WO2020009012A1 - Cucumber mosaic virus attenuated strain - Google Patents

Abstract

The present invention relates to: a novel cucumber mosaic virus (CMV) attenuated strain capable of controlling plant virus-derived plant diseases that occur in Cucurbitaceous vegetables; a mosaic disease-resistant inducer which is for Cucurbitaceous vegetables and contains said CMV attenuated strain; a method for preventing mosaic diseases of Cucurbitaceous vegetables using said CMV attenuated strain; and Cucurbitaceous vegetables. Specifically, the present invention relates to a cucumber mosaic virus attenuated strain having, in the genome, an RNA in which one or two bases are deleted at a base sequence position 279-282 from the 5'-end of an RNA expressed in a 2b protein-coding SEQ ID NO:1, or an RNA in which one or two bases are inserted at the base sequence position 279-282, wherein the cucumber mosaic virus attenuated strain has a 2b protein composed of a base sequence having a 2b protein-coding RNA expressed by SEQ ID NO: 2, or an amino acid sequence expressed by SEQ ID NO: 3.

Description

Cucumber mosaic virus attenuated strain

The present invention relates to a novel attenuated strain of cucumber mosaic virus that prevents plant virus infection. The present invention also provides a mosaic disease resistance inducer for cucumber plants containing the attenuated cucumber mosaic virus strain, a method for controlling mosaic disease of cucumber plants using the attenuated cucumber mosaic virus strain, and a mosaic disease resistant cucurbit. Family of plants.

植物 Conventionally, plant diseases found in crops such as vegetables grown outdoors are known to be caused in part by insect virus-borne plant virus infection.

For example, in mosaic disease observed in cucurbit plants, when aphids suck up from cucurbit plants, they are infected with plant viruses such as cucumber mosaic virus (CMV) and watermelon mosaic virus (WMV). It is known that by doing so, leaves and fruits form a ring point, mosaic or malformation in this plant, and the plant body is withered.

Cucumber mosaic virus (CMV) is one of the most widespread plant viruses that occurs in many parts of the world and infects more than 1,000 plants. CMV is a globular virus with a diameter of about 30 nm belonging to the genus Cucumovirus of the family Bromoviridae. The viral genome is a single-stranded (+)-strand RNA of three segments, which is referred to as RNA1, RNA2 or RNA3, respectively. RNA1 encodes 1a protein, RNA2 encodes 2a protein and 2b protein translated from 4A of subgenomic RNA, and RNA3 encodes 3a protein and coat protein (CP, structural protein) translated from 4 of subgenomic RNA are doing. The CMV 2b protein has been identified as a multifunctional factor important for systemic infection and subcellular distribution in cucumber and tobacco, and pathogenicity in each plant.

植物 By the way, plants are equipped with RNA silencing that degrades unnecessary double-stranded RNA, and this is used as a defense mechanism against plant viruses. However, since the 2b protein of CMV functions as a suppressor (suppressor) to avoid degradation by RNA silencing targeting plant viruses, when CMV establishes infection and the crop develops a viral disease, Conceivable.

ウ イ ル ス Also, the virus belonging to the genus Potyvirus belonging to the family Potyviridae to which watermelon mosaic virus (WMV) belongs is isolated from various plants around the world, although the host range of each individual is very narrow. WMV has been infected in plants of 23 families such as legumes in addition to cucurbits in various parts of the world. WMV is a string of 12 to 13 × 700 to 800 nm, and the virus genome is a single-stranded (+)-strand RNA (about 10,000 bases) virus. First, one polyprotein is translated, and ten kinds of proteins are produced by its own protease. Potyvirus helper component protease (HC-Pro) has been identified as a suppressor of RNA silencing and is also involved in RNA binding, virus growth and pathogenicity. These multifunctionalities are closely related to the function of suppressing RNA silencing.

Conventionally, there has been no effective antiviral agent for the above-mentioned plant virus. Therefore, in crop cultivation sites, as a countermeasure, a chemical such as an insecticide has been used to control insects that transmit the plant virus to the crop. Although this method relies on pesticides, such methods have been concerned about environmental pollution by chemical pesticides.

Therefore, in recent years, as a method for controlling plant virus diseases, a technique of controlling a plant by inoculating attenuated virus has attracted attention. This is a control method utilizing an interference effect that plants infected with a certain virus (primary virus) are not infected with a closely related virus (secondary virus). In other words, if a very weakly pathogenic attenuated strain is inoculated as a primary virus, it is possible to prevent secondary infection by a strongly pathogenic highly virulent strain, which is a so-called vaccine effect.

The applicant of the present application has also developed an attenuated zucchini yellow mosaic virus (Patent Document 1) which has a virus disease control action using attenuated zucchini yellow mosaic virus (ZYMV). In recent years, the present inventors have also developed a plant seedling immobilization device and a plant vaccination method capable of plant vaccination (Patent Document 2).

キ ュ As another attenuated virus, cucumber mosaic virus (CMV) attenuated by satellite RNA is known, and is used in tomatoes, peppers, gentian and the like. It has been reported that short RNAs called satellite RNAs are associated with the action of parasitizing CMV and suppressing the growth of genomic RNA, thereby attenuating CMV (Non-Patent Document 1).

However, no practical attenuated virus strain in cucurbits has been known so far.
For example, in the local cucumber and other cucumber-producing localities, chronic outbreaks of CMV and WMV, as well as intensification of symptoms due to superinfection of CMV and WMV, have been reported, and the damage has been enormous.

Japanese Patent No. 4045358 Japanese Patent No. 5938798

An object of the present invention is to provide a novel attenuated cucumber mosaic virus (CMV) strain that can control plant diseases derived from plant viruses that occur in Cucurbitaceae plants.
Another object of the present invention is to provide a mosaic disease resistance inducer for Cucurbitaceae plants containing the attenuated CMV strain, a method for controlling mosaic disease of Cucurbitaceae plants using the attenuated CMV strain, and a Cucurbitaceae plant. And

The present inventors have conducted intensive studies to solve the above-mentioned problems, and as a result, by isolating a CMV virulent strain from a cucumber field and repeating attenuation, a CMV attenuated strain having extremely low pathogenicity against cucumber and other Cucurbitaceae plants. It has been found for the first time that mosaic disease resistance can be induced in Cucurbitaceae plants by inoculating this attenuated CMV strain into Cucurbitaceae plants.
The present invention has been completed by the present inventors based on the above findings.

