CN114762730A

CN114762730A - Application of PCSK9 in tumor immunotherapy and immune cell immune effect enhancement

Info

Publication number: CN114762730A
Application number: CN202110071148.4A
Authority: CN
Inventors: 杨魏; 袁娟娟; 蔡婷; 郑晓君
Original assignee: Southern Medical University
Current assignee: Southern Medical University
Priority date: 2021-01-19
Filing date: 2021-01-19
Publication date: 2022-07-19

Abstract

Application of PCSK9 in tumor immunotherapy and immune cell immune effect enhancement is provided. Discloses the regulation and control function of cholesterol metabolism related genes and proteins on immune cell immune effect and anti-tumor activity, and the regulation and control process does not completely depend on the uptake of cholesterol, thereby providing a new strategy and target spot for tumor immunotherapy or enhancing immune cell immune effect and overcoming the technical bias existing in the prior art. Specifically, PCSK9 was found to be dependent on LDLR to directly affect TCR cycling and signal transduction pathways of immune cells, thereby allowing the corresponding CTLs to have different effector function manifestations. PCSK9 can be used as tumor cell and/or immune cell inhibition target to be adjusted to improve CTL killing effect, and can be used in tumor immunotherapy to improve tumor immunotherapy effect and prolong patient survival. And PCSK9 inhibition can further enhance the efficacy of immunotherapy in combination with immune checkpoint blockers.

Description

Application of PCSK9 in tumor immunotherapy and immune cell immune effect enhancement

Technical Field

The invention relates to the field of immunotherapy, and in particular relates to application of PCSK9 in tumor immunotherapy and immune effect enhancement of immune cells.

Background

Malignant tumor is a serious disease seriously harming human life and health, and at present, the treatment means of the malignant tumor mainly comprises operation treatment, radiotherapy, chemotherapy and immunotherapy. Among them, the tumor immunotherapy aims at providing anti-tumor efficacy by mobilizing the immune system of the body, thereby inhibiting and killing tumor cells, and is an important means for the current tumor therapy. In particular, the immunotherapy taking T cells as the core obtains certain curative effect in various tumors.

T cells are important components of the adaptive immune system, recognize specific antigens and mediate cellular immune responses, playing an important role in combating infection by foreign pathogens, tumor immunity, and autoimmune diseases. T cell-based immunotherapy, such as immunodetection point blocking therapy targeting PD-1 and CTLA-4 and chimeric antigen receptor T (CAR-T) cell therapy, has achieved excellent results in tumor therapy and has been approved for clinical use. It can treat tumor by enhancing the function of patient's own immune system, and has the features of fast reaction, less side effect, lasting curative effect, etc.

However, the therapy also has certain defects, such as that the anti-tumor effect cannot be fully exerted due to the influence of factors such as tumor microenvironment and the like, the anti-tumor effect is easily regulated and controlled by the tumor microenvironment to be inhibited, the response rate in part of tumors is low, and the curative effect on part of patients is very slight. Therefore, the research on the regulation mechanism of tumor immunotherapy and the further development of new targets and treatment strategies to improve the immune effect of immune cells, especially the anti-tumor activity of T cells, remain the focus of basic research and clinical research at present.

During the process of tumorigenesis and tumor progression, the tableOne of the obvious features of the present invention is the formation of a tumor microenvironment, specifically, an immunosuppressive tumor microenvironment composed of immunosuppressive stromal cells, myeloid cells, lymphoid cells and tumor cells themselves. Such tumor microenvironments may inhibit CD8⁺The anti-tumor activity of the T cell immune cells, and besides the inhibition of immune cell effect function caused by the characteristics of tumor microenvironment such as scarcity of nutrient substances such as glucose and the like and hypoxia state, partial research also finds that the tumor microenvironment can influence the anti-tumor effect of the immune cells through metabolic regulation. Among them is the study that reprogramming of cholesterol metabolism may affect CD8⁺Activation of T cells, modulation of CD8 in tumor immunotherapy⁺T cell antitumor activity. On the basis, the prior art develops researches on the role of cholesterol-related regulatory genes, such as PSCK9, in tumor immunotherapy, and aims to research strategies for improving immunotherapy from a metabolic level. However, recent studies have also shown that the tumor growth attenuation caused by PCSK9 deficiency is not affected by host LDLR status or cholesterol levels. Therefore, it is unknown whether tumor tissues inhibit the corresponding anti-tumor effect by affecting the cholesterol metabolism of immune cells, and whether other mechanisms affect the cholesterol metabolism-related genes and proteins to inhibit the anti-tumor activity of immune cells. The application aims to research the relevance of genes and proteins related to the cholesterol metabolism of immune cells and the expression of tumor microenvironment, immune effect inhibition and the like, explores a treatment strategy and a corresponding target spot which can solve the problems of the prior art that immunotherapy is inhibited and the like, obtains a new treatment target spot and strategy to improve the anti-tumor activity of immune cells, particularly T cells, and makes up for the vacancy of immunotherapy in the prior art.

Disclosure of Invention

The invention aims to overcome at least one defect of the prior art and provides an application of PCSK9 in tumor immunotherapy and immune cell immune effect enhancement, and the application can promote the immune effect and anti-tumor effect of immune cells by inhibiting the expression of PCSK9 in tumor cells or immune cells so as to improve the tumor immunotherapy effect; and according to the discovery that the LDLR-TCR access is regulated to influence the antitumor activity of immune cells, a new immunotherapy target and strategy can be provided for tumor immunotherapy, and the vacancy of the immunotherapy in the prior art is made up.

The invention aims to provide application of the PCSK9 gene, the protein thereof or the protein intermediate thereof serving as a tumor tissue or immune cell target in preparing a medicament for tumor immunotherapy and/or enhancing immune effect of immune cells. Further, as an inhibition target.

In one embodiment of the invention, the tumor tissue high-expression LDLR regulatory protein PCSK9 is found, the knock-down or knock-down of PCSK9 can promote the antitumor activity of tumor infiltrating CD8+ T cells, and besides the knock-down or knock-down of PCSK9 of the tumor tissue, the knock-down of PCSK9 expression of immune cells can also improve the immune effect function of the tumor tissue. Therefore, the PCSK9 gene can be used as a tumor tissue or immune cell suppression target to enhance immune cell immune effect and promote tumor immunotherapy effect. One or more embodiments of the present invention further indicate that PCSK9, which is at least a LDLR regulatory protein, regulates effector functions of immune cells by affecting LDLR-TCR pathways, and therefore, PCSK9, which is a target at the gene level, can be used as a target for promoting tumor immunotherapy and enhancing effector functions of immune cells during the process of forming proteins or forming proteins by transcription and translation, and is applied to preparation of corresponding drugs.

The invention also aims to provide application of the PCSK9 inhibitor in preparing a medicament for treating tumor immunity and/or enhancing immune cell immune effect. In more than one embodiment of the invention, the inhibitors through CRISPR/Cas9, PCSK9 shRNA and PF-06446846 can play the role of inhibiting PCSK9 to improve CTL killing effect and immunotherapy anti-tumor effect, so the PCSK9 inhibitor can also be applied to corresponding medicines for promoting tumor immunotherapy and enhancing immune effect of immune cells.

Further, the tumor includes solid tumor and blood tumor.

Further, the above tumors include colorectal cancer, lung cancer and breast cancer.

Further, the PCSK9 inhibitor comprises a PCSK gene, a PCSK9 protein intermediate, and/or a PCSK9 protein inhibitor. I.e. including inhibitors of the transcription to translation process of the PCSK9 gene.

Further, PCSK9 inhibitors include CRISPR/Cas9 agents that inhibit PCSK9 expression, PCSK9 shRNA, PCSK9 antibodies, and/or PF-06446846.

Further, the nucleotide sequences of PCSK9 shRNA were 5'-GCTGATCCACTTCTCTACC-3' and 5'-CAGAGGCTACAGATTGAAC-3'.

Further, the drugs for tumor immunotherapy and/or enhancing immune effect of immune cells include drugs for modulating LDLR content on immune cells, modulating CD3 content on cell membranes of immune cells, modulating LDLR interaction with TCR/CD3 complex on immune cells, modulating TCR signaling, modulating immune synapse formation, and/or modulating CD3 transport to cell membranes.

In one embodiment of the invention, PCSK9 is capable of mediating endocytosis and degradation of LDLR and inhibiting expression of CD3 on the cell membrane of immune cells, and therefore PCSK9 inhibitors can act on PCSK9 to regulate the level of LDLR on immune cells and regulate the level of CD3 on the cell membrane of immune cells. In one embodiment of the present invention, it is found that immune synapse formation of immune cells is also inhibited after knockout of LDLR, so that the PCSK9 inhibitor can be applied to drugs for regulating immune synapse formation, such as drugs for reducing LDLR content by inhibiting PCSK9, thereby promoting immune synapse formation. Meanwhile, more than one embodiment of the invention also shows that LDLR can interact with TCR/CD3, regulate TCR recycling and signal transduction pathways, including regulation of TCR complex ligand CD3 transportation, so as to directly influence the immune effect and the anti-tumor activity of immune cells. PCSK9 also regulates CD8 by inhibiting LDLR-TCR signaling pathway⁺The anti-tumor activity of T cells, so that the PCSK9 inhibitor can also be applied to the preparation of medicaments for regulating TCR signal transduction and/or CD3 transport to cell membranes.

Further, enhancing immune effects of immune cells including CD8 includes promoting proliferation of T cells and/or production and release of cytokines including IFN γ and TNF α and granzyme B⁺T cells.

The invention also aims to provide application of the PCSK9 inhibitor and an immune checkpoint blocker in preparation of an immunotherapy medicament for preventing and treating tumors.

Further, the immune checkpoint blocking agent comprises an anti-PD-1 antibody.

In one embodiment of the invention, the PCSK9 inhibitor is combined with an immune checkpoint blocker PD-1 antibody, so that the tumor growth can be better inhibited and the survival time of a host can be prolonged.

Still another object of the present invention is to provide a kit comprising a PCSK9 inhibitor and an anti-PD-1 antibody.

The invention further aims to provide application of the PCSK9 gene serving as an immune intracellular drug inhibition target in preparation of a tumor adoptive cell immunotherapy drug.

It is still another object of the present invention to provide a T lymphocyte for adoptive cellular immunotherapy, in which the PCSK9 gene is knocked down.

In one embodiment of the invention, the PCSK9 knockout CTL, upon adoptive transfer, is capable of significantly slowing tumor growth, with a better anti-tumor effect compared to CTLs without inhibition/knockout of PCSK 9. The PCSK9 can also be used as an immune cell drug inhibition target to be applied to the preparation of tumor adoptive immunotherapy drugs, and the correspondingly formed T cells can also be used for adoptive cell immunotherapy.

