WO2019151771A1 - Pd-1 variant having improved binding to pd-l1 - Google Patents

Abstract

The present invention relates to a PD-1 variant having improved binding to PD-L1. In addition, the present invention relates to a method for producing and a method for screening for the PD-1 variant. A PD-1 variant of the present invention effectively inhibits binding between wild-type PD-1 and PD-L1, and thus can be expected to have penetration power and an effect of cancer death by immunocytes or a treatment effect on infectious diseases, which are far greater than those of conventional therapeutic agents for immune checkpoint inhibition and, simultaneously, can minimize the possibility of immunogenicity occurrence and, further, can promote the convenience of developing biological pharmaceutical drugs through the implementation of aglycosylation.

Description

PD-1 variant with increased PD-L1 binding capacity

The present invention relates to a PD-1 variant and a method for preparing the same, wherein the PD-L1 binding ability is increased to effectively inhibit the binding between wild-type PD-1 and PD-L1.

Drugs for the treatment of cancer are largely divided into low-molecular weight drugs and high-molecular weight drugs, and due to their specificity, high-molecular weight drugs have specific attention as low-molecular weight drugs.

Recently, blockade of PD-1 / PD-L1 binding among the immune gate inhibitory proteins has been shown to be effective in the treatment of cancer, and the side effects of other immune gate inhibitory proteins have been reported in the academic community. (J. Naidoo et al. (2015) Annals of Oncology, Lucia Gelao et al. (2014) Toxins , Gorge K. Philips et al (2015) International Immunology ).

Large pharmaceutical companies such as Bristol-Myers Squibb are working to develop therapeutic drugs by suppressing the PD-1 / PD-L1 immune barrier, and anti-cancer drugs such as YERVOY (ipilimumab) and OPDIVO (nivolumab) have been using antibody formats Under development.

In addition, to remove the binding of tumor-infiltrating lymphocytes (TILs) that bind to tumors and PD-1 / PD-L1, a therapeutic agent with excellent cell penetration is required, but the antibody is disadvantageous to penetrate into a very large molecular protein of 150 kDa exist.

Although PD-1, which is smaller in size than PD-L1, seems to be more suitable for cancer treatment through effective immune gate suppression, conventional PD-1 engineering proceeded with screening through yeast display and the heterogenity of glycan and There is a possibility of immunogenicity due to many mutagenesis.

On the other hand, the drug product of the glycosylated form is easy to mass-produce inexpensively even in bacteria, there is no problem of glycation heterogenity according to cell line, culture process and purification process has a great advantage in biopharmaceutical manufacturing.

Therefore, the discovery of high variants in PD-L1 as a glycosylated form of PD-1 with few mutations is necessary.

The matters described as the background art are only for the purpose of improving the understanding of the background of the present invention and should not be taken as acknowledging that they correspond to the related art already known to those skilled in the art.

The present inventors made an effort to discover PD-1 variants that can effectively inhibit the binding between wild-type PD-1 and PD-L1 due to the high binding ability with PD-L1 and at the same time minimize the possibility of immunogenicity. . As a result, by binding to and optimizing some amino acid sequences of wild type PD-1 with other amino acid sequences, binding to PD-L1 is greatly improved, and immunogenicity is generated through minimization of mutation sites and / or implementation of aglycosylated PD-1. The present invention has been completed by confirming that the possibility can be reduced.

Accordingly, it is an object of the present invention to provide a PD-1 variant with increased PD-L1 binding capacity.

Another object of the present invention is to provide a nucleic acid molecule encoding the PD-1 variant.

Still another object of the present invention is to provide a vector containing the nucleic acid molecule.

Another object of the present invention to provide a host cell comprising the vector.

It is another object of the present invention to provide a composition comprising the PD-1 variant, nucleic acid molecule or vector.

Still another object of the present invention is to provide a method for preparing the PD-1 variant.

Still another object of the present invention is to provide an inhibitor for binding between wild type PD-1 and PD-L1 comprising the PD-1 variant, nucleic acid molecule or vector as an active ingredient.

Still another object of the present invention is to provide a method for inhibiting binding between wild type PD-1 and PD-L1, comprising administering an effective amount of the PD-1 variant, nucleic acid molecule or vector to a subject.

Still another object of the present invention is to provide a method of treating cancer disease or infectious disease, comprising administering a therapeutically effective amount of the PD-1 variant, nucleic acid molecule or vector to a subject.

Another object of the present invention to provide a method for screening the PD-1 variant.

Other objects and advantages of the present invention will become apparent from the following detailed description, claims and drawings.

According to one aspect of the present invention, the present invention provides a PD-1 variant having an increased PD-L1 binding force.

The present inventors made an effort to discover PD-1 variants that can effectively inhibit the binding between wild-type PD-1 and PD-L1 due to the high binding ability with PD-L1 and at the same time minimize the possibility of immunogenicity. . As a result, by binding to and optimizing some amino acid sequences of wild type PD-1 with other amino acid sequences, binding to PD-L1 is greatly improved, and immunogenicity is generated through minimization of mutation sites and / or implementation of aglycosylated PD-1. It was confirmed that the possibility could be reduced.

As used herein, the term “PD-1 variant” or “Programmed cell death protein-1 variant” includes variants in which one or more amino acids are substituted, deleted or added to the amino acid sequence of wild type PD-1. Means a variant.

According to a preferred embodiment of the present invention, the amino acid sequence of the wild type PD-1 comprises the amino acid sequence of SEQ ID NO: 61 sequence.

According to a preferred embodiment of the present invention, the PD-1 (Programmed cell death protein-1) variant having increased PD-L1 binding capacity is part of the amino acid sequence of the wild type PD-1. And the 69th amino acid of the amino acid sequence of wild type PD-1 of SEQ ID NO: 61 is replaced with a sequence different from that of the wild type amino acid.

According to a preferred embodiment of the present invention, the 69th amino acid is substituted with C69S, C69T, C69Y, C69G or C69A.

According to a preferred embodiment of the present invention, the PD-1 variant further comprises that the 36th amino acid of the amino acid sequence of wild type PD-1 of SEQ ID NO: 61 is substituted with S36P.

According to a preferred embodiment of the present invention, the PD-1 variant further comprises that the 114th amino acid of the amino acid sequence of wild type PD-1 of SEQ ID NO: 61 is substituted with L114P.

According to a preferred embodiment of the present invention, the PD-1 variant is the 12th, 34th, 92th, 107th, 131th, 132th and 142th amino acids of the amino acid sequence of the wild type PD-1 of SEQ ID NO: 61 It further comprises that one or more amino acids selected from the group consisting of is substituted with a sequence different from the amino acid of the wild type.