That is, the gist of the present invention is:
[1] RNA in which one or two bases are deleted from the 279th to 282nd base sequence from the 5 'side of the RNA shown in SEQ ID NO: 1 encoding 2b protein or the 279th to 282nd bases A cucumber mosaic virus attenuated strain having in the genome RNA having one or two bases inserted in the base sequence,
[2] the attenuated cucumber mosaic virus strain according to [1], wherein the RNA encoding the 2b protein comprises the nucleotide sequence of SEQ ID NO: 2;
[3] the attenuated cucumber mosaic virus strain according to [1] or [2], which has a 2b protein consisting of the amino acid sequence represented by SEQ ID NO: 3;
[4] a mosaic disease resistance inducer for Cucurbitaceae plants, comprising the cucumber mosaic virus attenuated strain according to any of [1] to [3] as an active ingredient;
[5] The mosaic disease resistance inducer for Cucurbitaceae according to [4], further comprising a watermelon mosaic virus attenuated strain having in the genome thereof an RNA represented by SEQ ID NO: 4 encoding a helper component protease,
[6] the mosaic disease resistance inducer for cucurbits according to [5], wherein the attenuated watermelon mosaic virus strain has a helper component protease having an amino acid sequence represented by SEQ ID NO: 5,
[7] A method for controlling mosaic disease of Cucurbitaceous plants, comprising inoculating the Cucumber mosaic virus attenuated strain according to any one of [1] to [3] above into Cucurbitaceae plants.
[8] The method for controlling mosaic disease of Cucurbitaceous plants according to [7], further comprising inoculating a Cucurbitaceous plant with an attenuated watermelon mosaic virus strain having an RNA shown in SEQ ID NO: 4 encoding a helper component protease in its genome. ,
[9] The method for controlling mosaic disease of Cucurbitaceous plants according to [7] or [8], wherein the attenuated watermelon mosaic virus strain has a helper component protease consisting of the amino acid sequence shown in SEQ ID NO: 5.
[10] A cucumber plant having mosaic disease resistance, inoculated with the attenuated cucumber mosaic virus strain according to any of [1] to [3] above,
[11] The Cucurbitaceae plant according to [10], further inoculated with an attenuated watermelon mosaic virus strain having an RNA shown in SEQ ID NO: 4 encoding a helper component protease in its genome.
[12] The Cucurbitaceae plant according to [11], wherein the attenuated watermelon mosaic virus strain has a helper component protease consisting of the amino acid sequence shown in SEQ ID NO: 5.
[13] A method for extracting an attenuated mosaic virus strain, the method for extracting an attenuated mosaic virus strain using a nonionic surfactant-added extraction buffer containing poly (oxyethylene) octylphenyl ether from leaves infected with the attenuated mosaic virus strain,
[14] The extraction method, wherein a mixture of the supernatant after centrifugation of the ground material of the leaf infected with the attenuated strain of the mosaic virus and an extract from the sedimentation using the nonionic surfactant-added extraction buffer, or the nonionic mixture The extraction method according to the above [13], which is a centrifuged supernatant of a ground product using a surfactant-added extraction buffer,
[15] The extraction method according to [13] or [14], wherein the mosaic virus is a cucumber mosaic virus or a watermelon mosaic virus.

The attenuated CMV strain of the present invention is extremely novel in the nucleotide sequence or amino acid sequence of the gene, and is effective against mosaic disease by inoculating not only cucumber but also cucumber as well as CMV or WMV. It can be a controlling means.

In addition, when the present invention is combined with a ZYMV vaccine that has already been put to practical use, it is possible to comprehensively control major viruses contaminated by insects such as aphids, thereby improving crop productivity, controlling costs and reducing work. By making it possible to reduce and save labor, it can contribute to the sustainable development of each production area where cucurbits are cultivated outdoors.

FIG. 1 is a schematic diagram showing the genome structure of CMV. FIG. 2 is a schematic diagram showing a comparison between the nucleotide sequence of the 2b protein of CM14 attenuated strain CMV and the virulent strain H23. FIG. 3 is a schematic diagram showing a comparison between the amino acid sequence of the 2b protein of the CM14 attenuated strain CMV and the virulent strain H23. FIG. 4 is a schematic diagram showing the 2b protein of the attenuated CMV strain. FIGS. 5-1 to 5-3 are schematic diagrams showing a comparison between the base sequence of HC-Pro of the attenuated WMV strain WM14 and the highly virulent strain MIYA. FIG. 5-2 is a diagram following FIG. 5-1. FIG. 5C is a diagram that follows FIG. FIG. 6 is a schematic diagram showing a comparison between the amino acid sequence of HC-Pro of the attenuated WMV strain WM14 and the virulent strain MIYA.

1. Cucumber mosaic virus (CMV) attenuated strain The CMV attenuated strain of the present invention lacks one or two bases from the nucleotide sequence at positions 279 to 282 from the 5 'side of the RNA shown in SEQ ID NO: 1 encoding the 2b protein. It is characterized by having in its genome a lost RNA or an RNA in which one or two bases are inserted in the nucleotide sequence at positions 279 to 282 (hereinafter also referred to as attenuated 2bRNA).

ＲＮＡ The RNA shown in SEQ ID NO: 1 is a nucleotide sequence encoding a 2b protein possessed by the CMV virulent strain, and has a total length of 333 bp.

Since the attenuated CMV strain of the present invention has the attenuated 2bRNA as described above, the amino acid sequence encoded by the nucleotide sequence from the 279th to 282nd from the 5 ′ side of the RNA shown in SEQ ID NO: 1 is modified. Attenuated 2b protein. Although the attenuated 2b protein is similar in molecular weight and the like to the normal 2b protein, it impairs the function of the 2b protein, particularly as a virulence factor. The family plants exhibit no mosaic disease symptom or have only a very slight symptom, and thus have excellent weak toxicity.
In addition, the Cucurbitaceae plant inoculated with the CMV attenuated strain of the present invention exists in the field due to the interference effect of the Cucurbitaceous plant because the CMV attenuated strain and / or the attenuated 2b protein are present in the plant body. It also exhibits excellent mosaic disease resistance against infection with other virulent CMV strains borne by aphids.
In the present invention, mosaic disease resistance refers to a property in which a plant virus that causes mosaic disease resists infection of Cucurbitaceae plants, and specifically, even when attacked by a CMV virulent strain. It means the property that cucurbits not infected, cucurbits infected with the CMV virulent strain do not show signs of mosaic disease, show only very slight symptoms, or do not inhibit the growth even if mosaic disease develops.

The attenuated 2bRNA possessed by the CMV attenuated strain of the present invention includes, in the base sequence of the RNA shown in SEQ ID NO: 1, a sequence in which four 279-282 th thymines (T) from the 5 ′ side are continuous. RNAs in which one or two bases have been deleted, RNAs in which one or two bases have been inserted in the sequence in which the 279th to 282nd four thymines are consecutive, and the like can be mentioned.
The deletion or insertion may be performed as long as the amino acid sequence translated from the nucleotide sequence at positions 279 to 282 and thereafter is different from that of the normal 2b protein. There is no particular limitation on the type of base to be made.

For example, the attenuated 2bRNA includes those having the nucleotide sequence shown in SEQ ID NO: 2.
SEQ ID NO: 2 shows that at the 279th to 282nd bases from the 5 'side of the 2b protein gene shown in the base sequence 1, four thymines (T) are consecutive in the case of the virulent strain, whereas thymine (T) Is a sequence in which three consecutive thymines (T) are deleted. In SEQ ID NO: 2, adenine (A) corresponding to the 319th base from the 5 ′ side of the 2b protein gene shown in base sequence 1 has been converted to thymine (T).
The attenuated 2bRNA is not limited to the nucleotide sequence itself of SEQ ID NO: 2, and has a homology of 80% or more, preferably 90% or more, more preferably 95% or more with the nucleotide sequence of SEQ ID NO: 2. The present invention also encompasses an RNA having a base sequence having the formula: and which exhibits the same level of attenuity and mosaic disease resistance as the attenuated 2bRNA.