Compared with the prior art, the invention has the following beneficial effects: the regulation and control effects of cholesterol metabolism related genes and proteins on immune effect and anti-tumor activity of immune cells are disclosed, and the regulation and control process does not completely depend on the intake of cholesterol in practice, so that a new strategy and a target point are provided for tumor immunotherapy or immune effect enhancement of the immune cells, and the technical bias existing in the prior art is overcome. Specifically, PCSK9 was found to be dependent on LDLR to directly affect TCR cycling and the signal transduction pathway of immune cells, thereby allowing the respective CTLs to have different effector function manifestations. In tumor tissues, PCSK9 is in high expression state, and PCSK9 can enhance immune cell effector function and inhibit tumor by inhibiting tumor tissues or immune cellsAnd (5) growing. Therefore, PCSK9 can be modulated as a tumor cell and/or immune cell target to improve CTL killing, thereby promoting anti-tumor effects. Is applied to tumor immunotherapy and is helpful for remarkably improving CD8⁺The anti-tumor activity of the T cells, the tumor immunotherapy effect is improved, and the life cycle of a patient is prolonged. On this basis, PCSK9 inhibition can further enhance the efficacy of immunotherapy in combination with anti-PD-1 antibodies, which are immune checkpoint blockers. The invention can provide a new treatment scheme and a new target spot for tumor treatment, particularly immunotherapy, and is expected to be applied to clinic to improve the tumor treatment effect and the survival rate of patients. The disclosed PCSK9, LDLR and TCR relation can also provide research basis for further improving the tumor immunotherapy effect and promote the development of the tumor therapy field.

Drawings

FIG. 1 shows that the tumor microenvironment is rich in cholesterol, but the tumor infiltrates CD8⁺T cell cholesterol levels are reduced.

FIG. 2 shows tumor infiltration of CD8⁺LDLR expression is down-regulated in T cells.

FIG. 3 shows that LDLR knock-out inhibits CD8⁺T cell effector function.

FIG. 4 shows that LDLR overexpression enhances CD8⁺T cell effector function.

FIG. 5 shows LDLR regulates CD8⁺T cell function is not completely dependent on LDL/cholesterol uptake.

FIG. 6 shows that LDLR can bind to TCR, modulating CD8⁺T cell TCR signaling pathways.

Figure 7 shows tumor tissue high expression of LDLR regulatory protein PCSK 9.

FIG. 8 shows that knocking out tumor cell PCSK9 expression increases tumor infiltration CD8⁺T cell antitumor activity.

FIG. 9 shows that knocking down PCSK9 expression in tumor cells increases tumor infiltration CD8⁺T cell antitumor activity.

FIG. 10 shows a knock-out CD8⁺Expression of T-cell PCSK9 enhances CD8⁺T cell antitumor activity.

FIG. 11 shows that PCSK9 modulates CD8⁺The antitumor activity of T cells is dependent onCD8⁺T cell LDLR expression.

FIG. 12 shows that PCSK9 modulates CD8 by inhibiting LDLR-TCR signaling pathway⁺T cell antitumor activity.

Figure 13 shows that PCSK9 inhibitor PF-06446846 enhances tumor immunotherapy efficacy.

Detailed Description

It should be noted that the following detailed description is exemplary and is intended to provide further explanation of the disclosure. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs.

It is noted that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of example embodiments according to the present application. As used herein, the singular forms "a", "an" and "the" are intended to include the plural forms as well, and it should be understood that when the terms "comprises" and/or "comprising" are used in this specification, they specify the presence of stated features, steps, operations, devices, components, and/or combinations thereof, unless the context clearly indicates otherwise.

The present invention will now be further described with reference to specific examples, which are intended to be illustrative only and not to be limiting. The test samples and test procedures used in the following examples include the following (generally, according to the conventional conditions or according to the conditions recommended by the reagent company if the specific conditions of the experiment are not specified in the examples; and reagents, consumables and the like used in the following examples are commercially available unless otherwise specified).

1. Patient and clinical specimens

Paraffin-embedded colorectal cancer tissue samples, adjacent non-tumor areas, and lung and breast cancer tissue samples were from the southern hospital pathology tissue bank of southern medical university. The colorectal, lung and breast cancer samples used have been clinically diagnosed as tumor tissue. All experiments involving patient samples were in accordance with the declaration principles of helsinki and were approved by the medical ethics committee of southern medical university.

2. Laboratory animal

C57BL/6 mice, Rag2^–/–Mouse, Ldlr^–/–Mouse, Pcsk9^–/–Mice and OT-I TCR transgenic mice were purchased from Jackson laboratories. Ldlr^–/–Mouse, Pcsk9^–/–Mice were mated separately with OT-I mice and mouse genotypes were identified using PCR methods. All animals used in the experiment were housed in the SPF barrier system and all animal experiments used age and sex matched mice and were randomized into groups. All animal experiments in this study were approved by the southern university of medical laboratory animal welfare and ethics committee.

3. Reagents and antibodies

Flow cytometry was performed using the antibodies anti-CD3 ε (145-2C11), anti-CD8(53-6.7), anti-CD44(IM7), anti-CD45(30-F11), anti-IFN γ (XMG1.2), anti-granzyme B (NGZB), anti-TNF- α (MP6-XT22), anti-p-ZAP70/Syk (Tyr319, Tyr352) (n3kobu5), anti-p-BTK/ITK (Tyr551, Tyr511) (M4G3LN), anti-p-Akt (Ser473) (SDRNR) and anti-p-Erk (Thr202, Tyr204) (MILAN8R) all purchased from Thermonofer. Anti-mouse LDLR (101) was purchased from Sino Biological Inc.

Western blot-related antibodies anti- β -actin, anti-GAPDH, anti-CD3 ε, anti-CD3 γ, anti-CD3 ζ were purchased from Santa Cruz Biotechnology. Anti-p-CD3 ζ (Tyr142) was purchased from Abcam. Anti-HA was purchased from Sigma. Immunohistochemistry related antibodies anti-Apolipoprotein B were purchased from Abcam, anti-PCSK9 was purchased from Sino Biological, and anti-CD3(SP7) was purchased from Abcam.

Immunofluorescence and PLA-related antibodies anti-LDLR were purchased from Lifespan, anti-CD3 from Genetex, anti-CD3 ε from Bio X Cell. Filipin III was purchased from Cayman. PF-06446846 was purchased from MedChemexpress. Isolation of tissue infiltrating T cell-related reagent Type IV Collagenase was purchased from Gibco, DNase I from Applichem, Hyaluronidase from Sigma, Percoll from GE. T Cell activation-associated antibodies anti-CD3 epsilon (145-2C11), anti-mouse CD28(37.51, Bio X Cell) were purchased from Bio X Cell. OVA_257-264The polypeptide (SIINFEKL) was purchased from Shanghai Qiaozhou Biotech, Inc. PCSK9 protein was purchased from ACROBiosystems. Celltrace CFSE, Celltracker Deep Red and Cell promotion Dye eFluor 450 were purchased from Invitrogen. Methyl-beta-cyclodextrin (M beta)CD) and M β CD-coated cholestol were purchased from Sigma.

4. Cell lines

MC38 cells were purchased from gieni europe biotechnology, guangzhou, B16F10 and EL4 cells were purchased from ATCC, all without mycoplasma contamination. MC38, B16F10 and 293T cells were cultured in DMEM medium and EL4 cells in RPMI-1640 medium, all supplemented with 10% FBS and 1% penicillin-streptomycin. MC38-OVA or B16F10-OVA cells were constructed by lentivirus infection of MC38 cells or B16F10 cells and flow cytometric sorting.

5. Construction of PCSK9 knockout and knockdown cell lines

pLKO.1-shRNA-GFP, psPAX2 and VSV-G transfect 293T cells to package lentivirus, and the supernatant of the culture medium containing the virus is taken to infect MC38 cells, and the GFP is sorted by flow⁺A cell. Knock-down efficiency was detected using QPCR method.

Transfecting 293T cells with Lenti-CRISPR-V2, psPAX2 and VSV-G to package lentivirus, taking culture supernatant containing the virus to infect MC38 or B16F10 cells, and sorting GFP in a flow mode⁺A cell. Sorted MC38 cells were separated into monoclonal cells by limiting dilution and the monoclonal cell genotypes were identified using Sanger sequencing.

sgRNA	Sequence(5’-3’)
		sgPcsk9#1	GCTGATGAGGCCGCACATG
sgPcsk9#
	2	CTACTGTGCCCCACCGGCGC
sgPcsk9#
	3	ACTTCAACAGCGTGCCGG
sgLacZ			GCGAATACGCCCACGCGAT

6. Flow cytometry analysis

The treated cells were washed once with PBS and the cell surface Fc receptor was blocked with anti-mouse CD16/32 followed by cell surface staining with the corresponding antibody for 30 min at 4 ℃. For cytokine staining, cells were treated with 5. mu.g/ml Brefeldin A for 4 hours, collected for surface staining, and then fixed with 4% paraformaldehyde and 0.1% Triton X-100 permeabilized cell membranes, and incubated with the corresponding antibody at 4 ℃ for 60 minutes for cytokine staining. All experiments were tested using a sony SA3800 flow cytometer and data analysis was performed using FlowJo software (Treestar).

7. Immunohistochemistry

Tumor tissues of patients or mice were paraffin-embedded and sectioned to 5 μm thickness, and after deparaffinization, rehydration, antigen retrieval, blocking endogenous peroxidase activity, sections were blocked with sheep serum and incubated with anti-PCSK9, APOB or CD3 antibodies overnight at 4 degrees, respectively, followed by incubation with anti-IgG-HRP and visualization with 3-amino-9-ethyllcarbazole (aec), and finally cell nuclei were stained with hematoxylin. Pictures were taken using a zeiss microscope.

8. Real-time quantitative PCR

RNA was extracted by TRIzol, followed by reverse transcription into cDNA by Hiscript III RT Supermix (Novozan), and gene expression was detected using a QuantStaudio real-time quantitative PCR instrument (Thermo Fisher) with 18S as an internal control.

The primers used for real-time quantitative PCR are as follows:

9. separation and activation of CD8⁺T cells

Using EasySep Mouse

CD8⁺T Cell Isolation Kit (Stem Cell) Isolation and purification

CD8⁺T cells, stimulated with plates coated with anti-CD3 and anti-CD28 antibodies at the corresponding concentrations.