According to a preferred embodiment of the invention, said PD-1 variant comprises at least one amino acid substitution selected from the group consisting of T12S, N34T, N92K or N92S, K107N, H131R, P132L and F142L.

According to a preferred embodiment of the present invention, the PD-1 variant further comprises that the thirteenth amino acid of the amino acid sequence of wild type PD-1 of SEQ ID NO: 61 is substituted with F13I or F13L, 46th amino acid is replaced by M46I .

According to a preferred embodiment of the present invention, the PD-1 variant is 1, 17, 36, 50, 79, 100, 114, And at least one amino acid selected from the group consisting of the 127th and 139th amino acids is substituted with a sequence different from that of the wild type amino acid.

According to a preferred embodiment of the invention, said PD-1 variant comprises at least one amino acid substitution selected from the group consisting of N1S, L17M, S36P, N50S, G79R, G100V, L114P, V127A and A139L.

According to a preferred embodiment of the present invention, the PD-1 variant further comprises that the 25th amino acid of the amino acid sequence of wild type PD-1 of SEQ ID NO: 61 is replaced with N25D, 92 amino acid is replaced with N92S or N92K .

According to a preferred embodiment of the present invention, the PD-1 variant further comprises that the 13th amino acid of the amino acid sequence of wild type PD-1 of SEQ ID NO: 61 is substituted with F13I or F13L.

According to a preferred embodiment of the present invention, the PD-1 variant is selected from the group consisting of the 9th, 88th, 101th, 125th and 137th amino acids of the amino acid sequence of the wild type PD-1 of SEQ ID NO: 61 It further includes that at least one amino acid is substituted with a sequence different from that of the wild type amino acid.

According to a preferred embodiment of the invention, said PD-1 variant comprises at least one amino acid substitution selected from the group consisting of N9D, R88K, A101V, A125S and R137K.

According to a preferred embodiment of the present invention, the PD-1 variant is an aglycosylated PD-1 variant.

Most of the commercially available therapeutic proteins are produced through animal cell culture. When the protein is produced, various carbohydrate variants are modified by the protein, resulting in glycogenous heterogeniety. It causes variations in stability and requires a high cost for purification, analysis, and quality control (QC) during the antibody manufacturing process.

Compared to the glycated proteins, which require expensive animal cell culture systems, aglycosylated proteins are capable of mass production in bacteria and have excellent speed and cost.

According to another aspect of the invention, the invention provides a nucleic acid molecule encoding the PD-1 variant, a vector comprising the same or a host cell comprising the vector.

According to a preferred embodiment of the present invention, the host cell is a bacterial cell.

Nucleic acid molecules of the invention can be isolated or recombinant and include single and double stranded DNA and RNA as well as corresponding complementarity sequences. An "isolated nucleic acid" is a nucleic acid isolated from a naturally occurring source, from a surrounding genetic sequence present in the genome of the individual from which the nucleic acid is isolated. In the case of nucleic acids, such as PCR products, cDNA molecules, or oligonucleotides synthesized enzymatically or chemically from a template, the nucleic acid resulting from this procedure can be understood as an isolated nucleic acid molecule. Isolated nucleic acid molecules refer to nucleic acid molecules in the form of separate fragments or as components of larger nucleic acid constructs. Nucleic acids are “operably linked” when placed in a functional relationship with other nucleic acid sequences. For example, the DNA of a presequence or secretion leader is operably linked to the DNA of a polypeptide when expressed as a preprotein, which is the form before the polypeptide is secreted, and the promoter or enhancer is a polypeptide sequence. Operably linked to a coding sequence when affecting the transcription of the ribosome binding site, or when the ribosome binding site is arranged to facilitate translation. In general, "operably linked" means that the DNA sequences to be linked are located contiguously, and in the case of a secretory leader, they are present within adjacent identical reading frames. However, enhancers do not have to be contiguous. Linking is accomplished by ligation at convenient restriction enzyme sites. If such sites do not exist, the synthetic oligonucleotide adapters or linkers are used in accordance with conventional methods.

As used herein, the term "vector" refers to a carrier capable of inserting a nucleic acid sequence for introduction into a cell capable of replicating the nucleic acid sequence. Nucleic acid sequences can be exogenous or heterologous. Vectors include, but are not limited to, plasmids, cosmids and viruses (eg bacteriophages). One skilled in the art can construct vectors by standard recombinant techniques (Maniatis, et al., Molecular Cloning , A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, NY, 1988; and Ausubel et al., In: Current Protocols in Molecular Biology , John, Wiley & Sons, Inc, NY, 1994, etc.).

The term "expression vector" as used herein refers to a vector comprising a nucleic acid sequence encoding at least a portion of the gene product being transcribed. In some cases, RNA molecules are then translated into proteins, polypeptides, or peptides. Expression vectors can include various regulatory sequences. In addition to regulatory sequences that regulate transcription and translation, vectors and expression vectors can also include nucleic acid sequences that provide additional functionality.

As used herein, the term "host cell" refers to any transgenic organism that includes eukaryotes and prokaryotes and is capable of replicating the vector or expressing a gene encoded by the vector. The host cell may be transfected or transformed by the vector, which means a process in which exogenous nucleic acid molecules are delivered or introduced into the host cell.

According to a preferred embodiment of the present invention, the host cell of the present invention is a bacterial cell, more preferably a Gram negative bacterial cell. The cells are suitable for the practice of the present invention in that they have a periplasmic region between the inner membrane and the outer membrane. Examples of preferred host cells of the present invention include E. coli , Pseudomonas aeruginosa , Vibrio cholera , Salmonella typhimurium , Shigella flexneri , Haemophilus influenza , Bordotella pertussi , Erwinia amylovora , Rhizobium sp. And the like, but are not limited thereto.

According to another aspect of the present invention, the present invention provides a wild type PD-1 (Programmed cell death protein-1) and PD-L1 (Programmed) comprising the PD-1 variant, nucleic acid molecule or vector as an active ingredient. death-ligand 1) provides liver binding inhibitors.

According to another aspect of the present invention, the present invention provides a composition comprising the PD-1 variant, nucleic acid molecule or vector as an active ingredient.

The composition is preferably a pharmaceutical composition, more preferably a pharmaceutical composition for preventing or treating cancer diseases or infectious diseases.

According to another aspect of the present invention, the present invention provides a wild type Programmed cell death protein-1 (PD-1) and PD comprising administering an effective amount of the PD-1 variant, nucleic acid molecule or vector to a subject. -L1 (Programmed death-ligand 1) provides a method of inhibiting binding.

