vitro data are backed up by our in vivo results that show that transfer of Piezol-/- CD8+ T-cells leads to enhanced tumor clearance compared to wild type (WT) T-cells. A physiological stimulus for Piezol is pressure and we demonstrate herein that increased pressure leads to T-cell inactivation, which is rescued by deletion of Piezol. Piezol knockout is not associated with increased activation in the absence of pressure. Using a pharmacological inhibitor for Piezol, we demonstrate that increased IFNy production both in vitro and in vivo was accompanied by tumor protection. These data indicate that Piezol functions as an immune checkpoint.
[0024] In myeloid cells, Piezol deletion is associated with improved antigen crosspresentation. Further, myeloid-specific deletion of Piezol is associated with tumor protection as well as a less severe outcome in sepsis. In tumor, Piezol deletion on myeloid cells is associated with decreased influx of monocytes. We show that in the bone marrow of myeloid cell-specific Piezol KO mice, monocyte production is impaired, too. The decreased number of monocytes may be due to developmental arrest during myelogenesis. In fact, monocyte-macrophage-DC-precursors are increased in the bone marrow of myeloid-specific Piezol KO mice, suggesting that the developmental arrest is happening at an early stage during myelogenesis, not allowing further differentiation.
[0025] In an aspect, this disclosure provides a method of modulation of immune response in the treatment of conditions where the cells may be exposed to increased pressure. For example, this disclosure provides methods for treatment of, or ameliorating the symptoms of, cancer, infectious diseases or sepsis.
[0026] The term“treatment” as used herein refers to reduction in one or more symptoms or features associated with the presence of the particular condition being treated.
Treatment does not necessarily mean complete cure or remission, nor does it preclude recurrence or relapses. For example, treatment in the present disclosure means reducing or inhibiting the growth of tumor cells, or reducing one or more symptoms associated with an infectious disease.
[0027] The term“therapeutically effective amount” as used herein in reference to a single agent is the amount sufficient to achieve, in a single or multiple doses, the intended purpose of treatment. The exact amount desired or required will vary depending on the particular compound or composition used, its mode of administration, patient specifics and the like. Appropriate effective amounts can be determined by one of ordinary skill in the art informed by the present disclosure.
[0028] Where a range of values is provided in this disclosure, it should be understood that each intervening value, to the tenth of the value of the lower limit between the upper and lower limit of that range, and any other intervening value in that stated range is encompassed within the invention, unless clearly indicated otherwise. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges encompassed within the disclosure.
[0029] A reference to singular form also includes its plural form, and vice versa.
[0030] Piezo 1 function may be modified (downregulated or up regulated) by using activators or inhibitors of Piezo 1 gene expression or Piezo 1 channel function.
[0031] In an aspect, the present disclosure provides a method of treating cancer by modulation of Piezol activity. The method comprises administering to an individual in need of treatment, a composition comprising, or consisting essentially of, an agent which modulates Piezol expression or function. In one aspect, this disclosure provides a method of treating an infectious disease by modulation of Piezol activity. The method comprises administering to an individual who has an infection, or is at risk of getting an infection, a composition comprising, or consisting essentially of, an agent which modulates Piezol expression or function. In an aspect, the present disclosure provides a method for treating sepsis comprising administering to an individual in need of treatment, a composition comprising, or consisting essentially of, an agent which modulates Piezol expression or function. In embodiments, the individual is administered a composition in which the Piezol modulator is the only active agent.
[0032] In an embodiment, this disclosure provides a method for enhancing T cell activation in an environment of increased mechanical stress comprising administering to an
individual who is afflicted with a condition that creates increased mechanical stress a composition comprising or consisting essentially of an inhibitor of Piezo 1 activity.
[0033] Expression of Piezo 1 gene can be down regulated by methods known in the art. For example, RNAi-mediated reduction in Piezo 1 mRNA may be carried out. RNAi- based inhibition can be achieved using any suitable RNA polynucleotide that is targeted to Piezo 1 mRNA. In embodiments, a single stranded or double stranded RNA, wherein at least one strand is complementary to the target mRNA, can be introduced into the cell to promote RNAi-based degradation of target mRNA. In another embodiment, microRNA (miRNA) targeted to the Piezo 1 mRNA can be used. In another embodiment, a ribozyme that can specifically cleave Piezo 1 mRNA can be used. In another embodiment, small interfering RNA (siRNA) can be used. siRNA can be introduced directly, for example, as a double stranded siRNA complex, or by using a modified expression vector, such as a lentiviral vector, to produce an shRNA. As is known in the art, shRNAs adopt a typical hairpin secondary structure that contains a paired sense and antisense portion, and a short loop sequence between the paired sense and antisense portions. shRNA is delivered to the cytoplasm where it is processed by DICER into siRNAs. siRNA is recognized by RNA- induced silencing complex (RISC), and once incorporated into RISC, siRNAs facilitate cleavage and degradation of targeted mRNA. Generally, shRNA polynucleotide used to suppress Piezol mRNA expression can comprise or consist of between 45-100 nucleotides, inclusive, and including all integers between 45 and 100
[0034] For delivering siRNA via shRNA, modified lentiviral vectors can be made and used according to standard techniques, given the benefit of the present disclosure. Custom siRNAs or shRNA can be obtained from, for example Thermo-Dharmacon or Cellecta for transient transfection resulting in temporary reduction in the targeted mRNA levels. The lentiviruses are capable of stably and permanently infecting target cells, such as by integrating into a genome of a cell.
[0035] In an embodiment, the disclosure includes disrupting the target gene such that
Piezol mRNA and protein are not expressed. The Piezol gene can be disrupted by targeted mutagenesis. In embodiments, targeted mutagenesis can be achieved by, for example, targeting a CRISPR (clustered regularly interspaced short palindromic repeats) site in the target gene. So-called CRISPR systems designed for targeting specific genomic sequences are known in the art and can be adapted to disrupt the target gene for making modified cells encompassed by this disclosure. In general, the CRISPR system includes one or more expression vectors encoding at least a targeting RNA and a polynucleotide sequence
encoding a CRISPR-associated nuclease, such as Cas9, but other Cas nucleases can alternatively be used. CRISPR systems for targeted disruption of mammalian chromosomal sequences are commercially available.
[0036] In an embodiment, this disclosure provides a method for treatment of cancer comprising deletion or mutation of the Piezol gene using CRISPR based DNA editing techniques, whereby the activity of Piezol is reduced resulting in inhibition of growth of cancer cells. In an embodiment, this disclosure provides a method for treatment of cancer comprising downregulating the expression of Piezol gene using RNAi based inhibition, whereby the activity of Piezol is reduced resulting in inhibition of growth of cancer cells.
The reduction in Piezo activity may be due to reduced protein, lack or protein, or defective protein, or interference with its activity by another molecule.
[0037] In another approach, the function of Piezol protein may be inhibited by the use of specific inhibitors. An example of such a compound that blocks the Piezol channel is GsMTx4 (also referred to herein as GsMTx-4), a component of tarantula venom, and/or its variants. Thus, in one embodiment, the present invention comprises administering to an individual a composition comprising GsMTx4 and/or one or more of its variant to treat cancer or an infectious disease (e.g. caused by a virus or bacteria).
[0038] The peptide GsMTx4, as used herein, has the sequence
GCLEF W WKCNPNDDKC CRPKLKC SKLFKLCNF SF (SEQ ID NO: l). This peptide is a 34 mer. Variants can be generated from this sequence by substitutions, additions or deletions wherein the variant is at least 75%, 80%, 85%, 90%, or 95% identical to SEQ ID NO: 1, provided it still exhibits blockage of Piezol channel or one or more properties described herein. A sequence of GsMTx4 is also disclosed in U.S. Pat. No. 7,125,847 (incorporated herein by reference). U.S. Patent No. 9,211,313 provides examples of substitutions that can be made (incorporated by reference). Deletions of one or more amino acids may also be made as long as it does not affect the ability of the peptide to block Piezo 1 channel. Both L and D enantiomers of GsMTx4 and its variants can be used.
[0039] GsMTx4 is available commercially and can also be isolated from spider venom by serial fractionation using standard chromatographic techniques. For example, fractionation of the spider venom is carried out using reverse phase high performance liquid chromatography (HPLC). Reverse phase HPLC can be performed using C-8 or C-18 silica columns and trifluoroacetic acid/acetonitrile buffer system. C-8 and C-18 silica columns are commercially available (Mac-Mod Analytical, Inc., West Chester, Pa.).
[0040] The peptide GsMTx4 and its variants can also be prepared by chemical synthesis using automated or manual solid phase methods. Such technologies are well known in the art. For example, such technologies are described in E. Atherton and R. C. Sheppard, Solid Phase Peptide Synthesis: A Practical Approach, IRL Press/Oxford University Press, Oxford, England, 1989; and M. Bodanzky, Peptide Chemistry: A Practical Textbook, Springer-Verlag, New York, N.Y., 1988. Thus, the peptide GsMTx4 can be synthesized using Fmoc chemistry or an automated synthesizer. Depending upon quantitative yields, production of the linear reduced peptide can be performed in either a single process or in two different processes followed by a condensation reaction to join the fragments. A variety of protecting groups can be incorporated into the synthesis of linear peptide so as to facilitate isolation, purification and/or yield of the desired peptide. Protection of cysteine residues in the peptide can be accomplished using protective agents such as triphenylmethyl, acetamidomethyl and/or 4-methoxybenzyl group in any combination.
[0041] The peptide GsMTx4 and its variants can be prepared by recombinant DNA technology. A DNA sequence coding for the peptide is prepared, inserted into an expression vector and expressed in an appropriate host cell. The expressed peptide can then be purified from the host cells and/or culture medium. Methods for preparing DNA coding for the peptide and expression of DNA are well known to those skilled in the art and are found for example, in Sambrook et ak, (1989) Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, N.Y., S. L. Berger and A. R. Kimmel, Eds., Guide to Molecular Cloning Techniques: Methods in Enzymology, vol 152, Academic Press, San Diego, Calif., 1987, and in E. J. Murray, Ed., Gene Transfer and Expression Protocols: Methods in Molecular Biology, vol 7, Humana Press, Clifton, N.J., 1991. For example, methods for preparing recombinant GsMTx- 4 peptide are described in U.S. patent application Ser. No. 12/907,475, US Patent application 2009/0023183 Al and US 2012/0015886, incorporated herein by reference.