10. OVA antigen activation OT-I CD8⁺T cells

OT-I mice spleens were ground and red blood cells were removed using red blood cell lysates, followed by 10nM OVA_257-264The polypeptide and 10ng/ml human recombinant IL-2(Peprotech) were stimulated for 3 days, and then the cells were cultured in a medium containing 10ng/ml IL-2 for subsequent experiments.

11. Detection of CD8 using CFSE⁺T cell proliferation

Separated and purified by 0.4 mu M CFSE dye label

CD8⁺After T cells, PBS wash 3 times to remove residual CFSE dye, followed by 48 or 72 hours of stimulation with anti-CD3 and anti-CD28 antibodies (1. mu.g/ml), followed by flow cytometry to detect CD8⁺T cell CFSE fluorescenceLight intensity.

12. Detection of Cytotoxic T (CTL) cell killing Activity

Spleen cells were isolated from OT-I mice and OVA was added_257-264And IL-2 for 3 days, differentiating the cells into cytotoxic T cells. The target cells EL4 cells were incubated with OVA_257-264Antigen was incubated at 37 ℃ for 30 minutes and labeled with 1. mu.M CellTracker Deep Red (CTDR), whereas EL4 cells not bound to the antigen were labeled with 0.5. mu.M CFSE dye, two EL4 cells were mixed in equal proportion, CTL cells and EL4 cells were co-cultured in different proportions for 4 hours, and the proportion of EL4 cells was examined by flow cytometry to evaluate the CTL cell killing activity.

13. Detection of CTL cellular immune synapse formation

The target cells EL4 cells were incubated with OVA_257-264Incubating at 37 ℃ for 30 min, labeling with 1. mu.M CellTracker Deep Red (CTDR), labeling CTL cells with 0.5. mu.M CFSE dye, mixing labeled CTL cells and EL4 cells at equal ratio, culturing for 30 min, adding 4% paraformaldehyde at equal volume, fixing at room temperature for 5min, and detecting CTDR by flow cytometry⁺CFSE⁺Cell ratio.

14. CTL cell overexpression LDLR

The LDLR coding sequence was cloned into pMxs-mTFP1 plasmid, platE cell packaging retrovirus was transfected, OT-I CTL cells were infected with virus-containing medium supernatant, 10ng/ml IL-2 and 10. mu.g/ml polybrene were added, secondary infection was performed the next day at 2000rpm for 2 hours in a centrifuge, and then mTFP1+ cells were sorted by flow cytometry and cultured with 10ng/ml IL-2.

15. Mouse subcutaneous colorectal cancer and melanoma models

We constructed a mouse subcutaneous colorectal cancer model using MC38 or MC38-OVA cells, and a mouse subcutaneous melanoma model using B16F10 cells. After digestion of MC38, MC38-OVA cells or B16F10 cells, the cells were filtered through a 40 μm filter. Then 1X 10⁶MC38, MC38-OVA or 4X 10⁵B16F10 cells were inoculated subcutaneously in the back of mice. Tumor size was measured every 2 days after 6-10 days of inoculation, and mice survival was recorded every day. Tumor size-tumor lengthX tumor width. Tumor sizes in excess of 225mm were ethically considered²Mice will be sacrificed (15 mm. times.15 mm).

16. Adoptive transfer of T cells

Will be 1 × 10⁶MC38-OVA cells are inoculated to the back of a Rag2 knockout mouse subcutaneously, tumor-bearing mice are randomly grouped after 12 to 14 days, and PBS and 1 × 10 cells are respectively injected into the tail vein⁶WT CTL cells, LDLR knockout CTL cells, or PCSK9 knockout CTL cells; in LDLR overexpression experiments, PBS and 5X 10 were injected through tail vein respectively⁵WT CTL cells, LDLR knockout CTL cells, LDLR overexpressing CTL cells. Tumor size was measured every 2 days and mice survival was recorded every day. Tumor size is tumor length x tumor width. Tumor sizes in excess of 225mm are ethically considered²Mice will be sacrificed (15 mm. times.15 mm).

17. CD8 antibody eliminates CD8⁺T cells

6-8 weeks of C57BL/6 mice were divided into groups, intraperitoneally injected with 200. mu.g/ml α -CD8 depleting antibody (2.43, Bio X Cell) or rat IgG antibody (2A3, Bio X Cell), and 2 days later 1X 10⁶MC38 cells were inoculated subcutaneously into the back of mice and injected with α -CD8 scavenger antibody or rat IgG antibody on

days

4, 8, 12, and 16, respectively, after inoculation with tumor cells.

18. PF-06446846 and anti-PD-1 for treating colorectal cancer and melanoma of mice

MC38 tumor-bearing mice with similar tumor sizes were randomized into groups and treated every two days with either intraperitoneal PBS, anti-PD-1 antibody (RMP1-14, Bio X Cell, 200. mu.g), PF-06446846(5mg/kg) or a combination of anti-PD-1 and PF-06446846. PF-06446846 was injected a total of 7 times from day 8 after tumor inoculation; anti-PD-1 antibody was injected 9 days after tumor inoculation, for a total of 6 times. Tumor size and mouse survival were recorded as before.

19. Isolation of tumor infiltrating lymphocytes

Mice were inoculated with tumors 14-18, tumors were removed, minced, digested with collagenase (210U/ml), DNase (100U/ml) and hyaluronidase (0.5mg/ml) for 30 minutes at 37 degrees, undigested tissue was removed by filtration using a 70 μm filter, supernatants were removed after centrifugation at 50g for 1 minute, centrifuged at 1000g for 10 minutes, and cells were harvested after discarding the supernatantsCentrifuging with 40% -70% Percoll density gradient, centrifuging 1000g of intermediate layer cells for 5 minutes to obtain tumor infiltrating lymphocytes. To detect cytokine expression, tumor infiltrating lymphocytes were stimulated with 50ng/ml PMA, 1. mu.M ionomycin and 5. mu.g/ml BFA at 37 degrees for 4 hours, followed by detection of cytokine production by flow cytometry. To further obtain tumor infiltration CD8⁺T cells were isolated and purified using a CD8 cell positive selection kit (Stemcell).

20. Filipin III staining

Cells were washed 3 times with PBS, fixed with 4% paraformaldehyde, washed 3 times with PBS, stained with 50 μ g/ml Filipin III dye for 2 hours at room temperature in the dark, washed 8 times with PBS to remove residual dye, imaged with a zeiss laser confocal microscope (LSM880, AxioObserver) and data analyzed with Image J software.

21. Use of Mbeta CD and Mbeta CD coated cholesterol to alter cholesterol levels on cell membranes

To remove cholesterol content from cell membrane, CD8 was added⁺T cells were washed 2 times with PBS, cells were incubated with 1mM M β CD 37 degrees for 15 minutes, and washed 3 times with PBS for subsequent experiments.

In order to increase the cholesterol level on the cell membrane, CD8 was added⁺The T cells were washed 2 times with PBS, incubated with 10 μ g/ml M β CD-coated cholesterol at 37 degrees for 15 minutes, washed 3 times with PBS and subjected to subsequent experiments.

22. PCSK9 or PF-06446846 stimulated cells

Sorting from mouse spleen

CD8+ T cells stimulated CD8 with 2. mu.g/ml anti-CD3 and anti-CD28 antibodies and 5. mu.g/ml PCSK9 protein⁺T cells, and cytokine production is detected. For CTL cells, the CTL cells were stimulated with 5. mu.g/ml or 10. mu.g/ml PCSK9 protein for 6 hours, and then the subsequent experiments were carried out.

The subsequent killing activity assay was performed by stimulating EL4 cells and EL4-OVA cells with 5. mu.M or 10. mu.M PF-06446846 for 24 hours, and co-culturing with CTL cells under PF-06446846 for 12 hours.

23. Immunofluorescence assay for detecting co-localization of CD3 and LDLR

CTL cells were collected and fixed with 4% paraformaldehyde, and after blocking for 30 min at room temperature using goat serum, incubated overnight at 4 ℃ with anti-LDLR (Lifespan) and anti-CD3(Genetex) antibodies, followed by incubation for 2 h at 4 ℃ with Alexa 488-conjugated giat anti-rabbitIgG and Alexa Fluor Plus 555-conjugated donkey anti-mouse IgG antibodies, and finally Mounting with In Situ Mounting Medium with DAPI (Sigma) confocal microscope (LSM880, AxioObserver) and pictures were taken.

24. Proximity ligation technique to detect LDLR and CD3 interactions

We used the Duolink PLA technique (Sigma) to detect LDLR and CD3 interactions. Cells were first fixed with 4% paraformaldehyde, incubated with Duolink Blocking Solution at 37 ℃ for 60 minutes to block non-specific signals, followed by 4 ℃ incubation for 12 hours using anti-LDLR and anti-CD3 antibodies, and the sample was incubated with 2 PLA probes at 37 ℃ for 60 minutes. After ligation and amplification reactions, In Situ Mounting Medium with DAPI Mounting was used. Pictures were taken using Olympus FV1000 or zeiss LSM880 confocal laser microscopy and analyzed with Image J software. TIRF imaging was performed using a Nikon N-SIM + N-STORM microscope.

25. Co-immunoprecipitation

EL4 cells and CTL cells were collected and lysed with NP-40 lysate (50mM Tris-HCl, pH 7.4,155mM NaCl,5mM EDTA,2mM Na)₃VO₄20mM NaF, complete protease inhibitor cocktail and phosphatase inhibitor cocktail) were lysed using Pierce^TMCo-Immunoprecipitation Kit was used for the Co-Immunoprecipitation experiment.

26. Statistical analysis

All data statistics herein were analyzed using GraphPad Prism software using either t-test or two-way ANOVA, and mouse survival curves were statistically analyzed using the Log-rank (Mantel-Cox) method; all data error bars herein represent standard deviations; ns, no signifiance; p < 0.05; p < 0.01; p < 0.001; p <0.0001.

Test 1

The tumor microenvironment is rich in cholesterol, but the tumor infiltrates CD8⁺T is thinReduction of cellular cholesterol levels

CD8 after stimulation by antigen⁺T cell cholesterol metabolism is reprogrammed to ensure that sufficient cholesterol is available for cell expansion and effector function. Some studies have shown that nutrient and oxygen starvation in the tumor microenvironment in order to explore whether sufficient cholesterol is present in the tumor microenvironment to maintain CD8⁺T cell antitumor activity, the present inventors examined apolipoprotein B (APOB) levels in colorectal (FIG. 1.a, b), lung (FIG. 1.c) and breast (FIG. 1.d) cancer samples of patients using immunohistochemical staining. The APOB content reflects the Low Density Lipoprotein (LDL)/cholesterol content, and the staining results show that the tumor tissue contains more LDL/cholesterol than the paracancerous normal tissue. Meanwhile, the inventor establishes an MC38 cell cecum implantation mouse model (figure 1.e) and a B16F10 melanoma lung metastasis mouse model (figure 1.F), detects the APOB level by using an immunohistochemical method, and finds that the LDL/cholesterol content in a mouse tumor tissue is higher than that in a normal tissue. I.e. the results indicate that the tumor microenvironment is actually cholesterol rich.