The CMV attenuated strain of the present invention has an attenuated 2b protein produced by translation with the attenuated 2b RNA.
The attenuated 2b protein has almost the same molecular weight as the normal 2b protein and has a highly homologous amino acid sequence from the N-terminus to the vicinity of the 93rd position. It has a different amino acid sequence. Further, the number of amino acids constituting the attenuated 2b protein may be such that one or more amino acid sequences are deleted or added as compared with the normal 2b protein.
The attenuated 2b protein includes, for example, a protein having the amino acid sequence shown in SEQ ID NO: 3. The attenuated 2b protein shown in SEQ ID NO: 3 is a sequence consisting of 106 amino acids, and compared to the amino acid sequence of the 2b protein of the virulent strain H23 (110 amino acids in total length) by 94 amino acids. The amino acid sequence of the second and subsequent amino acids is different.
It should be noted that the amino acid sequence has 80% or more homology, preferably 90% or more, more preferably 95% or more homology with the amino acid sequence shown in SEQ ID NO: 3, and is similar to the attenuated 2b protein. The present invention also includes a protein exhibiting attenuated and mosaic disease resistance.
For example, it may be a protein consisting of an amino acid sequence in which one or more amino acid sequences have been deleted, substituted or added from the amino acid sequence shown in SEQ ID NO: 3.

Examples of the CMV attenuated strain of the present invention having the attenuated RNA shown in SEQ ID NO: 2 include the CM14 attenuated CM14 strain described in Examples described later.
The CM14 strain is a virus having in its genomic RNA an RNA encoding the 2b protein consisting of the amino acid sequence shown in SEQ ID NO: 3, and is a virulent strain at the 279th to 282nd bases from the 5 'side of the 2b protein gene. In the case of thymine (T), four thymines (T) are continuous ("poisonous strain" in FIG. 4), whereas only three thymines (T) are continuous and one base thymine (T) is deleted. It is an attenuated strain having a nucleotide sequence ("attenuated strain" in FIG. 4).
In the CM14 strain, as described above, the deletion of one base of thymine (T) causes a shift in the reading frame for amino acid translation. In other words, the biosynthesis of the protein from the 280th to 282nd bases from the 5 'side of the 2b protein gene is different from the original 2b protein.

The production of the attenuated CMV strain of the present invention can be carried out by removing a nucleotide sequence or an amino acid sequence from a naturally-occurring or commercially available attenuated CMV strain or a CMV attenuated strain by site-directed mutagenesis, which is a well-known technique. This can be done by introducing an addition.
Further, the attenuated CMV strain of the present invention may be a naturally-occurring strain or an artificially attenuated one by genetic recombination technology or the like.
Further, the attenuated CMV strain of the present invention may be produced by a method of grinding and isolating the green part of mosaic leaves from a low-temperature-treated plant.
Examples of this method include the methods described in Kosaka and Fukunishi (1997) Plant disease 81 (7) 733-738, Kobori et al. (2005) Plant disease 89 (8) 879-882).

Here, the calculation of the nucleotide sequence number of the CMV attenuated strain when amino acids are deleted or added is performed in consideration of the number of such deleted or added bases. The number is increased, and if added, the number is reduced by the added amount. For example, when two bases are added upstream of the base corresponding to base sequence number 279 of SEQ ID NO: 1, the target base thymine (T) is actually the 281st base, By subtracting 2 corresponding to the number of added bases, the 281st base is determined to be base sequence number 279.

2. Mosaic disease resistance inducer for Cucurbitaceae plants The mosaic disease resistance inducer for Cucurbitaceous plants according to the present invention (hereinafter referred to as the inducer of the present invention) comprises the above-mentioned attenuated CMV strain of the present invention as an active ingredient. It contains.

Cucurbits in the present invention, cucumber, melon, watermelon, zucchini, gangan, shirouri, luffa, bitter melon, edible plants such as yugao, lakanka, plants used as crude drugs such as crow squirrel, but particularly limited. Absent.

As described above, the inducing agent of the present invention has an effect of inducing CMV resistance (mosaic disease resistance) by inoculating a Cucurbitaceae plant.

量 The amount of the CMV attenuated strain of the present invention contained in the inducer of the present invention is not particularly limited, as long as it can induce desired mosaic disease resistance in the inoculated Cucurbitaceae plant.

誘導 The inducer of the present invention may further contain an attenuated strain of watermelon mosaic virus (WMV) having in its genome the RNA shown in SEQ ID NO: 4 encoding a helper component protease (HC-Pro).

The attenuated WMV strain is the RNA sequence represented by SEQ ID NO: 4 encoding HC-Pro, in which the nucleotide sequence at positions 434 and 1048 from the 5 'side of the HC-Pro gene is lower than that of the selection source WMV virulent strain. Is an attenuated strain mutated to a characteristic nucleotide sequence mutated to thymine (T) and adenine (A) (hereinafter, attenuated HC-Pro RNA).
The attenuated HC-Pro RNA is not limited to the nucleotide sequence itself of SEQ ID NO: 4, but has a homology of 80% or more, preferably 90% or more, more preferably 95% or more with the nucleotide sequence of SEQ ID NO: 4. The present invention also includes an RNA having a base sequence having homology to the above and exhibiting the same level of attenuity as the attenuated HC-Pro RNA.

The attenuated WMV strain may have HC-Pro consisting of the amino acid sequence shown in SEQ ID NO: 5.
The amino acid sequence represented by SEQ ID NO: 5 is an amino acid sequence encoded by the attenuated HC-Pro RNA represented by SEQ ID NO: 4, and has an amino acid sequence of 145th from the N-terminus of HC-Pro compared to the WMV virulent strain. The amino acid sequence at position 350 is mutated to leucine (L) and threonine (T). The amino acid sequence represented by SEQ ID NO: 5 is presumed to have a mutation at the site, but have the same molecular weight as that of normalized HC-Pro, but impair its function as a suppressor. Therefore, the Cucurbitaceae plants inoculated with the attenuated WMV strain do not show the symptoms of mosaic disease, or have only a very slight symptom, and have excellent attenuability. By virtue of the interference effect, it exerts excellent mosaic disease resistance against infection of other virulent strains of WMV borne by various insects existing in the field.
Note that the amino acid sequence has 80% or more homology, preferably 90% or more, more preferably 95% or more homology with the amino acid sequence shown in SEQ ID NO: 5, and is the same as the attenuated HC-Pro. Proteins that exhibit a degree of attenuance and mosaic disease resistance are also included in the invention.
For example, it may be a protein consisting of an amino acid sequence in which one or more amino acid sequences are deleted, substituted or added from the amino acid sequence shown in SEQ ID NO: 5.

In the same manner as the CMV attenuated strain, the WMV attenuated strain can also be obtained by isolating the base sequence or amino acid sequence of a naturally-occurring or commercially available WMV attenuated strain by a well-known site-directed mutagenesis method. It can be carried out by introducing a deletion, substitution or addition.
Further, the attenuated WMV strain of the present invention may be a naturally occurring strain or a strain attenuated artificially by a genetic recombination technique or the like.
Further, the attenuated WMV strain of the present invention may be produced by a technique of grinding and isolating the green portion of mosaic leaves from a low-temperature-treated plant.
Examples of this method include the methods described in Kosaka and Fukunishi (1997) Plant disease 81 (7) p733-738, Kobori et al. (2005) Plant disease 89 (8) p879-882.

量 The amount of the attenuated WMV strain of the present invention contained in the inducer of the present invention is not particularly limited, as long as it can induce desired mosaic disease resistance in the inoculated cucurbitaceous plant.