[0042] A suitable amount for GsMTx4 or its variants in the pharmaceutical composition can be determined by empirical methods. Those skilled in the art will recognize that the dosage administered to a particular individual will depend on a number of factors such as the route of administration, the duration of treatment, the size and physical condition of the individual, and the patient's response to the peptide. The lack of any measurable toxicity of GsMTx4 in animal studies provides flexibility for designing a broad range of dosage regimens. In one embodiment, GsMTx4 or its variants may be used at a concentration from about 0.1 to 10.0 millimolar. The dosage regimen can include daily administrations, weekly or other suitable administrations. Extended release mechanisms can also be used.
Administration may be continuous (at desired frequency of administration) over a period of time or may be include interruptions of desired periods of time.
[0043] An example of an activator of Piezo 1 channel is Yoda 1 (2-[5-[[(2,6-
Dichlorophenyl)methyl]thio]-l,3,4-thiadiazol-2-yl]pyrazine), which is commercially available (such as from Tocris). The Piezol channel is a mechanosensitive channel and as such can be activated by physical stress.
[0044] Compositions comprising modulators of Piezol channel can be prepared by using pharmaceutical carriers. For example, the peptide GsMTx4 of the present invention can be prepared for pharmaceutical use by incorporation with a pharmaceutically acceptable carrier or diluent. The peptide can be formulated into tablets, capsules, caplets and the like. Suitable carriers for tablets include calcium carbonate, starch, lactose, talc, magnesium stearate and gum acacia. The peptide can also be formulated for oral, parenteral or intravenous administration in aqueous solutions, aqueous alcohol, glycol or oil solutions or emulsions. The peptide can also be formulated for inhaling by encapsulating to facilitate alveolar absorption as has been done for insulin (Inhale Therapeutic Systems, San Carlos, Calif., inhale.com). Pharmaceutical compositions suitable for such routes of administration are well known in the art. For example, suitable forms and compositions of pharmaceutical preparations can be found in Remington's Pharmaceutical Science, 1980, 15th ed. Mack Publishing Co., Easton, Pa. Thus, the peptide GsMTx4 can be administered orally, subcutaneously, intratumorally, parenterally, intravenously, intramuscularly or intranasally. The peptide may also be applied to medical devices that will come into contact blood. The pharmaceutical carriers or diluents etc. can also be used for preparing compositions comprising activators of Piezol, such as, for example, Yoda 1.
[0045] The present compositions and methods may be used in mammals including humans.
[0046] Modulators of Piezol expression/function (blockers and activators) can be used in the treatment of cancer and infectious diseases. For example, the peptide GsMTx4 and/or its variants may be used in the treatment of cancer and in the treatment of infectious diseases. For example, a composition comprising one or more peptides may be administered to an individual in need of treatment. The individual can be a mammal, more preferably a human. Other mammals include, but are not limited to, farm animals, pets, primates, horses, dogs, cats, mice and rats. A human individual in need of treatment may be a human patient having, at risk for, or suspected of having a solid tumor, such as pancreatic duct
adenocarcinoma (PDA), colorectal cancer (CRC), melanoma, breast cancer, lung cancer (for
example, non-small cell lung cancer, NSCLC, and small cell lung cancer, SCLC), upper and lower gastrointestinal malignancies (including, but not limited to, esophageal, gastric, and hepatobiliary cancer), squamous cell head and neck cancer, genitourinary, and sarcomas as well as leukemias. An individual having a solid tumor can be identified by routine medical examination, e.g ., laboratory tests, organ functional tests, CT scans, or ultrasounds.
Leukemias can also be identified by established clinical tests, such as blood based tests. An individual suspected of having any of such target disease/disorder might show one or more symptoms of the disease/disorder. An individual at risk for the disease/disorder can be an individual having one or more of the risk factors for that disease/disorder. In some embodiments, the individual to be treated by the method described herein may be a human cancer patient who has undergone or is individualing to an anti-cancer therapy, for example, chemotherapy, radiotherapy, immunotherapy, or surgery.
[0047] The modulators of Piezo 1 function (inhibitors (such as, for example, GsMTx-4 and its variants) may be used in the treatment of infectious diseases. The infectious disease may be caused by a virus, bacteria or other microorganisms, such as viral hepatitis, HIV infection or bacterial sepsis. For example, a composition comprising one or more blockers of Piezol (such as GsMTx-4) may be administered to an individual in need of treatment. The individual can be a mammal, more preferably a human. Mammals include, but are not limited to, farm animals, pets, primates, horses, dogs, cats, mice and rats. An individual in need of treatment may be one that has been clinically or symptomatically diagnosed as being infected, or that is at risk of being infected. In embodiments, the individual may be also being treated with other anti-infectious medications or approaches.
[0048] Activators of Piezol (such as, for example, Yoda 1) may be used in the treatment of autoimmune diseases, such as, for example, inflammatory autoimmune diseases. For example, a composition comprising a therapeutically effective amount of a Piezol activator may be administered to an individual in need of treatment. The individual can be a mammal, more preferably a human. Mammals include, but are not limited to, farm animals, pets, primates, horses, dogs, cats, mice and rats. An individual in need of treatment may be one that has been clinically or symptomatically diagnosed as having an autoimmune disease, such as, for example, inflammatory bowel disease, Crohn’s disease, rheumatoid arthritis, psoriasis and the like.
[0049] In an embodiment, this disclosure provides a composition comprising an inhibitor of Piezol activity for use in a method of treating cancer, infection or sepsis
comprising administering to an individual in need of treatment a therapeutically effective amount of an inhibitor of Piezo 1 channel activity.
[0050] In an embodiment, this disclosure provides a method for treatment of cancer comprising administering to an individual in need of treatment a composition comprising an agent which inhibits Piezol channel activity, wherein administration of the composition results in inhibition of growth of cancer cells. The agent that blocks Piezol channel activity may be a blocker of Piezol channel, such as, GsMTx4, or may be an RNAi molecule. The cancer may be pancreatic duct adenocarcinoma (PDA), colorectal cancer (CRC), melanoma, breast cancer, lung cancer (for example, non-small cell lung cancer (NSCLC), and small cell lung cancer (SCLC), upper and lower gastrointestinal malignancy, esophageal cancer, gastric cancer, hepatobiliary cancer, squamous cell head and neck cancer, genitourinary cancer, sarcoma, or leukemia.
[0051] In an embodiment, this disclosure provides a method for treating an infection in an individual comprising administering to an individual in need of treatment a composition comprising an agent which inhibits Piezol channel activity, wherein administration of the composition results in reducing the severity of the infection or completely treating it. The agent that blocks Piezol channel activity may be a blocker of Piezol channel, such as, GsMTx4, or may be an RNAi molecule. The infection may be caused by virus, bacteria or any other microbe or higher organism.
[0052] In an embodiment, this disclosure provides a method for treating microbial sepsis in an individual comprising administering to an individual in need of treatment a composition comprising an agent which inhibits Piezol channel activity, wherein
administration of the composition results in reducing the severity of sepsis or completely treating it. The agent that blocks Piezol channel activity may be a blocker of Piezol channel, such as, GsMTx4, or may be an RNAi molecule.
[0053] In an embodiment, this disclosure provides a method for treatment of cancer comprising deletion or mutation of the Piezol gene using CRISPR based DNA editing techniques, whereby the activity of Piezol is reduced resulting in inhibition of growth of cancer cells.
[0054] In an embodiment, this disclosure provides a method for treatment of an infection or microbial sepsis comprising deletion or mutation of the Piezol gene using CRISPR based DNA editing techniques, whereby the activity of Piezol is reduced resulting in reducing the severity of or complete treatment of the infection or sepsis.
[0055] The following examples are provided as illustrative examples and are not intended to be restrictive in any way.
EXAMPLE 1
[0056] Results
[0057] Piezo 1 signaling in inflammatory cells promotes cancer progression
[0058] To assess the influence of global Piezo 1 signaling on the progression of pancreatic ductal adenocarcinoma (PDA), we utilized GsMTx4 and Yodal, respectively, to inhibit or activate Piezol. Inhibition of Piezo 1 conferred tumor-protection in an orthotopic PDA model using tumor cells derived from PdxlCre ;KrasG12D ;Tp53R172H (KPC) mice (Figure 1A). By contrast, activation of Piezol accelerated tumor growth (Figure 1B). Similarly, in human PDA, low PIEZO 1 expression was associated with extended survival (Figure 1C). Whereas -20% of patients that expressed low PIEZO 1 were 5-year survivors, there were no long-term survivors in t e PIEZO 1 high group. PDA tumor cells expressed Piezol (Figure 7 A); however, neither activation nor inhibition of Piezol affected tumor cell growth in vitro (Figure 7B), nor did knockdown of Piezol affect PDA growth in vivo (Figures 1D, 7C). We therefore postulated that inhibiting Piezol mitigates oncogenic progression by reprograming the inflammatory tumor microenvironment (TME). Using Piezolpl tdT mice that express a fluorescent tdTomato reporter from the Piezol promoter, we confirmed that leukocytes robustly express Piezol (Figure 1E). To directly test our hypothesis, we generated
VavCr, ; Piezo I1111 mice in which Piezol is deleted from all hematopoietic cells.
Vav( n'; iezolJlJI mice demonstrated attenuated tumor growth compared to littermate controls (Figure 1F).