To explore tumor infiltration CD8⁺T cell cholesterol content, the inventor establishes an MC38 cell subcutaneous tumor model, and then utilizes Filipin III to mark mouse spleen CD8⁺T cell and tumor infiltrating CD8⁺T cell free cholesterol, and the content of the cell cholesterol is detected by laser confocal imaging to find the tumor infiltration CD8⁺The T cell cholesterol levels were significantly reduced (fig. 1.g, h).

The above results show that LDL/cholesterol levels in patient colorectal, lung, breast cancer tissue samples, as well as MC38 tumor and B16F10 lung metastatic cancer samples in mice were increased relative to normal tissue, but tumor infiltration CD8⁺The cholesterol content of T cells was in turn significantly reduced relative to spleen cells.

In particular, FIG. 1 tumor microenvironment is rich in cholesterol but tumor infiltrates CD8⁺A decrease in T cell cholesterol content; (a-b) detecting APOB levels in normal colorectal and tumor tissues of the patient using immunohistochemical methods; (c) detection of normal and lung cancer tissue in patients using immunohistochemical methodsModerate APOB levels; (d) detecting the level of APOB in normal breast tissue and breast cancer tissue of a patient by an immunohistochemical method; (e) establishing a mouse cecal planting MC38 cell model, and detecting the APOB level in normal intestinal tissues and tumor tissues of a mouse by using an immunohistochemical method; (f) B16F10 cells are injected through tail vein to establish a mouse melanoma lung metastasis model, and an immunohistochemical method is used for detecting the APOB level in normal lung tissues and lung cancer tissues of the mouse; (g-h) establishing a mouse MC38 subcutaneous tumor model by subcutaneous implantation, and respectively separating mouse spleen and tumor infiltration CD8⁺The T cell utilizes the Filipin III to mark cell free cholesterol, performs laser confocal imaging, and analyzes the cell cholesterol content; carrying out statistical analysis by using a t test method; (ii) P<0.0001。

Test 2

Tumor infiltration CD8⁺Downregulation of LDLR expression in T cells

The results of experiment 1 show that the tumor infiltrates CD8⁺The cholesterol content of T cells is reduced, in order to explore the mechanism, the inventor establishes a Rag2 knockout mouse model inoculated subcutaneously with MC38 cells, and takes spleen cells of OT-I transgenic mice to culture and differentiate into mature killer CD8⁺T Cells (CTL), adoptively transfused into tumor-bearing mice by tail vein injection, and separated and purified tumor-infiltrating CD8 after 3 days and 7 days, respectively⁺T cells (CD 8)⁺TILs). Meanwhile, separating and purifying from the spleen of OT-I transgenic mice

CD8⁺T cells and separately detected by fluorescent quantitative PCR method

CD8⁺T cells, CTL cells and CD8⁺Transcriptional levels of genes associated with the cholesterol metabolic pathway in TILs.

The results show that tumor infiltration of CD8 relative to CTL cells before adoptive transfer⁺mRNA levels of cholesterol synthesis pathway-associated genes such as Srebp1, Srebp2, Hmgcs1, Hmgcr, Sqle, Acaca and Fasn in T cells were significantly reduced (FIG. 2.a), while cholesterol levels were not present (see FIG. 2.a)The mRNA levels of the line-related genes Abca1 were significantly increased (fig. 2.b), and the mRNA levels of the cholesterol ester acylation modification-related genes Acat1, Acat2, nch were significantly decreased (fig. 2. c). Simultaneous tumor infiltration with CD8⁺The Ifng mRNA level in T cells was also significantly down-regulated (fig. 2.d), a result also consistent with part of the current study. The inventor then detects the expression of cholesterol transport related genes and finds that the tumor infiltrates CD8⁺The mRNA level of the main cholesterol transport receptor Ldlr (LDL receptor) in T cells is remarkably reduced, while the negative regulatory factor Idol of Ldlr infiltrates CD8 of tumor for 3 days⁺Slightly down-regulated in T cells, and CD8 at 7 days of infiltration⁺T cell expression increased (FIG. 2. e). Next, tumor infiltration CD8 was detected using flow cytometry analysis⁺LDLR cell surface levels in T cells, and tumor infiltration of CD8 was found relative to CTL cells⁺T cell surface LDLR levels were significantly down-regulated (fig. 2. f).

The above results indicate tumor infiltration of CD8⁺The mRNA and protein levels of the cholesterol transport receptor LDLR were significantly down-regulated in T cells, suggesting tumor-infiltrated CD8 even though sufficient cholesterol was present in the tumor microenvironment⁺T cells also do not take up efficiently.

In particular, FIG. 2 tumor infiltration CD8⁺Down-regulation of T cell LDLR expression; (a-d) detecting the transcript levels of the cholesterol synthesis related gene (a), the efflux related gene (b), the ester acylation modification related gene (c) and the Ifng (d) by using a fluorescent quantitative PCR method; (e) detecting the transcription levels of cholesterol transport related genes Ldlr and Idol by a fluorescent quantitative PCR method; (f) detecting the expression level of the cell surface LDLR by using flow cytometry; analyzing the difference of the transcription level by using a t test method; in the figure, P<0.05；**,P<0.01；***,P<0.001；****,P<0.0001。

Test 3

LDLR knock-out inhibits CD8⁺T cell effector function

To verify LDLR at CD8⁺Function in T cells, the inventors knockout mice systemically by LDLR (Ldlr for short)^-/-) The study was continued. First, it was first identified whether LDLR knockdown affects T cell development. By analyzing wild type mice (WT) and Ldlr^-/-The ratio of CD4 cells to CD8 cells in the mouse thymus (fig. 3.a) and spleen (fig. 3.b) was found that LDLR knockout did not affect mouse T cell development. Followed by LDLR to CD8 for verification⁺Regulation of T cell effector function from wild type mice and Ldlr, respectively^-/-Isolation in mouse spleen

CD8⁺T cells, cross-linked activation of CD8 using anti-CD3 and anti-CD28 antibodies⁺T cells, cytokine production of which was detected by flow cytometry and CD8 found after LDLR knock-out⁺The level of T cell activation was significantly down-regulated, and cytokine IFN γ and TNF α production and granzyme b (gzmb) release were significantly down-regulated (fig. 3. c).

To investigate whether LDLR regulates CD8⁺T cell proliferation Rate labeling of CD8 with CFSE dye⁺T cells, the intracellular CFSE content of each division of the cells is reduced by half, so that the cell proliferation rate can be analyzed according to the CFSE fluorescence intensity. From the results it was found that CD8 was post-LDLR knock-out⁺The T cell proliferation rate decreased significantly (fig. 3. d).

Then, Ldlr is added^-/-The mice were mated with OT-I transgenic mice to obtain OT-I Ldlr with OT-I background^-/-A mouse. The T cells of OT-I transgenic mice are mostly CD8⁺T cells, the TCR of which can specifically recognize the 257-264 peptide fragment (SIINFEKL) of the Ovabumin protein. Separately culturing OT-I mice and OT-I Ldlr^-/-Spleen cells of mice, which were differentiated into mature killer CD8⁺T Cells (CTL).

In CD8⁺When the T cell is activated by antigen, the T cell can form an immune Synapse (Immunological Synapse) structure with a target cell at a cell contact surface, and the formation of the immune Synapse is favorable for CD8⁺Stabilization of T cell signalosome and CD8⁺T cells can effectively kill target cells by releasing cytotoxic particles such as granzyme through immune synapses. To explore the LDLR pair CD8⁺Effect of T cell immune synapse formation, the inventors incubated OVA with EL4 cells, a suspension cell line_257-264Peptide fragments to allow the presentation of OVA antigens followed by conjugation withAnd (4) co-culturing CTL cells, and detecting the formation ratio of immune synapses. As a result, it was found that CFSE was present after LDLR knock-out⁺CTDR⁺The cellular proportion was clearly down-regulated (FIG. 3.e), indicating that LDLR knock-out inhibits CD8⁺T cell immune synapse formation.

Followed by CD8 for exploring LDLR knock-out pair⁺Regulating and controlling the anti-tumor activity of T cells, co-culturing CTL cells and EL4 cells, and finding CD8 after LDLR knockout⁺T cell killing activity was significantly reduced (fig. 3. f). To further determine the LDLR pair CD8 in vivo⁺Influence of T cell tumor killing activity, establishing MC38-OVA cell subcutaneous planting Rag2 knockout mouse model, and respectively planting PBS, WT OT-I CTL cell and Ldlr^-/-OT-I CTL cells were adoptively transferred into tumor-bearing mice via tail vein, and it was found that adoptively transferred Ldlr^-/-The growth rate of the tumor after OT-I CTL cells was faster than that of WT OT-I CTL cells transfused, and the survival time of the mice was shortened (FIG. 3.g, h). The above results indicate that LDLR knock-out can inhibit CD8⁺T cell antitumor activity.

