WO2020017112A1

WO2020017112A1 - Eicosanoid production promoter

Info

Publication number: WO2020017112A1
Application number: PCT/JP2019/015657
Authority: WO
Inventors: 漆畑　直樹; 勝幸隠岐; 桃子小林
Original assignee: 株式会社バイオミメティクスシンパシーズ
Priority date: 2018-07-17
Filing date: 2019-04-10
Publication date: 2020-01-23
Also published as: JP6497827B1; CN111727046A; JP2020011915A; CN111727046B

Abstract

[Problem] To provide a medical composition for promoting the production of a PPARγ activator from macrophages. [Solution] An eicosanoid production promoter for promoting the production of an eicosanoid from macrophages, the eicosanoid production promoter containing a secretion of mesenchymal stem cells as an active ingredient, wherein the eicosanoid is one or both of 15-deoxy-delta-12,14-prostaglandin J2 and 15-hydroxyeicosatetraenoic acid (15-HETE).

Description

Eicosanoid production promoter

(4) The present invention relates to a pharmaceutical composition for promoting the production of eicosanoids from macrophages.

Activation of PPARγ in macrophages suppresses conversion of macrophages to an inflammatory phenotype by treatment with lipopolysaccharide (LPS) or interferon γ (INFγ) (Non-Patent Document 1). The iNOS gene, which produces nitric oxide necessary for host defense, causes the inflammatory response to be exacerbated when overexpressed. However, 15-deoxy-delta-12,14-prostaglandin J2, a PPARγ activating ligand, is activated. (15-deoxy-δ-12,14-PGJ2) remarkably suppresses the transcription level of the iNOS gene and the activation level of NFκB that controls the gene expression.

Furthermore, it has been reported that activation of PPARγ in macrophages contributes to muscle regeneration. PPARγ deficiency leads to poor regeneration of skeletal muscle, and conversely ligand-activated PPARγ promotes gene expression of transforming growth factor (TGF) family growth differentiation factor 3 (GDF3), and GDF3 It has been reported that cell regeneration is promoted by promoting cell division (Non-Patent Document 2).

In addition, PPARγ-deficient animals in macrophages have not progressed to differentiation into anti-inflammatory macrophages (M2 type), and mice with a high fat diet have reduced glucose tolerance during glucose load and reduced insulin sensitivity (non Patent Document 3).

Patent No. 3518547 (Patent Document 1) describes eicosanoids as immunosuppressants.

Patent No. 5950428 (Patent Document 2) discloses, as examples of PPARγ ligands, 15-deoxy-Δ12,14-prostaglandin J2, nitrolinoleic acid, oxidized LDL, long-chain fatty acids, eicosanoids, thiazolidinedione drugs, And non-steroidal anti-inflammatory drugs.

Patent No. 3518547 Patent No. 5950428

In view of the above background, a pharmaceutical composition capable of activating PPARγ in macrophages has been desired.
Therefore, an object of the present invention is to provide a medical composition that promotes the production of a PPARγ activator from macrophages.

The present invention is basically based on the fact that those containing secretions of mesenchymal stem cells, such as culture supernatants of mesenchymal stem cells, promote the production of eicosanoids from macrophages, and eicosanoids are PPARγ activating ligands. Based on the finding that PPARγ is activated.

The first aspect of the present specification relates to an eicosanoid production promoter for promoting the production of eicosanoids from macrophages. This agent contains a secretion of mesenchymal stem cells as an active ingredient.
The mesenchymal stem cells are preferably mesenchymal stem cells derived from subcutaneous adipose tissue or umbilical cord tissue.
The eicosanoid is any of 15-deoxy-delta-12,14-prostaglandin J2 (15-deoxy-δ-12,14-PGJ2) and 15-hydroxyeicosatetraenoic acid (15-HETE) Or both.
Examples of secretions of mesenchymal stem cells are culture supernatants of mesenchymal stem cells or components of culture supernatants of mesenchymal stem cells, and are preferably culture supernatants using a serum-free medium.
Preferably, the agent does not contain IL-4. The phrase "containing no IL-4" includes those in which the agent does not contain IL-4 at all, as well as those in which the agent does not contain an amount of IL-4 that expresses a physiological activity.
This agent is preferably a therapeutic agent for arteriosclerosis or diabetes.
This agent is preferably a therapeutic agent for rheumatoid arthritis.
This agent is preferably a prophylactic or therapeutic agent for prostate cancer, cerebral infarction, or cerebral dysfunction.
This agent is preferably a prophylactic or therapeutic agent for pain.

According to the present invention, a medical composition that promotes the production of a PPARγ activator from macrophages can be provided.

FIG. 1A is a graph instead of a drawing showing the results of quantitative analysis of 15-deoxy-delta-12,14-prostaglandin J2. FIG. 1B is a graph instead of a drawing showing the results of quantitative analysis of 15-HETE. FIG. 2A is a photograph instead of a drawing showing cells after culture. FIG. 2B is a graph instead of a drawing showing the results of quantitative RT-PCR. FIG. 3 is a photograph replacing a drawing showing a fluorescence micrograph after staining with CD36. In the figure, “Merge” indicates a superimposed image of the phase difference photograph and the fluorescent photograph of CD36 staining. FIG. 4 is a graph instead of a drawing, showing the results of ELISA quantitative analysis showing the expression level of IL-4.

PPARγ is a transcription activator activated by ligand binding, and its function as a master regulator that promotes differentiation into adipocytes is best known. On the other hand, PPARγ in macrophages is also important as a factor having an important medical effect.

PPARγ endogenous activating ligands include 15-deoxy-delta-12,14-prostaglandin J2 (15-deoxy-δ-12,14-PGJ2) and 15-hydroxyeicosatetraenoic acid (15-deoxy-delta-12,14-PGJ2). HETE), prostaglandin D2 (PGD2), serotonin metabolites 5-hydroxyindoleacetic acid (5-HIAA), 5-methoxyindoleacetic acid (5-MIA), and the like. Rosiglitazone, pioglitazone, NSAIDs indomethacin and the like are known. A plurality of substances activate PPARγ, and are classified into full agonists having a full action and partial agonists having a partial action, depending on the binding site of PPARγ.

