WO2020004984A1 - Pd-l1 mutant having improved binding affinity for pd-1 - Google Patents

Abstract

The present invention relates to a PD-L1 mutant having improved binding affinity for PD-1. Also, the present invention relates to a method for preparing the PD-L1 mutant and a method for screening the PD-L1 mutant. The PD-L1 mutant of the present invention is made to greatly improve in binding affinity for PD-1 through the optimization achieved by substituting a part of the amino acid sequence of wild-type PD-L1 with a different amino acid sequence and to largely decrease in the plausibility of immunogenicity generation through the minimization of mutation positions.

Description

PD-L1 variant with increased binding force with PD-1

The present invention relates to a PD-L1 variant and a method for preparing the same, wherein PD-1 binding ability is increased to effectively inhibit binding between wild-type PD-L1 and PD-1.

Drugs for the treatment of cancer are largely divided into low-molecular weight drugs and high-molecular weight drugs, and due to their specificity, high-molecular weight drugs have specific attention as low-molecular weight drugs.

Recently, blockade of PD-1 / PD-L1 binding among the immune gate inhibitory proteins has been shown to be effective in the treatment of cancer, and the side effects of other immune gate inhibitory proteins have been reported in the academic community. (J. Naidoo et al. (2015) Annals of Oncology, Lucia Gelao et al. (2014) Toxins , Gorge K. Philips et al (2015) International Immunology ).

Large pharmaceutical companies such as Bristol-Myers Squibb are working to develop therapeutic drugs by suppressing the PD-1 / PD-L1 immune barrier, and anti-cancer drugs such as YERVOY (ipilimumab) and OPDIVO (nivolumab) have been using antibody formats. Under development.

Because PD-1 and PD-L1 are expressed not only in cancer cells but also in human immune cells, antibody drugs can kill normal immune cells and cause autoimmune diseases.

In addition, to remove the binding of tumor-infiltrating lymphocytes (TILs) that bind to tumors and PD-1 / PD-L1, a therapeutic agent with excellent cell penetration is required, but the antibody is disadvantageous to penetrate into a very large molecular protein of 150 kDa. exist.

In addition, in the previous studies, PD-L1 variants were screened through screening. However, PD-L1 has few mutations because of the relatively low binding force and the introduction of many mutations. As a result, it is necessary to find a variant that binds to PD-1 with high binding force.

The matters described as the background art are only for the purpose of improving the understanding of the background of the present invention and should not be taken as acknowledging that they correspond to the related art already known to those skilled in the art.

The present inventors made an effort to discover PD-L1 variants that can effectively inhibit the binding between wild-type PD-L1 and PD-1 due to their high binding capacity with PD-1, and at the same time minimize the possibility of immunogenicity. . As a result, it was confirmed that by replacing some amino acid sequences of wild-type PD-L1 with other amino acid sequences and optimizing them, binding ability with PD-1 can be greatly improved, and the possibility of immunogenicity can be reduced by minimizing mutation sites. The present invention was completed.

Accordingly, it is an object of the present invention to provide a PD-L1 variant with increased PD-1 binding force.

Another object of the present invention to provide a nucleic acid molecule encoding the PD-L1 variant.

Still another object of the present invention is to provide a vector containing the nucleic acid molecule.

Another object of the present invention to provide a host cell comprising the vector.

Still another object of the present invention is to provide a composition comprising the variant, nucleic acid molecule or vector.

Another object of the present invention to provide a method for producing the variant.

Another object of the present invention is to provide a method for screening the variants.

Other objects and advantages of the present invention will become apparent from the following detailed description, claims and drawings.

According to one aspect of the present invention, the present invention provides a PD-L1 variant with an increased PD-1 binding force.

The present inventors made an effort to discover PD-L1 variants that can effectively inhibit the binding between wild-type PD-L1 and PD-1 due to their high binding capacity with PD-1, and at the same time minimize the possibility of immunogenicity. . As a result, it was confirmed that by replacing some amino acid sequences of wild-type PD-L1 with other amino acid sequences and optimizing them, binding ability with PD-1 can be greatly improved, and the possibility of immunogenicity can be reduced by minimizing mutation sites. It was.

As used herein, the term “PD-L1 variant” or “Programmed death-ligand 1 variant” includes variants in which one or two or more amino acids are substituted, deleted or added to the amino acid sequence of wild type PD-L1. Means variant.

According to a preferred embodiment of the present invention, the PD-L1 variant of the present invention includes a variant in which some amino acids in the amino acid sequence of the wild-type PD-L1 of SEQ ID NO: 123 are substituted, deleted or added.

The PD-L1 variant of the present invention preferably has at least 50% homology, more preferably at least 60% homology, even more preferably at least 70% phase with the amino acid sequence of wild type PD-L1 of SEQ ID NO: 123 Homology, even more preferably at least 80% homology, most preferably at least 90% homology.

According to a preferred embodiment of the present invention, the PD-L1 variant of the present invention comprises a part of the amino acid sequence of the wild type PD-L1, the 169th amino acid sequence of the wild type PD-L1 of SEQ ID NO: 123 Amino acid substituted with E169D.

According to a preferred embodiment of the present invention, the PD-L1 variant of the present invention is 41, 73, 117, 124, 130, 139, 195 of the amino acid sequence of the wild type PD-L1 of SEQ ID NO: 123 And one or more amino acids selected from the group consisting of the 1 st, 198 th, 201 th, 213 th and 218 th amino acids are substituted with a sequence different from that of the wild type amino acid.

According to a preferred embodiment of the present invention, in the PD-L1 variant of the present invention, the 195th amino acid sequence of the wild-type PD-L1 of SEQ ID NO: 123 is R195K, R195A, R195I, R195T, R195V, R195F, R195L, R195R Or substituted with R195M.

According to a preferred embodiment of the present invention, the PD-L1 variant of the present invention comprises the substitution of P198S, P198T or P198H with the 198th amino acid sequence of the wild type PD-L1 of SEQ ID NO: 123.

According to a preferred embodiment of the present invention, in the PD-L1 variant of the present invention, the 41st amino acid is M41V, the 117th amino acid is N117S, and the 124th amino acid is L124S of the amino acid sequence of wild type PD-L1 of SEQ ID NO: 123. And 195th amino acid is substituted with R195A.

According to a preferred embodiment of the present invention, the PD-L1 variant of the present invention comprises that the 195th amino acid of the amino acid sequence of wild-type PD-L1 of SEQ ID NO: 123 is substituted with R195K.

According to a preferred embodiment of the present invention, the PD-L1 variant of the present invention comprises that the 73rd amino acid of the amino acid sequence of wild-type PD-L1 of SEQ ID NO: 123 is replaced with Q73R, and the 195th amino acid is replaced with R195I .

According to a preferred embodiment of the present invention, the PD-L1 variant of the present invention comprises the substitution of 130 amino acids to T130A and 195 amino acids to R195I of the amino acid sequence of wild type PD-L1 of SEQ ID NO: 123 .

According to a preferred embodiment of the present invention, the PD-L1 variant of the present invention comprises the substitution of 117th amino acid with N117S and 198th amino acid with P198H of the amino acid sequence of the wild-type PD-L1 of SEQ ID NO: 123 .

According to a preferred embodiment of the present invention, the PD-L1 variant of the present invention comprises that the 195th amino acid of the amino acid sequence of wild-type PD-L1 of SEQ ID NO: 123 is substituted with R195I, and the 213th amino acid is substituted with L213P .

According to a preferred embodiment of the present invention, the PD-L1 variant of the present invention has a 139th amino acid as A139S, 198th amino acid as P198T, and 201th amino acid in the amino acid sequence of wild type PD-L1 of SEQ ID NO: 123 It includes one substituted with N201S.

According to a preferred embodiment of the present invention, the PD-L1 variant of the present invention comprises the substitution of N218D amino acid 218 of the amino acid sequence of wild-type PD-L1 of SEQ ID NO: 123.