Specifically, FIG. 3LDLR knockouts inhibit CD8⁺T cell effector function; (a, b) detection of Wild Type (WT) mice and LDLR knock-out (Ldlr) by flow cytometry^-/-) The ratio of CD4 cells to CD8 cells in mouse thymus (a) and spleen (b); (c) mouse from WT and Ldlr^-/-Isolation of CD8 from mouse spleen⁺T cells, cross-linked activated for 24 hours using anti-CD3 and anti-CD28 antibodies (0, 1,2, 5. mu.g/ml), detected CD8⁺T cell activation (CD44), cytokine IFN γ, TNF α production, and granzyme b (gzmb) release; statistical data were analyzed using the two-way ANOVA method. (d) From WT mice and Ldlr^-/-Isolation of CD8 from mouse spleen⁺T cells, labeled with CFSE dye, activated with anti-CD3 and anti-CD28 antibody (1. mu.g/ml) for 72 hours, and the CFSE fluorescence intensity was measured by flow cytometry; carrying out statistical analysis by using a t test method; (e) EL4 cells were incubated with OVA and labeled with CellTracker Deep Red (CTDR) dye, and CTL cells were labeled with CFSE dye, and equal amounts of CTL cells were co-cultured with EL4 cells for 4 hours; carrying out statistical analysis by using a t test method; (f) labeling of OVA-incubated EL4 cells with CTDR dye, labeling of non-OVA-incubated EL4 cells with CFSE dye,mixing the two cells in equal proportion, co-culturing the mixture and CTL cells for 4 hours according to the proportion of the number of the cells shown in the figure, and detecting the killing capacity of the CTL cells by using flow cytometry; carrying out statistical analysis by using a t test method; (g, h) MC38-OVA cells were subcutaneously inoculated into Rag2 knockout mice, PBS, WT OT-I CTL cells and Ldlr were injected into the tail vein^-/-Adoptively transferring OT-I CTL cells into tumor-bearing mice, measuring and recording the tumor size (g) every two days, and recording the survival condition (h) of the mice every day; analyzing statistical data by using a two-way ANOVA method; in the figure, P<0.001；****,P<0.0001。

Test 4

LDLR overexpression enhancement of CD8⁺T cell effector function

The above results indicate that LDLR knock-out inhibits CD8⁺T cell effector function, which the inventors subsequently performed LDLR overexpression experiments to identify to CD8⁺Regulation of T cell function. Cloning LDLR CDS sequence into retrovirus plasmid expressing TFP fluorescent protein, packaging virus with platE cell and infecting CTL cell, and sorting TFP by flow method⁺Separating cells, and detecting CD8⁺T cell effector function. Significant increases in CTL cytokine TNF α production and granzyme b (gzmb) release were found following overexpression of LDLR (fig. 4a, b). Subsequently, it was found that LDLR overexpression can enhance CTL killing activity by in vitro cell killing experiments (fig. 4 c). The present inventors further established a MC38-OVA subcutaneous tumor model, and conducted tumor therapy by adoptively transferring CTL cells, and found that tumor growth rate was significantly decreased and tumor growth was significantly inhibited after transferring LDLR-overexpressed CTL cells, while mouse survival rate was significantly increased, compared to adoptively transferring WT CTL cells (fig. 4d, e). The above results indicate that LDLR overexpression can enhance CD8⁺T cell effector function.

Specifically, FIG. 4LDLR overexpression enhances CD8⁺T cell effector function; (a, b) spleen cells of WT OT-I mice were cultured, differentiated into mature CTL cells, infected with control (Vector) and LDLR overexpression (Ldlr OE) retroviruses, and successfully infected cells were selected by flow sorting method, and then anti-CD3, anti-CD28 antibody (1. mu.g/ml) andBFA (5 mu g/ml) cross-linked activates CTL cells for 4 hours, and cytokine and granzyme B expression is detected; carrying out statistical analysis by using a t test method; (c) marking the EL4 cells incubated with OVA by using a CTDR dye, marking the EL4 cells not incubated with OVA by using a CFSE dye, mixing the two cells in equal proportion, co-culturing the mixture with CTL cells for 4 hours according to the proportion of 1:5, and detecting the killing capacity of the CTL cells by using flow cytometry; carrying out statistical analysis by using a t test method; (d, e) MC38-OVA cells were subcutaneously inoculated into Rag2 knockout mice, PBS, WT OT-I CTL cells, Ldlr were injected into the tail vein^-/-Adoptively transferring OT-I CTL cells and Ldlr OEOT-I CTL cells into tumor-bearing mice, measuring and recording the tumor size (d) every two days, and recording the survival status of the mice (e) every day; analyzing statistical data by using a two-way ANOVA method; in the figure, ns, no signiciance; a, P<0.05；**,P<0.01；***,P<0.001；****,P<0.0001。

Test 5

LDLR regulates CD8⁺T cell function is not completely dependent on LDL/cholesterol uptake

The most basic function of LDLR is to mediate the transport of LDL/cholesterol, one of the important sources of intracellular cholesterol, as described in CD8⁺Important regulatory functions are played in T cell proliferation and effector functions. To explore the LDLR regulation of CD8⁺Mechanism of T cell effector function, the inventors first examined LDLR knock-out CD8⁺T cell LDL uptake capacity, found when LDLR knockdown, CD8⁺T cells were essentially unable to take up LDL (FIG. 5a), indicating CD8⁺LDL uptake by T cells is completely dependent on LDLR. Followed by investigation of LDL vs. CD8⁺Effect of T cell proliferation CTL cells were cultured in Lipoprotein-free Medium (Lipoprotein-free serum), and CD8 was found after LDL removal from the medium⁺T cell proliferation was significantly inhibited (FIG. 5b), suggesting that uptake of LDL is CD8⁺T cell proliferation is essential.

After recognition of the antigen by the TCR, CD8⁺The cholesterol metabolism of T cells is reprogrammed to meet the supply of cholesterol during cell activation and proliferation. By examining the expression of LDLR in activated CTL cells, it was found that

CD8⁺LDLR expression was dramatically increased in T cells, activated CTL cells (fig. 5 c). To investigate the effect of LDL on effector function of CTL cells, WT CTL cells and Ldlr were stimulated with anti-CD3 and anti-CD28 antibodies^-/-CTL cells, Ldlr discovery^-/-Cytokine IFN γ, TNF α production, and granzyme b (gzmb) release by CTL cells were down-regulated, and this difference was not altered in LDL-free media (fig. 5d, e), suggesting that LDLR regulates CTL cytokine production independent of LDL uptake.

To further investigate the effect of LDL on CTL cell killing activity subsequently, WT CTL cells and Ldlr were pretreated with LDL-free medium^-/-CTL cells, and Ldlr when the CTL cells were cultured with EL4 cells and found to be LDL-free^-/-The killing activity of CTL cells was still significantly reduced (fig. 5. f).

CD8 post LDLR knock-out⁺LDL uptake by T-cells was almost completely inhibited (FIG. 5.a), and Ldlr was found by Filipin III staining^-/-The membrane cholesterol content of CTL cells was significantly reduced (fig. 5. g). It has been reported that cholesterol on cell membrane is involved in T cell activation, and to investigate whether LDLR regulates CD8 by regulating cholesterol level on cell membrane⁺T cell effector function, the inventors treated CTL cells with M β CD-coated cholesterol to artificially increase Ldlr^-/-Cell membrane cholesterol content of CTL cells (fig. 5. g). CTL cells were subsequently stimulated with anti-CD3 and anti-CD28 antibodies and Ldlr was found after increasing cholesterol levels^-/-IFN γ production by CTL cells was still significantly down-regulated (fig. 5. h).

The above results indicate that LDLR can regulate CD8 through other mechanisms in addition to LDL/cholesterol uptake⁺T cell effector function.

Specifically, FIG. 5LDLR regulates CD8⁺T cell function is not completely dependent on LDL/cholesterol uptake; (a) different concentrations of LDL and LDL-Dil were added to the medium and WT CD8 was detected by flow cytometry⁺T cells and Ldlr^-/-CD8⁺T cell LDL-Dil uptake; (b) labeling of CD8 with CFSE dye⁺T cells inCulturing CD8 in a Medium with or without LDL⁺T cells, using flow cytometry to detect cell proliferation rate; (c) sorting from spleen by flow cytometry

CD8⁺LDLR expression in T cells and differentiated mature CTL cells. Carrying out statistical analysis by using a t test method; (d, e) cultivation of WT OT-I mice and Ldlr^-/-OT-I mouse spleen cells were differentiated into mature CTL cells, which were pretreated with LDL-containing or LDL-free medium, respectively, and then the CTL cells were re-stimulated with anti-CD3, anti-CD28 antibody (0,0.5,1, 2. mu.g/ml) and BFA (5. mu.g/ml) for 4 hours to detect cytokine and granzyme B expression. Carrying out statistical analysis by using a two-way ANOVA method; (f) EL4 cells incubated with OVA were labeled with CTDR dye, EL4 cells without OVA were labeled with CFSE dye, and the two cells were mixed at equal ratio and co-cultured with CTL cells at the indicated ratio for 4 hours, and CTL killing ability was examined by flow cytometry. Carrying out statistical analysis by using a t test method; (g) WT CTL cells and Ldlr were treated with 10. mu.g/ml M.beta.CD-coated cholesterol at 37 ℃ C^-/-After the CTL cells take 15min, detecting the cholesterol content of the CTL cells by using Filipin III staining and laser confocal imaging; scale: 10 mu m; (h) after treating CTL cells with M.beta.CD-coated cholesterol according to the method of (g), the CTL cells were re-stimulated for 4 hours with anti-CD3, anti-CD28 antibody (1. mu.g/ml) and BFA (5. mu.g/ml), and cytokine IFN. gamma.production was detected; carrying out statistical analysis by using a t test method; in the figure, ns, no design; x, P<0.01；***,P<0.001；****,P<0.0001。

Test 6

LDLR can bind to TCR and modulate CD8⁺T cell TCR signalling pathway

The above results indicate that LDLR can regulate CD8 through other mechanisms in addition to LDL/cholesterol uptake⁺T cell effector function, and then the inventors further explored LDLR to modulate CD8⁺Molecular mechanisms of T cell effector function. From the previous results, it was found that LDLR knock-out did not affect CD8 in the absence of anti-CD3 and anti-CD28 antibody stimulation⁺Details of T cellsCytokine production and granzyme B release (fig. 3. c). anti-CD3 and anti-CD28 antibodies stimulate co-stimulation signals which can respectively simulate TCR antigen recognition and CD80/CD86-CD28 binding, and a plurality of researches find that TCR antigen recognition, namely a TCR signal path, is regulated and controlled by a plurality of factors, such as kinase, phosphatase, lipid and protein composition of a cytoplasmic membrane and the like. To explore the regulatory role of LDLR on TCR signaling pathways, WT CTL cells and Ldlr were stimulated with anti-CD3 and anti-CD28 antibodies^-/-CTL cells, Ldlr discovery^-/-The phosphorylation level of CD3 ζ (one of the components of the TCR complex) of CTL cells was significantly reduced (fig. 6.a), while the phosphorylation levels of downstream signaling molecules ZAP70, BTK/ITK, ERK1/2 and Akt were also significantly reduced (fig. 6.b), suggesting that LDLR knockout could inhibit the CTL cell TCR signaling pathway. It was subsequently found that CD3 ζ phosphorylation levels of LDLR knockout CTL cells remained significantly reduced when cellular cholesterol was depleted by treatment of CTL cells with M β CD (fig. 6.c), suggesting that LDLR may directly modulate TCR signaling.