[0059] We analyzed the intra-tumoral immune phenotype in PDA-bearing mice treated with GsMTx4. We discovered that the GrUCDl lb+ myeloid-derived suppressor cell (MDSC) population was sharply diminished upon Piezol inhibition (Figure 1G). Similarly, PDA tumors in VavCrc; iezo lll /l mice exhibited lower MDSC infiltration (Figure 1H). By contrast, activation of Piezol in vivo with Yodal increased MDSC expansion in PDA (Figure II). Furthermore, consistent with immunogenic reprogramming in the TME, CD4+ and CD8+ T cells upregulated IFNy expression in PDA tumors in WT hosts treated with GsMTx4 (Figure 1 J), as well as in PDA tumors in VavCre;Piezo P mice (Figure 1K), indicative of adaptive immune activation. To evaluate the therapeutic efficacy of Piezol inhibition in human PDA, we treated patient-derived organotypic tumor spheroids (PDOTS) from freshly resected human tumors with GsMTx4 or vehicle using a 3 -dimensional microfluidic system
that has been validated as a platform for testing immune-based therapeutics (Wang et al. , Cancer Cell 34, 757-774 e757 (2018); Jenkins et al, Cancer Discov 8, 196-215 (2018)). Piezol inhibition resulted in MDSC contraction, CD4+ and CD8+ T cell activation, and attenuated spheroid growth in PDOTS (Figures 1L-0). By contrast, Piezol activation expanded MDSC, aggravated T cell suppression, and promoted spheroid growth in PDOTS (Figures 1P, Q, 7D, E).
[0060] Deletion of Piezol in T cells is tumor-protective
[0061] Since pan-inhibition of Piezol in PDA results in intra-tumoral CD4+ and CD8+
T cell activation, we investigated whether Piezol signaling directly suppresses T cell immunogenicity in cancer. We confirmed that mouse T cells robustly express Piezol (Figure 8A). Analysis of BioGPS gene portal data indicated that human T cells express >25-fold higher levels of PIEZO 1 than median expression in other tissues (Figure 8B). To investigate the impact of Piezol signaling in T cells on tumor immunity, we generated LekF™ iPiezol^fl mice, which lack Piezol in their T cell lineage. LclC^ Piezold1 mice were protected against PDA compared to littermate controls and exhibited extended oncologic survival (Figure 2A, B). Analysis of the intra-tumoral T cell infiltrate in Lck( rL‘ ; Piezo P111 mice revealed an enhanced cytotoxic CD8+ T cell phenotype, including upregulation of Granzyme B, IFNy, and EOMES (Figure 2C). Moreover, single dose i.v. adoptive transfer of naive splenic T cells from LclCre Piezold1 mice protected against established PDA tumors compared to transfer of control T cells (Figure 2D). Cd^ Piezo P mice were also protected against PDA and exhibited expansion of intra-tumoral Thl cells and diminution of Tregs (Figure 2E, F). Collectively, these data indicate that Piezol signaling in T cells mitigates tumor immunity. Of note, the frequency of progenitor and mature T cell populations in the thymus was unaffected by targeting Piezo f suggesting that Piezol does not affect lymphopoiesis (Figure 8C, D). T cells in the periphery also exhibited similar differentiation in
LclCre ;PiezolEfl and control mice (Figure 8E, F).
[0062] T cells sense mechanical forces via Piezol
[0063] We investigated if T cell dysfunction is linked to mechanical activation of
Piezol. We found that mechanical stimulation of Piezol+/+ T cells in whole-cell patch clamp configuration evoked currents characteristic of Piezol activation (Figure 2G). By contrast, Piezol T cells failed to respond to mechanical stimulation (Figure 2H). Current-pressure relationship in Piezol+/+ T cells demonstrated maximal opening at -60 mmHg and a half- maximal activation (Pso) of -35 mmHg (Figure 21). These pressures are below the reported fluid pressures found in PDA but well above the pressures observed in normal pancreas
(DuFort et al ., Biophys J 110, 2106-2119 (2016)). By contrast, Piezol T cells again failed to exhibit a positive current-pressure relationship (Figure 2J). Collectively, these data indicate that T cells sense mechanical forces via Piezol, whereas in the context of Piezol deletion T cells fail to transduce pressure-mediated currents.
[0064] Mechanical stress mitigates T cell activation in a Piezol dependent manner
[0065] We postulated that Piezol signaling induced by mechanical cues mitigates T cell activation. Accordingly, using in vitro modeling, we found that Piezo 1 ' CD4+ and CD8+ T cells exhibited markedly enhanced activation in response to CD3/CD28 co-ligation based on expression of surface markers, transcription factors, and cytokines (Figures 3A, B and 9 A). Piezo 1 -deficient CD8+ T cells exhibited higher IFNy responsiveness across a range of aCD3 signal strengths (Figure 3C). Similarly, Lck( rL’;PiezoI1111 T cells exhibited enhanced activation in a mixed lymphocyte reaction (MLR) (Figure 3D, E). Deletion of Piezol also resulted in higher CD8+ T cell responsiveness to PMA/Ionomycin, indicating that enhanced activation is independent of the TCR (Figure 3F). Further, consistent with our in vivo findings in tumor, CD4+ T cells derived from ( "d4( r ; Piezo I1111 mice exhibited increased Thl but reduced Treg differentiation under Thl and Treg polarizing conditions, respectively
(Figures 3G). Similarly, Piezol deletion in antigen-restricted CD4+ T cells enabled higher immunogenic responses to antigen presentation (Figure 3H). Further, paralleling our mouse data, human PBMC-derived T cells displayed enhanced activation to CD3 ligation when treated with GsMTx4 (Figure 31), whereas treatment with Yodal reduced T cell activation in a dose-dependent manner (Figure 3J). Piezol inhibition also enhanced human T cell responses in an MLR, whereas Piezol activation reduced responsiveness (Figure 9B, C).
[0066] To assess whether mechanical cues inhibit T cell activation via Piezol, we activated splenic T cells from Lclfre;Piezolll/ll or littermate control mice using CD3/CD28 co-ligation while simultaneously applying a range of compressive force using calibrated weights. Higher mechanical forces suppressed activation of Piezol+/+ T cells, suggesting that mechanical stress mitigates T cell responsiveness (Figures 3K-N and 9D, E). By contrast, increasing compressive force did not suppress Piezol T cells (Figure 30-Q). Collectively, these data indicate that Piezol links mechanical cues to immune-regulation. Notably, we did not observe size or volume differences in splenic T cells from LckCre ;Piezo flP compared to WT mice (Figure 9F, G).
[0067] Targeting Piezol in T cells enhances LCMV viral clearance
[0068] Lymphocytic choriomeningitis virus (LCMV) infection is characterized by high interstitial pressures in multiple compartments resulting from increased vascular
permeability. Since T cells are essential for antiviral immunity, including clearance of LCMV infection, we investigated if Piezol deletion would protect in this model. We observed that
mice exhibited enhanced immunity against LCMV as evidenced by reduced viral titers in the serum and spleen (Figure 3R, S), increased clonal expansion of GP33- specific CTLs in PBMC and spleen (Figure 3T, U), and evidence of higher CD8+ T cell activation (Figure 3V). The frequency of CXCR5+PDl+BCL6+ T follicular helper cells, which are essential for controlling viral titers, was also increased in the spleen of
Ldfre;Piezo P hosts (Figure 3W). In aggregate, these data indicate that deletion of Piezol activates LCMV-specific T cells resulting in accelerated viral clearance.
[0069] Piezol governs T cell activation via Akt-mTOR mediated regulation ofMyc
[0070] To investigate the mechanism by which Piezol suppresses T cell activation, we analyzed changes in the transcriptome in Piezol compared to Piezol+/+ T cells. We found that aCD3/aCD28-stimulated Piezo 1 ' T cells exhibited marked changes in global gene expression compared to controls (Figure 4A, B). Granzyme B ( Gzmb ) and Perforin (PrfP) were among the most highly upregulated genes in
T cells consistent with enhanced cytotoxic function. Similarly, Thl -related chemokines including Cc/3, Cell, Ccl5 , Cxc/9, and CxcllO were substantially increased in Piezol T cells (Figure 4C, D). In addition, a host of genes regulating aerobic glycolysis and oxidative phosphorylation - including hexokinase2 (Hk2\ phosphofructokinasel {Pfkl ), pyruvate dehydrogenase ( Pdhx\ and components of ATP synthase, and complex I and IV - were among the most highly overexpressed genes in Piezol ^ T cells (Figure 4A, B). Ingenuity pathway analysis (IP A) confirmed that, in addition to enhanced T cell signaling and CTL function, diverse metabolic pathways were upregulated in Piezol T cells including those controlling glycolysis, the TCA cycle, and oxidative phosphorylation (Figure 4E). Gene set enrichment analysis (GSEA) similarly suggested increased expression of genes regulating glycolysis in Piezol T cells (Figure 4F). Accordingly, Piezol T cells exhibited increased rates of oxygen consumption (OCR) and extracellular acidification (ECAR), indicative of increased activation-induced metabolic activity (Figure 4G, H). Activated Piezol T cells also had a higher rate of ATP production (Figure 41). As such, mitochondria in Piezol T cells were more numerous and larger, but exhibited a less spherical morphology compared to Piezol+/+
T cells (Figures 4J, 10A-C).
[0071] IPA suggested that Myc signaling was the most highly upregulated pathway in
Piezol T cells (Figure 4E). We investigated if Piezol regulates T cell metabolism via suppression ofMyc. Accordingly, activated Piezol T cells exhibited increased pAkt and
mTOR signaling (Figure 4K, L). elF signaling, which is directly promoted by mTOR, was also highly upregulated in Piezol ^ T cells (Figure 4M, N). Moreover, inhibition of PI3K/Akt abrogated the elevated IFNy and upregulation of Myc expression in Piezo l T cells (Figure 40, P). Calcium can act as a second messenger in lymphocytes to initiate PI3K/Akt activation, IFNy production, and upregulation of Myc. We found that Ca2+ influx was increased in Piezol ^ T cells upon TCR activation (Figures 4Q, 10D). Consistent with these data, we found enrichment for gene ontology (GO) terms associated with cytokine and inflammatory signaling and cellular metabolism in Piezol ^ T cells (Figure 10E). However, we did not observe differences between Piezol+/+ and
T cells in levels of NFAT, which is regulated by Ca2+/calcineurin signaling (Figure 10F). In aggregate, we show that deletion of Piezol enhances T cell cytotoxic function and metabolic readiness leading to activation of PI3K/Akt signaling and Myc upregulation (Figure 10G). Further, consistent with our observation that mechanical forces mitigate T cell activation, WT T cells cultured under reduced mechanical stress exhibited higher OCR, ECAR and ATP production and higher Myc expression (Figures 10H-J). Of note, cellular viability was not affected by application of higher compressive force (Figure 10L).