According to a preferred embodiment of the present invention, the PD-L1 variant of the present invention is SEQ ID NO: 90, SEQ ID NO: 94, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 100, SEQ ID NO: And SEQ ID NO: 102, SEQ ID NO: 103, SEQ ID NO: 104, SEQ ID NO: 107, SEQ ID NO: 108 to SEQ ID NO: 122.

According to another aspect of the present invention, the present invention provides a nucleic acid molecule encoding the PD-L1 variant, a vector comprising the same or a host cell comprising the vector.

Nucleic acid molecules of the invention can be isolated or recombinant and include single and double stranded DNA and RNA as well as corresponding complementarity sequences. An “isolated nucleic acid” is a nucleic acid isolated from a naturally occurring source, which is separated from the surrounding genetic sequence present in the genome of the individual from which the nucleic acid is isolated. In the case of nucleic acids, such as PCR products, cDNA molecules, or oligonucleotides synthesized enzymatically or chemically from a template, the nucleic acid resulting from this procedure can be understood as an isolated nucleic acid molecule. Isolated nucleic acid molecules refer to nucleic acid molecules in the form of separate fragments or as components of larger nucleic acid constructs. Nucleic acids are “operably linked” when placed in a functional relationship with other nucleic acid sequences. For example, the DNA of a presequence or secretion leader is operably linked to the DNA of a polypeptide when expressed as a preprotein, which is the form before the polypeptide is secreted, and the promoter or enhancer is a polypeptide sequence. Operably linked to a coding sequence when affecting the transcription of the ribosome binding site, or when the ribosome binding site is arranged to facilitate translation. In general, “operably linked” means that the DNA sequences to be linked are located contiguously, and in the case of a secretory leader, they are present in the same reading frame adjacently. However, enhancers do not have to be contiguous. Linking is accomplished by ligation at convenient restriction enzyme sites. If such sites do not exist, the synthetic oligonucleotide adapters or linkers are used in accordance with conventional methods.

As used herein, the term "vector" refers to a carrier capable of inserting a nucleic acid sequence for introduction into a cell capable of replicating the nucleic acid sequence. Nucleic acid sequences can be exogenous or heterologous. Vectors include, but are not limited to, plasmids, cosmids and viruses (eg bacteriophages). One skilled in the art can construct vectors by standard recombinant techniques (Maniatis, et al., Molecular Cloning , A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, NY, 1988; and Ausubel et al., In: Current Protocols in Molecular Biology , John, Wiley & Sons, Inc, NY, 1994, etc.).

As used herein, the term “expression vector” refers to a vector comprising a nucleic acid sequence encoding at least a portion of a gene product to be transcribed. In some cases, RNA molecules are then translated into proteins, polypeptides, or peptides. Expression vectors can include various regulatory sequences. In addition to regulatory sequences that regulate transcription and translation, vectors and expression vectors can also include nucleic acid sequences that provide additional functionality.

As used herein, the term “host cell” refers to any transgenic organism that includes eukaryotes and prokaryotes and is capable of replicating the vector or expressing a gene encoded by the vector. The host cell may be transfected or transformed by the vector, which means a process in which exogenous nucleic acid molecules are delivered or introduced into the host cell.

According to a preferred embodiment of the present invention, the host cell of the present invention is a bacterial cell, more preferably a Gram negative bacterial cell. The cells are suitable for the practice of the present invention in that they have a periplasmic region between the inner membrane and the outer membrane. Examples of preferred host cells of the present invention include E. coli , Pseudomonas aeruginosa , Vibrio cholera , Salmonella typhimurium , Shigella flexneri , Haemophilus influenza , Bordotella pertussi , Erwinia amylovora , Rhizobium sp. And the like, but are not limited thereto.

Most of the commercially available therapeutic proteins are produced through animal cell culture. When the protein is produced, various carbohydrate variants are modified by the protein, resulting in glycogenous heterogeniety. It causes variations in stability and requires a high cost for purification, analysis, and quality control (QC) during the antibody manufacturing process.

Compared to the glycated proteins, which require expensive animal cell culture systems, aglycosylated proteins are capable of mass production in bacteria and have excellent speed and cost.

According to another aspect of the present invention, the present invention provides a wild type PD-L1 (Programmed death-ligand 1) and PD-1 (Programmed cell) comprising the PD-L1 variant, nucleic acid molecule or vector as an active ingredient death protein-1) liver binding inhibitor.

According to another aspect of the present invention, the present invention provides a composition comprising the PD-L1 variant, nucleic acid molecule or vector as an active ingredient.

The composition is preferably a pharmaceutical composition, more preferably a pharmaceutical composition for preventing or treating cancer diseases or infectious diseases.

According to another embodiment of the present invention, the present invention provides a wild type PD-L1 (Programmed death-ligand 1) comprising administering a pharmaceutically effective amount of the PD-L1 variant, nucleic acid molecule or vector to a subject. And PD-1 (Programmed cell death protein-1).

According to another aspect of the present invention, the present invention provides a method for increasing an immune response comprising administering to the subject a pharmaceutically effective amount of the PD-L1 variant, nucleic acid molecule or vector.

According to another aspect of the present invention, the present invention provides a method for treating a cancer disease or infectious disease, comprising administering a pharmaceutically effective amount of the PD-L1 variant, nucleic acid molecule or vector to a subject.

The pharmaceutical composition of the present invention comprises (a) the PD-L1 variant, nucleic acid molecule or vector; And (b) a pharmaceutically acceptable carrier.

The type of cancer to be prevented or treated by the present invention is not limited, leukemias and acute lymphocytic leukemia, acute nonlymphocytic leukemias, chronic lymphocytic leukemia, chronic lymphocytic leukemia Lymphomas, brain tumors, neuroblastoma, such as myelogenous leukemia, Hodgkin's Disease, non-Hodgkin's lymphomas, and multiple myeloma Childhood solid tumors such as retinoblastoma, Wilms Tumor, bone tumors and soft-tissue sarcomas, lung cancer, breast cancer cancer, prostate cancer, urinary cancers, uterine cancers, oral cancers, pancreatic cancer, melanoma and other skin cance rs, stomach cancer, ovarian cancer, brain tumors, liver cancer, laryngeal cancer, thyroid cancer, esophageal cancer and testicular cancer It may be administered to treat a number of cancers, including common solid tumors of adults such as).

The type of infectious disease to be prevented or treated by the present invention is not limited, and includes a viral infection, an influenza infection, a bacterial infection and a fungal infection.

Pharmaceutically acceptable carriers included in the pharmaceutical compositions of the present invention are those commonly used in the preparation, such as lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia rubber, calcium phosphate, alginate, gelatin, Calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil, and the like It doesn't happen. In addition to the above components, the pharmaceutical composition of the present invention may further include a lubricant, a humectant, a sweetener, a flavoring agent, an emulsifier, a suspending agent, a preservative, and the like. Suitable pharmaceutically acceptable carriers and formulations are described in detail in Remington's Pharmaceutical Sciences (19th ed., 1995).

The pharmaceutical composition of the present invention may be administered orally or parenterally to a subject, preferably parenteral administration, for example, by intravenous infusion, topical infusion and intraperitoneal infusion.

As used herein, the term “subject” or “subject” refers to an object to prevent or treat the disease through inhibition of binding between the PD-1 and PD-L1, and preferably includes humans and animals.

As used herein, the term “pharmaceutically effective amount” means an amount of an active ingredient or pharmaceutical composition that induces a biological or medical response in a tissue system, animal or human, as contemplated by a researcher, veterinarian, doctor or other clinician. Amounts that induce alleviation of the symptoms of the disease or disorder in question. It will be apparent to those skilled in the art that the effective amount and administration frequency for the active ingredient of the present invention will vary depending on the desired effect.