We subsequently explored the localization of CD3 and LDLR within CTL cells using immunofluorescence staining and found that LDLR and CD3 co-localized on the cell membrane as a result of confocal laser imaging (fig. 6. d). In order to more precisely explore the interaction between LDLR and TCR, the proximity Ligation technology (PLA) is used, and specific antibodies for recognizing CD3 and LDLR and corresponding probes are respectively used, when the distance between the two probes is less than 40nm, the Ligation reaction can occur, and finally, a fluorescence signal is presented, which indicates that the two proteins are very close to each other in space position. When the present inventors performed PLA experiments in WT CTL cells and Laser confocal (LSCM) imaging, we found that there was a clear fluorescence signal spot in CTL cells, while the fluorescence signal completely disappeared in LDLR knockout CTL cells (fig. 6.e), indicating that LDLR can interact with CD3 in CTL cells. The interaction of LDLR and CD3 was then found to be located at or near the plasma membrane region of CTL cells using Total Internal Reflection Fluorescence Microscopy (TIRFM) imaging (fig. 6. e). Further, the interaction of LDLR and CD3 was examined using the co-immunoprecipitation (co-IP) method, and it was found that LDLR protein could be detected in IP samples when IP was performed using CD3 epsilon antibody in CTL cells (fig. 6.f), whereas CD3 gamma and CD3 epsilon subunits could be detected in IP samples when IP was performed using HA antibody in EL4 cells where LDLR-HA was overexpressed, while CD3 gamma and CD3 epsilon subunits could still be IP-expressed after removal of plasma membrane cholesterol with M beta CD (fig. 6.g), further demonstrating that LDLR could interact with CD3 and its interaction was not affected by plasma membrane cholesterol content.

In addition, the inventors have found that Ldlr^-/-CD8⁺To further explore the mechanism of the reduction in CD3 expression on the surface of T cells (FIG. 6.h, i), it was found that CD3 expression on WT CTL cell membranes was significantly reduced after BFA treatment by using a protein transport inhibitor Brefeldin A (BFA) to inhibit plasma membrane protein circulating transport, whereas WT CTL cells and Ldlr^-/-The difference in CD3 expression on CTL membranes was significantly reduced, but not in blocking protein synthesis (CHX) or the proteasome inhibitor MG132 (fig. 6.j), suggesting that LDLR may be involved in the circulating transport of TCR at the plasma membrane, thereby modulating the TCR signaling pathway. Subsequently, the present inventors examined the effector function of CTL cells after blocking protein transport, and found that WT CTL cells and Ldlr after blocking^-/-The differences between TNF α production and granzyme b (gzmb) release by CTL cells were significantly reduced (fig. 6. k).

The above results are shown in CD8⁺LDLR in T cells can interact with CD3 protein in the TCR complex, acting as an immunomodulating membrane protein regulating the TCR signaling pathway, not just the LDL transport receptor.

Specifically, FIG. 6LDLR binding to TCR modulates CD8⁺T cell TCR signaling pathways; (a) WT and Ldlr^-/-CTL cells are stimulated with 1 mu g/ml anti-CD3, anti-CD28, anti-Armenian hamster IgG and anti-Syrian hamster IgG antibodies for 0, 5, 10, 15 and 30 minutes respectively, and the CTL cell phosphorylation CD3 zeta, total CD3 zeta and beta-actin expression are detected by an immunoblotting method; (b) WT and Ldlr^-/-CTL cells were stimulated with antibody for 10 minutes according to the method of (a), and the phosphorylation levels of ZAP70, BTK/ITK, ERK1/2 and Akt were measured by flow cytometry; carrying out statistical analysis by using a t test method; (c) WT and Ldlr were treated with 1mM M β CD at 37 deg.C^-/-CTL cells were cultured for 15 minutes according to the method (a), and then the cultured cells were used for immunoblottingDetecting the phosphorylation level of CD3 zeta by the method; (d) detecting the cell location of CD3 and LDLR in CTL cell by using immunofluorescence staining and laser confocal microscopy (LCSM); scale: 10 mu m; (e) detection of WT and Ldlr by using ortho-position connection technique and laser confocal microscope^-/-CD3 and LDLR interaction in CTL cells (scale: 20 μm) and detection by Total Internal Reflection Fluorescence Microscopy (TIRFM) imaging (scale: 10 μm); (f) performing a co-immunoprecipitation experiment in CTL cells by using an anti-CD3 epsilon antibody, and detecting the LDLR level in an IP sample by an immunoblotting experiment; (g) overexpression of HA-tagged LDLR protein in EL4 cells by viral infection, subsequent treatment of EL4 cells with M β CD (Ctrl: not treated with M β CD), and co-immunoprecipitation with anti-HA antibody, detection of CD3 γ and CD3 ε levels in IP samples by immunoblotting; (h, i) BFA (5. mu.g/ml) stimulates WT and Ldlr^-/-CTL cells were tested for 2 hours for cell surface CD3 expression using flow cytometry; carrying out statistical analysis by using a t test method; (j) stimulation of WT and Ldlr with CHX (50. mu.g/ml), MG132 (15. mu.M) and BFA (5. mu.g/ml), respectively^-/-CTL cells were assayed for 2 hours by flow cytometry for cell surface and intracellular CD3 expression, respectively; carrying out statistical analysis by using a t test method; (k) BFA (5. mu.g/ml) pretreatment WT and Ldlr^-/-CTL cells were stimulated for 2 h, then 4 h with anti-CD3, anti-CD28(0,0.5, 1. mu.g/ml) and 5. mu.g/ml BFA, and cytokine production and granzyme B release were detected by flow cytometry; carrying out statistical analysis by using a t test method; in the figure, ns, no signiciance; a, P<0.05；**,P<0.01；***,P<0.001；****,P<0.0001。

Test 7

Tumor tissue high expression LDLR regulatory protein-PCSK 9

The inventor previously utilizes a mouse adoptive transfer model to find the transferred CD8⁺CD8 in tumor microenvironment 72 hours after T cells⁺Both the transcriptional and protein levels of T-cell LDLR were significantly inhibited (fig. 2.e, f). To further explore the tumor microenvironment regulating tumor infiltration CD8⁺The expression mechanism of T cell LDLR establishes MC38-OVA subcutaneous planting Rag2 knockout miceModel, adoptive transfer of WT OT-I CTL cells into tumor-bearing mice by tail vein injection, followed by isolation and purification of tumor-infiltrating CD8 24 hours and 48 hours after transfer⁺T cells, LDLR transcript levels using QPCR and LDLR surface expression using flow cytometry. Tumor infiltration CD8 was found 24 hours after transfusion⁺The expression of the LDLR protein on the surface of the T cell is sharply reduced, the level of LDLR mRNA has no significant change after 24 hours of transfusion, and is inhibited after 48 hours (figure 7.a, b), and the result shows that the tumor microenvironment regulates CD8 through other ways besides the regulation of transcription level(s)⁺T cell surface LDLR protein levels.

Part of the existing studies found that proprotein convertase protease/kexin 9 type (proprotein convertase subtilisin/kexin type 9, PCSK9) can bind to LDLR, mediate endocytosis and degradation of LDLR, thereby regulating LDLR protein levels, and PCSK9 has been used as a target for treating hypercholesterolemia. To investigate whether PCSK9 participates in the regulation of CD8 in the tumor immune process⁺T cell LDLR expression, the inventors first collected tumor samples from colorectal cancer patients and examined PCSK9 levels using immunohistochemistry, and found significant elevation of PCSK9 expression in tumor tissues relative to normal tissues (fig. 7 c-f). Subsequent detection of CD3 in colorectal cancer samples⁺Infiltration of cells, expression of PCSK9 in tumor and CD3⁺Infiltration of cells showed negative correlation (fig. 7g, h). To further validate PCSK9 function, we knocked out PCSK9 expression in B16F10 cells and examined to find that PCSK9 had no effect on tumor cell MHC-I and PD-L1 expression (fig. 7I, j).

Specifically, figure 7 tumor tissues highly express the LDLR regulatory protein PCSK 9; (a, b) plating MC38-OVA cells to Rag2 knockout mice subcutaneously to construct a subcutaneous tumor model, adoptively transferring WT OT-I CTL cells to tumor-bearing mice by tail vein injection, and separating and purifying tumor infiltration CD8 after 24 hours and 48 hours of transfer respectively⁺T cells, LDLR transcript levels detected by QPCR (a), LDLR cell surface levels detected by flow cytometry (b). Carrying out statistical analysis by using a t test method; (c, f) detection of Normal colorectal tissue and colorectal Using immunohistochemical methodsTumor tissue region PCSK9 expression levels; a scale: 120 μm. Carrying out statistical analysis by using a t test method; (d) detecting the expression level of PCSK9 in the normal breast tissue and breast cancer tissue region by using an immunohistochemical method; a scale: 120 μm; (e) detecting the expression level of PCSK9 in the normal lung tissue and lung cancer tissue region by using an immunohistochemical method; a scale: 120 μm; (g, h) detecting PCSK9 and CD3 expression levels in colorectal tumor tissue regions by immunohistochemical method, and analyzing PCSK9 expression level and CD3 expression level⁺The relevance of cellular infiltration; a scale: 120 μm; (I, j) knocking out PCSK9 expression in B16F10 cells using CRISPR/Cas9 technology, detecting cell MHC-I and PD-L1 expression using flow cytometry; in the figure, ns, no design; p<0.01；****,P<0.0001。

Test 8

Knockout of tumor cell PCSK9 expression promoting tumor infiltration CD8⁺Anti-tumor activity of T cells

To further explore the relationship between tumor PCSK9 expression and T cell infiltration, PCSK9 expression in MC38 and B16F10 cells was knocked out using CRISPR/Cas9 technology. We subsequently implanted MC38 or B16F10 cells subcutaneously into C57BL/6 mice and found a significant decrease in tumor growth rate and a significant increase in mouse survival time following PCSK9 knockout (fig. 8. a-d). Whereas MC38 cells when seeded into Rag2 knockout mice, PCSK9 knockout MC38 tumor growth rate was not different from controls (fig. 8e, f), which suggests that tumor PCSK9 may modulate adaptive immune cell effector function in the microenvironment due to the lack of T and B cells in Rag2 knockout mice. Because in the process of tumor immunization, CD8⁺T cells play an important role, and CD8 in receptor mice is eliminated by using a CD8 antibody⁺Cells, found to clear CD8 in C57BL/6 mice⁺After the cells, knockout of MC38 cell PCSK9 expression had no effect on tumor growth and mouse survival (fig. 8g, h). The results show that the tumor expressing PCSK9 can inhibit CD8⁺Cell antitumor activity, resulting in tumor immune escape.