The inducer of the present invention is obtained by mixing the attenuated CMV strain of the present invention and the attenuated WMV strain of the present invention with water, a sodium phosphate buffer, a potassium phosphate buffer, a citrate buffer, or the like. Agent, a saccharide, a chelating agent or a reducing agent.
Further, a juice obtained from a ground material such as a leaf of a plant of a Cucurbitaceae plant inoculated with the attenuated CMV strain of the present invention, or a liquid obtained by concentrating or diluting this juice may be used as the inducer of the present invention. The present invention comprises mixing a juice obtained from a plant of a cucumber plant inoculated with an attenuated CMV strain with a juice obtained from a plant of a cucurbit plant inoculated with an attenuated WMV strain, or a liquid obtained by concentrating or diluting the juice. May be used as an inducer.
Grinding refers to crushing and grinding, for example, mortar, millstone, homogenizer, obtained by subjecting a known crushing machine such as a super blender to a medium such as a plant and water for grinding. Can be. The grinding is not particularly limited as long as the plant is crushed or ground to such an extent that the CMV attenuated strain or the WMV attenuated strain existing in the plant can be extracted.

When juice is obtained from the ground material of leaves, water, various extraction buffers such as sodium phosphate buffer, potassium phosphate buffer or citrate buffer, various surfactant solutions, n-butanol, Organic solvents such as chloroform and carbon tetrachloride may be used alone or as a mixture thereof.
Examples of the surfactant include a cationic surfactant solution, an anionic surfactant solution, and a nonionic surfactant solution.
Among them, a nonionic surfactant containing poly (oxyethylene) octylphenyl ether is preferable from the viewpoint of extraction efficiency. Preferably, Triton (registered trademark) X-100 is used.

3. Mosaic Disease Control Method for Cucurbitaceous Plants By inoculating the attenuated CMV strain of the present invention into Cucurbitaceae plants, mosaic disease of Cucurbitaceous plants can be prevented (controlled).

In the present invention, "control of mosaic disease" refers to preventing the occurrence of mosaic disease symptoms in Cucurbitaceae plants, reducing the degree of onset, or delaying the occurrence of symptoms.
By controlling mosaic disease from cucurbits, it is possible to promote smooth growth and increase the yield and commercial value of cucurbits.

モ ザ イ ク In addition to the CMV attenuated strain of the present invention, by inoculating the attenuated WMV strain into Cucurbitaceae plants, mosaic diseases related to two types of plant viruses, CMV and WMV, can be controlled.

For the inoculation, the inducer of the present invention containing the attenuated CMV strain may be used. Further, the inducer of the present invention may further contain the attenuated WMV strain.
As a method for the inoculation, for example, a known method can be employed without any particular limitation. For example, rub-inoculation by the carborundum method or high-pressure spray inoculation using a spray gun, an airbrush, or the like can be given.
When a WMV attenuated strain is used, CMV attenuated strain and WMV attenuated strain may be individually inoculated, or a mixture of CMV attenuated strain or WMV attenuated strain may be used for inoculation, or WMV attenuated after CMV attenuated strain is inoculated. The strain can be inoculated, or the CMV attenuated strain can be inoculated after inoculating the WMV attenuated strain.
The number of inoculations may be determined in consideration of the concentration of the attenuated CMV strain to be inoculated, the size of the Cucurbitaceae plant, and the like. For example, the number of inoculations may be one, or infection of the attenuated strain can be confirmed after the first inoculation. If not, it may be more than once.

4. Cucurbitaceae Plants Having Mosaic Virus Disease Resistance As described above, Cucurbitaceae plants inoculated with the attenuated CMV strain of the present invention have mosaic disease resistance to CMV.

The Cucurbitaceae plant according to the present invention contains the attenuated CMV strain of the present invention, the RNA shown in SEQ ID NO: 4, or the amino acid sequence shown in SEQ ID NO: 5 in the plant body, and thus, the non-inoculated cucurbit Can be distinguished from family plants.

The timing of inoculating the attenuated CMV strain of the present invention is not particularly limited. For example, seedlings of Cucurbitaceae plants having mosaic disease resistance can be prepared by inoculating CMV attenuated strains at the stage of raising seedlings. In addition, by inoculating CMV attenuated strains on Cucurbitaceae plants growing in a relatively clean environment and planting them in fields such as open fields, or by inoculating them before exporting them for sale, various unspecified species can be obtained. It can also grow safely under the environment.
In addition, mosaic disease resistance of Cucurbitaceae plants can be further improved by further inoculating a WMV attenuated strain in the same manner as the CMV attenuated strain.
Accordingly, the state of the Cucurbitaceae plant having mosaic disease resistance includes, but is not limited to, seedlings and grown plants.

Hereinafter, the present invention will be described more specifically with reference to Examples, but the scope of the present invention is not limited thereto.

Example 1
Production of CM14 attenuated strain CMV Select cucumber cultivated in Fukushima prefecture and causing severe mosaic symptoms, and use CMV test by DAS-ELISA method and inoculation test to Nicotiana rustica (Nicotiana rustica). A virulent strain of CMV causing severe mosaic symptoms in cucumber (hereinafter referred to as "H23 strain") was isolated.
Next, the H23 strain was inoculated into Nicotiana rustica of the genus Tobacco, and used for low-temperature treatment and a method for separating the green portion of mosaic leaves (leaves in which mosaic symptoms can be visually observed). The aforementioned low-temperature treatment and separation of the green part have already been reported as a method for selecting attenuated strains of plant viruses present in plants (Kosaka and Fukunishi (1997) Plant disease 81 (7) 733-). 738, Kobori et al. (2005) Plant disease 89 (8) 879-882).

Specifically, first, seedlings of Nicotiana rustica inoculated with the H23 strain, which is a CMV virulent strain, were immediately cultivated at 15 ° C. for 2 months in an artificial weather device (low-temperature treatment).
Thereafter, the green part of the mosaic leaf of the seedling was cut out, and a 10- to 50-fold amount of leaf weight of 0.1 M potassium phosphate buffer, pH 7.0 was added and ground to obtain an inoculum. Rustica seedlings were inoculated. After virus inoculation, they were grown in a glass greenhouse at 25 ° C. for 11 to 25 days.
After that, the symptom investigation of each reared Nicotiana rustica was performed. The green part was further cut out from Nicotiana rustica, whose symptoms seemed to have eased, and 0.1 to 50 times the leaf weight of 0.1 M potassium phosphate buffer, pH 7.0 was added, and the juice was ground and used as an inoculum. By repeating the low-temperature treatment at 15 to 18 ° C. for 14 days to 2 months or the separation of the green portion a total of 10 times, one attenuated strain that had a slight mosaic symptom even when inoculated was isolated.

Next, the attenuated strain-infected leaves were inoculated into Chenopodium quinoa using a sap obtained by adding 0.1 M potassium phosphate buffer, pH 7.0, ten times the weight of the leaves, and grinding. After 2-3 days, a large number of local lesions caused by virus infection were cut out on the inoculated leaves one by one, and the leaves were polished by adding 50 times the leaf weight of 0.1 M potassium phosphate buffer, pH 7.0. The crushed juice was used as an inoculum, and inoculated into Nicotiana rustica seedlings (single lesion isolation). When this single lesion isolation was repeated four times, CM14 strain with minimal symptoms was obtained when inoculated into cucumber and zucchini.
Furthermore, the cotyledons of cucumber or zucchini seedlings were rubbed with the crude juice of the virus-infected leaves of the H23 strain or the CM14 strain by the carborundum method, and the H23 strain caused severe mosaic symptoms, whereas the CM14 strain caused cucumber. And zucchini had only transient chlorotic spots. Table 1 shows the results.