Suitable dosages of the pharmaceutical compositions of the invention vary depending on factors such as the formulation method, mode of administration, age, weight, sex, morbidity, condition of food, time of administration, route of administration, rate of excretion and response to reaction, Usually a skilled practitioner can easily determine and prescribe a dosage effective for the desired treatment or prophylaxis. According to a preferred embodiment of the present invention, the daily dose of the pharmaceutical composition of the present invention is 0.0001-100 mg / kg.

The pharmaceutical compositions of the present invention may be prepared in unit dosage form by formulating with a pharmaceutically acceptable carrier and / or excipient according to methods which can be easily carried out by those skilled in the art. Or may be prepared by incorporation into a multi-dose container. In this case, the formulation may be in the form of a solution, suspension or emulsion in an oil or an aqueous medium, or may be in the form of extracts, powders, granules, tablets or capsules, and may further include a dispersant or stabilizer.

The pharmaceutical composition of the present invention may be used alone as a therapy, but may also be used in conjunction with other conventional biological, chemo, or radiation therapies, and such combination therapy may be used to treat cancer or infectious disease more effectively. Can be. Chemotherapeutic agents that can be used with the composition when the present invention is used for the prevention and treatment of cancer are cisplatin, carboplatin, procarbazine, mechlorethamine, Cyclophosphamide, ifosfamide, melphalan, chlorambucil, bisulfan, nitrosourea, diactinomycin, daunorucin Daunorubicin, doxorubicin, bleomycin, plecomycin, mitomycin, etoposide, tamoxifen, tamoxifen, taxol, transflavol Transplatinum, 5-fluorouracil, vincristin, vinblastin, methotrexate, and the like. Radiation therapy that can be used with the composition of the present invention is X-ray irradiation, γ-ray irradiation, and the like.

According to another aspect of the present invention, the present invention provides a method for preparing a PD-L1 variant, comprising the following steps:

a) culturing a host cell comprising a vector comprising a nucleic acid molecule encoding the PD-L1 variant; And

b) recovering the PD-L1 variant expressed by the host cell.

According to another aspect of the invention, the invention provides a method of screening for PD-L1 variants comprising the following steps:

a) constructing a library of PD-L1 variants or nucleic acid molecules encoding the PD-L1 variants or randomly added point mutations to the PD-L1 variants or nucleic acid molecules encoding the same; And

b) selecting PD-L1 variants that inhibit binding between wild type Programmed death-ligand 1 and PD-1 Programmed cell death protein-1 in the library.

The screening methods of the present invention can use fluorescence labeled cell separation (FACS) screening, or other automated flow cytometry techniques. Instruments for performing flow cytometry are known to those skilled in the art. Examples of such devices are FACSAria, FACS Star Plus, FACScan and FACSort devices (Becton Dickinson, Foster City, CA), Epics C (Coulter Epics Division, Hialeah, FL), MOFLO (Cytomation, Colorado Springs, Colo.), MOFLO- XDP (Beckman Coulter, Indianapolis, IN). Flow cytometry techniques generally include the separation of cells or other particles in a liquid sample. Typically the purpose of a flow cytometer is to analyze the separated particles for their one or more properties (eg the presence of labeled ligands or other molecules). Particles are passed one by one by the sensor and are classified based on size, refraction, light scattering, opacity, roughness, shape, fluorescence, and the like.

The features and advantages of the present invention are summarized as follows:

(i) The present invention provides PD-L1 variants with increased PD-1 binding capacity.

(ii) The present invention also provides a method for producing and screening the PD-L1 variant.

(iii) The PD-L1 variant of the present invention significantly improves the binding ability with PD-1 by replacing some amino acid sequences of wild-type PD-L1 with other amino acid sequences, thereby generating immunogenicity through the implementation of minimization of mutation sites. The likelihood can be greatly reduced.

1 shows the results of expression analysis of PD-L1 in E. coli using Anti-FLAG-FITC.

2 shows Dimeric PD-1 preparation, fluorescence labeling and activity validation results.

3 shows E. coli endothelium display method and probe concentration selection results.

4 shows the results of the initial library DNA sequence analysis.

5 shows library enrichment verification results according to the screening process.

Figure 6 shows the result of the binding force analysis of the PD-L1 variants obtained with PD-1.

Figure 7 shows the results of the binding force analysis of PD-1 of PD-L1 variants obtained through major position mutations.

8 shows the results of avidity analysis of PD-L1 variants with PD-1 comprising additional triple mutations (positions 169, 195 and 198).

Hereinafter, the present invention will be described in more detail with reference to the following examples. These examples are only for illustrating the present invention in more detail, it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples in accordance with the gist of the present invention. .

Example

Example 1: Cloning to Display Human PD-L1 in Bacterial Cell Intima (Wild Type PD-L1)

The human PD-L1 extracellular region portion (SEQ ID NO: 123) was cloned for PD-L1 engineering using bacterial displays. First, human PD-L1 gene cDNA was purchased from Sino Biotech (Catalog number: HG10084-M), and then the DNA of amino acid sequence F19-R238, which is a PD-L1 extracellular region, was prepared by primer (JY # 1, JY # 2). The gene was amplified by PCR with Vent Polymerase (New England Biolab). Processing the amplified gene into the restriction enzyme Sfi I and then, the process proceeds to the process with Sfi I-pMopac12 NlpA-FLAG vector and the ligation was complete pMopac12-NlpA-PDL1_WT-FLAG plasmids. This is to secrete PD-L1 protein into E. coli periplasmic region by using a signal peptide called NlpA immobilized on the cell membrane. The ligated plasmid was transformed into Jude1 ((F-mcrA Δ (mrr-hsdRMS-mcrBC) Φ80lacZΔM15 ΔlacX74 recA1 endA1 araD139 △ (ara, leu) 7697 galU galK λ-rpsL nupG) Escherichia coli and analyzed by individual colonies). The sequence was confirmed.

Example 2: Cloning of tetrameric Human PD-L1 (PD-L1-Streptavidin) for Engineering Glycosylated PD-1

The cloned pMopac12-NlpA-PDL1-FLAG plasmid and pMopac12-NlpA-Fc-FLAG, a positive control well expressed in Escherichia coli, and pMopac12-NlpA-PDL1, a negative control without FLAG tag, were transformed into Jude1 cells, respectively. Each sample was incubated for 16 hours at 37 ° C., 250 rpm in 4 ml of TB 2% glucose medium containing 40 μg / ml of chloramphenicol, and then the cultured cells were 7 mL of TB containing 40 μg / ml of chloramphenicol. The medium was inoculated at a 1: 100 ratio. After incubating at OD ₆₀₀ = 0.5 at 37 ° C. and 250 rpm, the mixture was cooled at 25 ° C. and 250 rpm for 15 minutes, followed by induction for 25 ° C., 250 rpm, and 5 hours by adding 1 mM IPTG. After the induction, the same amount of cells were centrifuged (14,000 rpm, 1 min) through OD ₆₀₀ normalize and recovered in the e-tube. Resuspension was performed by adding 1 ml of 10 mM Tris-HCl (pH 8.0) to each e-tube from which the cells were recovered, and the remaining medium was removed by repeating the cell collection again by centrifugation (14,000 rpm, 1 min). . After washing, the cells were resuspensioned with 1 ml of STE [0.5 M sucrose, 10 mM Tris-HCl, 10 mM EDTA (pH 8.0)] solution, and rotated at 37 ° C. for 30 minutes to remove the extracellular membrane. The cells were collected again by centrifugation (14,000 rpm, 1 min), and then the supernatant was removed. 1 ml of Solution A [0.5 M sucrose, 20 mM MgCl ₂ , 10 mM MOPS pH 6.8] was added to resuspension and centrifuged (14,000 rpm, 1 min) to remove the supernatant, followed by 1 mL of Solution A and 50 mg / ml lysozyme. 1 ml of a solution containing 20 μl of solution was resuspensioned and rotated at 37 ° C. for 15 minutes to remove the peptidoglycan layer. After centrifugation (14,000 rpm, 1 min), the supernatant was removed and resuspensioned with 1 ml PBS to transfer 300 μL to a new e-tube, followed by 700 μl PBS and 33 nM anti-FLAG-FTIC (SIGMA), respectively. After rotation for 1 hour at room temperature, the spheroplast was labeled with a fluorescent probe. Thereafter, the supernatant is discarded by centrifugation (14,000 rpm, 1 minute) and resuspensioned with 1 ml of PBS and washed twice. Three samples were completed using the Guava (Merck Millipore) instrument. As a result, it was confirmed that PD-L1 was successfully expressed in Escherichia coli (FIG. 1), through which screening potential using bacterial display was verified.