PAs mentioned above, PPARγ is a specific fatty acid metabolite or eicosanoid as an endogenous ligand, but prostaglandin E2 does not function as a ligand for PPARγ.

Pioglitazone (15 mg tablet), which is a PPARγ activator sold as a diabetes improving drug, has a maximum blood concentration reaching time (T-max) of 2.1 ± 0.9 hours and a blood concentration half-life (T-max). -Half) is 5.3 ± 1.6 hours, and adults usually receive 15 mg of pioglitazone once a day to compensate for the decrease in blood concentration (medicine interview form—Japanese Pharmacopoeia) Pioglitazone hydrochloride tablets). Furthermore, the use of pioglitazone is contraindicated in patients with heart failure, patients with severe renal impairment, patients with severe liver impairment, etc., and in patients with renal failure as a complication of diabetes, In some cases, use was restricted.

The first aspect of the present specification relates to an eicosanoid production promoter for promoting the production of eicosanoids from macrophages.

剤 This drug contains secreted mesenchymal stem cells as an active ingredient. Examples of secretions of mesenchymal stem cells are culture supernatants or components derived from culture supernatants. The mesenchymal stem cells are preferably mesenchymal stem cells derived from subcutaneous adipose tissue or umbilical cord tissue. Examples of secretions of mesenchymal stem cells are culture supernatants of mesenchymal stem cells or components of culture supernatants of mesenchymal stem cells, and are preferably culture supernatants using a serum-free medium. This agent preferably does not contain an amount of IL-4 that expresses a physiological activity.

Mesenchymal stem cells are a cell population with anti-inflammatory activity, and cellular drugs are being developed. There is a close functional correlation between mesenchymal stem cells and macrophages that play a central role in the inflammatory response. Mesenchymal stem cells change macrophages from M1 type (inflammatory type) to M2 type (anti-inflammatory type) and terminate the inflammatory response. Its actions are the CC motif chemokine ligand の 2 (CCL2) of proteins secreted from mesenchymal stem cells, Siglec-9 of the sialic acid receptor protein family and (J Neurosci. 2015 Feb 11; 35 (6): 2452-64.), And the eicosanoid prostaglandin E2 (PGE2) is responsible (Luan B. et. Al., Proc Natl Acad Sci U U S A. 2015 Dec 22; 112 (51): 15642-7.).

As noted above, activation of PPARγ often has clinically beneficial consequences. In addition, the function of PPARγ in macrophages is one particularly important. The use of interleukin 4 (IL-4) has been reported to enhance the production of endogenous PPARγ ligands from macrophages (Nature. 1999 Jul 22; 400 (6742): 378-82. ). However, interleukin 4 has a risk of side effects such as promotion of IgE production, atopic dermatitis, and increased sensitivity of allergic reactions in addition to its action. Is difficult to choose. In fact, a monoclonal antibody against the interleukin 4/13 receptor has been approved as a therapeutic agent for atopic dermatitis (packaged human anti-IL-4 / 13 receptor monoclonal antibody Sanofi Co., Ltd.).

(4) In the present invention, it has been newly discovered that a component secreted by mesenchymal stem cells has an effect of accelerating the production of a PPARγ-activating ligand from macrophages. More specifically, 15-deoxy-delta-12,14-prostaglandin J2 (15-deoxy-δ-12,14-PGJ2) and 15-hydroxyeicosatetraenoic acid (15-HETE) Corresponds to that.

Little is known about agents or methods that increase PPARγ ligand production. Some reports have shown that IL-4 was secreted from mesenchymal stem cells for the aforementioned interleukin-4 (PLoS \ One. \ 2013 \ Sep \ 12; 8 (9): e73722.) , Interleukin 4 is a factor mainly produced from mast cells, activated T cells and the like, and its expression is usually not recognized in mesenchymal stem cells. Interleukin-4 was not contained in the mesenchymal stem cell-derived culture supernatant of the present invention. Therefore, the novelty of the present invention exists as a culture supernatant derived from mesenchymal stem cells that does not contain interleukin 4 and that functions as a PPARγ-activating ligand production promoter.

The pharmaceutical composition of the present invention was confirmed to have a substance other than interleukin 4 in which secretion of mesenchymal stem cells had an effect of enhancing PPARγ ligand production.

The secretion of mesenchymal stem cells having a PPARγ ligand production promoting action can be usually obtained as a culture supernatant of mesenchymal stem cells. The mesenchymal stem cells are preferably derived from adipose tissue or umbilical cord tissue, but the tissues that separate mesenchymal stem cells are not limited, and mesenchymal stem cells isolated from dental pulp, amniotic membrane, bone marrow, or umbilical cord blood Furthermore, mesenchymal stem cells differentiated from embryonic stem cells (ES cells) and mesenchymal stem cells differentiated from induced pluripotent stem cells (iPS cells) may be used.

The mesenchymal stem cells for effectively carrying out the present invention may be derived from humans or animals. Tissues to be cultured may be free of microorganisms as much as possible, and may be subjected to bactericidal or bacteriostatic treatment with an antibacterial agent or an antifungal agent, if necessary. In the cultivation, it is necessary to perform the cultivation by an aseptic operation so that there is no propagation of microorganisms.

For the culture of mesenchymal stem cells, flasks and enzymes used in general cell biology experiments and the like can be arbitrarily selected. Serum medium is selected. More desirably, for all reagents, culture media, flasks, and the like, products that do not use animal or human components can be selected, and biological safety as a pharmaceutical composition can be ensured.