[0072] Piezol deletion in myeloid cells is protective against cancer
[0073] We had observed that pan-inhibition or deletion of Piezol reduced MDSC infiltration in PDA, whereas Piezol activation increased MDSC infiltration (Figure 1). Therefore, we postulated a parallel immune-regulatory role for Piezol signaling in myeloid cells. Human monocytic cells expressed ~l0-fold higher levels of PIEZOl than median expression in other tissues (Figure S5A), and we confirmed that mouse myeloid cells robustly express Piezol (Figure 11B). To investigate the impact of Piezol signaling in myeloid cells, we generated I z2M( r, ; Piezo l1111 mice. WT and I z2M( r ; Piezo l1111 mice had similar frequencies of progenitor populations in the bone marrow and macrophage and DC populations in the periphery (Figure 11C, D). Similar to our findings in T cells, mechanical stimulation of Piezol+/+ myeloid cells while patch-clamp recording in whole-cell configuration evoked mechanically-activated currents, whereas Piezol myeloid cells failed to respond (Figure 11E, F). These observations indicate that myeloid cells sense mechanical forces via Piezol. Moreover, we found that Piezol mitigates inflammatory responses to endotoxin in mouse and human myeloid cells when cultured under conditions of high mechanical force but Piezol is dispensable to the inflammatory response in absence of mechanical stimulation (Figure 11G). Of note, Piezol deletion did not alter myeloid cell size (Figure 11H, I).
[0074] To investigate the impact of Piezo 1 signaling in myeloid cells in cancer, we challenged I z2M( rc; Piezo P111 mice and littermate controls with orthotopic KPC tumors. I z2M( r ; Piezo I1111 mice were protected against PDA (Figure 5A). Tumors in
I z2M( rc; Piezo l1111 mice exhibited a reduced MDSC infiltrate akin to pan-inhibition or deletion of Piezo 1 (Figure 5B). Moreover, we found that targeting Piezol in myeloid cells resulted in enhanced intra-tumoral CD4+ and CD8+ T cell activation (Figure 5C, D).
[0075] Deletion of Piezol in myeloid cells protects against polymicrobial sepsis
[0076] We investigated if Piezol also influences outcome in bacterial sepsis, which is regulated by myeloid cell expansion and characterized by increased interstitial pressure. Lyz2MCre ;Piezolfl/fl mice and littermate controls were individualed to polymicrobial sepsis via cecal ligation and puncture (CLP). Lyz2MCre ; Piezo P animals were protected from sepsis exhibiting minimal core temperature loss, reduced clinical sepsis scores, decreased interstitial edema, and marked protection from sepsis-induced death (Figure 5E-H). Serum levels of pro-inflammatory cytokines were also substantially lower in CLP-treated I z2M( n';Piezoll! l1 mice (Figure 51). Further, consistent with our data in tumor-bearing hosts,
Lyz2MCre iPiezo P mice exhibited a decreased frequency of MDSC in PBMC and reduced MDSC abundance in the peritoneum (Figure 5J, K). Accordingly, bacteremia was markedly reduced in Lyz2MCre , ίbzo R mice (Figure 5L). Similarly, culture of peritoneal contents yielded ~l04-fold lower bacterial colonies in I z2M( rc; Piezo l1111 mice compared to controls (Figure 5M). Consistent with these data, GsMTx4 treatment of WT mice also protected against CLP, resulting in preservation of core body temperature, lower clinical sepsis scores, and reduced serum levels of TNFa (Figure 12A-C).
[0077] Piezol governs myeloid cell expansion via regulation ofRbl
[0078] We investigated if Piezol controls MDSC levels in disease by regulation of
Rbl. We observed an increase in peritoneal MDSC in Lyz2MCre ;Rb l^ mice compared to littermate controls following CLP (Figure 6A). Accordingly, Lyz2MCre ;Rb flP mice exhibited exacerbation in sepsis-related inflammation, morbidity, and death (Figure 6B-D). Consistent with our hypothesis, we further found that increasing mechanical stress in myeloid cells lowered expression ofRbl (Figure 6E). Similarly, activating Piezol using Yodal reduced Rbl expression (Figure 6F). By contrast, GsMTx4-mediated inhibition of Piezol (Figure 6G) or deletion of Piezol in myeloid cells (Figure 6H) upregulated Rbl. Of note,
and Piezol+/+ myeloid cells expressed similar levels of Rbl by qPCR after overnight culture on plates of low stiffness (Figure 13A). Collectively, these data indicate that whereas Piezol signaling or mechanical stimulation suppress Rbl , ablation of Piezol upregulates Rbl.
Further, inhibition of Piezol in PDA-bearing Lyz2A/fre ;Rb l-f1!1 mice failed to reduce MDSC expansion, confirming that Piezol modulates MDSC via Rbl (not shown). Moreover, concomitant Piezol and Rbl deletion in myeloid cells using I z2M( r ; Piezo l1111 Jib /// // ice abrogated the tumor-protection observed with Piezol deletion alone (Figure 61, J).
[0079] We investigated if Piezol signaling expands MDSC by suppressing Rbl via epigenetic silencing. We observed reduced HDAC2 expression in I z2M( rc; Piezo lll /l myeloid cells (Figure 6K). We performed single cell sequencing of the bone marrow of I z2M( rc; Piezo l1111 and littermate control mice to investigate whether Piezol promotes MDSC expansion via the HDAC2-Rbl axis (Figure 6L). We found diminished Hdac2 expression but increased Rbl expression in Piezol granulocyte-monocyte progenitors (GMP) and macrophage and DC progenitors (MDP), each of which gives rise to MDSC (Figure 6M). Further, ingenuity analysis indicated that multiple pathways that drive MDSC expansion, including eåF2 signaling and Sirtuin signaling, were among the most
downregulated pathways in /kt'zo /-deficient GMP and MDP (Figure 6N, O). Using ChlP- sequencing, we confirmed enhanced histone H4 acetylation of the Rbl promoter in
Lyz2MCre Piezol^l1 bone marrow cells (Figures 6P, 13B, C). Similarly, HDAC2 inhibition eliminated the protection against polymicrobial sepsis and the associated reduced MDSC expansion in Lyz2MCre;Piezo /Sl hosts (Figure 6Q-S). In aggregate, these data indicate that deletion of Piezol in myeloid cells is protective against neoplastic and infectious disease in an Rbl -dependent manner.
[0080] Discussion
[0081] Piezol is a non-selective cation channel that serves in mechanosensory transduction. However, Piezol has not been intensively studied in inflammatory disease or in cancer. Our results provide direct demonstration that Piezol is a vital regulator of innate and adaptive immune responses with implications for the balance of tumor immunity and clearance of infectious viral and bacterial disease. Our data also indicate a potentially important role for Piezol in modulating autoimmunity. Moreover, we demonstrate that both myeloid and lymphoid cells sense mechanical forces via Piezol as leukocytes deleted of Piezol were unable to transduce mechanosensory signals. Thus, Piezol links physical forces to immune regulation.
[0082] We found that ablation of Piezol signaling catalyzes Akt-phosphorylation and metabolic reprogramming in T cells, thereby increasing their effector function including potentiating IFNy expression and upregulating Myc. We further show that overexpression of Myc in Piezol_/_ T cells is dependent on the upregulation of Akt-mTOR signaling. Myc
signaling promotes higher metabolic activity, including increased aerobic glycolysis and oxidative phosphorylation. Accordingly, Piezol ^ T cells exhibited increased OCR, ECAR, and ATP production rates consistent with higher metabolic activity. Further, mitochondria were more numerous and exhibited a less spherical morphology in Piezol ^ T cells., each of which are linked to generation of long-lasting metabolic reserve and tumor clearance.
[0083] Besides delimiting T cell immunogenicity, we demonstrate that targeting
Piezol in myeloid cells is protective against cancer and polymicrobial sepsis, and is associated with a reduced infiltrate of immature myeloid cells. We demonstrate that Piezol promotes MDSC expansion by regulating Rbl expression via epigenetic silencing. As such, inhibition of HDAC2 abrogated protection against sepsis and muted MDSC expansion in mice with targeted Piezol deletion in myeloid cells. In aggregate, we show that Piezol serves as an ion channel checkpoint that can markedly suppress immunological responses via both silencing of T cell effector function and enhancing myeloid cell tolerance. Moreover, inhibition of Piezol can be used for cancer immunotherapy and treatment of viral and bacterial infections.
[0084] Methods
[0085] Animals and In Vivo Models
[0086] C57BL/6, BALB/c, LckCre (proximal promoter), Lyz2MCre , VavCre, Piezo lM1,
Piezolpl tdT, Rb 7// //, and OT-II mice were purchased from Jackson Labs (Bar Harbor, ME) and bred in-house. Age-matched 8 to 10-week-old mice were used in experiments. Both male and female mice were used, but animals were gender-matched within each experiment. For orthotopic pancreatic tumor challenge, mice were administered intra-pancreatic injections of FC1242 tumor cells (lxlO5) derived from KPC mice. Cells were suspended in PBS with 50% Matrigel (BD Biosciences, Franklin Lakes, NJ) before administration. In select experiments, sub-lethally irradiated (600 cGy) mice were adoptively transferred intravenously with FACS- purified CD3+ T cells (3xl04) 3 days after orthotopic tumor injections. In other experiments, mice were serially treated with GsMTx4-D (0.8 mg/kg; Alomone Labs, Jerusalem, Israel) or Yodal (2.6 mg/kg; Tocris, Bristol, UK). In vivo doses of GsMTx4-D and Yodal were based on previous reports and pharmacokinetic studies (Wang et ak, JMol Cell Cardiol 98, 83-94 (2016); Romac et ak, Nat Commun 9, 1715 (2018). In select experiments, mice were treated daily with the HDAC-inhibitor LBH589 (20 mg/kg; Selleckchem, Houston, TX). For LCMV experiments, mice were infected via the retro-orbital sinus with LCMV-C113 (2xl06 PFU). LCMV-C113 was propagated in baby hamster kidney cells and titrated using Vero African green monkey kidney cells. Mice were sacrificed on either day 8 or 21 after infection. CLP
experiments were performed. Briefly, mice underwent laparotomy and the cecum was exteriorized and ligated at -50% distal to the ileocecal valve using absorbable 4-0 suture. The cecum was then perforated using a 23 G needle and returned to the peritoneal cavity, after which the peritoneum was closed. Temperature was serially monitored using the
Microtherma 2 rectal probe (Thermo Works, American Fork, UT). Clinical sepsis score was assessed as follows. Points were assigned in the following categories: Appearance: normal (0), lack of grooming (1), piloerection (2), hunched up (3), above and eyes half closed (4); Behavior - unprovoked: normal (0), minor changes (1), less mobile and isolated (2), restless or very still (3); Behavior - provoked: responsive and alert (0), unresponsive and not alert (3); Clinical signs: normal respiratory rate (0), slight changes (1), decreased rate with abdominal breathing (2), marked abdominal breathing and cyanosis (3); Hydration status: normal (0), dehydrated (5). Serum cytokine levels were analyzed using the LegendPLEX arrays, as per the manufacturer’s protocol (BioLegend, San Diego, CA). All procedures performed on these animals were in accordance with regulations and established guidelines and were reviewed and approved by NYU School of Medicine Institutional Animal Care and Use Committee or through an ethical review process.