According to another aspect of the present invention, the present invention provides a method for increasing an immune response comprising administering an effective amount of the PD-1 variant, nucleic acid molecule or vector to a subject.

According to another aspect of the present invention, the present invention provides a method for treating cancer disease or infectious disease, comprising administering a therapeutically effective amount of the PD-1 variant, nucleic acid molecule or vector to a subject.

The pharmaceutical composition of the present invention comprises (a) the PD-1 variant, nucleic acid molecule or vector; And (b) a pharmaceutically acceptable carrier.

The type of cancer to be prevented or treated by the present invention is not limited, leukemias and acute lymphocytic leukemia, acute nonlymphocytic leukemias, chronic lymphocytic leukemia, chronic lymphocytic leukemia Lymphomas, brain tumors, neuroblastoma, such as myelogenous leukemia, Hodgkin's Disease, non-Hodgkin's lymphomas, and multiple myeloma Childhood solid tumors such as retinoblastoma, Wilms Tumor, bone tumors and soft-tissue sarcomas, lung cancer, breast cancer cancer, prostate cancer, urinary cancers, uterine cancers, oral cancers, pancreatic cancer, melanoma and other skin cance rs, stomach cancer, ovarian cancer, brain tumors, liver cancer, laryngeal cancer, thyroid cancer, esophageal cancer and testicular cancer It may be administered to treat a number of cancers, including common solid tumors of adults such as).

The type of infectious disease to be prevented or treated by the present invention is not limited, and includes a viral infection, an influenza infection, a bacterial infection and a fungal infection.

Pharmaceutically acceptable carriers included in the pharmaceutical compositions of the present invention are those commonly used in the preparation, such as lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia rubber, calcium phosphate, alginate, gelatin, Calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil, and the like It doesn't happen. In addition to the above components, the pharmaceutical composition of the present invention may further include a lubricant, a humectant, a sweetener, a flavoring agent, an emulsifier, a suspending agent, a preservative, and the like. Suitable pharmaceutically acceptable carriers and formulations are described in detail in Remington's Pharmaceutical Sciences (19th ed., 1995).

The pharmaceutical composition of the present invention may be administered orally or parenterally to a subject, preferably parenteral administration, for example, by intravenous infusion, topical infusion and intraperitoneal infusion.

As used herein, the term “subject” or “subject” refers to an object to prevent or treat the disease through inhibition of binding between the PD-1 and PD-L1, and preferably includes humans and animals.

Suitable dosages of the pharmaceutical compositions of the invention vary depending on factors such as the formulation method, mode of administration, age, weight, sex, morbidity, condition of food, time of administration, route of administration, rate of excretion and response to reaction, Usually a skilled practitioner can easily determine and prescribe a dosage effective for the desired treatment or prophylaxis. According to a preferred embodiment of the present invention, the daily dose of the pharmaceutical composition of the present invention is 0.0001-100 mg / kg.

The pharmaceutical compositions of the present invention may be prepared in unit dosage form by formulating with a pharmaceutically acceptable carrier and / or excipient according to methods which can be easily carried out by those skilled in the art. Or may be prepared by incorporation into a multi-dose container. In this case, the formulation may be in the form of a solution, suspension or emulsion in an oil or an aqueous medium, or may be in the form of extracts, powders, granules, tablets or capsules, and may further include a dispersant or stabilizer.

The pharmaceutical composition of the present invention may be used alone as a therapy, but may also be used in conjunction with other conventional biological, chemo, or radiation therapies, and such combination therapy may be used to treat cancer or infectious disease more effectively. Can be. Chemotherapeutic agents that can be used with the composition when the present invention is used for the prevention and treatment of cancer are cisplatin, carboplatin, procarbazine, mechlorethamine, Cyclophosphamide, ifosfamide, melphalan, chlorambucil, bisulfan, nitrosourea, diactinomycin, daunorucin Daunorubicin, doxorubicin, bleomycin, plecomycin, mitomycin, etoposide, tamoxifen, taxol, transflavol Transplatinum, 5-fluorouracil, vincristin, vinblastin, methotrexate, and the like. Radiation therapy that can be used with the composition of the present invention is X-ray irradiation, γ-ray irradiation, and the like.

According to another aspect of the present invention, the present invention provides a method for preparing a PD-1 variant, comprising the following steps:

a) culturing a host cell comprising a vector comprising a nucleic acid molecule encoding the PD-1 variant; And

b) recovering the PD-1 variant expressed by the host cell.

According to another aspect of the invention, the invention provides a method for screening PD-1 variants comprising the following steps:

a) constructing a library of the PD-1 variant or a nucleic acid molecule encoding the PD-1 variant or a random point mutation added to the PD-1 variant or the nucleic acid molecule encoding the same; And

b) selecting PD-1 variants that inhibit binding between wild type Programmed cell death protein-1 (PD-1) and Programmed death-ligand 1 (PD-L1) in the library.

The screening methods of the present invention can use fluorescence labeled cell separation (FACS) screening, or other automated flow cytometry techniques. Instruments for performing flow cytometry are known to those skilled in the art. Examples of such devices are FACSAria, FACS Star Plus, FACScan and FACSort devices (Becton Dickinson, Foster City, CA), Epics C (Coulter Epics Division, Hialeah, FL), MOFLO (Cytomation, Colorado Springs, Colo.), MOFLO- XDP (Beckman Coulter, Indianapolis, IN). Flow cytometry techniques generally include the separation of cells or other particles in a liquid sample. Typically the purpose of a flow cytometer is to analyze the separated particles for their one or more properties (eg the presence of labeled ligands or other molecules). Particles are passed one by one by the sensor and are classified based on size, refraction, light scattering, opacity, roughness, shape, fluorescence, and the like.

The features and advantages of the present invention are summarized as follows:

(i) The present invention provides PD-1 variants with increased PD-L1 binding capacity.

(ii) The present invention also provides a method for producing and screening the PD-1 variant.

(iii) PD-1 variant of the present invention effectively inhibits the binding between wild-type PD-1 and PD-L1, significantly higher permeability and cancer killing effect of immune cells or therapeutic effect of infectious diseases as compared to conventional immune barrier inhibitors It can be expected and at the same time minimize the possibility of immunogenicity. In addition, it is possible to facilitate the development of biopharmaceuticals by implementing aglycosylation.

1 shows SDS-PAGE images of wild type PD-1 and four sugar chain variants PD-1 produced and purified in animal cells.

Figure 2 shows the results of avidity verification of wild type PD-1 and four variant PD-1 to PD-L1.

3 shows Tetrameric PD-L1 preparation, fluorescence labeling and activity validation results.

Figure 4 shows the results of expression analysis of aglycosylated PD-1 in E. coli using Anti-FLAG-FITC.