The cell division frequency (PDL) of the mesenchymal stem cells for recovering the culture supernatant of the mesenchymal stem cells is not particularly limited, but is preferably 0 to 100 in non-transformed cells. Preferably, PDLs 5 to 20 are selected. The optimum values of these vary depending on the medium used. In the transformed cells, collection of the culture supernatant can be continued as long as the characteristics of the cells are maintained.

Regarding the number of cells to be seeded, when the culture supernatant is collected in a flat culture such as a T flask, the cells are seeded at 100 to 50,000 cells / cm ² , and more preferably at 500 to 15,000 cells / cm ² . And most preferably seeded at 2,000 to 6,000 cells / cm ² . The culture supernatant as the PPARγ ligand production promoter of the present invention should be collected between the time when the cell growth rate becomes about 90% of the flask area and the day 20 in the case of planar culture. And more preferably from the second day to the fifth day.

In addition to the flat culture, the culture supernatant may be collected by hollow fiber culture or culture using a microcarrier, and the culture method is limited as long as the environment allows mesenchymal stem cells to be cultured well. It is not something to be done.

However, any culture method in which the amount of interleukin-4 protein detected by a biochemical method is secreted into the culture supernatant of mesenchymal stem cells at a concentration that expresses a biological activity should not be taken. More specifically, the concentration of interleukin 4 is preferably 1 pg / mL or less.

否定 As a negative test to confirm that interleukin 4 is not contained in the culture supernatant at a concentration higher than that concentration, an ELISA method using an antibody against interleukin 4 or a Western blot method is selected. In this case, the practitioner should carefully consider the characteristics of the non-specific reaction inherent in the antibody, quantify the control sample with the culture supernatant at the same time, and make a reasonable comparison of the results with the control sample. Note that you need to make a decision. More specifically, antibodies are sometimes seen to react with non-specific antigens, especially for antibodies sold as research reagents. It is also effective to complement the absence of interleukin-4 gene expression by gene expression analysis in conjunction with the antibody-based negative test.

Next, the obtained culture supernatant containing secreted mesenchymal stem cells is desirably stored in a refrigerated or frozen state at 4 ° C or lower, where many substances are stable. The obtained culture supernatant is subjected to aseptic treatment usually selected from a filter of PES material of 0.1 to 0.2 μm, a virus clearance filter for removal of virus, an ultrafiltration filter for component concentration, and the like. May be.

The culture supernatant containing the mesenchymal stem cell-derived secretion as a pharmaceutical composition thus obtained by the practice of the present invention can directly act on macrophages to reduce the production of PPARγ ligand from the acted macrophages. Can be promoted. In a test tube, a culture supernatant derived from mesenchymal stem cells may be directly added to the cultured macrophages. In general, the treatment for 1 to 3 days enhances the production of PPARγ ligand from macrophages, and the PPARγ ligand is recovered in the culture medium of macrophages. As a matter of course, the PPARγ ligand before secretion outside the cell can also be recovered from the macrophage cell.

Macrophages are present in all tissues in the body, and are monocytes in the bone marrow and blood vessels as poorly differentiated monocytes, as tissue macrophages in other tissues, alveolar macrophages in the lung, glial cells in the brain, and destruction in bone. There are bone cells, intestinal macrophages in the intestine, Kupffer cells in the liver, and marginal zone macrophages in the spleen. When the present invention is made to act in vivo, the production of the PPARγ ligand may be enhanced by effectively delivering the pharmaceutical composition according to the present invention to a tissue in which PPARγ ligand production from macrophages is to be activated. . More specifically, for example, the liver may be used by administering the agent of the present invention from the hepatic portal vein, or the brain may be used by delivering it directly from the nose through the nasal mucosal epithelium to the brain. May be. Injection and application under the skin. In order to effect the present pharmaceutical composition most widely and systemically, intravenous injection may be selected. In addition, the composition of the appropriate pharmaceutical composition may be constituted depending on the method of delivery. For example, when the present invention is used as a subcutaneous agent for application in application, it is combined with a sustained-release pharmaceutical base (PLGA), which is a component that promotes subcutaneous penetration, etc. The pharmaceutical compositions of the invention may be delivered effectively.

(4) If the production of PPARγ ligand from macrophages is enhanced, the PPARγ of its own macrophage, which is the closest, is naturally activated. As a result, a therapeutic effect is exerted on a group of diseases in which PPARγ of macrophages is involved in the onset, so that the present pharmaceutical composition can be used as a prophylactic or therapeutic agent for them.

Examples of the culture supernatant of mesenchymal stem cells include a supernatant obtained by solid-liquid separation of the culture supernatant by centrifugation, a processed supernatant obtained by removing water by lyophilization, and an evaporator. The product obtained by concentrating the culture supernatant under reduced pressure using a method such as the above, the product obtained by concentrating the culture supernatant using an ultrafiltration membrane, etc., or the culture supernatant is solid-liquid separated using a filter. Or a stock solution of the culture supernatant before the treatment as described above. Further, for example, the supernatant obtained by culturing the mesenchymal stem cells of the present invention is centrifuged (for example, 1,000 × g, 10 minutes), and then fractionated with ammonium sulfate (for example, 65% saturated ammonium sulfate) to obtain a precipitate. May be suspended in an appropriate buffer, dialyzed, and filtered through a syringe filter (for example, 0.2 μm) to obtain a sterile culture supernatant. The collected culture supernatant can be used as it is, or can be stored frozen and thawed at the time of use. Alternatively, a pharmaceutically acceptable carrier may be added and the solution may be dispensed into a sterile container so as to have an easily handled liquid volume, for example, 0.2 ml or 0.5 ml. Furthermore, as a measure against the risk of infectious pathogens, the culture supernatant may be treated with a virus clearance filter or ultraviolet irradiation.

剤 An agent containing a culture supernatant as an active ingredient is known as disclosed in, for example, JP-A-2013-18756, Japanese Patent No. 5139294, and Japanese Patent No. 5526320. Therefore, the agent containing the culture supernatant of the present invention can be produced by a known method.