[0087] Cellular Preparation and Flow Cytometry
[0088] For tumor studies, single-cell suspensions of PDA tumors were prepared for flow cytometry as follows. Pancreata were placed in cold 2% FACS (PBS with 2% FBS) with Collagenase IV (1 mg/mL; Worthington Biochemical, Lakewood, NJ), Trypsin inhibitor (1 mg/mL; EMD Millipore, Billerica, MA) and DNase I (2 U/mL; Promega, Madison, WI), and minced with scissors to sub-millimeter pieces. Tissues were then incubated at 37°C for 20 minutes with gentle shaking every 5 minutes. Specimens were passed through a 70 pm mesh and centrifuged at 350 g for 5 minutes. Cell pellets were re-suspended and cell labeling was performed after blocking FcyRIII/II with an anti-CD 16/CD32 mAh (eBioscience, San Diego, CA) by incubating lxlO6 cells with 1 pg of fluorescently conjugated mAbs directed against mouse CD3 (17A2), CD4 (GK1.5), CD8 (53.-6 7), CD44 (IM7), CD69 (H1.2F3), LFA-l (H155-78), PD1 (29F.1A12), LAG-3 (C9B7W), BCL6 (7B1), CXCR5 (L138D7), Gr-l (RB6-8C5), CDl lb (Ml/70), TNFa (MP6-XT22), åFNy (XMG1.2), GAT A3 (16E10A23), FoxP3 (MF-14), T-bet (AB10), IL6 (MP5-20F3), IL-2 (JES65-H4), IL10 (JES5-16E3), F4/80 (BM8), I-A/I-E (M5/114.15.2), CD117 (2B8), CD115 (AFS98), CD135 (A2F10), Ly6G (1A8), Ly6C (HK1.4), CDl lc (N418), CD19 (1D3/CD19), NK1.1 (PK136), B220 (RA3- 6B2), Terl 19 (TER- 119; all Biolegend), Granzyme B (NGZB), Roryt (AFKJS-9), EOMES
(DANl lmag, all eBioscience), pS6S235/236 (D57.2.2E; Cell Signaling Technology, Danvers, MA), and pAktT308 (545007; R&D, Minneapolis, MN). Human flow cytometry antibodies included CD45 (2D1), CD3 (UCHT1), CD8 (HIT8a), CD4 (A161A1), CD44 (IM7), IFNy (4S.B3), CDl lb (CBRM1/5), CD14 (M5E2), CD15 (HI98), HLA-DR (L243; all BioLegend). Dead cells were excluded from analysis using Zombie Yellow (BioLegend). Intracellular staining for cytokines, transcription factors, and Granzyme B was performed using the Fixation/Permeabilization Solution Kit (eBioscience). For phosphoflow staining, cells were fixed with 1.85% formaldehyde in PBS for 7 min at 37°C, followed by incubation with 90% methanol on ice for 30 minutes. After washing, the cells were stained with phosphoflow antibodies. For Cl 13 studies, cells were cultured for lh with GP33-4i-loaded tetramer (2 pg/mL; NIH Tetramer Core Facility, Atlanta, GA). Flow cytometry was performed on the Attune NxT Acoustic Focusing Cytometer (Thermo Fisher, Waltham, MA). FACS-sorting was performed on the SY3200 (Sony, Tokyo, Japan). Data were analyzed using FlowJo n.10.1 (Treestar, Ashland, OR). Bone marrow derived cultures were harvested by aspiration of mouse femurs, stimulated with GM-CSF (20 ng/ml; BioLegend), and harvested on day 5. Splenocytes were prepared by manual disruption. PBMC were prepared for flow cytometry using a Ficoll-Paque PLUS gradient (GE Healthcare, Uppsala, Sweden).
[0089] Cell size and volume determination
[0090] For cell size determination in adherent myeloid cells, CD1 lb+ cells were isolated and cells were plated at lxlO6 cells/ml in Opti-MEM media with or without 40ng/ml phorbol l2-myristate l3-acetate (PMA) (Sigma-Aldrich). Following overnight incubation, cells were fixed in 4% paraformaldehyde and permeabilized with 0.25% Triton-X 100, blocked and then stained with Phalloidin-488 (Invitrogen, A12379) and DAPI. Images were acquired at 20x on the Celllnsight CX7 (ThermoFisher Scientific). The Cell Spreading algorithm was used to quantify cell perimeter and area. For non-adherent T cells, cell size and volume was measured using the Z2 Beckman Coulter Cell and Particle Counter (Brea, CA).
[0091] Patient-derived Organotypic Tumor Spheroids (PDOTS)
[0092] PDOTS were prepared as follows. Human surgically-resected tumor specimens were received fresh in DMEM on ice and minced to sub-millimeter pieces in 10 cm petri dishes. Minced tumors were resuspended in DMEM +10% FBS with 100 U/mL collagenase type IV to obtain spheroids. Partially digested samples were pelleted, re suspended in fresh DMEM +10% FBS, then strained over both 100 pm and 40 pm filters to generate Sl (>100 pm), S2 (40-100 pm), and S3 (<40 pm) spheroid fractions, which were
subsequently maintained in ultra-low-attachment tissue culture plates. An aliquot of the S2 fraction was pelleted and re-suspended in type I rat tail collagen and the spheroid-collagen mixture was then injected into the center gel region of the DAX-l 3D microfluidic cell culture chip (Aim Biotech, Singapore). After 30 minutes at 37°C, collagen hydrogels containing PDOTS were hydrated with media with indicated treatments. Spheroids were harvested on day 3 for analysis by flow cytometry. Images were captured on a Nikon Eclipse 80i fluorescence microscope equipped with Z-stack (Prior) an dCoolSNAP CCD camera (Roper Scientific, Trenton, NJ). Image capture and analyses were performed using NIS- Elements AR software package (Nikon, Tokyo, Japan). Human biological samples were sourced ethically, and their research use was in accord with the terms of the informed consents under an IRB-approved protocol.
[0093] In Vitro T cell Stimulation and Tumor Proliferation Assays
[0094] For antibody-based T cell proliferation assays, splenic CD3+ T cells were activated using CD3/CD28 co-ligation in 96-well plates. Alternatively, T cells were activated using PMA (200 pg/mL; Sigma-Aldrich) + Ionomycin (10 mM; Sigma-Aldrich). For antigen- restricted T cell stimulation assays, splenocytes from OT-II mice were cultured with Ova323- 339 peptide (10 pg/mL; Invitrogen, Carlsbad, CA). T cell activation was determined at 72 hours by flow cytometry. For mixed lymphocyte reactions, DC from BALB/c mice were co cultured with allogeneic T cells from C57BL/6 mice at a 1 :5 ratio for 5 days. For Thl- polarizing conditions, complete RPMI medium was supplemented with plate-bound anti-CD3 (10 pg/mL), soluble anti-CD28 (2 pg/mL), IL-4 (20 ng/mL), anti-IFNy (10 pg/mL) and IL-2 (50 U/niL; all BioLegend). For Treg polarizing conditions, media was supplemented with plate-bound anti-CD3 (3 pg/mL), soluble anti-CD28 (3 pg/mL), IL-2 (5 ng/mL; BioLegend) and TGFp i (5 ng/mL; BioLegend). Cells were harvested on day 5 for analysis by flow cytometry. For analysis of T cell effector function, sorted T cells were stimulated with anti- CD3 and anti-CD28 in culture medium containing IL-2 (6000IU; BioLegend) for 4 days and were then stimulated on day 4 in the indicated conditions for 5 hours with anti-CD3 and anti- CD28 without IL-2 in the presence of Brefeldin A (5 pg/mL) and monensin (5 pg/mL; both BioLegend). In select experiments, T cells were treated with the PI3K inhibitor BKM-120 (2 pM; Selleckchem). T cells from PBMCs were enriched with a manual MACS system using anti-human-CD3 microbeads (Miltenyi Biotech, Bergisch Gladbach, Germany) per the manufacturer's protocol after Ficoll isolation (GE Healthcare, Princeton, NJ). CD3+ human T cells were plated with 2.5 pg/mL anti-CD3 (HIT3a, BioLegend) and various concentrations
of Yodal (100 nM, I mM, 3.16 mM, 10 mM) and GsMTx4 (1 nM, 100 nM, 1 mM, 10 mM) for 48 hours in a 96-well flat-bottom plate. Supernatants were tested after 24 hours for IFNy production using the MILLIPLEX MAP Human Cytokine Panel I (EMD Millipore). For tumor cell proliferation assays, KPC-derived tumor cells (2xl03) were seeded in 96-well round- bottom plates and incubated with 100 pL of culture medium. Cells were selectively treated with GsMTx4 (2.5 mM), Yodal (10 mM), or vehicle. Tumor cell proliferation was measured using the XTT assay kit according to the manufacturer’s protocol (Sigma- Aldrich).