Example 2
Analysis of 2b protein gene of CMV attenuated strain The 2b protein gene of CM14 strain obtained in Example 1 was analyzed, and the difference from the H23 strain as a selection source was examined.
RNA was extracted from Nicotiana rustica leaves infected with the CM14 strain, and a 2b protein gene was synthesized by RT-PCR.
The primers used were PeR2-2367F: TAGTACAGAGTCAGAGTTGAGCCG (SEQ ID NO: 6) and PeR2-2967R: GTCCTTCCGAAGAAACCTAGG (SEQ ID NO: 7), and the enzyme used was "Onestep RT-PCR kit" (QIAGEN).
For DNA analysis, the DNA sequence service of Eurofin Genomics was used, and the results were compiled to determine the nucleotide sequence of the 2b protein gene.
SEQ ID NOS: 2 and 3 show the nucleotide sequence and amino acid sequence, FIG. 1 shows the genome structure of CMV, FIG. 2 shows the comparison of the nucleotide sequences of the attenuated strain and the virulent strain with respect to the 2b protein, and FIG. For comparison, FIG. 4 shows a schematic diagram of the 2b protein.

Example 3
Production of attenuated WMV strain WM14 Select cucumber cultivated in Miyazaki prefecture and causing mosaic symptoms, and induce mosaic symptoms in cucumber by using WMV test by DAS-ELISA method and inoculation test on pumpkin and cucumber A virulent strain of WMV (hereinafter referred to as "MIYA strain") was isolated.
Next, the MIYA strain was inoculated into a pumpkin and used for the above-mentioned low-temperature treatment and the method for isolating the virus from the green part of the mosaic leaf. Furthermore, in the selection of attenuated WMV strains, single plant isolation (SPI) was combined. SPI is prepared by adding a 100-500 times volume of 0.1 M potassium phosphate buffer, pH 7.0 from the infected leaf to the leaf weight to prepare a ground juice, that is, a high dilution ratio solution, and inoculating the selected plants. It is a known method.

Specifically, first, pumpkin seedlings inoculated with the MIYA strain, which is a virulent WMV strain, were immediately grown at 15 ° C. for 2 months in an artificial weather device (low-temperature treatment).
Thereafter, the ground juice prepared by cutting out the green part of the mosaic leaf of the seedling was used as an inoculum for SPI and inoculated to another pumpkin seedling. After virus inoculation, they were grown in a glass greenhouse at 25 ° C. for 14 to 21 days.
After that, the symptom survey of each pumpkin was conducted. A grind juice prepared by cutting out a green part from a pumpkin whose symptoms seemed to be lighter was used as an inoculum for SPI, and was subjected to low-temperature treatment at 18-20 ° C. for 2-3 months or separation of the green part and SPI for a total of 7 days. By repeating the procedure twice, one attenuated strain that had only a slight symptom of mosaic disease even when inoculated was isolated.

Next, the attenuated strain-infected leaf was inoculated into Chenopodium murale using a sap obtained by adding a 0.1 M potassium phosphate buffer, pH 7.0, which was 10 times the leaf weight, and grinding it as an inoculum. On the inoculated leaves 12 to 26 days later, a large number of local lesions caused by virus infection were cut out one by one, and the leaves were polished by adding 50 times the leaf weight of 0.1 M potassium phosphate buffer, pH 7.0. Pumpkin seedlings were inoculated with the crushed juice as an inoculum source. When this single lesion isolation was repeated seven times, WM14 strains with slight symptom were obtained when inoculated into both pumpkin and zucchini.
Furthermore, when the cotyledons of cucumber, zucchini or pumpkin seedlings were rubbed with the crude juice of the virus-infected leaves of the MIYA strain or the WM14 strain by the carborundum method, the MIYA strain caused severe mosaic symptoms, whereas the WM14 strain The cucumber, zucchini or pumpkin had slight chlorotic patches or very slight mosaic. Table 2 shows the results.

Example 4
Analysis of HC-Pro gene of WMV attenuated strain The HC-Pro gene of the WM14 strain obtained in Example 3 was analyzed, and the difference from the MIYA strain as a selection source was examined.
RNA was extracted from pumpkin leaves infected with the WM14 strain, and the HC-Pro gene was synthesized by RT-PCR.
As primers, WMV-1389F: TGTGCGAGGGAGGAGAATGG (SEQ ID NO: 8) and WMV-2865R: TTCACACTTCATCCTTTGTTTG (SEQ ID NO: 9), and as an enzyme, “Onestep RT-PCR kit” (QIAGEN) was used.
For DNA analysis, the DNA sequence service of Eurofin Genomics was used, the results were compiled, and the nucleotide sequence of the HC-Pro gene was determined. SEQ ID NOs: 4 and 5 show the nucleotide sequence and amino acid sequence, FIGS. 5-1 to 5-3 show the comparison of the nucleotide sequences of the attenuated strain and the highly virulent strain related to HC-Pro, and FIG. Are respectively shown.

Example 5
Intensification of symptoms due to superinfection of CMV and WMV is well known for cucumber and other cucumber crops. When the CMV attenuated strain and the WMV attenuated strain were mixedly inoculated into cucumber seedlings (variety: Excellent Kushige No. 2), as shown in Table 3, the symptom did not increase as compared with each single infection.

From the results of Examples 1, 3 and 5, the CM14 strain exhibits excellent attenuability even when used in combination with the WM14 strain, in addition to exhibiting attenuability when inoculated solely into Cucurbitaceae plants. This indicates that the strain is an attenuated strain excellent in safety.

Example 6
Interference effect of cucumber seedlings caused by inoculation of CM14 strain Cucumber seedlings in potted plants in greenhouses, the effect of suppressing the onset of CMV and virulent strains in Cucurbitaceae plants inoculated with CM14 and WM14 (Cultivar: Onozomi) was verified by an inoculation test.
The leaf juice of Nicotiana rustica infected with the CM14 strain or the pumpkin leaf juice infected with the WM14 strain alone or in combination was rubbed and inoculated onto the cotyledons of the test cucumber seedlings by the carborundum method.
After 18 days, the leaf juice of Nicotiana rustica infected with the H23 strain, which is a CMV virulent strain, or the pumpkin leaf juice, which was infected with the MIYA strain, which is a virulent strain of WMV, was used as the first cucumber seedling for the test. The leaves were rubbed and inoculated.
Thereafter, the interference effect was determined based on whether a mosaic symptom peculiar to the virulent virus appeared in the upper leaves of the test cucumber seedlings. Table 4 shows the interference effect on the CMV virulent strain, and Table 5 shows the interference effect on the WMV virulent strain.
As a result, as shown in Table 4, in the non-inoculated group, severe mosaic symptoms appeared in all test strains 11 days after inoculation with the CMV virulent strain, and thus infection with the CMV virulent strain was confirmed.
On the other hand, in the case of inoculating CM14 alone or mixed with WM14, the number of diseased CMV virulent strains is as low as 5 or 2 out of 10 even 31 days after inoculation. It was recognized that the test cucumber seedlings had a high interference effect.

In the WMV interference effect test, as shown in Table 5, severe mosaic symptoms appeared in all test strains 11 days after inoculation of the WMV virulent strain in the non-vaccinated plot, so that infection of the WMV virulent strain was confirmed. .
On the other hand, in the case of the WM14 strain alone or in the mixed inoculation with the CM14 strain, the number of virulent strains of the WMV virulent strain is as small as 3 or 2 out of 10 strains even after 31 days from the inoculation. It was confirmed that the test cucumber had a high interference effect.