(4) As the dosage form of the culture supernatant according to the present invention, both liquid and solid preparations can be selected. For protein-based biopharmaceuticals, powdering with excellent storage stability is often selected due to stability problems. It is desirable that the culture supernatant of the present invention is also produced as a solid preparation in order to improve the stability and the storage period.

(4) In the agent of the present invention, a culture supernatant as an active ingredient may be prepared together with a pharmaceutically acceptable carrier or medium. Pharmaceutically acceptable carriers or vehicles include, for example, excipients, stabilizers, solubilizers, emulsifiers, suspending agents, buffers, isotonic agents, antioxidants, or preservatives. Substances that are acceptable. Further, a polymer material such as polyethylene glycol (PEG) or a conjugation inhibitor such as cyclodextrin can also be used. Examples of excipients are those which themselves have no pharmacological action, such as starch or lactose. Examples of stabilizers are albumin, gelatin, sorbitol, mannitol, lactose, sucrose, trehalose, maltose, and glucose. Of these, sucrose or trehalose is preferred. Examples of solubilizers are ethanol, glycerin, propylene glycol, and polyethylene glycol. Examples of emulsifiers are lecithin, aluminum stearate, or sorbitan sesquioleate. Examples of suspending agents are macrogol, polyvinylpyrrolidone (PVP), or carmellose (CMC). Examples of tonicity agents are sodium chloride and glucose. Examples of buffers are citrate, acetate, boric acid, and phosphate. As the aqueous medium for diluting the culture supernatant preparation, for example, an aqueous solution for injection in which the osmotic pressure and pH are adjusted to a physiological range and the salt concentration and the like are adjusted may be used as appropriate. Ringer's solution such as acetic acid-ringer solution or other infusions, physiological saline, glucose solution, or the like can be used, but is not limited thereto. Examples of antioxidants are ascorbic acid, sodium bisulfite, and sodium pyrosulfite. Examples of preservatives are phenol, thimerosal, and benzalkonium chloride.

The agent containing the secretion of mesenchymal stem cells such as the culture supernatant of mesenchymal stem cells of the present invention (the agent of the present invention) may be administered intravenously, intraarterially, intramuscularly, subcutaneously, intraperitoneally, or in the nasal cavity. The administration can be performed by a known administration method such as internal administration, intrathecal spinal transplant, intraarticular transplant, intragingival injection, and application. The agent of the present invention may be directly injected into an affected part or a target site, or the agent of the present invention may be administered by opening the affected part by surgical operation. All optimal administration methods are possible depending on the disease to be treated. When intravenous injection is selected as the transplantation method, it is preferable to administer the culture supernatant in a dose of 1 mL or more and 1,000 mL or less, more preferably 30 mL or more and 300 mL or less, as one unit.

This agent is preferably a therapeutic agent for arteriosclerosis or diabetes. Patent No. 6250196 describes that a PPAR agonist is a therapeutic agent for diabetes. Japanese Patent No. 4515026 shows that activating PPARγ is effective for treating diabetes. Japanese Patent No. 6157041 discloses that a PPARγ activator is effective for treating arteriosclerosis and diabetes. Since the agent of the present invention activates PPARγ, it is effective for treating arteriosclerosis and diabetes.

This agent is preferably a therapeutic agent for rheumatoid arthritis. In a rheumatoid arthritis model, 15-deoxy-delta-12,14-prostaglandin J2 is known to suppress rheumatic clinical score, pain, and edema (Mediators Inflamm. 2016; 2016: 9626427. Epub 2016) Oct 31.). The agent of the present invention promotes the production of eicosanoid which is an activator of PPARγ from macrophages. For example, the agent promotes the production of 15-deoxy-delta-12,14-prostaglandin J2. It is effective for treating rheumatism.

This agent is preferably a prophylactic or therapeutic agent for prostate cancer, cerebral infarction, or cerebral dysfunction. For example, Cancer Res. 2001 2001 Jan 15; 61 (2): 497-503. Reports that 15-HETE suppresses the growth of prostate cancer cell line (PC3) and suppresses multiple carcinomas. Have been. In addition, J-Lipid Res. 2015 Mar; 56 (3): 502-14 shows that administration of 15-HETE suppresses brain tissue injury level after cerebral ischemia and inflammatory response in the brain in a cerebral infarction model. It has been reported. The agent of the present invention promotes the production of eicosanoid which is an activator of PPARγ from macrophages. For example, the agent of the present invention promotes the production of 15-hydroxyeicosatetraenoic acid (15-HETE). It is effective for the treatment of. Patent No. 5940261 discloses that a peroxisome proliferator-activated receptor gamma (PPARγ) activator can prevent and improve at least one of hypertension, insulin resistance disease, cerebral infarction, Alzheimer's disease, and neurological disease. Has been described. Since the agent of the present invention activates PPARγ, it is effective for prevention and treatment of cerebral infarction and cerebral dysfunction.

This agent is preferably a prophylactic or therapeutic agent for pain. For example, Exp. Ther. {Med. In 2016 {Oct; 12 (4): 2644--2650.}, Administration of pioglitazone, an activator of PPARγ, suppresses activated microglia in neuropathic pain and consequently reduces pain threshold for mechanical stimulation It is shown. The agent of the present invention promotes the production of eicosanoid which is an activator of PPARγ from macrophages. For example, it promotes the production of 15-deoxy-delta-12,14-prostaglandin J2, and It is effective for prevention or treatment of

This application also provides the use of secreted mesenchymal stem cells to produce an eicosanoid production promoter for promoting the production of eicosanoids from macrophages.

This application also provides a method of promoting the production of eicosanoids from macrophages present in the body of a subject, comprising the step of administering a secretion of mesenchymal stem cells to the subject. The application also provides a method of treating or preventing arteriosclerosis, diabetes, rheumatoid arthritis, prostate cancer, cerebral infarction, or cerebral dysfunction, comprising administering to the subject a secretion of mesenchymal stem cells.