[0095] Mechanical stimulation of non-adherent and adherent cells
[0096] Mechanical stimulation of T cells was performed as follows. T cells (2xl06) cells were attached in l2-well tissue culture plates coated in poly-l-lysine and stimulated by CD3/CD28 co-ligation using Abs placed in the media. A 2mm thick agarose gel was placed on the fluid phase to allow a deformable cushion. A l .8mm thick SYLGARD 184 PDMS pad (Newark/Elementl4, Leeds, England) was placed on top of the gel to allow for even weight distribution. 5/16 stainless steel weights (2-l5g; Midwest Fastener Corporation, Kalamazoo, MI) were then applied to this setup to apply calibrated mechanical forces to cells.
Compressive stress was calculated as Force (N)/Area (m2). For adherent myeloid cells, cells were seeded at 1.5 c 105 cell/well on top of 96-well glass bottom Easy Coat plates of varied substrate stiffness (50 kPa and 0.2 kPa) populated with quinone groups, which allow strong nucleophile bonds with cellular surface proteins (Matrigen, Brea, CA). Control standard endotoxin (CSE, 200 ng/mL; Cape Cod Incorporated, East Falmouth, MA) was added to select wells at equal concentrations. After 18 hours, secretions of TNFa in the supernatant was measured by Quantikine ELISA according to the manufacturer’s protocol (R&D).
[0097] Intracellular calcium measurements
[0098] T cells were isolated from spleens of LckCre;Piezolfl/fl WT mice as above.
Prior to analysis, cells were rested in IL-2-free complete RPMI 1640 for 12 h. Cells were loaded with 1 mM Fura 2-AM (Invitrogen) for 30 min at 37°C in pre-warmed 1 : 1 mixtures of FfBSS with Ca2+ and Mg2+ and RPMI 1640. Fura-labeled cells were then attached for 10 min to 96-well imaging plates (Fisher) that were coated with 0.1% poly-L-lysine. Calcium signals were recorded in 2 mM Ca2+ Ringer solutions. For TCR crosslinking, T cells were incubated with 1 pg/mL biotinylated anti-CD3e (145-2C11, BD Biosciences) and stimulated by addition of 1 pg/mL Streptavidin (Invitrogen). Intracellular calcium measurement was performed using a FlexStation 3 multi-mode microplate reader (Molecular Devices, San Jose, CA).
Fura-2 fluorescence was measured at 510 nm after excitation at 340 nm and 380 nm and plotted as the F340/F380 emission ratio.
[0099] OCR, ECAR, and ATP production rates
[0100] OCR and ECAR were measured following aCD3/aCD28 stimulation of T cells using the XFe96 extracellular analyzer (Seahorse Bioscience, North Billerica, MA). OCR and ECAR were measured in DMEM containing 25 mM glucose, 4 mM L-glutamine, no pyruvate, no bicarbonate and no phenol red. Mitostress test was performed using 1 mM oligomycin, 0.25 pM fluoro-carbonyl cyanide phenylhydrazone (FCCP), or 200 nM rotenone with 2 pM antimycin A (all Sigma).
[0101] Western Blotting
[0102] For protein extraction, tissues were homogenized in ice-cold RIPA buffer.
Total protein was quantified using the DC Protein Assay according to the manufacturer’s instructions (BioRad, Hercules, CA). Western blotting was performed as follows. 10% Bis- Tris polyacrylamide gels (NuPage, Invitrogen) were equiloaded with 10-30 pg of protein, electrophoresed at 200V, and electrotransferred to PVDF membranes. After blocking with 5% BSA, membranes were probed with primary antibodies to HDAC2, NFAT1, Lamin A/C and b-Actin (all Cell Signaling Technology). Cytosolic and nuclear fractions were collected using the NE-PER nuclear and cytoplasmic extraction kit (Thermo Scientific). Blots were developed by ECL (Thermo Fisher).
[0103] qPCR
[0104] For qPCR, total RNA was extracted using an RNeasy mini kit (Qiagen,
Valencia, CA) and cDNA was synthesized using the High-Capacity cDNA Reverse
Transcription Kit (Applied Biosystems, Foster City, CA). Real-time qPCR was performed in duplicate for each sample using the BioRad Real-Time PCR System (BioRad). Each reaction mixture contained 10 pl of SYBR Green Master Mix (Applied Biosystems), 0.5 pl each of forward and reverse primers (Invitrogen) and 3 pl of cDNA (corresponding to 50 ng of RNA). The qPCR conditions were: 50°C for 2 minutes, 95°C for 10 minutes, followed by 40 cycles at 95°C for 15 seconds, and 60°C for 1 minute. Amplification of specific transcripts was confirmed by melting curve profiles generated at the end of the PCR program.
Expression levels of target genes were normalized to the expression of GAPDH (internal control) and calculated based on the comparative cycle threshold (CT) method (2 DDa). The Rbl primer sequences used in the study were F- CAGGGCTGTGTTGACATCGGAGTA (SEQ ID NO:2), R- TCCACGGGAAGGACAAATCTGTTC (SEQ ID NO:3). The c-Myc sequences were F-TTGAAGGCTGGATTTCCTTTGGGC (SEQ ID NO:4), R-
TCGTCGCAGATGAAATAGGGCTGT (SEQ ID NO:5). Piezol primer sequences were F- AGCGAGGCCCCTCTGCTTGA (SEQ ID NO: 6), R-TGCCGGCGGTAGTGCTCTT (SEQ ID NO:7).
[0105] Immunohistochemistry and Microscopy
[0106] For histological analysis, specimens were fixed with 10% buffered formalin, dehydrated in ethanol, embedded with paraffin, and stained with H&E. For immufluorescent staining of enriched mouse leukocyte populations, cells were fixed in 4% PFA on ice. Cells were then probed with antibodies directed against CD45 (30-F11, BD Biosciences), CD3 (17A2), CDl lb (Ml/70), Piezol (Polyclonal; Novus Biologicals, Littleton, CO) and DAPI (Vector Labs, Burlingame, CA). Images were acquired using a Zeiss LSM700 confocal microscope with ZEN 2010 software (Carl Zeiss, Thornwood, NY) and analyzed using ImageJ.
[0107] Conventional RNA-Seq and Analysis
[0108] iri\¾-Seq libraries were prepared using the Illumina TruSeq Stranded Total
RNA library prep, after ribodepletion with Ribozero Gold kit (cat# 20020597, Illumina, San Diego, CA) starting from 500 ng of DNase I treated total RNA, following the manufacturer’s protocol, with the exception that 9 cycles of PCR were performed to amplify the libraries. The amplified libraries were purified using AMPure beads, quantified by Qubit and qPCR, and visualized in an Agilent Bioanalyzer (Agilent, Santa Clara, CA). The libraries were pooled equimolarly and sequenced on one lane of an Illumina HiSeq 2500 flow cell, v4 chemistry as paired end 50. The raw fastq reads were aligned to mm 10 mouse reference genome using STAR aligner. Fastq Screen was used to check for any contaminations in the samples and Picard RnaSeqMetrics was used to obtain the metrics of all aligned RNA-Seq reads . featureCounts was used to quantify the gene expression levels. The raw gene counts data were used for further differential expression analysis. To identify the differentially expressed genes, DESeq2 R package was used. The resulting genes with adjusted p<0.05 were considered significant. Heatmaps were generated using pheatmap R package. To identify the signaling pathways in which the genes are enriched, Ingenuity Pathway Analysis (IP A) was carried out for genes that were considered significant. The canonical pathways from IPA analysis were represented as a barplot and the regulatory network of genes associated with phagocytosis and cell death were represented using Cytoscape. For Gene Set Enrichment Analysis (GSEA), upregulated and downregulated sets of genes were ranked based on their average and normalized log2 fold change between treatment and control group and each gene set was assessed for enrichment in the KEGG 2016 geneset library
(amp.pharm.mssm.edu/Enrichr/#stats) using python package gseapy
(pypi.org/project/gseapy/) for analyses. Gene ontology (GO) enrichment analyses were performed using the Cytoscape module ClueGO. The one-sided Fisher’s Exact Test was used for enrichment and corrected for multiple tests using the Benjamini-Hochberg method (math.tau.ac.il/~ybenja/MyPapers/benjamini_hochbergl995.pdf). Terms found in the GO interval of 3 to 8, with at least three genes from the initial list representing a minimum of 5% were selected.
[0109] Single Cell RNAseq
[0110] After confirming the integrity of the cDNA, quality of the libraries, number of cells sequenced and mean number of reads per cell, as a quality control, we used the cellranger package to map the reads and generate gene-cell matrices. A quality control was then performed on the cells to calculate the number of genes, UMIs and the proportion of mitochondrial genes for each cell using scSeqR R package (v0.99.0)
(https://github.com/rezakj/scSeqR) and the cells with low number of covered genes (gene- count < 500) and high mitochondrial counts (mt-genes > 0.1) were filtered out. Then the matrix was normalized based on ranked geometric library size factor (ranked glsf) using scSeqR. Geometric library size factor normalization is a common normalization method used by popular tools such as DEseq2, however, here we use only the top ranked genes (top 500 genes sorted by base mean) to correct for dropout size factors. General gene statistics were then performed to calculate gene dispersion, base mean and cell coverage to use to build a gene model for performing Principal Component Analysis (PCA). Genes with high coverage (top 500 ranked by base mean) and high dispersion (dispersion > 1.5) were chosen for PCA. Top highly expressed genes and highly dispersed/variable genes are a good list of gene to define the identity of the cells. Once PCA analysis was completed on our model, gene clustering was performed on principal component with high standard deviations (top 10 PCs) (scSeqR options; clust.method = "kmeans", dist.method = "euclidean", index. method = "silhouette") and T-distributed Stochastic Neighbor Embedding (t-SNE) was generated. Marker genes for each cluster were then determined based on fold change and adjusted p- value (t-test) and average gene expression for each cluster was calculated using scSeqR. Marker genes were visualized on heatmaps, bar plots and box plots for each cluster and were used to determine the cell types using ImmGen database (https://www.immgen.org/). Cell type identities were of known population markers were assigned as follows: GMP
- IJanel"l rss34l"Mcpt8l"Ctsgl"l>rtn3l" Macrophages
- Cldnl3hlGlypahlSlc4alhlTspo2hlTrimlOhl ; Monocytes - DstnhiPrtn3hiFcnbhJtb4rlhAldh2hl,
Neutrophils - Cd77hiMgstlh,Cybbh,TkyhJfitm6hl ; MDP -
Igslf) 1" EmbhlAp3s I1" NcllnMpn IhlCcr2hl CDP - SlOOae^Lgalsi^Fcerl^'Tyrobp^CripE1 ChIP-seq
[0111] All of the reads from the ChIP Sequencing for each sample were mapped to the mouse reference genome (mmlO/GRCm38.74) using Bowtie2 (v2.2.4) and duplicate reads were removed using Picard tools (v.1.126) (broadinstitute.github.io/picard/). Low quality mapped reads (MQ<20) were removed from the analysis. The read per million (RPM) normalized BigWig files were generated using BEDTools (v.2.17.0) and the
bedGraphToBigWig tool (v.4). Peak calling was performed using MACS (vl.4.2) and peak count tables were created using BEDTools. Differential Binding (DB) analysis was performed using DESeq2. ChIPseeker (vl.8.0) R package and HOMER (v4.8) were used for peak annotations and motif discovery was performed using HOMER ngs.plot (v2.47) and ChIPseeker was used for TSS binding site visualizations and quality controls. KEGG pathway analysis and Gene Ontology (GO) analysis was performed using the clusterProfiler R package (v3.0.0). To compare the level of similarity among the samples and their replicates, we used two methods: classical multidimensional scaling or principal-component analysis and Euclidean distance-based sample clustering. The downstream statistical analyses and generating plots were performed in R environment (v3. l.l) (r-project.org/).