In particular, figure 8 knock-out tumor cell PCSK9 expression promotes tumor infiltration CD8⁺T cell anti-tumor activity; (a, b) subcutaneous inoculation of PCSK9 knockout MC38 cells or control cells, respectivelyRecording the tumor size and the survival condition of the mice on C57BL/6 mice; (C, d) inoculating PCSK9 knockout B16F10 cells or control cells, respectively, subcutaneously on C57BL/6 mice and recording tumor size and mouse survival; (e, f) inoculating PCSK9 knockout MC38 cells or control cells to Rag2 knockout mice subcutaneously respectively, and recording the tumor size and survival condition of the mice; (g, h) scavenging of CD8 in C57BL/6 mice with CD8 antibody⁺T cells are inoculated to C57BL/6 mice subcutaneously by PCSK9 knockout MC38 cells or control cells respectively, and the tumor size and the survival condition of the mice are recorded; ns, no signifiance; x, P<0.01；****,P<0.0001。

Test 9

Knocking down tumor cell PCSK9 to promote tumor infiltration CD8⁺Anti-tumor activity of T cells

The inventor simultaneously utilizes shRNA to knock down PCSK9 expression in MC38 cells, constructs a C57BL/6 tumor-bearing mouse model through subcutaneous inoculation, and finds that the growth speed of MC38 tumors is obviously reduced and the survival time of mice is prolonged after PCSK9 is knocked down (figures 9a and b). As with the PCSK9 knockout experiment, when inoculated into Rag2 knockout mice, PCSK9 knockdown MC38 tumor growth rate, mice survival time was not different compared to control tumors (fig. 9c, d). Since the knockdown efficiency of shPcsk9#1 was significantly higher in MC38 cells than shPcsk9#2, the shPcsk9#1MC38 tumor growth rate was inhibited more significantly (fig. 9a, b, e). We subsequently isolated tumor infiltrating lymphocytes and found that PCSK9 was knocked down for CD8 infiltrated in MC38 tumors⁺T cells can produce more cytokines IFN gamma and TNF alpha, CD44^hiThe proportion of activated cells also increased significantly (FIG. 9 f).

In particular, FIG. 9 knock-down of tumor cells PCSK9 promotes tumor infiltration of CD8⁺T cell anti-tumor activity; (a, b) PCSK9 knockdown MC38 cells or control cells were inoculated subcutaneously into C57BL/6 mice, respectively, and tumor size (a) and mouse survival (b) were recorded; analyzing statistical data by using a two-way ANOVA method; (c, d) inoculating PCSK9 knockdown MC38 cells or control cells subcutaneously on Rag2 knockout mice, respectively, and recording tumor size (c) and survival of mice (d); analyzing statistical data by using a two-way ANOVA method; (e) detecting PCSK9 knockdown efficiency in MC38 cells using QPCR; (f) are respectively provided withIsolating tumor infiltrating lymphocytes from control tumors or shPcsk9#1MC38 tumors, measuring CD44 levels or cytokine IFN γ and TNF α production 4 hours after stimulation with PMA/Ionomycin/BFA; carrying out statistical analysis by using a t test; ns, no signifiance; a, P<0.05；**,P<0.01；****,P<0.0001。

Test 10

Knock-out CD8⁺Enhanced expression of T-cell PCSK9 on CD8⁺Anti-tumor activity of T cells

CD8⁺The regulation of effector functions by PCSK9 expressed by T cells themselves is not clear. Thus, the inventors obtained Pcsk9 systemic knockout mice, followed by stimulation with antibodies

CD8⁺T cells examined cytokine production and found CD8 after PCSK9 knock-out⁺The cytokine IFN γ production and granzyme b (gzmb) release of T cells was increased, while the cytokine TNF α production was unaffected (fig. 10. a). To explore PCSK9 pair CD8⁺Effect of T cell antitumor Activity Pcsk9 knockout mice were mated with OT-I background mice to obtain Pcsk9^-/-OT-I mice. CD8 was found by immunological synapse assay (FIG. 10.b) and CTL cell killing activity assay (FIG. 10.c)⁺Knockout of PCSK9 in T cells does not affect CTL cellular immune synapse formation, but may enhance CTL cell killing activity. Finally, detection of knock-out PCSK9 vs CD8 using an adoptive transfer experiment⁺Effect of in vivo tumor killing Activity of T cells, it was found that adoptive transfer of Pcsk9 compared to control^-/-MC38-OVA tumors grew slower after OT-I CTL cells and mice survived longer (FIG. 10.d, e).

Specifically, FIG. 10 knockdown CD8⁺T cell PCSK9 expression enhancement of CD8⁺T cell anti-tumor activity; (a) from WT mice and Pcsk9^-/-Isolation of CD8 from mouse spleen⁺T cells are activated by anti-CD3 and anti-CD28 antibody (0,0.5,1,2 mu g/ml) in a crosslinking mode for 24 hours, and cytokines IFN gamma and TNF alpha are produced, and granzyme B (GzmB) is released; analyzing statistical data by using a two-way ANOVA method; (b) labelling of CTL cells with CFSE dye compared to CTDMarking OVA-incubated EL4 cells by using an R dye, co-culturing CTL cells and EL4 cells for 30 minutes, and detecting the formation ratio of immune synapses by using flow cytometry; carrying out statistical analysis by using a t test; (c) detection of WT CTL cells and Pcsk9^-/-CTL cell killing activity; labeling OVA-incubated EL4 cells with CTDR dye, labeling OVA-unincubated EL4 cells with CFSE dye, and mixing the two cells in equal proportion; taking CTL cells and EL4 cells to co-culture for 4 hours according to the proportion shown in the figure, and detecting the killing activity of the CTL cells by using flow cytometry; carrying out statistical analysis by using a t test; (d, e) MC38-OVA cells were subcutaneously inoculated into Rag2 knockout mice, and PBS, WT OT-I CTL cells, Pcsk9 were injected into tail vein^-/-Adoptively transferring OT-I CTL cells into tumor-bearing mice, and recording the tumor size (d) and the survival condition (e) of the mice; analyzing statistical data by using a two-way ANOVA method; in the figure, ns, no design; a, P<0.05；**,P<0.01；***,P<0.001；****,P<0.0001。

Test 11

PCSK9 regulates CD8⁺The anti-tumor activity of T cells is dependent on CD8⁺T cell LDLR expression

To explore the regulation of CD8 by PCSK9⁺Mechanism of anti-tumor Activity of T cells, the inventors adoptively transfused PBS, WT OT-I CTL cells, Ldlr in Rag2 knockout mice inoculated with control MC38-OVA or PCSK9 knockout MC38-OVA cells, respectively^-/-OT-I CTL cells, found no difference in control and PCSK9 knockout MC38 tumor growth when PBS was transfused (fig. 11. a-c); when WT OT-I CTL cells were transfused, PCSK9 knockout of MC38 tumor growth slowed (fig. 11.d-f), which is also consistent with previous conclusions; and when the Ldlr is transmitted by the relay^-/-There was no difference in growth between control and PCSK9 knockout MC38 tumors on OT-I CTL cells (fig. 11. g-I). The above results indicate that PCSK9 inhibits CD8⁺T cell antitumor Activity is dependent on CD8⁺T cell LDLR expression.

Specifically, FIG. 11PCSK9 modulates CD8⁺The anti-tumor activity of T cells is dependent on CD8⁺T cell LDLR expression; (a-I) control or PCSK9 knock-out MC38-OVA cells were subcutaneously inoculated into Rag2 knock-out mice, and PBS (a-c), WT OT-I CTL cells (d-f), Ldlr were injected using tail vein^-/-Adoptively transferring OT-I CTL cells (g-I) into a tumor-bearing mouse, and recording the size of the tumor and the survival condition of the mouse; analyzing statistical data by using a two-way ANOVA method; in the figure, ns, notigificance; p<0.01；****,P<0.0001。

Test 12

PCSK9 regulates CD8 by inhibiting LDLR-TCR signaling pathway⁺Anti-tumor activity of T cells

The inventors treated CTL cells with recombinant PCSK9 protein and found that PCSK9 could significantly inhibit CTL cell surface LDLR expression (fig. 12.a) and also inhibit surface CD3 expression (fig. 12. b). We subsequently examined the TCR signaling pathway by stimulating cells with anti-CD3 and anti-CD28 antibodies after treating CTL cells with PCSK9 and found that PCSK9 could inhibit phosphorylation of CTL cells CD3 ζ (fig. 12. c). By PLA experiments, the inventors found that the LDLR interaction signal with CD3 was reduced in CTL cells after PCSK9 treatment (fig. 12. d). At the same time when in

CD8⁺CD8 after PCSK9 protein treatment during T cell activation⁺The level of activation of T cells and the production of the cytokines IFN γ and TNF α were significantly down-regulated (fig. 12. e). Meanwhile, CTL were co-cultured with control EL4 cells or PCSK9 overexpressing EL4 cells, and it was found that EL4 cells overexpressing PCSK9 could significantly inhibit the killing activity of CTL cells (fig. 12. f). Infiltration of tumor with CD8⁺The signal for LDLR interaction with CD3 was also significantly reduced in T cells (fig. 12. g). The results show that PCSK9 can inhibit CD8⁺T cell LDLR expression and TCR signaling, thereby inhibiting CD8⁺T cell antitumor activity.

To further verify the TCR-modulating effects of PCSK9 in vivo, control cells and PCSK9 knock-out MC38-OVA cells, respectively, were subcutaneously inoculated into Rag2 knock-out mice followed by adoptive transfer of WT OT-I CTL cells, tumor-infiltrating lymphocytes were isolated after 7 days, and control MC38 tumor-infiltrating CD8, relative to CTL cells, was found⁺Expression of CD3 on the surface of T cells was inhibited, and upon knock-out of MC38-OVA cell PCSK9 expression, tumors infiltrated CD8⁺The degree of suppression of CD3 expression on the T cell surface was reduced, with increased production of the cytokines IFN γ and TNF α (FIG. 12.h-j) In that respect The above results further demonstrate that PCSK9 is a tumor-infiltrating CD8⁺The regulatory effect of the antitumor activity of T cells.