Example 3: Cloning of dimeric Human PD-1 (PD-1-GST) for Engineered PD-L1 Screening

PD-1 was cloned in order to use it as a fluorescent probe when screening PD-L1 with strong binding force to PD-1. At this time, dimer was induced by expressing GST in C-terminal part of PD-1 for more efficient screening using avidity effect through PD-1 dimerization. Also included is a linker consisting of Gly and Ser between PD-1 and GST for fluidity of each protein. First, Sino Biotech. After purchasing PD-1 gene cDNA (Catalog number: HG10377-M), the DNA of amino acid sequence L25-Q167, which is a part of PD-1 extracellular domain, was converted to Vent Polymerase using primers (CKJ # 1, CKJ # 2). PCR amplified the genes. GST was also amplified by PCR with Vent Polymerase using primers (CKJ # 3, CKJ # 4). The PD-1 and GST DNAs amplified in this way were subjected to assembly PCR using a vent polymerase to generate PD-1-GST-His tags, followed by restriction enzymes Bss HII and Xba I (New England Biolab). Ligation was performed with pMAZ, an enzyme-treated animal cell expression vector. The ligated plasmid was transformed into Jude1 Escherichia coli and confirmed the sequence through individual colony analysis.

Example 4: Animal Cell Expression, Purification and Fluorescent Labeling of Dimeric PD-1-GST

The completed dimeric PD-1 expression vector was transfected into animal cells (HEK293F) and incubated for 6 days. Cell culture was centrifuged at 6,000 xg for 15 minutes, then the supernatant was taken and filtered through a 0.22 μm filter. The filtered solution was mixed with 1 mL of Ni-NTA resin (Qiagen) and bound at 4 ° C. for 16 hours. The combined solution was poured into a column, washed with 10 CV (column volume) of PBS solution containing 10 mM imidazole (SIGMA), and washed once more with 10 CV of 20 mM imidazole containing PBS solution. Finally, the eluate was recovered with a PBS solution containing 250 mM imidazole. The purified PD-1 dimer was fluorescently labeled using Alexa-488 labeling kit. As a result of analyzing the activity of the fluorescently labeled dimeric PD-1 by ELISA, it was confirmed that it has excellent binding capacity with PD-L1 (Fig. 2).

Example 5: PD-L1 Cloning for E. coli Endometrial Display Method Selection

For efficient screening, E. coli cell anchoring motifs were determined, and NlpA system (pMopac12-NlpA-PDL1_WT-FLAG) anchoring the N-terminal of protein and geneIII system (pAK200-PelB-PDL1_WT) anchoring the C-terminal part -gene III) will be compared. Since pMopac12-NlpA-PDL1_WT-FLAG plasmid has already been secured, only pAK200-PelB-PDL1_WT-gene III was further cloned. First, DNAs of the amino acid sequences F19-R238, which are part of the extracellular region of PD-L1, were amplified by PCR with Vent Polymerase using primers (JY # 3, JY # 2). Processing the amplified gene into the restriction enzyme Sfi I and then, the process proceeds to the process with Sfi I pAK200-PelB-geneⅢ vector and the ligation was complete the pAK200-PelB-PDL1_WT-geneⅢ plasmid. This is to secrete the protein into the E. coli periplasmic region through a signal peptide called PelB, and then to anchor the C-terminal of PD-L1 by the gene III protein immobilized on the cell membrane. The ligated plasmid was transformed into Jude1 Escherichia coli and confirmed the sequence through individual colony analysis.

Example 6: Selection of display method and probe concentration by verifying the binding force between PD-L1 expressed in E. coli and PD-1-GST probe using flow cytometry

The completed pMopac12-NlpA-PDL1-FLAG and pAK200-PelB-PDL1-geneIII plasmids were transformed into Jude1 cells, respectively. Each sample was incubated for 16 hours at 37 ° C., 250 rpm in 4 ml of TB 2% glucose medium containing 40 μg / ml chloramphenicol, and then the cultured cells were stored in 7 mL TB containing 40 μg / ml chloramphenicol. The medium was inoculated at a 1: 100 ratio. After culturing to OD ₆₀₀ = 0.5 at 37 ° C. and 250 rpm, the mixture was cooled at 25 ° C. and 250 rpm for 15 minutes, followed by induction for 25 ° C., 250 rpm, and 5 hours by adding 1 mM IPTG. After the induction, the same amount of cells were centrifuged (14,000 rpm, 1 minute) through OD ₆₀₀ normalize and recovered in the e-tube. Resuspension was performed by adding 1 ml of 10 mM Tris-HCl (pH 8.0) to each e-tube from which the cells were recovered, and the remaining medium was removed by repeating the cell collection again by centrifugation (14,000 rpm, 1 min). . After washing, the cells were resuspensioned with 1 ml of STE [0.5 M sucrose, 10 mM Tris-HCl, 10 mM EDTA (pH 8.0)] solution and rotated at 37 ° C. for 30 minutes to remove the extracellular membrane. The cells were collected again by centrifugation (14,000 rpm, 1 min), and then the supernatant was removed. 1 ml of Solution A [0.5 M sucrose, 20 mM MgCl ₂ , 10 mM MOPS pH 6.8] was added to resuspension and centrifuged (14,000 rpm, 1 min) to remove supernatant, followed by 1 ml of Solution A and 50 mg / ml lysozyme solution. 1 ml of 20 μl mixed solution was added and resuspensioned and rotated at 37 ° C. for 15 minutes to remove the peptidoglycan layer. After centrifugation (14,000 rpm, 1 min), the supernatant was removed and resuspensioned with 1 ml PBS to transfer 300 μl to a new e-tube, followed by 700 μl PBS and 100 nM, 200 nM dimeric PD1-Alexa488 probe, respectively. After rotation for 1 hour at room temperature, the spheroplast was labeled with a fluorescent probe. Thereafter, the supernatant is discarded by centrifugation (14,000 rpm, 1 minute) and resuspensioned with 1 ml of PBS and washed twice. Samples that completed this process were analyzed using Guava (Merck Millipore) instrument. The NlpA system anchored to the inner membrane of the N-terminal part showed almost no binding to the gene III system anchored to the C-terminal, whereas the fluorescence peak at 100 nM rather than 200 nM was observed. Judging from the good separation, the first screening probe concentration was determined to be 100 nM (FIG. 3).

Example 7: Fabrication of large PD-L1 error prone library for using ultrafast screening technique

PD-1 and enables the random mutations into every part of PDL1 based on pAK200-PelB-PDL1-geneⅢ to search at a high speed for PDL1 variant with a high affinity containing Sfi I site on both Primers (JY # 4, JY # 5) were designed. DNA was amplified using the designed primer, Taq Polymerase (TAKARA), dNTPs (Invitrogen), MgCl ₂ , MnCl ₂ (SIGMA) using Error Prone PCR. Processing the amplified gene into the restriction enzyme Sfi I and then, the process proceeds to the process with Sfi I pAK200-PelB-geneⅢ vector and ligation was Jude1 transformation in E. coli. Spread it on a plate and incubated at 37 ℃ for 16 hours to recover all the E. coli using TB 2% glucose medium to secure the initial library. As a result of confirming 10 DNA sequences of individual colonies, it was found that a library containing an average of about 3 amino acids mutations per PD-L1 protein was produced (FIG. 4).