5 shows the results of verifying activation of aglycosylated PD-1.

Figure 6 shows the DNA sequencing data of the initial library produced.

Figure 7 shows the library enrichment test results by flow cytometry.

8 shows the results of PD-L1 avidity analysis of E. coli cells displaying aglycosylated PD-1 variants.

9 shows the results of protein expression analysis using anti-FLAG-FITC of E. coli cells displaying aglycosylated PD-1 variants.

10 shows the results of PD-L1 avidity analysis of E. coli cells displaying aglycosylated PD-1 variants.

Figure 11 shows the results of protein expression analysis using anti-FLAG-FITC of E. coli cells displaying aglycosylated PD-1 variants.

12 shows variant search results with novel mutations based on CKJ 41.

FIG. 13 shows DNA sequencing data of a secondary library prepared using CKJ 41T as a template. FIG.

14 shows the library enrichment test results through flow cytometry.

FIG. 15 shows the results of PD-L1 avidity analysis of Escherichia coli cells displaying aglycosylated PD-1 variants discovered through secondary screening.

Figure 16 shows the results of comparing PD-L1 avidity of the PD-1 variant and the common sequence variant.

17 shows SDS-PAGE images of purified control HAC-V and two PD-1 variant proteins.

Figure 18 shows the results of affinity verification of wild type PD-1 and HAC-V, two PD-1 variants to PD-L1.

Hereinafter, the present invention will be described in more detail with reference to the following examples. These examples are only for illustrating the present invention in more detail, it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples in accordance with the gist of the present invention. .

Example

Example 1 Influences Human PD-L1 Binding N- Linked glycosylation site verification

To verify that the presence of glycosylation of human PD-1 actually plays an important role in binding to PD-L1, the effect of each glycosylation on binding was tested by deglycosylating four glycosylations present in PD-1. Since there are four N-glycosylation sites in PD-1, it was decided to create four genomes (N25A, N34A, N50A, N92A), each of which replaced the asparagine at four sites with alanine. Using the gene of PD-1 (Catalog number: HG10377-M) and primers (CKJ # 1, CKJ # 2), the genome of PD-1 outer membrane region (amino acid sequence L25-Q167) was determined by PCR using Vent polymerase. Amplified. The amplified genome was processed using BssH II and Xba I enzymes and ligated to pMaz vector, which is an animal cell expression vector treated with the same enzyme. The ligated plasmid was Jude1 ((F-mcrA Δ (mrr-hsdRMS-mcrBC)

80lacZΔM15 ΔlacX74 recA1 endA1 araD139 Δ (ara, leu) 7697 galU galK λ-rpsL nupG) were transformed into E. coli and the sequence was confirmed by individual colony analysis. Based on the prepared plasmid, primers (CKJ # 3, CKJ # 4, CKJ # 5, CKJ # 6, CKJ # 7,) were used for site-directed mutagenesis using QuikChange PCR. CKJ # 8, CKJ # 9, CKJ # 10) were designed. The genome was amplified using the designed primer and Pfu turbo polymerase (Agilent). The sequence was confirmed by transforming the amplified gene into Jude1. Five wild type PD-1 (pMaz-wild type PD-1-His tag) and PD-1 glycosylation variants expression vector (pMaz-N25A PD-1-His tag, pMaz-N34A PD-1-His tag, pMaz -N50A PD-1-His tag, pMaz-N92A PD-1-His tag) were transfected into animal cells (HEK293F), and cultured for 6 days, the cell culture was centrifuged at 6,000 rpm for 20 minutes, and then the supernatant was removed and 0.22 μm. Filter through filter. The filtered supernatant was induced to bind to 1 ml of Ni-NTA resin (Qiagen) at 4 ° C. for 16 hours. The combined resin was washed with PBS solution containing 10 CV (column volume) of 10 mM imidazole (Sigma) and then washed once more with PBS solution containing 10 CV of 20 mM imidazole. Finally, the eluate was recovered with PBS solution containing 250 mM imidazole (FIG. 1). Through ELISA, the PD-L1 binding capacity of wild type PD-1 and four glycosylated PD-1 variants were verified by ELISA. Each protein was diluted in 0.05M Na ₂ CO _3, pH9.6 (Junsei) in a high binding 96 well plate (Costar), and bound for 16 hours at 4 ° C. at a concentration of 200 ng / well. After protein removal, 5% skim milk containing PBST (0.5% Tween-20 containing PBS) solution was added to w / v 5% and each 96 well plate was blocked at room temperature for 1 hour. After discarding the above solution and washed 4 times with 200 μl of tween20 0.5% containing PBS solution, PD-L1 tetramer was diluted in PBS solution and bound to each 96 well plate for 1 hour at room temperature. After washing four times with 200 μl of PBST 0.5% solution, anti-streptavidin-HRP (Genetex) was diluted in PBS at a ratio of 1: 2,000 and bound to each 96 well plate for 1 hour at room temperature. The solution was discarded and washed four times with 200 μl of PBST 0.5% solution, followed by reaction with 50 μl TMB (Thermo Scientific). After 20 minutes, the reaction was terminated with 4 NH ₂ SO ₄ (FIG. 2). As a result of reaction, N92A mutant showed no significant difference with wild type PD-1, but the other three glycosylation variants showed a very large difference in binding ability. Glycosylation of N25, N34, and N50 significantly affected the binding capacity with PD-L1. Appeared to cause.