[0112] Electron Microscopy
[0113] Cultured T cells were fixed in 0.1M sodium cacodylate buffer (pH 7.2) containing 2.5% glutaraldehyde and 2% paraformaldehyde. For transmission electron microscopy, the cells were post-fixed with 1% osmium tetroxide, and processed in a standard manner and embedded in EMbed 812 (Electron Microscopy Sciences, Hatfield, PA). Thin sections were cut, stained with uranyl acetate and lead citrate and imaged using a Thermo Fisher Talosl20C electron microscope and photographed with a Gatan OneView camera. For three-dimensional electron microscopy, fixed cells were continuing with OTO method to increase cell membrane contrast. Briefly, cells were post-stained with 2% 0s04/l.5% potassium ferrocyanide, 1% thiocarbohydrazide (TCH), 2% aqueous Os04, 1% aqueous uranyl acetate and embedded in Durcupan, to allow polymerization. For Serial Block Face Scanning Electron Microscopy (SBF-SEM), the sample block was mounted on 3 View pin using silver conductive epoxy (Ted Pella, Inc, Redding, CA) to electrically ground the tissue block. The entire surface of the specimen was then sputter coated with a thin layer of gold/palladium imaged using Gatan OnPoint BSE detector in a Zeiss GEMINI 300 VP
FESEM equipped with a Gatan 3 View automatic microtome. The system was set to cut 50 nm slices, and images were recorded after each round of section from the block face using the
SEM beam at 1 keV with a dwell time of 1.0 ps/pixel. The image size is 9500 x 9500 pixels, and the pixel size is 2 nm. Data acquisition occurred in an automated way using the Auto
Slice and View G3 software. A stack of 149 slices was aligned, and assembled using ImageJ.
Segmentation and video were generated by Thermo Fisher Scientific Amira 6.4 software. EM images were used to calculate mitochondrial volume (V), area (A) and sphericity (i p), defined
[0114] Bacterial Culture
[0115] To evaluate anaerobic bacteria in whole blood and peritoneal fluid, six-fold serial dilutions of the samples were performed in sterile PBS. Each dilution was plated onto blood agar plates (BD Difco) and incubated anaerobically at 37°C for 60-72 hours. The viable counts of bacteria were calculated and interpreted as colony forming units (CFU) per mL.
[0116] shRNA knockdown
[0117] Non-silencing (Cat-No. RHS4348) and Piezol (V3SM7598-00EG234839) shRNA were purchased as lentiviral particles (GE Healthcare Dharmacon, Lafayette, CO). Target cells were seeded one day prior to transduction at a density of lOxlO3 cells per cm2. For transduction, growth medium was replaced with shRNA lentivirus to 2 mL volume in DMEM containing 10% FBS and 8 pg/mL polybrene (EMD Millipore) and 2 pg/mL puromycin. After 48 hours, virus was replaced with standard growth medium. The efficacy of Piezol knockdown was measured by RT-qPCR.
[0118] Electrophysiology
[0119] For patch clamping, T cells were patched after magnetic isolation from murine spleens using a Pan T Cell Isolation Kit (Miltenyi Biotec, Auburn, CA) and 48 hours of CD3/CD28 co-ligation in 96-well plates supplemented with 60 IU/mL LEAF-Purified IL-2 (BioLegend, San Diego, CA). Cells were plated on l5-mm round glass 0.01% poly-L-lysine- coated coverslips for 30 minutes, then washed thoroughly with extracellular solution immediately prior to patching. Patch clamp experiments were performed in whole-cell configuration using an Axon MultiClamp 700A amplifier and Axon Digidata 1550A digitizer (Molecular Devices) at room temperature. Currents were low-pass filtered with 8-pole Bessel filter (-3dB @ 1 Hz) and digitized at 3 kHz (DigiData 1550A, Molecular Devices) using pClamp vl0.5 software (Molecular Devices). Patch electrodes were manufactured (Zeitz
puller, Germany) using borosilicate glass (1.5 mm OD; World Precision Instruments,
Sarasota, FL) and had tip resistances of 2.5-3.5 MW when filled with (in mmol/L): 133 CsCl, 10 HEPES, 5 EGTA, 1 CaCk, 1 MgCk, 4 MgATP, and 0.4 NaiGTP (pH 7.3 with CsOH osmolarity 280±10 mOsm). The pipette solution was supplemented with 30 mM Yodal in order to maximize pressure sensitivity during patch clamp recordings. The extracellular solution consisted of (in mM) 127 NaCl, 3 KC1, 1 MgCk, 10 HEPES, 2.5 CaCk, and 10 glucose (pH 7.3 with NaOH, osmolarity 300±10 mOsm). Mechanically-activated whole-cell currents were elicited as previously described using a Clampex-controlled high-speed pressure clamp system (HSPC-2, ALA Scientific Instruments). Data were not corrected for the liquid junction potential, which was calculated to be 5.0 mV. The whole-cell capacitance and series resistance were compensated to levels greater than 80%. Currents were expressed as pA/pF after correcting for cell size by dividing membrane current by the cell capacitance. Leak subtraction was performed post-acquisition. Representative patch clamp recordings were compiled in Origin 8.1 (OriginLab, Northampton, MA).
[0120] Statistical Analysis
[0121] Data are presented as mean +/- standard error. Statistical significance was determined by the Student’s t test and the log-rank test using GraphPad Prism 7 (GraphPad Software, La Jolla, CA). P-values <0.05 were considered significant. Significance for GSEA analysis and differential gene expression based on single cell RNAseq was determined using the Wilcoxon rank sum test with Bonferroni multiple-comparison correction. Comparisons for more than two groups were calculated using two-way ANOVA followed by Bonferroni multiple-comparison correction. Data on gene expression in human tissues was derived from the TCGA data base (https://portal.gdc.cancer.gov/). Survival was measured according to the Kaplan-Meier method and analyzed by log rank. The publicly available dataset GeneAtlas EG133A, gcrma on the BioGPS-site was used to obtain cell-type specific gene expression patterns.
[0122] Data Availability
[0123] The single cell RNAseq data maps are deposited in the Gene Expression
Omnibus database (github.com/rezakj/iCellR). The RNA-Seq and ChIP-seq data maps will be deposited in the Gene Expression Omnibus database upon publication. All other data are available from the author upon request.
[0124] While the present invention has been described through illustrative embodiments, routine modification will be apparent to those skilled in the art and such modifications are intended to be within the scope of this disclosure.
Claims
1. A method for enhancing immune system function in an individual afflicted with a condition where the immune system is compromised comprising administering to an individual in need of treatment a composition comprising an agent which inhibits Piezol channel activity, wherein inhibiting the activity of Piezol channel augments the immune system function and results in treatment of said condition.
2. The method of claim 1, wherein the individual is afflicted with cancer.
3. The method of claim 2, wherein the cancer is pancreatic duct adenocarcinoma (PDA), colorectal cancer (CRC), melanoma, breast cancer, lung cancer (for example, non-small cell lung cancer (NSCLC), and small cell lung cancer (SCLC), upper and lower gastrointestinal malignancy, esophageal cancer, gastric cancer, hepatobiliary cancer, squamous cell head and neck cancer, genitourinary cancer, sarcoma, or leukemia.
4. The method of claim 1, wherein the individual is afflicted with an infection.
5. The method of claim 4, wherein the infection is caused by a virus or bacteria.
6. The method of claim 1, wherein the individual is afflicted with sepsis.
7. The method of claim 1, wherein the agent that inhibits Piezol channel activity is a blocker of Piezol channel.
8. The method of claim 2, wherein the agent is GsMTx4.
9. The method of claim 1, wherein the agent that inhibits Piezol activity is an RNAi molecule.
10. The method of claim 1, wherein the agent is an expression vector that encodes a RNA targeting Piezol gene and a polynucleotide sequence encoding a CRISPR-associated nuclease, wherein administration of the agent results in deletion or mutation of the Piezol gene whereby activity of Piezol channel is reduced.
11. A method of suppressing immune function in an individual in whom suppression of the immune system function is desired comprising administering to the individual a composition comprising an activator of Piezo 1 gene or function, wherein administration of the activator of Piezol gene or function results in suppression of the immune system in the individual.