In particular, figure 12.PCSK9 modulates CD8 by inhibiting the LDLR-TCR signaling pathway⁺T cell anti-tumor activity; (a) CTL cells were treated with 0, 5 and 10. mu.g/ml PCSK9 protein for 6 hours, and CTL cell surface LDLR expression was detected by flow cytometry; (b) CTL cells are treated with 5 mu g/ml PCSK9 protein for 6 hours, and the CD3 expression on the surface of the CTL cells is detected by flow cytometry; (c) CTL cells were treated with 5. mu.g/ml PCSK9 protein for 6 hours, stimulated with 1. mu.g/ml anti-CD3, anti-CD28, anti-Armenian hamster IgG and anti-Syrian hamster IgG antibodies for 0, 5, 10, 15 and 30 minutes, respectively, and subjected to immunoblotting to detect CD3 ζ, total CD3 ζ and β -actin expression; (d) the interaction between LDLR and CD3 was detected using the PLA method after treatment of CTL cells with PCSK9 protein. A scale: 5 μm; (e) stimulation with 2. mu.g/mlatini-CD 3 and anti-CD28

CD8⁺T cells are treated for 24 hours by adding 5 mu g/ml of PCSK9 protein while stimulating, and T cell activation and cytokine production are detected by flow cytometry; carrying out statistical analysis by using a t test; (f) co-culturing CTL cells with control EL4 cells and PCSK9 overexpressing EL4 cells for 4 hours, respectively, and detecting CTL killing activity using flow cytometry; carrying out statistical analysis by using a t test; (g) detection of CTL cells and tumor infiltration CD8 by PLA technology⁺LDLR and CD3 interaction in T cells; a scale: 5 mu m; (h-j) control cells and PCSK9 knock-out MC38-OVA cells were subcutaneously inoculated into Rag2 knock-out mice, followed by adoptive transfer of WT OT-I CTL cells, isolation of tumor-infiltrating lymphocytes after 7 days, and detection of CD8⁺T cell surface CD3 expression (h, i) and cytokine IFN γ and TNF α production (j); in the figure, ns, no signiciance; x, P<0.05；**,P<0.01；***,p<0.001；****,P<0.0001。

Test No. 13

PCSK9 inhibitor PF-06446846 promoting tumor immunotherapy effect

Targeting PCSK9-LDLR has been successfully applied to clinical high cholesterol fixationTreatment of alcoholism, such as antibodies evocolumab and Alirocumab targeting PCSK9, and the like. The inventor finds that PCSK9-LDLR can regulate CD8⁺The anti-tumor activity of the T cells, in order to verify whether the target PCSK9-LDLR has the clinical tumor treatment potential, the PCSK9 inhibitor is used for treating the tumor of the mouse, and the application value of the inhibitor is identified. Since the PCSK9 antibody, evorocumab and Alirocumab, which are currently used in clinical applications, are humanized antibodies, the affinity of evorocumab for mouse PCSK9 protein (Kd ═ 17nM) is 1000 times lower than that of human PCSK9 protein (Kd ═ 16pM), whereas the affinity of Alirocumab for mouse PCSK9 protein (Kd ═ 2.61nM) is 4.5 times lower than that of human PCSK9 protein (Kd ═ 0.58 nM). The inventors also found by in vitro experiments that Alirocumab had a lower affinity for mouse PCSK9 protein than human PCSK9 protein. The assay therefore identified its tumor therapeutic potential using a chemical inhibitor of PCSK9 protein translation, PF-06446846.

Firstly, an MC38 subcutaneous tumor model is used for detecting the inhibition effect of PF-06446846 on the expression of PCSK9 of tumor cells in vivo, 5mg/kg of PF-06446846 is intraperitoneally injected into tumor-bearing mice respectively, and the expression of PCSK9 of a tumor region is detected by immunohistochemical staining after 8 times of injection, so that PF-06446846 can obviously inhibit the expression of PCSK9 and inhibit the growth of tumors (fig. 13a and b). Subsequently, we pretreated EL4 cells with PF-06446846 and co-cultured with CTL cells, and found that treatment with PF-06446846 significantly promoted CTL killing activity (fig. 13. c).

The tumor treatment effect of PF-06446846 was further tested by using a mouse tumor model. MC38 cells or B16F10 cells were inoculated to C57BL/6 mice respectively to establish a subcutaneous tumor model, and it was found that the tumor growth rate was significantly slowed down and the survival time of the mice was significantly prolonged after PF-06446846 treatment (FIG. 13. d-g). Whereas inoculation of MC38 cells into Rag2 knockout mice followed by PF-06446846 treatment had no effect on tumor growth and mouse survival (fig. 13.h, i), consistent with the results of the previous PCSK9 knockout tumor model. The results show that PF-06446846 can promote CD8⁺T cell anti-tumor activity, and improved tumor immunotherapy effect.

The inventors subsequently examined whether PF-06446846 in combination with immune checkpoint blockade therapy would further enhance the effect of immunotherapy. Through the MC38 subcutaneous tumor model, the combination of PF-06446846 and anti-PD1 antibody can better inhibit tumor growth and prolong the survival time of mice compared with single treatment (figure 13.j, k), and the PCSK9 can be used as a novel target of tumor immunotherapy.

In particular, figure 13PCSK9 inhibitor PF-06446846 promotes tumor immunotherapy efficacy; (a) inoculating MC38 cells to C57BL/6 mice, injecting PF-06446846(5mg/kg) every two days by intraperitoneal injection, and detecting the expression of PCSK9 in a tumor region by an immunohistochemical method 8 days after injection; scale: 50 μm; (b) (ii) stripping tumor tissue from (a) to display tumor size; scale: 10 mm; (c) pretreatment of EL4 cells with PF-06446846 for 24 hours, followed by co-culture of EL4 cells with CTL cells under PF-06446846 treatment for 12 hours, and detection of CTL killing activity by flow cytometry; carrying out statistical analysis by using a t test; (d, e) inoculating MC38 cells to C57BL/6 mice subcutaneously to establish a tumor-bearing model, injecting Vehicle or 5mg/kg PF-06446846 intraperitoneally every two days, and recording the tumor size and the survival condition of the mice; analyzing statistical data by using a two-way ANOVA method; (F, g) inoculating B16F10 cells to C57BL/6 mice subcutaneously to establish a tumor-bearing model, injecting Vehicle or 5mg/kg PF-06446846 into the abdominal cavity every two days, and recording the tumor size and the survival condition of the mice; analyzing statistical data by using a two-way ANOVA method; (h, i) inoculating MC38 cells to a Rag2 knockout mouse subcutaneously to establish a tumor-bearing model, injecting Vehicle or 5mg/kg PF-06446846 intraperitoneally every two days, and recording the tumor size and the survival condition of the mouse; analyzing statistical data by using a two-way ANOVA method; (j, k) inoculating MC38 cells to C57BL/6 mice subcutaneously to establish a tumor-bearing model, and recording the tumor size and the survival condition of the mice by respectively using PF-06446846 and anti-PD1 antibodies or PF-06446846 and anti-PD1 antibodies in a combined manner; analyzing statistical data by using a two-way ANOVA method; in the figure, ns, no signiciance; p < 0.05; p < 0.01; p < 0.001; p <0.0001.

And in combination with the foregoing assays, administration of a small molecule inhibitor in addition to or in combination with the PD-1 antibody promotes CD8⁺In addition to the anti-tumor activity of T cells and the improvement of the tumor immunotherapy effect, PCSK9 is knocked out by using CRISPR/Cas9 technology or PCSK9 small fraction is knocked outThe sub-inhibitor PF-06446846 can remarkably improve CD8 by inhibiting the expression of PCSK9⁺T cell anti-tumor activity, and promoting tumor immunotherapy effect.

In general, the present embodiment: it was found that the cholesterol content in the tumor microenvironment was not deficient, but that tumor infiltration CD8⁺Decreased T cell cholesterol levels; further research shows that the tumor infiltrates CD8⁺Expression of Low Density Lipoprotein Receptor (LDLR), a T cell cholesterol transport Receptor, was down-regulated, and LDLR was examined using LDLR systemic knockout mice for CD8⁺Effect of T cell function, CD8 after LDLR knock-out was found⁺T cell proliferation, cytokine IFN gamma and TNF alpha production, granzyme B (GzmB) release are all down-regulated, and meanwhile, Cytotoxic T (CTL) cell immune synapse formation is inhibited, and tumor killing activity is obviously down-regulated. In mechanism, the inventors discovered that in addition to mediating CD8⁺In addition to LDL uptake by T cells, LDLR regulation of CTL cytokine production and killing activity is not completely dependent on LDL uptake, and LDLR can interact with CD3 in the TCR complex, regulating TCR cycling and signal transduction pathways. Tumor cells highly express the LDLR regulatory protein PCSK9, PCSK9 can inhibit CD8⁺LDLR and CD3 expression on T cell membrane, and inhibition of TCR signal pathway and further CD8⁺Cytokine production and killing activity of T cells. The PCSK9 knockout by using CRISPR/Cas9 technology or the PCSK9 small-molecule inhibitor PF-06446846 can obviously improve CD8⁺T cell anti-tumor activity, and promoting tumor immunotherapy effect. The research results show that PCSK9-LDLR has potential and very important clinical application value as a tumor immunotherapy drug target, and is beneficial to being applied to the preparation of drugs for tumor immunotherapy and enhancing immune cell immune effect so as to obtain more effective immunotherapy drugs, improve the curative effect of immunotherapy and promote the development of the tumor immunotherapy field.

It should be understood that the above-mentioned embodiments of the present invention are only examples for clearly illustrating the technical solutions of the present invention, and are not intended to limit the specific embodiments of the present invention. Any modification, equivalent replacement, and improvement made within the spirit and principle of the present invention claims should be included in the protection scope of the present invention claims.

Claims

Use of the PCSK9 gene, its protein or its protein intermediate as tumor tissue or immune cell target in preparing medicine for tumor immunotherapy and/or enhancing immune effect of immune cell.
Use of a PCSK9 inhibitor for the manufacture of a medicament for the immunotherapy of tumours and/or for enhancing the immune response of immune cells.
3. The use of claim 2, wherein the PCSK9 inhibitor comprises a CRISPR/Cas9 agent that inhibits PCSK9 expression, a PCSK9 shRNA, a PCSK9 antibody, and/or PF-06446846.
4. The use of claim 2, wherein the agent for the immunotherapy of tumors and/or for enhancing the immune effect of immune cells comprises an agent that modulates the level of LDLR on immune cells, modulates the level of CD3 on the cell membrane of immune cells, modulates the interaction of LDLR with the TCR/CD3 complex on immune cells, modulates TCR signaling, modulates immune synapse formation and/or modulates the transport of CD3 to cell membranes.
5. The use according to any one of claims 2 to 4, wherein the enhancing of the immune effect of immune cells comprises promoting proliferation of T cells and/or production and release of cytokines including IFN γ and TNF α and granzyme B, and the immune cells comprise CD8⁺T cells.
Use of a PCSK9 inhibitor in combination with an immune checkpoint blocker in the manufacture of an immunotherapeutic medicament for the prevention or treatment of tumours.
7. The use of claim 6, wherein the immune checkpoint blockade agent comprises an anti-PD-1 antibody.
8.A kit comprising a PCSK9 inhibitor and an anti-PD-1 antibody.
Application of PCSK9 gene as an immune cell internal drug inhibition target in preparing tumor adoptive cell immunotherapy drugs.
10.A T lymphocyte for use in adoptive cellular immunotherapy, wherein the PCSK9 gene is knocked down.