Sequence Listing	primer	Sequence (5 '→ 3')
Sequence Listing First Sequence		CKJ # 1	GCGGAATTCG GCGCGC ACTCCGAATTAGACTCCCCAGACAGGCCC
SEQ ID NO 2	CKJ # 2	GAATTCCGC TCTAGA TTATCAATGATGATGGTGGTGATGTTGGAACTGGCCGGCTGG
Sequence Listing Third Sequence		CKJ # 3	CGTGGTGACCGAAGGGGACGCCGCCACCTTCACCTGCAGCT
SEQ ID NO: 4 Sequence		CKJ # 4	AGCTGCAGGTGAAGGTGGCGGCGTCCCCTTCGGTCACCACG
SEQ ID NO: 5 Sequence	CKJ # 5	ACCTTCACCTGCAGCTTCTCCGCCACATCGGAGAGCTTCGTGCTAAAC
SEQ ID NO: 6 Sequence		CKJ # 6	GTTTAGCACGAAGCTCTCCGATGTGGCGGAGAAGCTGCAGGTGAAGGT
SEQ ID NO: 7 Sequence	CKJ # 7	GTACCGCATGAGCCCCAGCGCCCAGACGGACAAGCTGGCCG
SEQ ID NO: 8 Sequence	CKJ # 8	CGGCCAGCTTGTCCGTCTGGGCGCTGGGGCTCATGCGGTAC
SEQ ID NO: 9 Sequence	CKJ # 9	GTCAGGGCCCGGCGCGCCGACAGCGGCACCTACCTCTG
SEQ ID NO: 10	CKJ # 10	CAGAGGTAGGTGCCGCTGTCGGCGCGCCGGGCCCTGAC
SEQ ID NO: Eleventh Sequence		Hw # 1	GCGGAATTCG GCGCGC ACTCCGAATTTACTGTCACGGTTCCCAAGGACC
SEQ ID NO 12	Hw # 2	CTTGTGCCTTGCTATCTTTAGACGGGTCAGAGCCACCGCCACCCCTTTCATTTGGAGGATGTGCCAGAG
SEQ ID NO: Thirteenth Sequence		HW # 3	GACCCGTCTAAAGATAGCAAGGCACAAG
SEQ ID NO: 14 Sequence		HW # 4	GAATTCCGC TCTAGA TCATTAGTGGTGATGATGGTGGTGAG
SEQ ID NO: 15 Sequence		JY # 1	CGCAGCGA GGCCCAGCCGGCC TTAGACTCCCCAGACAGGCCC
SEQ ID NO: 16	JY # 2	CGCAGCGA GGCCCCCGAGGCC CCTTGGAACTGGCCGGCTGG
SEQ ID NO: 17 Sequence		JY # 3	CGCAGCGA GGCCCAGCCGGCC
SEQ ID NO: 18 Sequence		JY # 4	CGCAGCGA GGCCCCCGAGGCC CC

Primers used in the experiment

Example 2: Cloning of tetrameric Human PD-L1 (PD-L1-Streptavidin) for PD-1 Engineering

After purchasing human PD-L1 gene cDNA from Sino Biotech (Catalog number: HG10084-M), the gene of PD-L1 outer membrane portion (amino acid sequence F19-R238) was transferred to primer (HW # 1, HW # 2) and Vent. Amplification by PCR using polymerase. Because of the low dissociation constants of wild type PD-1 and wild type PD-L1 (equilibrium dissociation constant K _D = 8.7 μM), we decided to induce the avidity effect through tetramerization for efficient screening of aglycosylated PD-1 variants. In order to induce tetramerization, streptavidin was expressed in C-terminal part of PD-L1 to induce tetramer. GS linker was inserted between streptavidin and PD-L1 to secure fluidity of each protein. Streptavidin was amplified using primers (HW # 3, HW # 4) and Vent polymerase (New England Biolab), followed by assembly PCR using PD-L1 genome and Vent polymerase. The generated gene was subjected to restriction enzyme treatment using Bss HII and Xba I (New England Biolab). Restriction-treated PD-L1-streptavidin-His tag gene was ligated to the same restriction enzyme-treated pMaz vector. The ligated plasmid was transformed into Jude1 Escherichia coli, and a single clone was obtained to confirm that the PD-L1-streptavidin-His tag was successfully inserted into the pMaz vector by sequencing.

Example 3: Animal Cell Expression, Purification and Fluorescent Labeling of Tetrameric PD-L1-streptavidin

The transmeric PD-L1 expression vector was transfected into animal cells (HEK293F), and after 6 days of incubation, the cell culture was centrifuged at 6,000 rpm for 20 minutes, and the supernatant was collected and filtered through a 0.22 μm filter. The filtered supernatant was induced to bind 1 ml of Ni-NTA resin (Qiagen) for 16 hours at 4 ℃. The bound resin is washed with PBS solution containing 10 CV of 10 mM imidazole (Sigma) of resin and then washed once more with 10 CV of 20 mM imidazole containing PBS solution. Finally, the eluate was recovered with PBS solution containing 250 mM imidazole. The purified PD-L1 tetramer was fluorescently labeled using Alexa-488 labeling kit. Fluorescently labeled tetrameric PD-L1 showed excellent PD-1 binding as a result of ELISA analysis (FIG. 3).

Example 4: Cloning to Display Human PD-1 in Bacterial Cell Intima (Wild Type PD-1, HAC-V PD-1)

PD-1 primer to display an outer film portion of the amino acid sequence of PD-1 with the (JY # 1, JY # 2 ) - After the DNA of (amino acid sequence L25 Q167) amplifying the gene by PCR with Vent Polymerase, Sfi I restriction enzyme treatment. Sfi I-treated DNA was ligated to Sfi I treated pMopac12-NlpA-FLAG vector, like in order to use the signal peptide is a signal peptide NlpA immobilizing cells in the lining under the secretion of proteins into the E. coli periplasmic region pMopac12-NlpA-WTPD- 1-FLAG vector was prepared. HAC-V variant for use as a control was conducted through a gene synthesis, as in order to use the NlpA signal peptides ligated in-pMopac12 NlpA-FLAG vector treated Sfi I pMopac12-NlpA-HAC- V PD-1- FLAG plasmids were prepared. Subsequently, a single clone was obtained by transforming E. coli Jude1 and sequencing confirmed that wild type PD-1 and HAC-V PD-1 were successfully inserted into the pMopac-12 vector.

Example 5: Expression of PD-1 and PD-1 variants (wild type PD-1, HAC-V PD-1) in E. coli and binding to PD-L1 using flow cytometry