12. The method of claim 11, wherein the activator of Piezol gene or function is yodal.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201862713344P | 2018-08-01 | 2018-08-01 | |
| US62/713,344 | 2018-08-01 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2020028686A1 true WO2020028686A1 (en) | 2020-02-06 |
Family
ID=69232065
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2019/044703 Ceased WO2020028686A1 (en) | 2018-08-01 | 2019-08-01 | Targeting piezo1 for treatment of cancer and infectious diseases |
Country Status (1)
| Country | Link |
|---|---|
| WO (1) | WO2020028686A1 (en) |
Cited By (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111751532A (en) * | 2020-07-20 | 2020-10-09 | 河南省医药科学研究院 | Application of PIEZO1 protein as a marker of esophageal cancer |
| CN115120723A (en) * | 2022-05-09 | 2022-09-30 | 浙江大学 | Application of macrophage Piezo1 knockout in promotion of angiogenesis of ischemic tissues |
| WO2023279067A1 (en) * | 2021-07-01 | 2023-01-05 | The Regents Of The University Of California | Targeting piezo1 to treat inherited and age-related macular degenerations |
| WO2023091901A1 (en) * | 2021-11-16 | 2023-05-25 | Duke University | Compositions and methods for the modulation of piezo1 and trpv4 |
| CN117653733A (en) * | 2023-12-08 | 2024-03-08 | 中国医学科学院基础医学研究所 | Application of a new immune checkpoint PIEZO1 pathway in tumor T cell therapy |
| WO2024059183A1 (en) * | 2022-09-14 | 2024-03-21 | President And Fellows Of Harvard College | Methods and compositions for modulation of piezo1 in the treatment of cancer |
| CN118903424A (en) * | 2024-07-16 | 2024-11-08 | 华中科技大学同济医学院附属协和医院 | Application of targeted inhibitor in preparation of drug for treating skin melanoma |
| WO2025118269A1 (en) * | 2023-12-08 | 2025-06-12 | 中国医学科学院基础医学研究所 | Use of new immune checkpoint piezo1 pathway in tumor t-cell therapy |
| WO2025235983A1 (en) * | 2024-05-10 | 2025-11-13 | Nova Southeastern University | Activation of piezo proteins for therapeutic application in treatment and cure of disease |
| CN121513203A (en) * | 2025-12-25 | 2026-02-13 | 北京市心肺血管疾病研究所 | Application of Piezo1-specific inhibitors in the preparation of drugs for the prevention and/or treatment of intestinal barrier damage |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20100087415A1 (en) * | 2008-10-03 | 2010-04-08 | Calcimedica, Inc. | Inhibitors of store operated calcium release |
| US20130156762A1 (en) * | 2010-08-23 | 2013-06-20 | The Scripps Research Institute | Mechanically-Activated Cation Channels |
| US20130158101A1 (en) * | 2009-10-08 | 2013-06-20 | Immune Disease Institute, Inc. | Regulators of nfat and/or store-operated calcium entry |
| US20160281072A1 (en) * | 2012-12-12 | 2016-09-29 | The Broad Institute Inc. | Crispr-cas systems and methods for altering expression of gene products |
-
2019
- 2019-08-01 WO PCT/US2019/044703 patent/WO2020028686A1/en not_active Ceased
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20100087415A1 (en) * | 2008-10-03 | 2010-04-08 | Calcimedica, Inc. | Inhibitors of store operated calcium release |
| US20130158101A1 (en) * | 2009-10-08 | 2013-06-20 | Immune Disease Institute, Inc. | Regulators of nfat and/or store-operated calcium entry |
| US20130156762A1 (en) * | 2010-08-23 | 2013-06-20 | The Scripps Research Institute | Mechanically-Activated Cation Channels |
| US20160281072A1 (en) * | 2012-12-12 | 2016-09-29 | The Broad Institute Inc. | Crispr-cas systems and methods for altering expression of gene products |
Non-Patent Citations (3)
| Title |
|---|
| CINAR ET AL.: "Piezol regulates mechanotransductive release of ATP from human RBCs", PNAS, vol. 112, no. 38, 22 September 2015 (2015-09-22), pages 11783 - 11788, XP055684295, DOI: 10.1073/pnas.1507309112 * |
| MACIAN: "NFAT PROTEINS: KEY REGULATORS OF T- CELL DEVELOPMENT AND FUNCTION", NATURE REVIEW IMMUNOLOGY, vol. 5, June 2005 (2005-06-01), pages 472 - 484, XP055684288, DOI: 10.1038/nri1632 * |
| ROMAC ET AL.: "Piezol is a mechanically activated ion channel and mediates pressure induced pancreatitis", NAT COMMUN., vol. 9, no. 1, 30 April 2018 (2018-04-30), pages 1715, XP055684308, DOI: 10.1038/s41467-018-04194-9 * |
Cited By (12)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111751532A (en) * | 2020-07-20 | 2020-10-09 | 河南省医药科学研究院 | Application of PIEZO1 protein as a marker of esophageal cancer |
| CN111751532B (en) * | 2020-07-20 | 2022-07-12 | 河南省医药科学研究院 | Application of PIEZO1 protein as esophageal cancer marker |
| WO2023279067A1 (en) * | 2021-07-01 | 2023-01-05 | The Regents Of The University Of California | Targeting piezo1 to treat inherited and age-related macular degenerations |
| WO2023091901A1 (en) * | 2021-11-16 | 2023-05-25 | Duke University | Compositions and methods for the modulation of piezo1 and trpv4 |
| CN115120723A (en) * | 2022-05-09 | 2022-09-30 | 浙江大学 | Application of macrophage Piezo1 knockout in promotion of angiogenesis of ischemic tissues |
| WO2024059183A1 (en) * | 2022-09-14 | 2024-03-21 | President And Fellows Of Harvard College | Methods and compositions for modulation of piezo1 in the treatment of cancer |
| CN117653733A (en) * | 2023-12-08 | 2024-03-08 | 中国医学科学院基础医学研究所 | Application of a new immune checkpoint PIEZO1 pathway in tumor T cell therapy |
| WO2025118269A1 (en) * | 2023-12-08 | 2025-06-12 | 中国医学科学院基础医学研究所 | Use of new immune checkpoint piezo1 pathway in tumor t-cell therapy |
| CN117653733B (en) * | 2023-12-08 | 2025-08-19 | 中国医学科学院基础医学研究所 | Application of novel immune checkpoint PIEZO1 pathway in tumor T cell treatment |
| WO2025235983A1 (en) * | 2024-05-10 | 2025-11-13 | Nova Southeastern University | Activation of piezo proteins for therapeutic application in treatment and cure of disease |
| CN118903424A (en) * | 2024-07-16 | 2024-11-08 | 华中科技大学同济医学院附属协和医院 | Application of targeted inhibitor in preparation of drug for treating skin melanoma |
| CN121513203A (en) * | 2025-12-25 | 2026-02-13 | 北京市心肺血管疾病研究所 | Application of Piezo1-specific inhibitors in the preparation of drugs for the prevention and/or treatment of intestinal barrier damage |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| WO2020028686A1 (en) | Targeting piezo1 for treatment of cancer and infectious diseases | |
| Marin et al. | Cellular senescence is immunogenic and promotes antitumor immunity | |
| Imperatore et al. | SIRT1 regulates macrophage self‐renewal | |
| Li et al. | A systematic CRISPR screen reveals an IL-20/IL20RA-mediated immune crosstalk to prevent the ovarian cancer metastasis | |
| Silvestri et al. | Persistence of drug-resistant leukemic stem cells and impaired NK cell immunity in CML patients depend on MIR300 antiproliferative and PP2A-activating functions | |
| Chang et al. | Single-cell transcriptomic identified HIF1A as a target for attenuating acute rejection after heart transplantation | |
| AU2017359333A1 (en) | Compositions and methods of modulating anti-tumor immunity | |
| Chen et al. | The RNA-binding protein HuR contributes to neuroinflammation by promoting CC chemokine receptor 6 (CCR6) expression on Th17 cells | |
| CN111166867B (en) | Function and application of PD-1 ubiquitination agonist | |
| US11879137B2 (en) | Treatment of type 1 diabetes and autoimmune diseases or disorders | |
| Augustine et al. | Potentiating effect of reovirus on immune checkpoint inhibition in microsatellite stable colorectal cancer | |
| WO2020041776A1 (en) | Methods and compositons for modulations of immune response | |
| Kim et al. | Disrupting Notch signaling related HES1 in myeloid cells reinvigorates antitumor T cell responses | |
| Terasaki et al. | Mitochondrial transfer from immune to tumor cells enables lymph node metastasis | |
| Li et al. | Transcoelomic spread of cancer cells across the peritoneal cavity occurs in most initially diagnosed ovarian cancer (OC) patients and accounts for most cancer-related death. However, how OC cells interact with peritoneal stromal cells to evade the immune surveillance remains largely unexplored. Here, through an in vivo genome-wide CRISPR/Cas9 screen, we identified IL20RA, which decreased dramatically in OC patients during peritoneal metastasis, as a key factor preventing the transcoelomic metastasis of OC. Reconstitution of IL20RA in highly metastatic OC cells greatly suppresses the transcoelomic metastasis. OC cells, when disseminate into the peritoneal cavity, greatly induce peritoneum mesothelial cells to express IL-20 and IL-24, which in turn activate the IL20RA downstream signaling in OC cells to produce mature IL-18, eventually resulting in the polarization of macrophages into the M1-like subtype to clear the cancer cells. Thus, we show an IL-20/IL20RA-mediated crosstalk between OC and mesothelial cells that supports a metastasis-repressing immune microenvironment. | |
| US11702632B2 (en) | Ex vivo method of generating super regulatory T cells for the prevention of autoimmune disease | |
| EP3962604A1 (en) | Systems and methods for modulating a cell phenotype | |
| Hu et al. | Activated T cell extracellular vesicle DNA transfer enhances antigen presentation and anti-tumor immunity | |
| Ao et al. | Targeting GFPT2 to reinvigorate immunotherapy in EGFR-mutated NSCLC | |
| CN113502265A (en) | Inducer for reprogramming T cells into NK-like cells and application thereof | |
| CN114762730A (en) | Application of PCSK9 in tumor immunotherapy and immune cell immune effect enhancement | |
| CN114788864A (en) | Application of LDLR in tumor immunotherapy and enhancing immune cell immune effect | |
| Frusteri | Targeting immune dysregulation mediated by FLIP and putative FLIP-related pathways to develop new therapeutic approaches | |
| US20250223555A1 (en) | Reprogramming of immune-enhancing neutrophils by subclinical low-dose endotoxin for the treatment of cancer | |
| Mola | Tumor Associated Macrophages (TAMs) a pivotal orchestrator in cancer-related inflammation and a new important target in cancer-therapy |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 19845428 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 19845428 Country of ref document: EP Kind code of ref document: A1 |