Example 8: PD-L1 variant screening using flow cytometer

1 ml of the initial library was inoculated into 25 ml of TB 2% glucose medium to which 40 μg / ml of chloramphenicol was added, and then incubated at 37 ° C. at 250 rpm for 4 hours. E. coli cultured in 100 ml of TB medium containing 40 μg / ml chloramphenicol was inoculated at a ratio of 1: 100. After incubating at OD ₆₀₀ = 0.5 at 37 ° C. and 250 rpm, the mixture was cooled at 25 ° C. and 250 rpm for 15 minutes, followed by induction for 25 ° C., 250 rpm, and 5 hours by adding 1 mM IPTG. After the induction, the cells were recovered in the e-tube by centrifugation (14,000 rpm, 1 min) by OD ₆₀₀ normalization. Resuspension was performed by adding 1 ml of 10 mM Tris-HCl (pH 8.0) to each e-tube from which the cells were collected, and the remaining medium was removed by repeating the cell collection through centrifugation (14,000 rpm, 1 minute) twice. . The washed cells were resuspensioned with 1 ml of STE [0.5 M sucrose, 10 mM Tris-HCl, 10 mM EDTA (pH 8.0)] solution and rotated at 37 ° C. for 30 minutes to remove the extracellular membrane. The cells were collected again by centrifugation (14,000 rpm, 1 min), and then the supernatant was removed. 1 ml of Solution A [0.5 M sucrose, 20 mM MgCl ₂ , 10 mM MOPS pH 6.8] was added to the solution and centrifuged (14,000 rpm, 1 min) to remove the supernatant, followed by 1 ml of Solution A and 50 mg / ml lysozyme. 1 ml of a solution containing 20 μl of solution was added and resuspensioned to rotate at 37 ° C. for 15 minutes to remove the peptidoglycan layer. After centrifugation (14,000 rpm, 1 min), remove the supernatant, resuspension with 1 ml of PBS, transfer 300 μl to a new e-tube, add 700 μl of PBS and 100 nM dimeric PD1-Alexa488 probe, respectively. The spheroplasts were labeled with fluorescent probes by rotating for 1 h at. Subsequently, the supernatant was discarded by centrifugation (14,000 rpm, 1 minute), resuspensioned with 1 ml of PBS, and washed twice. S3 sorter (Bio-Rad) was used for high binding to PD-1. E. coli were recovered. The recovered E. coli were able to be obtained by amplifying a gene by PCR using a primer (JY # 5, JY # 6) again, and then processed by a restriction enzyme, Sfi I, treated with Sfi I pAK200-PelB-geneⅢ Ligation with the vector was transformed into Jude1 Escherichia coli. Spread it on a plate and incubated for 16 hours at 37 ℃ to recover all E. coli using TB 2% glucose medium and stored at -80 ℃. The screening process as described above was carried out a total of six times while reducing the concentration of the probe.

Example 9: Escherichia coli culture for confirming enrichment of PD-L1 variants with increased binding force with PD-1

25 ml of TB 2% glucose medium supplemented with 40 μg / ml chloramphenicol was inoculated separately with 1 ml of initial, 1st, 2nd, 3rd, 4th, 5th, and 6th round libraries and 250 ° C at 37 ° C. Incubated for 4 hours at rpm. E. coli cultured in 100 ml of TB medium to which 40 μg / ml chloramphenicol was added was inoculated at a ratio of 1: 100. After culturing to OD ₆₀₀ = 0.5 at 37 ° C. and 250 rpm, the mixture was cooled at 25 ° C. and 250 rpm for 15 minutes, followed by incubation for 25 hours, 250 rpm, and 5 hours by adding 1 mM IPTG. In addition, wild-type PD-L1, a control group, was incubated for 16 hours at 37 ° C. and 250 rpm in 4 ml of TB 2% glucose medium containing 40 μg / ml of chloramphenicol, and the cultured cells contained 40 μg / ml of chloramphenicol. 7 ml of TB medium was inoculated at a ratio of 1: 100. After incubating at OD ₆₀₀ = 0.5 at 37 ° C. and 250 rpm, cooling was performed at 25 ° C. and 250 rpm for 15 minutes, followed by induction for 25 ° C., 250 rpm, and 5 hours by adding 1 mM IPTG. After induction, all cells were normalized to OD ₆₀₀ and recovered in the e-tube by centrifugation (14,000 rpm, 1 min).

Example 10 Enrichment of PD-L1 Variants with Increased Adhesion with PD-1 Using Flow Cytometry

Resuspension was performed by adding 1 ml of 10 mM Tris-HCl (pH 8.0) to each e-tube from which the cells were recovered, and the remaining medium was removed by repeating the cell collection through centrifugation (14,000 rpm, 1 minute) twice. . The washed cells were resuspensioned with 1 ml of STE [0.5 M sucrose, 10 mM Tris-HCl, 10 mM EDTA (pH 8.0)] solution and rotated at 37 ° C. for 30 minutes to remove the extracellular membrane. The cells were collected again by centrifugation (14,000 rpm, 1 minute), and then the supernatant was removed. Add 1 ml of Solution A [0.5 M sucrose, 20 mM MgCl ₂ , 10 mM MOPS pH 6.8], resuspension, remove the supernatant by centrifugation (14,000 rpm, 1 min), and 1 ml of Solution A with 50 mg / ml lysozyme. 1 ml of a solution containing 20 μl of solution was resuspensioned and rotated at 37 ° C. for 15 minutes to remove the peptidoglycan layer. After centrifugation (14,000 rpm, 1 min), remove the supernatant, resuspension with 1 ml of PBS, transfer 300 μl to a new e-tube, add 700 μl of PBS and 5 nM dimeric PD1-Alexa488 probe, respectively, at room temperature. The spheroplasts were labeled with fluorescent probes after rotation for 1 hour. Thereafter, the supernatant was discarded by centrifugation (14,000 rpm, 1 minute) and resuspensioned with 1 ml of PBS and washed twice. Samples that completed this process were analyzed using Guava (Merck Millipore) instrument. As a result, as the screening progressed, it was confirmed that variants with improved binding to PD-1 were amplified than wild type PD-L1 (FIG. 5).

Example 11: PD-L1 Control Cloning (PD-L1_L3B3) for Comparison with Secured PD-L1 Variants

PD-L1_L3B3 variants were used as primers (JY # 7, JY # 8, JY # 9, JY # 10, JY # 11, JY # 12, JY # 13, JY # 14, JY # 15, JY # 16, JY # 17, JY # 18, JY # 19, JY # 20) the after processing that have been created through the assembly PCR using 14 was amplified gene with restriction enzyme Sfi I, treated with Sfi I pAK200-PelB Ligation with -geneIII vector was performed to complete the pAK200-PelB-PDL1_L3B3-geneIII plasmid. The ligated plasmid was transformed into Jude1 Escherichia coli and confirmed the sequence through individual colony analysis.