Plasmids prepared by cloning (pMopac12-NlpA-PD-1-FLAG, pMopac12-NlpA-HAC-V PD-1-FLAG, pMopac12-NlpA-Fc-FLAG) were transformed into Jude1 cells, respectively. Prepared samples were incubated at 37 ° C. and 250 rpm for 16 hours in TB medium containing 2% glucose and 40 μg / ml chloramphenicol, respectively. The cultured cells were inoculated at a ratio of 1:50 in 6 ml of TB medium containing 40 μg / ml of chloramphenicol. After incubation to OD ₆₀₀ = 0.5, after cooling for 20 minutes at 25 ° C and 250 rpm, 1 mM IPTG was added to overexpress the protein at 25 ° C, 250 rpm and 5 hours. E. coli overexpressed the protein was added to the e-tube by the same amount through OD ₆₀₀ normalize and cells were recovered by centrifugation at 14,000 rpm for 1 minute. In order to remove the residual medium, the cells placed in the e-tube were resuspensioned with 1 ml of 10 mM Tris-HCl (pH 8.0) and washed twice by centrifugation at 13,500 rpm for 1 minute. Cells were resuspensioned with 1 ml of STE [0.5 M sucrose, 10 mM Tris-HCl, 10 mM EDTA (pH 8.0)] solution to remove the extracellular membrane by rotation at 37 ° C. for 30 minutes. E. coli was collected by centrifugation at 13,500 rpm for 1 minute, and then the supernatant was removed. Centrifuged Escherichia coli was resuspensioned with 1 ml of Solution A [0.5 M sucrose, 20 mM MgCl ₂ , 10 mM MOPS pH 6.8] and then centrifuged at 13,500 rpm for 1 minute. 1 ml of Solution A and 20 ml of 50 mg / ml lysozyme solution were added, and 1 ml of the solution was added to resuspension of the centrifuged Escherichia coli, followed by rotation at 37 ° C. for 15 minutes to remove the peptidoglycan layer. After centrifugation, the supernatant was removed, resuspensioned with 1 ml of PBS, 300 μl was taken, and 700 μl of PBS, 12.5 nM tetrameric PD-L1-Alexa488 probe and 33 nM anti-FLAG-FTIC (SIGMA), respectively. The plate was rotated at room temperature and labeled with a fluorescent probe on the spheroplast. After 1 hour of labeling, centrifugation was performed at 13,500 rpm for 1 minute. Discard the supernatant and wash the centrifuged Escherichia coli once with 1 ml of PBS and centrifuge again for 13 minutes at 13,500 rpm. Centrifuged E. coli was resuspensioned with 1 ml of PBS and analyzed using Guava (Merck Millipore) equipment. As a result, it was confirmed that aglycosylated PD-1 was well expressed in Escherichia coli (FIG. 4), but no binding ability with PD-L1 was observed, and aglycosylated HAC-V PD-1 had weak PD-L1 binding ability. (FIG. 5).

Example 6 Fabrication of a Large PD-1 Error Prone Library for Ultrafast Screening Techniques

To search for ladybird screen PD-1 with a high bonding strength between the PD-L1 at a high speed pMopac12-NlpA-PD-1-FLAG used based on both able to get an error for all parts of the PD-1 Sfi I site Designed primers (JY # 3, JY # 4) containing. To prepare a library using the designed primer, Taq Polymerase (TAKARA), dNTPs (Invitrogen), MgCl ₂ , and MnCl ₂ (SIGMA), the genome was amplified using the Error Prone PCR technique. The amplified genome is treated Sfi I enzyme comprising similarly inserted pMopac12-NlpA-FLAG vector, which is the Sfi I enzyme treatment was then ligated to the transformation, Jude1 cells. Transformed E. coli was spread on a square plate and incubated at 37 ° C. for 16 hours to recover E. coli with TB containing 2% glucose to secure an initial library (FIG. 6).

Example 7: PD-1 variant screening using flow cytometer

After adding 40 μg / ml of chloramphenicol to 25 ml of Glucose-containing 2% TB medium, the prepared library was inoculated into a 250 mL flask, incubated for 4 hours at 37 ° C and 250 rpm, and containing 40 μg / ml of chloramphenicol. E. coli cultured in 100 ml of TB medium was inoculated in a 1: 100 ratio. After incubation to OD ₆₀₀ = 0.5, after 20 minutes of cooling at 25 ° C and 250 rpm, 1 mM IPTG was added to overexpress the protein at 25 ° C, 250 rpm and 5 hours, and then centrifuged at 14,000 rpm for 1 minute. The cells were recovered. In order to remove the residual medium, the cells placed in the e-tube were resuspensioned with 1 ml of 10 mM Tris-HCl (pH 8.0) and centrifuged for 1 minute at 13,500 RPM. The cells were resuspensioned with 1 ml of STE [0.5 M sucrose, 10 mM Tris-HCl, 10 mM EDTA (pH 8.0)] solution to remove the extracellular membrane by rotation at 37 ° C. for 30 minutes. E. coli was collected by centrifugation at 13,500 rpm for 1 minute, and then the supernatant was removed. Centrifuged Escherichia coli was resuspensioned with 1 ml of Solution A [0.5 M sucrose, 20 mM MgCl ₂ , 10 mM MOPS pH 6.8] and then centrifuged at 13,500 rpm for 1 minute. 1 ml of Solution A and 20 μl of 50 mg / ml lysozyme solution were added to the solution, followed by resuspension of the centrifuged Escherichia coli, followed by rotation at 37 ° C. for 15 minutes to remove the peptidoglycan layer. After centrifugation, the supernatant was removed, resuspensioned with 1 ml of PBS, 300 μl was taken, and 700 μl of PBS and 12.5 nM tetrameric PD-L1-Alexa488 probe were added together and rotated at room temperature to label fluorescent probes on spheroplasts. After 1 hour of labeling, centrifugation was performed at 13,500 rpm for 1 minute. The supernatant was discarded and centrifuged E. coli was washed once with 1 ml of PBS, followed by further centrifugation at 13,500 rpm for 1 minute. After resuspension of the centrifuged Escherichia coli with 1 ml PBS, E. coli having high binding strength to PD-L1 was recovered using S3 sorter (Bio-Rad). The recovered E. coli were obtained by PCR amplification using primers (JY # 1, JY # 2), and the genomes were sfi I-restricted and ligated to the restriction-treated pMopac12-NlpA-FLAG vector. After transforming the plasmid to Jude1, E. coli was spread on a square plate, incubated at 37 ° C for 16 hours, recovered, and stored in a deep freezer. The above screening procedure was repeated five more times.

Example 8: Increased PD-L1 Affinity Escherichia coli Culture for Confirmation of Enrichment of PD-1 Variants

Add 40 μg / ml of chloramphenicol to 25 ml of TB containing 2% glucose, and then add 250 mL flask of Initial library, 1 round library, 2 round library, 3 round library, 4 round library, 5 round library, 6 round library. Put in. After 4 hours of incubation at 250 ° C. at 37 ° C., E. coli was inoculated 1: 100 in 100 ml of TB containing 40 μg / ml chloramphenicol. After incubation to OD ₆₀₀ = 0.5, after cooling for 20 minutes at 25 ° C and 250 rpm, 1 mM IPTG was added to overexpress the protein at 25 ° C, 250 rpm and 5 hours. In addition, 40 μg / ml of chloramphenicol was added to 4 ml of TB medium containing 2% glucose and inoculated with wild type PD-1 and HAC-V-PD-1 cells, respectively, and used at 37 ° C. and 250 rpm. Time incubation. The cultured cells were inoculated 1:50 in 6 ml of TB medium containing 40 μg / ml of chloramphenicol. After incubation to OD ₆₀₀ = 0.5, after cooling for 20 minutes at 25 ° C and 250 rpm, 1 mM IPTG was added to overexpress the protein at 25 ° C, 250 rpm and 5 hours. Escherichia coli were recovered by centrifugation at 14,000 rpm for 1 minute in an equal amount of e-tubes through OD ₆₀₀ normalize.