Example 7
Interference Effect on Cucumber Grafted Seedlings Inoculated by CM14 Strain Inoculation The CMV and WM14 virulent strains inoculated with CM14 strains and WM14 strains were evaluated for their interference effects on CMV virulent strains and WMV virulent strains using potted grafted cucumber seedlings (spike cultivars) in a greenhouse. : Pilot No. 2, rootstock variety: GT-II).
The leaf juice of Nicotiana rustica infected with the CM14 strain in advance and the pumpkin leaf juice of the WM14 strain infected were mixed and rubbed and inoculated to the cotyledons of the grafted cucumber seedling for testing by the carborundum method.
Next, grafting and raising seedlings with rootstock pumpkins were carried out, and the leaf juice and the WMV virulent strain of Nicotiana rustica infected with the H23 strain, a CMV virulent strain 16 days after inoculation with the CM14 strain and the WM14 strain, were used. A mixed solution of pumpkin leaf sap infected with the MIYA strain was rubbed and inoculated on the first true leaf of a test grafted cucumber seedling.
Thereafter, the interference effect was determined by whether or not a mosaic disease specific to the virulent virus appeared in the upper leaves of the test grafted cucumber seedlings. Table 6 shows the results.
As a result, as shown in Table 6, in the non-inoculated group, severe mosaic disease symptoms appeared in all test strains 12 days after inoculation of the CMV virulent strain and the WMV virulent strain, and infection of the virulent strain was confirmed. Was.
On the other hand, no mosaic disease was observed in the test grafted cucumber seedlings inoculated with the CM14 strain and the WM14 strain, so that the inoculation of the CM14 strain and the WM14 strain caused a very high interference effect on the grafted cucumber seedlings. Was admitted.

Example 8
Effect of controlling attenuated strains on mosaic disease in vinyl house The effect of controlling CM14 strain and WM14 strain on mosaic disease was verified by planting cucumber seedlings (cultivar: Excellent Setsusei No. 2) in a vinyl house field.
The leaf juice of Nicotiana rustica infected with the CM14 strain in advance and the pumpkin leaf juice of the WM14 strain infected were mixed together, and the mixture was rubbed against the cotyledons of the test cucumber seedlings by the carborundum method and inoculated. The plants were grown in a greenhouse until the number of leaves became about four.
Thereafter, the test cucumber seedlings were planted and cultivated in a vinyl house field.
By 24 to 37 days after planting, aphids were put on cucumber seedlings infected with the H23 strain, a CMV virulent strain and the MIYA strain, a WMV virulent strain, and the seedlings were placed in furrows as a transmission source to induce mosaic disease. .
Thereafter, the control effect was determined based on whether mosaic disease and wilt caused by the virulent strain appeared. Table 7 shows the proportion of strains in which mosaic disease has occurred, Table 8 shows the proportion of strains in which wilt has been confirmed, and Table 9 shows the results of fruit yield surveys. In addition, the product fruit rate described in Table 9 is
(Number of excellent fruits + number of good fruits) / total harvested fruits x 100
Was calculated.
The diseased fruit rate is
Affected fruit number / total harvested fruit number x 100
Was calculated.

From the results of Tables 7 and 8, mosaic disease was confirmed in 10 out of 12 strains and wilt in 3 out of 12 strains in the non-vaccinated plot 60 days after planting. In the inoculated plot, mosaic disease was detected in 12 strains. The number was as low as 5 strains, and no wilt was observed.

From the results in Table 9, the commercial fruit rate in the non-inoculated group was 60.6% and the diseased fruit rate was 35.6%, whereas the commercial fruit rate in the inoculated group was 90.7% and the diseased fruit rate was 90.7%. Was 8.9%.
Therefore, by inoculating the CM14 strain and the WM14 strain, the number of fruits that can be used as commercial products was remarkably improved to 1.56 times, and the number of diseased fruits was also significantly reduced with respect to the non-inoculated plot. Understand. From these results, CM14 strain and WM14 strain greatly contribute to improvement of productivity of Cucurbitaceae plants, and if inoculated on seedlings before planting in a field, mosaic disease can be controlled even in subsequent growth. It can be understood that the cost and the labor saving of the work in the field can be reduced.

Example 9
Extraction of CMV-attenuated strain For extraction of the CMV-attenuated strain, Nicotiana rustica inoculated leaves, which had been infected with CM14 strain in advance, were frozen and stored at -80 ° C.
To the freeze-infected leaves, three times the leaf weight of an extraction buffer (0.1 M citrate buffer, 0.01 M disodium ethylenediaminetetraacetate (hereinafter EDTA), pH 7.2, 0.1% sodium thioglycolate) was added. And ground with a homogenizer (15,000 rpm, 5 minutes, 4 ° C.). Thereafter, an equal amount of chloroform was added to the ground juice, and the mixture was further ground and stirred, and then centrifuged (7,000 rpm, 15 minutes, 4 ° C.) to obtain a supernatant. As a substitute for chloroform, a solution obtained by adding butanol to 5% of the ground juice or a juice solution containing no organic solvent was centrifuged in the same manner to obtain a supernatant. The virus content of each CM14 strain-containing supernatant was measured as follows.

When a virus was extracted from a plant-infected leaf infected with the attenuated CMV strain, the content (concentration) of the virus was expressed using a 50% infectious titer (ID ₅₀ ) as an index. A virus-containing sample was diluted and inoculated with 0.3 mL per plant, the infection rate of each diluted sample inoculated was examined, and the infection rate (actually measured value) was substituted into the calculation formula of the Behrens-Kelber method. The 50% infectious titer (ID ₅₀ ) was determined (Introduction to Experimental Virology (Revised 2nd Edition) 23. How to Handle Numerical Values Required for Virology, Gakuyukai, National Institute of Health, published by Maruzen Co., Ltd., June 1973 Month).
In this way, the limiting dilution at which infection occurs was determined. The limiting dilution is the dilution factor (log) at which infection was observed in 50% of the inoculated individuals. The virus content (concentration) is represented by the reciprocal of the dilution factor at this time, and the 50% infection titer ( A unit called ID ₅₀ ) was used. This was defined as the virus content per 0.3 mL of the sample.

Behrens-Kerber Method formula 50% infectivity (index of _{logarithm) = χ K - (h 1} + h 2 + ... + h K-1) × d-0.5 × d
χ _K : dilution of sample showing 100% infection rate (logarithmic index))
h ₁ + h ₂ +... + h _K−1 : the sum of the infection rates at each dilution 0.5: constant d: logarithmic exponent of the dilution interval (d = 1 for 10-fold serial dilution)

Example of calculation of 50% infectious titer The following is an example of a calculation in the case where a sample whose virus content is to be measured is serially diluted 10-fold, and each infection rate is shown in Table 10. When the result of Table 10 is put into the calculation formula of the Behrens-Kelber method,
ID ₅₀ = −1− (0.8 + 0.2 + 0) × 1−0.5 × 1 = − (1 + 1 + 0.5) = − 2.5
That is, the dilution at which this sample shows 50% infection is 10 ^−2.5 , and therefore the virus content (concentration) of this virus solution is 10 ^2.5 ID ₅₀ per 0.3 mL, which is the reciprocal of the dilution. It becomes. In other words, this sample would have an infectious dose that would infect 50% when diluted 10 ^2.5 (about 316).

Next, in order to measure the virus content of each CM14 strain-containing supernatant, samples were serially diluted 10-fold with 0.1 M potassium phosphate buffer, pH 7.0, and 0.3 mL of each sample was swabbed. The seedlings were rubbed into Nicotiana rustica seedlings by the carborundum method and inoculated. Inoculation was performed on 4 strains for each sample. Immediately after the inoculation, water was sprayed on the inoculated leaves and cultivated under artificial light or natural light at 10,000 to 18,000 lux (irradiation for 14 hours) at 20 to 30 ° C. Symptoms were observed 14 to 21 days after the inoculation, and the infection rate of each sample was determined. Table 11 shows the results.