Example 12: Obtaining PD-L1 Variants with Increased Adhesion with PD-1 by Flow Cytometry Analysis

Six rounds of single colonies, wild-type PDL1, and control PDL1_L3B3 were incubated for 16 hours at 37 ° C and 250 rpm in 4 ml of TB 2% glucose medium containing 40 μg / ml of chloramphenicol, respectively. Inoculated in a ratio of 1: 100 in 7 ml of TB medium containing ml of chloramphenicol. After culturing to OD ₆₀₀ = 0.5 at 37 ° C. and 250 rpm, the mixture was cooled at 25 ° C. and 250 rpm for 15 minutes, followed by induction for 25 ° C., 250 rpm, and 5 hours by adding 1 mM IPTG. After the induction, the same amount of cells were centrifuged (14,000 rpm, 1 minute) through OD ₆₀₀ normalize and recovered in the e-tube. Resuspension was performed by adding 1 ml of 10 mM Tris-HCl (pH 8.0) to each e-tube from which the cells were recovered, and the remaining medium was removed by repeating the cell collection again by centrifugation (14,000 rpm, 1 min). . The washed cells were resuspensioned with 1 ml of STE [0.5 M sucrose, 10 mM Tris-HCl, 10 mM EDTA (pH 8.0)] solution and rotated at 37 ° C. for 30 minutes to remove the extracellular membrane. The cells were recollected by centrifugation (14,000 rpm, 1 min), and then the supernatant was removed. Add 1 ml of Solution A [0.5 M sucrose, 20 mM MgCl ₂ , 10 mM MOPS pH 6.8], resuspension, remove the supernatant by centrifugation (14,000 rpm, 1 min), and 1 ml of Solution A and 50 mg / ml 1 ml of a solution of 20 μl of lysozyme solution was added, resuspensioned, and rotated at 37 ° C. for 15 minutes to remove the peptidoglycan layer. After centrifugation (14,000 rpm, 1 min), the supernatant was removed and resuspensioned with 1 ml of PBS to transfer 300 μl to a new e-tube. Then, 700 μl of PBS and 30 nM dimeric PD1-Alexa488 probe were added at room temperature. After rotating for 1 hour, the spheroplast was labeled with a fluorescent probe. Thereafter, the supernatant was discarded by centrifugation (14,000 rpm, 1 minute) and resuspensioned with 1 ml of PBS and washed twice. Samples that completed this process were analyzed using Guava (Merck Millipore) instrument. This confirmed the variant amplified affinity up to about 7 ~ 8 times the fluorescence signal value (Fig. 6).

Example 13: Cloning of Mutant Variants at Key Locations via Sequencing Analysis

As a result of analyzing the sequence of the obtained variants, it was found that the amino acid position that was likely to have a major influence on the binding force and the common amino acid characteristic of the position. This cloned a total of 16 variants into amino acids that might be important for the site. This is done by assembly PCR using degenerate codon primers (JY # 21, JY # 22, JY # 23, JY # 24, JY # 25, JY # 26, JY # 27, JY # 28, JY # 29, JY # 30). after treatment the progress gene were amplified with the restriction enzymes Sfi I, the process proceeds to the process with Sfi I pAK200-PelB-geneⅢ vector and the ligation was complete the pAK200-PelB-PDL1_L3B3-geneⅢ plasmid. The ligated plasmid was transformed into Jude1 Escherichia coli and confirmed the sequence through individual colony analysis. For unidentified variants, additional primers (JY # 31, JY # 32, JY # 33, JY # 34, JY # 35, JY # 36, JY # 37, JY # 38, JY # 39, JY # 40, JY # 41, JY # 42) were fabricated and secured using the Quikchange PCR technique.

Example 13: Cloning of Mutant Variants at Key Locations via Sequencing Analysis

Wild-type PD-L1, No.73 and 74 variants (JY-73 and JY-74) and 16 additional variants were prepared at 37 ° C in 4 ml of TB 2% glucose medium containing 40 μg / ml of chloramphenicol, respectively. After 16 hours of incubation at 250 rpm, the cultured cells were inoculated at a ratio of 1: 100 in 7 ml of TB medium containing 40 μg / ml of chloramphenicol. After incubating at OD ₆₀₀ = 0.5 at 37 ° C. and 250 rpm, the mixture was cooled at 25 ° C. and 250 rpm for 15 minutes, followed by induction for 25 ° C., 250 rpm, and 5 hours by adding 1 mM IPTG. After the induction, the same amount of cells were centrifuged (14,000 rpm, 1 minute) through OD ₆₀₀ normalize and recovered in the e-tube. 1 ml of 10 mM Tris-HCl (pH 8.0) was added to each e-tube from which the cells were recovered, and the remaining medium was removed by repeating the cells again by centrifugation (14,000 rpm, 1 min). . The washed cells were resuspensioned with 1 ml of STE [0.5 M sucrose, 10 mM Tris-HCl, 10 mM EDTA (pH 8.0)] solution and rotated at 37 ° C. for 30 minutes to remove the extracellular membrane. The cells were collected again by centrifugation (14,000 rpm, 1 min), and then the supernatant was removed. Add 1 ml of Solution A [0.5 M sucrose, 20 mM MgCl ₂ , 10 mM MOPS pH 6.8], resuspension, remove the supernatant by centrifugation (14,000 rpm, 1 min), and then remove 1 ml of Solution A with 50 mg / 1 ml of the solution containing 20 μl of the ml lysozyme solution was resuspensioned and rotated at 37 ° C. for 15 minutes to remove the peptidoglycan layer. After centrifugation (14,000 rpm, 1 min), remove the supernatant, resuspension with 1 ml of PBS, transfer 300 μl to a new e-tube, add 700 μl of PBS and 30 nM dimeric PD1-Alexa488 probe, respectively, at room temperature. After rotating for 1 hour, the spheroplast was labeled with a fluorescent probe. Thereafter, the supernatant is discarded by centrifugation (14,000 rpm, 1 minute) and resuspensioned with 1 ml of PBS and washed twice. Samples that completed this process were analyzed using Guava (Merck Millipore) instrument. Fluorescence signal values were indirectly analyzed for binding of the variants to PD-1 (FIG. 7). Through this, the variants with amplification of fluorescence signal values more than four-fold amplification were identified. Among them, the affinity of DAS, DTS, DTT, DLT and DMS increased five times or more (FIG. 8).