Example 9: Enrichment of PD-L1 Affinity Increased PD-1 Variants Using Flow Cytometry

In order to remove the residual medium, the cells placed in the e-tube were resuspensioned with 1 ml of 10 mM Tris-HCl (pH 8.0) and washed twice by centrifugation at 13,500 rpm for 1 minute. The cells were resuspensioned with 1 ml of STE [0.5 M sucrose, 10 mM Tris-HCl, 10 mM EDTA (pH 8.0)] solution to remove the extracellular membrane by rotation at 37 ° C. for 30 minutes. E. coli was collected by centrifugation at 13,500 rpm for 1 minute, and then the supernatant was removed. Centrifuged Escherichia coli was resuspensioned through 1 ml of Solution A [0.5 M sucrose, 20 mM MgCl ₂ , 10 mM MOPS pH 6.8], and then centrifuged at 13,500 rpm for 1 minute. 1 ml of solution A and 20 μl of 50 mg / ml lysozyme solution were added to the solution, followed by resuspension of centrifuged Escherichia coli, followed by rotation at 37 ° C. for 15 minutes to remove the peptidoglycan layer. After centrifugation, the supernatant was removed, resuspensioned with 1 ml of PBS, 300 μl was taken, 700 μl of PBS and 12.5 nM tetrameric PD-L1-Alexa488 probe were added together, and rotated at room temperature to label the fluorescent probe on the spheroplast. After 1 hour of labeling, centrifugation was performed at 13,500 rpm for 1 minute. The supernatant was discarded and centrifuged E. coli was washed once with 1 ml of PBS, followed by further centrifugation at 13,500 rpm for 1 minute. After centrifuged Escherichia coli was resuspensioned with 1 ml of PBS, binding ability with PD-L1 was analyzed by measuring flow rate (Mean fluorescence intensity, MFI) using a flow cytometer (Guava, Millipore). As the screening progressed, it was possible to analyze the amplification in the library of variants having high binding capacity to PD-L1 (FIG. 7).

Example 10: Obtaining PD-1 Variants with Enhanced PD-L1 Adhesion through Flow Cytometry Analysis

The last round single colonies were inoculated in TB medium containing 2% glucose and 40 μg / ml chloramphenicol and incubated at 37 ° C. and 250 rpm for 16 hours. The cultured cells were inoculated by diluting 1:50 in 6 ml of TB medium containing 40 μg / ml of chloramphenicol. After incubation to OD ₆₀₀ = 0.5, after 20 minutes of cooling at 25 ° C and 250 rpm, 1 mM IPTG was added to overexpress the protein at 25 ° C, 250 rpm and 5 hours. Escherichia coli were recovered by centrifugation at 14,000 rpm for 1 minute in an equal amount of e-tubes through OD ₆₀₀ normalize. In order to remove the residual medium, the cells placed in the e-tube were resuspended with 1 ml of 10 mM Tris-HCl (pH 8.0) and centrifuged for 1 minute at 13,500 rpm. The cells were resuspensioned with 1 ml of STE [0.5 M sucrose, 10 mM Tris-HCl, 10 mM EDTA (pH 8.0)] solution to remove the extracellular membrane by rotation at 37 ° C. for 30 minutes. E. coli was collected by centrifugation at 13,500 rpm for 1 minute, and then the supernatant was removed. Centrifuged Escherichia coli was resuspensioned with 1 ml of Solution A [0.5 M sucrose, 20 mM MgCl ₂ , 10 mM MOPS pH 6.8], and then centrifuged at 13,500 rpm for 1 minute. 1 ml of solution A and 20 μl of 50 mg / ml lysozyme solution were added to the solution, followed by resuspension of centrifuged Escherichia coli, followed by rotation at 37 ° C. for 15 minutes to remove the peptidoglycan layer. After centrifugation, the supernatant was removed, resuspensioned with 1 ml of PBS, 300 μl was taken, 700 μl of PBS and 12.5 nM tetrameric PD-L1-Alexa488 probe were added together, and rotated at room temperature to label the fluorescent probe on the spheroplast. After 1 hour of labeling, centrifugation was performed at 13,500 rpm for 1 minute. The supernatant was discarded and centrifuged E. coli was washed once with 1 ml of PBS, followed by further centrifugation at 13,500 rpm for 1 minute. After centrifuged Escherichia coli was resuspensioned with 1 ml of PBS, the binding force with PD-L1 was analyzed by measuring the fluorescence signal using GUAVA equipment (FIG. 8). In addition, since the expression level of PD-1 protein displayed by E. coli may affect the fluorescence intensity, 300 μl of the remaining E. coli was collected after resuspension with PBS to confirm the expression level, and 700 μl of PBS and 1 μl of anti -FLAG-FITC was put together and rotated at room temperature to label the fluorescent probe on the spheroplast. After 1 hour of labeling, centrifugation was performed at 13,500 rpm for 1 minute. The supernatant was discarded and centrifuged E. coli was washed once with 1 ml of PBS, followed by further centrifugation at 13,500 rpm for 1 minute. After resuspension of the centrifuged Escherichia coli with 1 ml of PBS, the expression level of the protein through binding to anti-FLAG-FITC was indirectly analyzed by measuring a fluorescence signal using a flow cytometer (FIG. 9).

Sequence Listing	PD-1 variant	PD-1 variant position and substituted amino acid
SEQ ID NO: 48 Sequence	No.41 (CKJ 41)	S36P / C69S / L114P
SEQ ID NO: 50 Sequence	No.45 (CKJ 45)	S36P / C69S / K107N / L114P / F142L
SEQ ID NO: 51 Sequence	No.46 (CKJ 46)	S36P / C69S / L114P / P132L
SEQ ID NO: 56 Sequence	No.56 (CKJ 56)	S36P / C69S / N92K / L114P / H131R
SEQ ID NO: 58 Sequence	No.67 (CKJ 67)	N34T / S36P / C69S / L114P
SEQ ID NO: 59 Sequence	No.70 (CKJ 70)	S36P / C69S
SEQ ID NO: 60 Sequence	No.78 (CKJ 78)	T12S / S36P / C69S / L114P
SEQ ID NO: 49 Sequence	No.44 (CKJ 44)	F13I / M46I / N50S / C69Y / V127A
SEQ ID NO: 54 Sequence	No.52 (CKJ 52)	F13I / M46I / C69Y
SEQ ID NO: 52 Sequence	No.49 (CKJ 49)	F13L / N25D / C69S / N92S / R137K
SEQ ID NO: 53 Sequence	No.50 (CKJ 50)	F13L / N25D / C69S / R88K / N92S / A125S
SEQ ID NO: 55 Sequence	No.55 (CKJ 55)	N25D / C69S / N92S / A101V
SEQ ID NO: 57 Sequence	No.66 (CKJ 66)	N9D / N25D / C69S / N92S / A101V