The pharmaceutical composition according to the present invention can continuously increase the amount of an endogenous PPARγ activating ligand in vivo by promoting the production of an endogenous PPARγ activating ligand from macrophages in vivo. . Furthermore, the production of macrophages that require PPARγ activation enables macrophages to preferentially and effectively receive PPARγ activation, and to activate PPARγ at a high concentration for treatment. Since there is no need to administer the ligand, it can be expected that a pharmaceutical composition having high safety in terms of side effects will be obtained.

1. Quantification of eicosanoids in macrophage culture supernatant To evaluate the effect of secretions from mesenchymal stem cells on the amount of eicosanoids secreted from macrophages, human macrophage cell line THP-1 was used as a culture supernatant of mesenchymal stem cells. After treatment with E. coli, the amount of eicosanoid secreted from macrophages was quantified. For eicosanoid quantification, the culture supernatant of macrophages was used as a measurement sample.

1.1 Preparation of culture supernatant from adipose tissue-derived mesenchymal stem cells <Primary culture (P0)>
After obtaining consent for the research use of surplus tissue from the subcutaneous adipose tissue, which is a raw material necessary for the preparation of cells for administration, from patients undergoing regenerative medicine using adipose tissue-derived mesenchymal stem cells Subcutaneous fat was provided and used for primary culture. The subcutaneous adipose tissue was subjected to centrifugation (400 × g for 5 minutes), and separated into three layers of a lipid fraction, an adipose tissue fraction, and an aqueous fraction in order from the upper layer. The upper and lower layers were discarded, leaving the middle adipose tissue fraction. To the remaining adipose tissue fraction, a 0.15% collagenase enzyme solution in an amount 4 times the weight of the tissue was added, and the mixture was permeated at 37 ° C. for 1 hour to perform enzyme treatment. After the adipose tissue is dispersed, centrifuge (400 xg for 5 minutes), and suspend the precipitated fraction as a stromal vascular cell fraction containing mesenchymal stem cells in 30 mL of PBS (-) solution. did. Thereafter, the suspension was passed through a cell strainer (70 μm diameter), and the flow-through fraction was subjected to centrifugation again (400 × g for 5 minutes), and the tissue residue and the like captured by the cell strainer were discarded. The precipitate fraction was suspended in 6 mL of a serum-free culture solution (Procul AD (registered trademark); Rohto Pharmaceutical Co., Ltd.), the whole volume was inoculated into a T-25 flask (CellBIND (registered trademark); Corning), and the whole was inoculated (37 ° C) , 5% CO ₂ ) to start primary culture.

<Subculture (P0 → P1 → P2)>
The medium was completely changed once every three days, the supernatant was discarded, and the cells growing on the bottom of the flask were selectively grown. To the cells in a T-25 flask that had grown to semi-confluence, 2 mL of an enzyme solution (TrypLE Secret (registered trademark); Thermo Fisher Scientific) was added, and the cells were detached (rest at 37 ° C for 5 minutes). The cells were diluted with PBS (-) and subjected to centrifugation (400 xg for 5 minutes). The precipitated cells were suspended in a culture solution, the cell number was measured by a trypan blue staining method, and seeded in a T-150 flask (CellBIND (registered trademark); Corning) with a serum-free culture solution (Procul AD; Rohto Pharmaceutical). The cells were allowed to stand in an incubator (37 ° C., 5% CO ₂ ) and subcultured (P0 → P1). Thereafter, the cells were subcultured in the same procedure to obtain the required number of cells (P1 → P2).

<Preparation of culture supernatant>
In the preparation of the culture supernatant, a serum-free culture medium (Procul AD; Rohto Pharmaceutical) was used as the medium. Adipose tissue-derived mesenchymal stem cells were seeded in the same medium at the number of 4.5 × 10 ⁵ cells per T-150 flask, and the culture supernatant was collected on the third day when the cells reached semi-confluence. The culture supernatant was filtered through a 0.2 μm PES syringe filter (25 mm GD / X syringe filter (PES 0.2 μm sterilized); 6896-2502; GE Healthcare Japan) at −28 ° C. until used for analysis. It was kept frozen.

1.2 Preparation of culture supernatant from umbilical cord tissue-derived mesenchymal stem cells <Primary culture (P0)>
The umbilical cord tissue obtained with the consent of a parturition woman who normally gave birth was subjected to primary culture the day after collection. After removing cord blood from about 10 cm of umbilical cord tissue, it was cut into about 5 mm with a medical scalpel, immersed in a 0.15% collagenase solution, and subjected to enzyme treatment at 37 ° C. for 16 hours while gently stirring with a shaker. After visually confirming the dispersion of the umbilical cord tissue, the suspension was diluted 10-fold with PBS (-), centrifuged at 1,000 × g for 5 minutes, and the upper layer was discarded except for the precipitated fraction. After that, the precipitate fraction was suspended in PBS (-), applied to a 70 μm filter, the flow-through fraction was equally divided into two conical tubes, and then subjected to centrifugation at 400 × g for 5 minutes. Was suspended in 24 mL of serum-free culture medium (Procul AD (registered trademark); Rohto Pharmaceutical). Thereafter, the entire amount was inoculated into one T-150 flask (CellBIND (registered trademark); Corning), and left to stand in an incubator (37 ° C., 5% CO 2) to start primary culture.

<Subculture (P0 → P1 → P2)>
The medium was completely changed once every two days, the supernatant was discarded, and the cells growing on the bottom of the flask were selectively grown. 6 mL of an enzyme solution (TrypLE Secelt (registered trademark); Thermo Fisher Scientific) was added to the cells in a T-150 flask that had grown to semi-confluence, and the cells were detached (rest at 37 ° C. for 5 minutes). The cells were diluted with PBS (-) and subjected to centrifugation (400 xg for 5 minutes). The precipitated cells were suspended in a culture solution, the cell number was measured by trypan blue staining, and the cells were seeded in a T-150 flask (CellBIND (registered trademark); Corning) with a serum-free culture solution (Procul AD; Rohto Pharmaceutical). The subculture was carried out by leaving still in an incubator (37 ° C., 5% CO 2) (P0 → P1). The medium was completely changed once every two days, and then subculture was performed in the same manner to secure the required number of cells (P1 → P2).