primer #	sequence (5 ’→ 3’)
CKJ # 1 (SEQ ID NO: 1)	GCGGAATTCGGCGCGCACTCCGAATTAGACTCCCCAGACAGGCCC
CKJ # 2 (SEQ ID NO: 2)	GCCCTTAATTTTCCAATAACCTAGTATAGGGGACATAGAGCCACCGCCACCTTGGAACTGGCCGGCTGG
CKJ # 3 (SEQ ID NO: 3)	ATGTCCCCTATACTAGGTTATTGGAAAATTAAGGGC
CKJ # 4 (SEQ ID NO: 4)	GAATTCCGCTCTAGATTATCAATGATGATGGTGGTGATGGGATTTTGGAGGATGGTCGCCACC
JY # 1 (SEQ ID NO: 5)	CGCAGCGAGGCCCAGCCGGCCTTTACTGTCACGGTTCCCAAGGACC
JY # 2 (SEQ ID NO: 6)	CGCAGCGAGGCCCCCGAGGCCCCCCTTTCATTTGGAGGATGTGCCAGAG
JY # 3 (SEQ ID NO: 7)	CGCAGCGAGGCCCAGCCGGCCATGGCGTTTACTGTCACGGTTCCCAAGGACC
JY # 4 (SEQ ID NO: 8)	CGCAGCGAGGCCCAGCCGGCC
JY # 5 (SEQ ID NO: 9)	CGCAGCGAGGCCCCCGAGGCCCC
JY # 6 (SEQ ID NO: 10)	TTGTGAGCGGATAACAATTTC
JY # 7 (SEQ ID NO: 11)	TTTACTGTCACGGTTCCCAAGGACCTATATG
JY # 8 (SEQ ID NO: 12)	TTTTTCTACTGGGAATTTGCATTCAATTGTCATATTGCTACCATACTCTACCACATATAGGTCCTTGGGAACCGT
JY # 9 (SEQ ID NO: 13)	TGAATGCAAATTCCCAGTAGAAAAACAATTAGACCTGGCTGCACTACAAGTCTTCTGGATGATGGAGGATAAGAA
JY # 10 (SEQ ID NO: 14)	TACTATGCTGAACCTTCAGGTCTTCCTCTCCATGCACAAATTGAATAATGTTCTTATCCTCCATCATCCAGAAGA
JY # 11 (SEQ ID NO: 15)	AGACCTGAAGGTTCAGCATAGTAGCTACAGACAGAGGGCCCGGCTGTTGAAGGACCAGCTCTCCCTGGGAAATGC
JY # 12 (SEQ ID NO: 16)	TCAAGCACGTGTACACCCCTGCATCCTGCAATTTCACATCTGTGATCTGAAGTGCAGCATTTCCCAGGGAGAGCT
JY # 13 (SEQ ID NO: 17)	GGGGTGTACACGTGCTTGATCGCATATAAAGGTGCCGACTACAAGCGAATTACTGTGAAAGTCAATGCCCCATAC
JY # 14 (SEQ ID NO: 18)	TCATGTTCAGAGGTGACTGGATCCACAACCAAAATTCTTTGGTTGATTTTGTTGTATGGGGCATTGACTTTCACA
JY # 15 (SEQ ID NO: 19)	ATCCAGTCACCTCTGAACATGAACTGACATGTCAGGCTGAGGGCTACCCCAAGGCCGAAGTCATCTGGACAAGCA
JY # 16 (SEQ ID NO: 20)	CCTCTCTCTTGGAATTGGTGGTGGTGGTCTTACCACTCAGGACTTGATGGTCACTGCTTGTCCAGATGACTTCGG
JY # 17 (SEQ ID NO: 21)	ACCACCAATTCCAAGAGAGAGGAGAAGCTTTTCAATGTGACCAGCACACTGAGAATCAACACAACAACTAATGAG
JY # 18 (SEQ ID NO: 22)	TGTATGGTTTTCCTCAGGATCTAATCTCCTAAAAGTGCAGTAGAAAATCTCATTAGTTGTTGTGTTGATTCTCAG
JY # 19 (SEQ ID NO: 23)	GATTAGATCCTGAGGAAAACCATACAGCTGAATTGGTCATCCCAGAACTACCTCTGGCACATCCTCCAAATGAAA
JY # 20 (SEQ ID NO: 24)	CCTTTCATTTGGAGGATGTGCCAG
JY # 21 (SEQ ID NO: 25)	TTTACTGTCACGGTTCCCAAGGACC
JY # 22 (SEQ ID NO: 26)	TCTCTCTTGGAATTGGTGGTGGTGG
JY # 23 (SEQ ID NO: 27)	CCACCACCACCAATTCCAAGAGAGATGAGAAGCTTTTCAATGTGACCAGCACACTGAGAATC
JY # 24 (SEQ ID NO: 28)	CCTAAAAGTGCAGTAGAAAATCTCATTAGTTGTTGTGTTGATTCTCAGTGTGCTGGTCACATTGAAAAG
JY # 25 (SEQ ID NO: 29)	CACAACAACTAATGAGATTTTCTACTGCACTTTTAGGRYYTTAGATWCYGAGGAAAACCATACAGCTGAATTGGTCATC
JY # 26 (SEQ ID NO: 30)	CACAACAACTAATGAGATTTTCTACTGCACTTTTAGGAKGTTAGATWCYGAGGAAAACCATACAGCTGAATTGGTCATC
JY # 27 (SEQ ID NO: 31)	CACAACAACTAATGAGATTTTCTACTGCACTTTTAGGYTYTTAGATWCYGAGGAAAACCATACAGCTGAATTGGTCATC
JY # 28 (SEQ ID NO: 32)	CCTTTCATTTGGAGGATGTGCCAGAGGTAGTTCTGGGATGACCAATTCAGCTGTATGGTTTTCCTC
JY # 29 (SEQ ID NO: 33)	CCACCACCACCAATTCCAAGAGAGA
JY # 30 (SEQ ID NO: 34)	CCTTTCATTTGGAGGATGTGCCAGAG
JY # 31 (SEQ ID NO: 35)	CAACTAATGAGATTTTCTACTGCACTTTTAGGACTTTAGATACTGAGGAAAACCATACAGCTGAATTGGTC
JY # 32 (SEQ ID NO: 36)	GACCAATTCAGCTGTATGGTTTTCCTCAGTATCTAAAGTCCTAAAAGTGCAGTAGAAAATCTCATTAGTTG
JY # 33 (SEQ ID NO: 37)	CAACAACTAATGAGATTTTCTACTGCACTTTTAGGGCTTTAGATTCTGAGGAAAACCATACAGCTGAATTGG
JY # 34 (SEQ ID NO: 38)	CCAATTCAGCTGTATGGTTTTCCTCAGAATCTAAAGCCCTAAAAGTGCAGTAGAAAATCTCATTAGTTGTTG
JY # 35 (SEQ ID NO: 39)	CAACAACTAATGAGATTTTCTACTGCACTTTTAGGGCTTTAGATACCGAGGAAAACCATACAGCTGAATTG
JY # 36 (SEQ ID NO: 40)	CAATTCAGCTGTATGGTTTTCCTCGGTATCTAAAGCCCTAAAAGTGCAGTAGAAAATCTCATTAGTTGTTG
JY # 37 (SEQ ID NO: 41)	CTAATGAGATTTTCTACTGCACTTTTAGGAGGTTAGATTCTGAGGAAAACCATACAGCTGAATTGGTC
JY # 38 (SEQ ID NO: 42)	GACCAATTCAGCTGTATGGTTTTCCTCAGAATCTAACCTCCTAAAAGTGCAGTAGAAAATCTCATTAG
JY # 39 (SEQ ID NO: 43)	CACAACAACTAATGAGATTTTCTACTGCACTTTTAGGCTTTTAGATTCCGAGGAAAACCATACAGCTG
JY # 40 (SEQ ID NO: 44 Sequence)	CAGCTGTATGGTTTTCCTCGGAATCTAAAAGCCTAAAAGTGCAGTAGAAAATCTCATTAGTTGTTGTG
JY # 41 (SEQ ID NO: 45 Sequence)	CTATTGGGAAATGGAGGATAAGAACATTATTCAATTTGTGCATGGAGAGGAAGACCTGAAGGTTCAG
JY # 42 (SEQ ID NO: 46)	CTGAACCTTCAGGTCTTCCTCTCCATGCACAAATTGAATAATGTTCTTATCCTCCATTTCCCAATAG

Primers used in the experiment

PD-L1 variant	Sequence Listing	PD-L1 variant position and substituted amino acid
JY-1	SEQ ID NO: 89 Sequence	V50A, N78K, R195T
JY-7	SEQ ID NO: 90 Sequence	M41V, N117S, L124S, E169D, R195A
JY-11	SEQ ID NO: 91 Sequence	S151N, P217L
JY-19	SEQ ID NO: 92 Sequence	K160N, I181 V, P198S
JY-25	SEQ ID NO: 93 Sequence	Q155R, P198T
JY-36	SEQ ID NO: 94 Sequence	E169D, R195K
JY-48	SEQ ID NO: 95 Sequence	Q73R, E169D, R195I
JY-49	SEQ ID NO: 96 Sequence	P198T
JY-50	SEQ ID NO: 97 Sequence	T130A, E169D, R195I
JY-53	SEQ ID NO: 98 Sequence	V58D, R195I
JY-56	SEQ ID NO: 99 Sequence	V50M, R195V, E219G, R220G
JY-57	SEQ ID NO: 100 Sequence	N117S, E169D, P198H
JY-69	SEQ ID NO: 101 Sequence	R195I
JY-71	SEQ ID NO: 102 Sequence	E169D
JY-73	SEQ ID NO: 103 Sequence	E169D, R195I, L213P
JY-74	SEQ ID NO: 104 Sequence	A139S, E169D, P198T, N201S
JY-76	SEQ ID NO: 105 Sequence	D197G, P198S, V207I
JY-78	SEQ ID NO: 106 Sequence	L124S, S158G, R195I
JY-83	SEQ ID NO: 107	E169D, N218D
JY-DAS	SEQ ID NO: 108 Sequence	E169D, R195A, P198S
JY-DAT	SEQ ID NO: 109	E169D, R195A, P198T
JY-DIS	SEQ ID NO: 110 Sequence	E169D, R195I, P198S
JY-DIT	SEQ ID NO: 111 Sequence	E169D, R195I, P198T
JY-DTS	SEQ ID NO: 112 Sequence	E169D, R195T, P198S
JY-DTT	SEQ ID NO: 113 Sequence	E169D, R195T, P198T
JY-DVS	SEQ ID NO: 114 Sequence	E169D, R195V, P198S
JY-DVT	SEQ ID NO: 115 Sequence	E169D, R195V, P198T
JY-DFS	SEQ ID NO: 116	E169D, R195F, P198S
JY-DFT	SEQ ID NO: 117 Sequence	E169D, R195F, P198T
JY-DLS	SEQ ID NO: 118 Sequence	E169D, R195L, P198S
JY-DLT	SEQ ID NO: 119	E169D, R195L, P198T
JY-DRS	SEQ ID NO: 120 Sequence	E169D, R195R, P198S
JY-DMS	SEQ ID NO: 121 Sequence	E169D, R195M, P198S
JY-DMT	SEQ ID NO: 122 Sequence	E169D, R195M, P198T