From the results in Table 11, the content of the CM14 strain in the sample without the addition of the organic solvent was the lowest at 10 ^2.0 ID ₅₀ /0.3 mL, and the content with the addition of chloroform or 5% butanol was 10 ^2.50 ID ₅₀ / There was a tendency to be as high as 0.3 mL or 10 ^2.75 ID ₅₀ /0.3 mL.

Example 10
Extraction of CMV-attenuated strain from centrifugal sediment In Example 9, the content of CM14 strain was as low as 10 ^2.0 ID ₅₀ /0.3 mL in the centrifugal supernatant without addition of an organic solvent. Therefore, conditions for extracting the CMV attenuated strain from the centrifugal sediment were verified. The same extraction buffer as in Example 9 (0.1 M citrate buffer, 0.01 M EDTA, pH 7.2, 0.1% sodium thioglycolate) was added to the frozen-infected leaves in a volume 2.5 times the leaf weight, and the mixture was superimposed. Triturated in a blender (15 minutes, 4 ° C). Thereafter, the mixture was centrifuged (7,000 rpm, 25 minutes, 4 ° C.) to obtain a centrifugal sediment together with the supernatant. To the centrifuged sediment, an extraction buffer was added in an amount three times the sediment volume, and the suspension was again resuspended in a super blender for 10 minutes, and centrifuged (7,000 rpm, 25 minutes, 4 ° C) to obtain a resuspended supernatant. . At this time, the extraction buffer used was a solution to which Triton (registered trademark) X-100 was not added and added to a final concentration of 0.12% or 0.5%. The virus content of each of the resulting CM14 strain-containing solutions was measured in the same manner as in Example 9.

Table 12 shows the results. The content of the CM14 strain in the centrifuged sediment was 10 ^2.00 ID ₅₀ /0.3 mL without Triton (registered trademark) X-100, and 0.12% or 0.5% for Triton (registered trademark) X-100. Since each was 10 ^3.50 ID ₅₀ /0.3 mL or 10 ^3.25 ID ₅₀ /0.3 mL, the CM14 strain was found to remain in the centrifugal sediment in large amounts without floating in the centrifugal supernatant. It was revealed. In addition, it was confirmed that the CM14 strain could be extracted from the centrifuged sediment with high efficiency by adding Triton (registered trademark) X-100.

Example 11: Establishment of high extraction conditions for CMV attenuated strain The conditions for enhancing the extraction efficiency of the CMV attenuated strain were verified. The same extraction buffer as in Example 9 (0.1 M citrate buffer, 0.01 M EDTA, pH 7.2, 0.1% sodium thioglycolate) was added to the frozen-infected leaves in a volume 2.5 times the leaf weight, and the mixture was superimposed. Triturated in a blender (15 minutes, 4 ° C). Thereafter, the mixture was centrifuged (7,000 rpm, 25 minutes, 4 ° C.) to obtain a supernatant (1) and a sediment. Triton (registered trademark) X-100 was added to the above extraction buffer at a final concentration of 0.5%, and the resulting precipitate was re-suspended in a super-blender for 10 minutes. 000 rpm, 25 minutes, 4 ° C.) to obtain a supernatant (resuspension supernatant (2)). Thereafter, the liquids (1) and (2) were mixed. The virus content of each of the resulting CM14 strain-containing solutions was measured in the same manner as in Example 9.

Table 13 shows the results. The content of the CM14 strain was as low as 10 ^2.0 ID ₅₀ /0.3 mL in the centrifugal supernatant, but was high as 10 ^2.75 ID ₅₀ /0.3 mL in the resuspended supernatant. . The mixture of the centrifuged supernatant (1) and the obtained resuspended supernatant (2) of the sediment had a high value of 10 ^2.50 ID ₅₀ /0.3 mL. From the above, it was revealed that resuspension of the centrifuged sediment by adding Triton (registered trademark) X-100 was effective for extraction of CM14 strain.

Extraction of CM14 strain was attempted using an extraction buffer to which {Triton (registered trademark)} X-100 had been added. The same extraction buffer as in Example 10 (0.1 M citrate buffer, 0.01 M EDTA, pH 7.2, 0.1% sodium thioglycolate) was added to Triton (registered trademark) X-100 at a final concentration of 0.1%. Those added to 12% or 0.5% were used for grinding infected leaves. Extraction buffer obtained by adding Triton (registered trademark) @ X-100 to the frozen infected leaves was added in an amount 2.5 times the weight of the leaves, and triturated with a super blender (15 minutes, 4 ° C). Thereafter, the mixture was centrifuged (7,000 rpm, 25 minutes, 4 ° C) to obtain a supernatant. The virus content of each of the resulting CM14 strain-containing solutions was measured in the same manner as in Example 9.

Table 13 shows the results. The content of the CM14 strain is 0.12% or 0.12% for Triton® X-100 compared to 10 ^2.0 ID ₅₀ /0.3 mL of the centrifugal supernatant without addition of Triton® X-100. Grinding the infected leaves with an extraction buffer containing Triton (registered trademark) X-100 was effective in extracting the CM14 strain, since the value was as high as 10 ^2.75 ID ₅₀ /0.3 mL with the addition of 5%. It proved to be effective.

Example 12: Extraction of attenuated WMV strain For extraction of the attenuated WMV strain, a pumpkin variety Ebisu infected leaf which had been infected with the WM14 strain in advance was frozen and stored at -80 ° C.
Frozen infected leaves were extracted with 2.5 times the leaf weight of extraction buffer (0.1 M potassium phosphate buffer, 0.01 M EDTA, 0.01 M sodium N, N-diethyldithiocarbamate trihydrate (DIECA), pH 7). (0.0, 0.1% mercaptoethanol) and triturated with a homogenizer (15,000 rpm, 5 minutes, 4 ° C). Thereafter, 15% by volume of carbon tetrachloride was added to the ground juice, the mixture was further ground and stirred, and then centrifuged (7,000 rpm, 15 minutes, 4 ° C) to obtain a supernatant. The sap without an organic solvent was similarly centrifuged to obtain a supernatant.

Next, the virus content of each WM14 strain-containing supernatant was measured in the same manner as in Example 9. Samples were serially diluted 10-fold with 0.1 M potassium phosphate buffer, 0.01 M DIECA, pH 7.0, and 0.3 mL of each sample was sucked into a cotton swab, and rubbed into a pumpkin seedling by the carborundum method and inoculated. Inoculation was performed on 4 or 8 strains per sample. Immediately after the inoculation, water was sprayed on the inoculated leaves and cultivated in a glass greenhouse at 20 to 30 ° C. under natural light. Pumpkin leaves were collected 14 to 21 days after the inoculation, and WMV infection was confirmed by DAS-ELISA.

The results are shown in Table 14. Although clarification of the centrifugal supernatant was confirmed by the addition of carbon tetrachloride, the content of strain WM14 was the same with and without the addition of carbon tetrachloride.