<Preparation of culture supernatant>
In the preparation of the culture supernatant, a serum-free culture solution (Procul AD (registered trademark); Rohto Pharmaceutical Co., Ltd.) was used as the medium. Umbilical cord tissue-derived mesenchymal stem cells were seeded at 9.0 × 10 ⁵ cells per T-150 flask in the same medium, and the culture supernatant was collected on the third day when the cells reached semi-confluence. The culture supernatant was filtered through a 0.2 μm PES syringe filter (25 mm GD / X syringe filter (PES 0.2 μm sterilized); 6896-2502; GE Healthcare Japan) and kept at -28 ° C until used for analysis. It was kept frozen.

1.3 Preparation of culture supernatant of macrophage The culture supernatant obtained from fat and umbilical cord tissue-derived mesenchymal stem cells prepared as described above was added to the culture system of human macrophage cell line THP-1. As a control, a serum-free culture solution (Procul AD; Rohto Pharmaceutical Co., Ltd.) used for culturing the culture supernatant of mesenchymal stem cells was added.

The specific procedure was as follows. THP-1 was seeded in a T-25 flask (CellBIND; Corning) at 5.0 × 10 ⁵ per well. The medium was supplemented with 100 nM LPS for RPMI with 10% FBS to activate THP-1. The medium volume was 6.0 mL per flask. On the following day, the medium was changed, and 3.6 mL of RPMI containing 10% FBS and 2.4 mL of a test substance were added per well, and LPS having a final concentration of 100 nM was added. Three kinds of test substances were used: culture supernatant of mesenchymal stem cells derived from adipose tissue, culture supernatant of mesenchymal stem cells derived from umbilical cord tissue, or Procul AD medium (Rohto Pharmaceutical) as a control. Thereafter, culture was performed for 2 days, and the culture supernatant of THP-1 was recovered. The collected culture supernatant is filtered through a 0.2 μm PES syringe filter (25 mm GD / X syringe filter (PES 0.2 μm sterilized); 6896-2502; GE Healthcare Japan) until it is used for analysis. It was kept frozen at 80 ° C.

1.4 Quantification of eicosanoids Eicosanoids, which are PPARγ activating agonists, were quantified by liquid chromatography mass spectrometry (LC-MS / MS). The THP-1 culture supernatant treated with the above-mentioned mesenchymal stem cell-derived culture supernatant and the mesenchymal stem cell culture supernatant were also quantified.

<Preparation of standard substance>
15-deoxy-delta-12,14-prostaglandin J2 (15-deoxy-δ-12,14-PGJ2) and 15-HETE, and deuterium-labeled prostaglandin E2 as an internal standard substance ( After dissolving PGE2-d4) in methanol, it was diluted 2-fold with ultrapure water to prepare standard solutions of 10 ng / mL each.

<Pretreatment of sample>
After adding and mixing 100 μL of 5 ng / mL methanol solution of PGE2-d4 to 900 μL of THP-1 culture supernatant, the solid phase extraction column Empore Solid Phase Extraction Cartridge C18 Standard Density, 4 mm / 1 mL (3M )) To purify the fraction containing eicosanoids. More specifically, 1 mL of methanol and 1 mL of ultrapure water were provided for equilibration of the resin, the sample was provided, and the resin was washed with 1 mL of ultrapure water. Thereafter, dehydration was performed by centrifugation at 9,100 × g for 1 minute, and 500 μL of methanol was used for elution. The eluted fraction was centrifuged to dryness by a rotary evaporator, dissolved in a shaker after adding 50 μL of methanol (2,500 rpm, 5 minutes). Then, 50 μL of ultrapure water was added and mixed to obtain a sample for LC-MS / MS measurement.

<Analysis conditions>
Table 1 shows the analysis conditions of LC-MS / MS.

<Quantitative analysis>
Analysis software MassLynx ver.4.1 (Waters) was used for peak detection. The detection limit was a signal-to-noise ratio (S / N) = 3. The area value of the detected peak was divided by the peak area value of the internal standard substance (PGE2-d4) to perform normalization. After normalizing the 10 ng / mL standard solution and the analysis sample, the concentration in the sample was calculated from the peak area ratio and the concentration ratio (18 times) in the pretreatment. The quantification results are shown in FIGS. 1A and 1B. FIG. 1A is a graph instead of a drawing showing the results of quantitative analysis of 15-deoxy-delta-12,14-prostaglandin J2. FIG. 1B is a graph instead of a drawing showing the results of quantitative analysis of 15-HETE.

The culture supernatant of adipose tissue-derived mesenchymal stem cells and the culture supernatant of umbilical cord tissue-derived mesenchymal stem cells contained 15-deoxy-delta-12,14-prostaglandin J2 (15-deoxy-δ-12). , 14-PGJ2) and 15-HETE were not detected (“AD-CM” and “UC-CM” in FIGS. 1A and 1B). On the other hand, those eicosanoids were detected in the culture supernatant of THP-1 in all samples. For 15-deoxy-delta-12,14-prostaglandin J2 (15-deoxy-δ-12,14-PGJ2), 0.001 ng / mL of THP-1 treated with Prucul AD medium (FIG. 1A and FIG. 1B "THP-1 @ Procul @ AD"), THP-1 treated with the culture supernatant of adipose tissue-derived mesenchymal stem cells was 0.0014 ng / mL ("THP-1 @ AD-CM" in FIGS. 1A and 1B). ), THP-1 treated with the culture supernatant of umbilical cord tissue-derived mesenchymal stem cells was 0.0018 ng / mL (“THP-1 @ UC-CM” in FIGS. 1A and 1B). Next, for 15-HETE, THP-1 treated with Prucul AD medium was 0.006 ng / mL, THP-1 treated with the culture supernatant of adipose tissue-derived mesenchymal stem cells was 0.01 ng / mL, and umbilical cord was used. THP-1 treated with the culture supernatant of tissue-derived mesenchymal stem cells was 0.013 ng / mL. In this way, the culture supernatant containing the secretion of mesenchymal stem cells is allowed to act on macrophages, thereby producing 15-deoxy-delta-12,14-prostaglandin J2 (15-deoxy-δ-12, 14-PGJ2) and 15-HETE were found to increase. The secretion of mesenchymal stem cells was found to be a PPARγ activating agonist production promoter for macrophages.