PD-L1 Variant Location and Substituted Amino Acids from the Experiment

Having described the specific part of the present invention in detail, it is apparent to those skilled in the art that the specific technology is merely a preferred embodiment, and the scope of the present invention is not limited thereto. Therefore, the substantial scope of the present invention will be defined by the appended claims and equivalents thereof.

(National R & D project supporting this invention)

(Task unique number) 1711072940

(Ministry Name) Ministry of Science and Technology

(Research Management Specialized Institution) Korea Research Foundation

(Name of research project) Biomedical Technology Development (R & D)

(Project name) Discovery of next-generation anti-cancer antibody targeting endocrine GPCR based on sustained Fc in blood

(Contribution rate) 1/1

(Host) Kookmin University Industry-Academic Cooperation Foundation

(Research Period) 2018.03.30 ~ 2019.01.29

Claims (25)

1. Programmed death-ligand 1 (PD-L1) variant with increased PD-1 (Programmed cell death protein-1) binding capacity, wherein the PD-L1 variant comprises a part of the amino acid sequence of wild type PD-L1 , PD-L1 variant comprising the 169 amino acid of the amino acid sequence of wild-type PD-L1 of SEQ ID NO: 123 is substituted with E169D.
2. According to claim 1, wherein the PD-L1 variant of the amino acid sequence of the wild-type PD-L1 of SEQ ID NO: 123, 41, 73, 117, 124, 130, 139, 195, 198, And at least one amino acid selected from the group consisting of the 201, 213, and 218th amino acids is substituted with a sequence different from that of the wild type amino acid.
3. The method of claim 2, wherein the PD-L1 variant of the amino acid sequence of the wild type PD-L1 of SEQ ID NO: 123 is replaced with R195K, R195A, R195I, R195T, R195V, R195F, R195L, R195R or R195M PD-L1 variant, characterized in that.
4. The PD-L1 variant according to claim 2, wherein the PD-L1 variant is substituted with P198S, P198T, or P198H for the 198th amino acid sequence of the wild-type PD-L1 of SEQ ID NO: 123.
5. The variant of claim 2, wherein the PD-L1 variant of the amino acid sequence of the wild-type PD-L1 of SEQ ID NO: 123, 41st amino acid is M41V, 117th amino acid is N117S, 124th amino acid is L124S, and 195th PD-L1 variant, wherein the amino acid is substituted with R195A.
6. The PD-L1 variant according to claim 2, wherein the PD-L1 variant is substituted with R195K in amino acid sequence 195 of the amino acid sequence of wild-type PD-L1 of SEQ ID NO: 123.
7. According to claim 2, wherein the PD-L1 variant of the amino acid sequence of the wild-type PD-L1 of SEQ ID NO: 123 of the PD-L1 variant, characterized in that the 73rd amino acid is replaced by Q73R and the 195th amino acid is R195I .
8. According to claim 2, wherein the PD-L1 variant of the amino acid sequence of the wild-type PD-L1 of SEQ ID NO: 123 of the PD-L1 variant, characterized in that the 130 amino acid is replaced with T130A, and the 195 th amino acid is R195I .
9. According to claim 2, wherein the PD-L1 variant of the amino acid sequence of the wild-type PD-L1 of SEQ ID NO: 123, the 117th amino acid is replaced with N117S, and the 198th amino acid PD-L1 variant, characterized in that replaced with P198H .
10. According to claim 2, wherein the PD-L1 variant of the amino acid sequence of the wild-type PD-L1 of SEQ ID NO: 123, the 195 amino acid is replaced with R195I, and the 213th amino acid PD-L1 variant, characterized in that substituted with L213P .
11. According to claim 2, wherein the PD-L1 variant of the amino acid sequence of the wild-type PD-L1 of SEQ ID NO: 123, 139 amino acid is replaced with A139S, 198 amino acid is replaced with P198T, 201 amino acid is replaced with N201S PD-L1 variant characterized by the above.
12. According to claim 2, wherein the PD-L1 variant PD-L1 variant, characterized in that the 218th amino acid of the amino acid sequence of the wild-type PD-L1 of SEQ ID NO: 123 is substituted with N218D.
13. According to claim 1, wherein the PD-L1 variant is SEQ ID NO: 90, SEQ ID NO: 94, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 100, SEQ ID NO: 102, SEQ ID NO: 102 PD-L1 variant, comprising a sequence selected from the group consisting of SEQ ID NO: 103, SEQ ID NO: 104, SEQ ID NO: 107, SEQ ID NO: 108 to SEQ ID NO: 122.
14. A nucleic acid molecule encoding the PD-L1 variant of claim 1.
15. A vector comprising the nucleic acid molecule of claim 14.
16. A host cell comprising the vector of claim 15.
17. The host cell of claim 16, wherein the host cell is a bacterial cell.
18. A wild type PD-L1 (Programmed death-ligand 1) and a PD-1 (Programmed cell death protein-1) comprising the PD-L1 variant of claim 1, the nucleic acid molecule of claim 14, or the vector of claim 15 as an active ingredient. ) Liver binding inhibitors.
19. A composition comprising a PD-L1 variant of claim 1, a nucleic acid molecule of claim 14 or a vector of claim 15 as an active ingredient.
20. 20. The composition according to claim 19, wherein the composition is a pharmaceutical composition for preventing or treating cancer diseases or infectious diseases.
21. A wild type Programmed death-ligand (PD-L1) and PD-1 comprising administering to a subject a pharmaceutically effective amount of the PD-L1 variant of claim 1, the nucleic acid molecule of claim 14, or the vector of claim 15. Programmed cell death protein-1.
22. A method of increasing an immune response comprising administering a PD-L1 variant of claim 1, a nucleic acid molecule of claim 14, or a vector of claim 15 to a subject.
23. A method of treating cancer or infectious disease, comprising administering a PD-L1 variant of claim 1, a nucleic acid molecule of claim 14, or a vector of claim 15 to a subject.
24. Method for producing a PD-L1 variant comprising the following steps:

    a) culturing a host cell comprising a vector comprising a nucleic acid molecule encoding a PD-L1 variant of claim 1; And

    b) recovering the PD-L1 variant expressed by the host cell.
25. Screening method of PD-L1 variant comprising the following steps:

    a) constructing a library of PD-L1 variants or nucleic acid molecules encoding the PD-L1 variant or a nucleic acid molecule encoding the randomly added point mutations of claim 1; And

    b) selecting PD-1 variants that inhibit binding between wild type PD-L1 (Programmed death-ligand 1) and PD-1 (Programmed cell death protein-1) in the library.

Images