Example 13: Extraction of attenuated WMV strain from centrifuged sediment Example 10 revealed that Triton® X-100 was effective in re-extracting CM14 strain from centrifuged sediment.
Therefore, with respect to the WM14 strain, residual virus in the centrifugal sediment and its extraction were attempted. For extraction of the attenuated WMV strain, a pumpkin variety Ebisu-infected leaf which had been infected with the WM14 strain in advance was frozen and stored at -80 ° C.
Frozen infected leaves are added with 2.5 times the leaf weight of extraction buffer (0.3 M potassium phosphate buffer, 0.01 M EDTA, pH 7.5, 0.1% mercaptoethanol) and ground with a super blender ( (15 minutes, 4 ° C). Thereafter, the mixture was centrifuged (7,000 rpm, 25 minutes, 4 ° C.) to obtain a centrifugal sediment together with the supernatant. To the centrifuged sediment, an extraction buffer was added in an amount three times the sediment volume, and the suspension was again resuspended in a super blender for 10 minutes, and centrifuged (7,000 rpm, 25 minutes, 4 ° C) to obtain a resuspended supernatant. . At this time, the extraction buffer used was a solution to which Triton (registered trademark) X-100 was not added and which was added to a final concentration of 0.5% by volume. The virus content of each of the obtained WM14 strain-containing solutions was measured in the same manner as in Example 12.

Table 15 shows the results. The content of the WM14 strain in the centrifugal sediment was 10 ^2.25 ID ₅₀ /0.3 mL without Triton (registered trademark) X-100, and 10 ^{2.75 when} Triton (registered trademark) X-100 was 0.5% by volume. since ID was _{50 /0.3mL,} the centrifugal sediment WM14 strain was found to be remaining in a large amount without floating in the centrifugal supernatant as with CM14 strain. In addition, it was confirmed that the WM14 strain could be extracted from the centrifuged sediment with high efficiency by adding Triton (registered trademark) X-100.

Example 14: Establishment of high extraction conditions for attenuated WMV strain Conditions for increasing the extraction efficiency of attenuated WMV strain were examined. The same extraction buffer as in Example 13 (0.3 M potassium phosphate buffer, 0.01 M EDTA, pH 7.5, 0.1% mercaptoethanol) was added to the freeze-infected leaves in an amount 2.5 times the weight of the leaves, and a super blender was added. (15 minutes, 4 ° C). Thereafter, the mixture was centrifuged (7,000 rpm, 25 minutes, 4 ° C.) to obtain a supernatant (1) and a sediment. Triton (registered trademark) X-100 was added to the above extraction buffer at a final concentration of 0.5%, and the resulting precipitate was re-suspended in a super-blender for 10 minutes. 000 rpm, 25 minutes, 4 ° C.) to obtain a supernatant (resuspension supernatant (2)). Thereafter, the liquids (1) and (2) were mixed. The virus content of each of the obtained WM14 strain-containing solutions was measured in the same manner as in Example 12.

Table 16 shows the results. The content of WM14 strain supernatant was ¹⁰ 2.5 _ID 50 ^/0.3mL but resuspended supernatant was ¹⁰ 2.75 _ID 50 ^/0.3mL a high value. The mixture of the centrifugal supernatant (1) and the obtained resuspended supernatant (2) of the sediment was 10 ^2.75 ID ₅₀ /0.3 mL. From the above, it was revealed that the resuspension of the centrifuged sediment by adding Triton (registered trademark) X-100 was effective for extracting the WM14 strain.

Extraction of WM14 strain was attempted using an extraction buffer to which {Triton (registered trademark)} X-100 had been added. As an extraction buffer, the same as in Example 13 (0.3 M potassium phosphate buffer, 0.01 M EDTA, pH 7.5, 0.1% mercaptoethanol) was added with Triton (registered trademark) X-100 at a final concentration of 0,1. What was added so that it might become 5 volume% was used for grinding of the infected leaf. Extraction buffer supplemented with Triton (registered trademark) @ X-100 was added to the freeze-infected leaves in an amount 2.5 times the weight of the leaves, followed by trituration with a super blender (15 minutes, 4 ° C). Thereafter, the mixture was centrifuged (7,000 rpm, 25 minutes, 4 ° C) to obtain a supernatant. The virus content of each of the obtained WM14 strain-containing solutions was measured in the same manner as in Example 12.

Table 16 shows the results. The content of strain WM14 was determined by adding 0.5% by volume of Triton (registered trademark) X-100 compared to 10 ^2.50 ID ₅₀ /0.3 mL of the centrifugal supernatant without Triton (registered trademark) X-100. Therefore, grinding the infected leaves with an extraction buffer supplemented with Triton (registered trademark) X-100 is effective for extracting the WM14 strain, since the value was as high as 10 ^3.25 ID ₅₀ /0.3 mL. It became clear.

Claims (15)

1. RNA having 1 or 2 bases deleted from the 279th to 282nd base sequence from the 5 'side of the RNA shown in SEQ ID NO: 1 encoding the 2b protein or in the 279th to 282nd base sequence Cucumber mosaic virus attenuated strain having in its genome an RNA having one or two bases inserted therein.
2. The cucumber mosaic virus attenuated strain according to claim 1, wherein the RNA encoding the 2b protein comprises the nucleotide sequence shown in SEQ ID NO: 2.
3. 弱 The attenuated strain of cucumber mosaic virus according to claim 1 or 2 having a 2b protein consisting of the amino acid sequence shown in SEQ ID NO: 3.
4. A mosaic disease resistance inducer for Cucurbitaceae plants, comprising the attenuated strain of cucumber mosaic virus according to any one of claims 1 to 3 as an active ingredient.
5. The mosaic disease resistance inducer for Cucurbitaceae plants according to claim 4, further comprising an attenuated strain of watermelon mosaic virus having in the genome thereof an RNA shown in SEQ ID NO: 4 encoding a helper component protease.
6. モ ザ イ ク The mosaic disease resistance inducer for Cucurbitaceae plants according to claim 5, wherein the attenuated watermelon mosaic virus strain has a helper component protease having the amino acid sequence shown in SEQ ID NO: 5.
7. (4) A method for controlling mosaic disease of Cucurbitaceous plants, comprising inoculating the attenuated strain of Cucumber mosaic virus according to any one of (1) to (3) into Cucurbitaceae plants.
8. 8. The method for controlling mosaic disease of Cucurbitaceae plants according to claim 7, further comprising inoculating a Cucurbitaceous plant with an attenuated strain of watermelon mosaic virus having in the genome thereof RNA encoding SEQ ID NO: 4 encoding a helper component protease.
9. The method for controlling mosaic disease of Cucurbitaceous plants according to claim 7 or 8, wherein the attenuated strain of watermelon mosaic virus has a helper component protease having an amino acid sequence represented by SEQ ID NO: 5.
10. A cucumber plant having mosaic disease resistance, inoculated with the attenuated strain of cucumber mosaic virus according to any one of claims 1 to 3.
11. (11) The Cucurbitaceae plant according to (10), further inoculated with an attenuated watermelon mosaic virus strain having an RNA shown in SEQ ID NO: 4 encoding a helper component protease in its genome.
12. The Cucurbitaceae plant according to claim 11, wherein the attenuated strain of watermelon mosaic virus has a helper component protease consisting of the amino acid sequence shown in SEQ ID NO: 5.
13. (4) A method for extracting an attenuated mosaic virus strain, the method for extracting an attenuated mosaic virus strain from a leaf infected with the attenuated mosaic virus strain using an extraction buffer containing a nonionic surfactant containing poly (oxyethylene) octylphenyl ether.
14. The extraction method is a mixed solution of the supernatant after centrifugation of the ground material of the leaf infected with the attenuated mosaic virus-infected strain and the extract using the nonionic surfactant-added extraction buffer from the sedimentation, or the nonionic surfactant 14. The extraction method according to claim 13, which is a centrifuged supernatant of a ground product using an additional extraction buffer.
15. The method according to claim 13 or 14, wherein the mosaic virus is a cucumber mosaic virus or a watermelon mosaic virus.
    

Images