2. Analysis of gene expression of PPARγ regulatory factor In macrophage cells (THP-1) obtained by treating the culture supernatant of mesenchymal stem cells, expression analysis of CD36 and FABP4, which are typical genes controlled by PPARγ, was performed. Both genes are known as major genes whose expression is increased in a PPARγ-dependent manner by treating cells with a PPARγ-activating agonist, and can be used as an index for knowing the activation state of PPARγ.

2.1 Cell culture and RNA extraction
THP-1 was seeded in a 12-well plate (CellBIND; Corning) at 1 × 10 ⁵ cells per well. The culture medium was supplemented with RPMI supplemented with 10% FBS with 100 nM PMA for THP-1 activation. The medium volume was 800 μL per well. On the next day, the medium was changed, and 600 μL of RPMI medium supplemented with 10% FBS and 400 μL of a culture medium for mesenchymal stem cell culture or control were added per well. As a mesenchymal stem cell culture supernatant, a sample of the same lot as that used for eicosanoid quantification in “Example 1” was used and prepared from adipose tissue-derived mesenchymal stem cells and umbilical cord tissue-derived mesenchymal stem cells. The culture supernatant was used. The control medium used was serum-free medium Procul AD (Rohto Pharmaceutical) used for cell culture when preparing the culture supernatant of mesenchymal stem cells, and RPMI without FBS.

After 3 days, the medium was removed, the cells were lysed with TRI Reagent (Molecular Research Center; TR118), and total RNA was extracted using SV Total RNA Isolation System (Promega; Z3100) according to the instructions attached to the kit. Was. FIG. 2A shows a photograph of the cells subjected to RNA extraction. FIG. 2A is a photograph instead of a drawing showing cells after culture.

2.2 Quantitative RT-PCR
From 1 μg of the total RNA, a reverse transcription reaction was performed with an Oligo dT primer using PrimeScript (registered trademark) II 1st strand cDNA Synthesis Kit (Takara Bio; 6210A). Using the obtained cDNA as a template, quantitative PCR of the CD36 gene and the FABP4 gene was performed using THUNDERBIRD (registered trademark) SYBR qPCR Mix (TOYOBO; QPS-201). The apparatus used was Mx3000P (Agilent Technologies), and the following primers were used. GAPDH gene was used for internal correction of each gene expression level.

"PPARγ primer sequence"
PPARγ-Fw: gacaggaaagacaacagacaaatc (SEQ ID NO: 1)
PPARγ-Rv: ggggtgatgtgtttttgaacttg (SEQ ID NO: 2)

"FABP primer sequence"
FABP4-Fw: ccaccataaagagaaaacgagag (SEQ ID NO: 3)
FABP4-Rv: gtggaagtgacgcctttcat (SEQ ID NO: 4)

"CD36 primer sequence"
CD36-Fw: gcagcaacattcaagttaagca (SEQ ID NO: 5)
CD36-Rv: gctgcaggaaagagactgtgt (SEQ ID NO: 6)

"GAPDH primer sequence"
GAPDH-Fw: ttcaccaccatggagaagg (SEQ ID NO: 7)
GAPDH-Rv: cacacccatcacaaacatgg (SEQ ID NO: 8)

PCR conditions were performed according to the procedure manual of the reagent manufacturer. The composition of the PCR reaction solution was as shown in Table 2a, and the PCR reaction conditions were as shown in Table 2b.

結果 The results of the quantitative RT-PCR are shown in FIG. 2B. FABP4 and CD36, PPARγ response genes, were expressed in THP-1 treated with culture supernatant containing secretion from adipose tissue-derived mesenchymal stem cells and umbilical cord tissue-derived mesenchymal stem cells (in FIG. 2B, the former was referred to as “AD -CM ", the latter is referred to as" UC-CM "), and the gene expression level of each gene was significantly increased as compared with the control medium-added group (" RPMI "and" ProculProAD "in Fig. 2B). Was. The control sample added to THP-1 for eicosanoid quantification in "Example 1" is "Procul @ AD", but compared to THP-1 treated with Procul @ AD, 15-deoxy-delta-12, In THP-1 in which increased production of 14-prostaglandin J2 (15-deoxy-δ-12,14-PGJ2) and 15-HETE was detected (THP treated with culture supernatant derived from mesenchymal stem cells) -1), It was confirmed that the expression of FABP4 and CD36, which are PPARγ response genes, was increased.

2.3 CD36 antibody immunostaining Next, we evaluated the induction of protein expression by the action of the secretory component of mesenchymal stem cells for CD36, a scavenger receptor that has the function of taking up oxidized lipids etc. into cells induced by PPARγ expression. did.

The specific procedure was as follows. THP-1 was seeded in a 6-well plate (CellBIND; Corning) at 2.5 × 10 ⁵ per well. The medium was supplemented with 100 nM LPS for RPMI with 10% FBS to activate THP-1. The medium volume was 3 mL per well. On the following day, the medium was changed, and 1.8 mL of RPMI containing 10% FBS and 1.2 mL of the test substance were added per well, and LPS having a final concentration of 100 nM was added. Three kinds of test substances were used: culture supernatant of adipose tissue-derived mesenchymal stem cells, RPMI basic medium, or Procul AD medium (Rohto Pharmaceutical). Thereafter, the cells were cultured for 3 days and subjected to human anti-CD36 antibody immunostaining.

The cells were fixed with {4% paraformaldehyde (PFA) for 15 minutes at room temperature, and washed three times with 0.01% Triton X-100 (Tx-100) prepared by diluting with PBS (-)}. Next, blocking was performed for 30 minutes at room temperature in 0.01% Tx100 / PBS (−) supplemented with 3% bovine serum albumin (BSA), followed by 1,000% with 3% BSA / 0.01% Tx100 / PBS (−). The cells were immunostained with a 1: 2 diluted anti-CD36 antibody solution (PE-anti-Human-CD36 (BioLegend; Cat. 336206), followed by washing 3 times with 3% BSA / 0.01% Tx100 / PBS (-), and immediately The staining image of CD36 was observed under a phycoerythrin (PE) detection condition using a fluorescence microscope (Keyence; BZ-X).

The results are shown in FIG. Compared with the expression level of CD36 protein in THP-1 treated with control RPMI basal medium and ProculｃAD medium, THP-1 treated with the culture supernatant of adipose tissue-derived mesenchymal stem cells (see “AD -CM "), a strong fluorescent signal was detected, indicating that the expression level was increased. This was in accordance with the result of CD36 gene expression analysis in FIG. 2B. From these results, it was confirmed that in macrophages affected by the culture supernatant of mesenchymal stem cells, the induction of the expression of a factor whose expression was induced by the activation of PPARγ occurred.

3. Quantification of Interleukin 4 (IL-4) Protein Expression in Mesenchymal Stem Cell Culture Supernatant Interleukin 4 (IL-4) is known as a known factor that promotes PPARγ ligand production from macrophages. In the action shown in Example 1, the production of PPARγ was enhanced in macrophage cells (THP-1) treated with culture supernatant prepared from mesenchymal stem cells, but this was due to the action of IL-4. In order to verify whether this was the case, the secretion amount of IL-4 protein in the culture supernatant of mesenchymal stem cells was quantified.

3.1 Preparation of culture supernatant The culture supernatant of mesenchymal stem cells used for measurement was prepared from adipose tissue-derived mesenchymal stem cells and umbilical cord tissue-derived mesenchymal stem cells, the former being “AD-CM” and the latter being Was designated as “UC-CM”. Samples prepared from two different tissue donors were subjected to analysis, and the culture supernatants treated with THP-1 in “Example 1” were referred to as “AD-CM-1” and “UC-CM-1”. did. The preparation of the culture supernatants “AD-CM-2” and “UC-CM-2” was also performed using the preparation of “AD-CM-1” and “UC-CM-1” described in “Example 1”. According to the law. The culture supernatant was filtered through a 0.2 μm PES syringe filter (25 mm GD / X syringe filter (PES 0.2 μm sterilized); 6896-2502; GE Healthcare Japan) and kept at -28 ° C until used for analysis. It was kept frozen.

3.2 ELISA Quantification Using a commercially available ELISA kit (Human IL-4 Quantikine HS ELISA Kit; HS400; R & D SYSTEMS), a quantitative test of interleukin 4 (IL-4) protein was performed by the method described in the protocol. The lower limit of detection of this kit is 0.22 pg / mL. For comparison, “RPMI”, a basic medium, “RPMI 10% FBS” with 10% FBS added to RPMI, and “Procul AD”, a serum-free medium used for preparing culture supernatants of mesenchymal stem cells, were also used. It was measured. As described above, Procul AD (Roth Pharmaceutical) is a serum-free medium and contains no animal-derived components. That is, Procul AD does not contain interleukin 4.

(4) The results are shown in FIG. “RPMI 10% FBS” had an IL-4 concentration of 0.38 (± 0.03) pg / mL, and the other samples were below the detection limit of the kit. The "RPMI" of the protein-free medium is below the measurement concentration range of the kit, and "AD-CM-1", "AD-CM-2", "UC-CM-1" and "UC-CM-2" The value was about the same as "RPMI" due to detection noise. This confirmed that IL-4 was not contained in the culture supernatant of the mesenchymal stem cells of the present invention, and that the effect of THP-1 to promote the production of PPARγ-activating ligand was different from that of IL-4. It was confirmed that it was due to.

The present invention can be used in the pharmaceutical industry.

SEQ ID NO: 1 Primer SEQ ID NO: 2 Primer SEQ ID NO: 3 Primer SEQ ID NO: 4 Primer SEQ ID NO: 5 Primer SEQ ID NO: 6 Primer SEQ ID NO: 7 Primer SEQ ID NO: 8 Primer

Claims

An eicosanoid production promoter for promoting the production of eicosanoids, which are PPARγ activators, from macrophages, comprising a secretion of mesenchymal stem cells as an active ingredient.
The agent according to claim 1, wherein the mesenchymal stem cells are mesenchymal stem cells derived from subcutaneous adipose tissue or umbilical cord tissue.
The agent according to claim 1, wherein the secretion of the mesenchymal stem cells is a culture supernatant using a serum-free medium.
2. The agent according to claim 1, wherein the PPARγ activator eicosanoid is any one of 15-deoxy-delta-12,14-prostaglandin J2 and 15-hydroxyeicosatetraenoic acid. Or an agent that is both.
The agent according to claim 1, wherein the agent does not contain IL-4.
The agent according to claim 1, which is an agent for treating arteriosclerosis or diabetes.
The agent according to claim 1, which is a therapeutic agent for rheumatoid arthritis.
The agent according to claim 1, which is a prophylactic or therapeutic agent for prostate cancer, cerebral infarction, or cerebral dysfunction.
The agent according to claim 1, which is a prophylactic or therapeutic agent for pain.