PD-1 variants with enhanced PD-L1 binding

Example 11. Cloning for Comparison with Additional Controls of PD-1 Variants (PD-1 S.6.8.3, S.5.1T)

S.6.8.3 and S.5.1T variants for use as additional controls were cloned via Primer assembly PCR. First, Primer (S.6.8.3: JY # 5,6,7,8,9,10,11,12 / S.5.1T: JY # 13,14,15,16,17,18,19,20 ), Primer assembly PCR using Vent Polymerase, and then amplified properly amplified gene through Amplify PCR. After the gene was amplified similarly treated Sfi I Sfi I-treated ligated to pMopac12-NlpA-FLAG vector pMopac12-NlpA-PD-1 S.6.8.3 -FLAG and pMopac12-NlpA-PD-1 S.5.1T -FLAG vector was prepared. Subsequently, the strain was transformed into E. coli Jude1 to obtain a single clone, and confirmed by successful sequencing.

Sequence Listing	primer	Sequence (5 '→ 3')
SEQ ID NO: 62 Sequence	JY # 5	TTAGACTCCCCAGACAGGCCCTGGAACCCCCCCACCTTCTCCCCAGCCCTGCTCGTGGTGA
SEQ ID NO: 63 Sequence		JY # 6	ACGAAGCTCTCCGATGTGTTGGAGAAGCTGCAGGTGAAGGTGGCGTTGTCCCCTTCGGTCACCACGAGCAGGGCT
SEQ ID NO: 64 Sequence	JY # 7	AACACATCGGAGAGCTTCGTGCTAAACTGGTACCGCATGAGCCCCAGCAACCAGACGGACAAGCTGGCCGCCTTC
SEQ ID NO: 65 Sequence	JY # 8	TGGGCAGTTGTGTGACACGGAAGCGGCTGGCCTGGCCCAGCTGGCCGCGGTCCTCGGGGAAGGCGGCCAGCTTGT
SEQ ID NO: 66 Sequence	JY # 9	CGTGTCACACAACTGCCCAACGGGCGTGACTTCCACATGAGCGTGGTCAGGGCCCGGCGCAGCGACAGCGGCACC
SEQ ID NO: 67 Sequence		JY # 10	ACCCGCAGGCTCTCCCGGATCTGGATCCGGGGGGCCAGCAGGATGGCGCTACAGAGGTAGGTGCCGCTGTCGCTG
SEQ ID NO: 68 Sequence	JY # 11	GGGAGAGCCTGCGGGTGGAGCTCAGGGTGACAGAGAGAAGGGCAGAAGTGCCCACAGCCCACCCCAGCCCCTCAC
SEQ ID NO: 69 Sequence	JY # 12	TTGGAACTGGCCGGCTGGCCTGGGTGAGGGGCTGGGGTG
SEQ ID NO: 70 Sequence	JY # 13	TTAGACTCCCCAGACAGGCCCTGGAACCCCCCCACCTTCTCCCCAGCCCTGCTCGTGGTGACCGAAGGGG
SEQ ID NO: 71 Sequence	JY # 14	CAGTTTAGCACGAAGCTCTCCGATGTGTTGGAGAAGCTGCAGGTGAAGGTGGCGCTGTCCCCTTCGGTCACCACG
SEQ ID NO: 72 Sequence		JY # 15	GGAGAGCTTCGTGCTAAACTGGTACCGCATGAGCCCCAGCAACCAGGCCGACAAGCTGGCCGCCTTCCCCGAGGA
SEQ ID NO: 73 Sequence	JY # 16	CACGCCCGTTGGGCAGTTGTGTGACACGGAAGCGGGAGTCCTGGCCGGGCTGGCTGCGGTCCTCGGGGAAGGCGG
SEQ ID NO: 74 Sequence	JY # 17	CTGCCCAACGGGCGTGACTTCCACATGAGCGTGGTCGGGGCCCGGCGCTCCGACAGCGGCACCTACCTCTGTTCC
SEQ ID NO: 75 Sequence	JY # 18	CTGAGCTCTGCCCGCAGGCTCTCCCGGATCTGCACCTTGGGGGCCAGGGAGATGGCGGAACAGAGGTAGGTGCCG
SEQ ID NO: 76 Sequence	JY # 19	CTGCGGGCAGAGCTCAGGGTGGCAGAGAGAAGGGCAGAAGTGCCCACAGCCCACCCCAGCCCCTCACCCAGGCCA
SEQ ID NO: 77 Sequence		JY # 20	TTGGAACTGGCCGGCTGGCCTGGGTGAGGGG
SEQ ID NO: 78 Sequence	JY # 21	CCCCAGCCCCTCACCCAGGCCAGCCGGCCAGTTCC
SEQ ID NO: 79 Sequence	JY # 22	GGAACTGGCCGGCTGGCCTGGGTGAGGGGCTGGGG

Primers used for further experiments

Example 12 Comparison of PD-L1 Avidity between PD-1 Variants and Controls

To compare PD-L1 avidity between PD-1 variants with high binding capacity and additional controls, wild type PD-1 and control groups PD-1 HAC-V, S.6.8.3, S.5.1T and CKJ 49 and A total of six CKJ 50 strains were inoculated into TB medium containing 2% glucose and 40 μg / ml chloramphenicol, and then incubated at 37 ° C and 250 rpm for 16 hours. The cultured cells were inoculated by diluting 1: 100 in 6 ml of TB medium containing 40 μg / ml of chloramphenicol. After incubation to OD ₆₀₀ = 0.5, after cooling for 20 minutes at 25 ° C and 250 rpm, 1 mM IPTG was added to overexpress the protein at 25 ° C, 250 rpm and 5 hours. Escherichia coli were recovered by centrifugation at 14,000 rpm for 1 minute in an equal amount of e-tubes through OD ₆₀₀ normalize. Experiments were carried out in the same manner as in the spheroplasting method described in Example 5, 12.5 nM tetrameric PD-L1-Alexa488 probe was put together in the spheroplast produced by this to rotate at room temperature to label the fluorescent probe. After 1 hour of labeling, centrifugation was performed at 13,500 rpm for 1 minute. The supernatant was discarded and centrifuged E. coli was washed once with 1 ml of PBS, followed by further centrifugation at 13,500 rpm for 1 minute. After centrifuged Escherichia coli was resuspensioned with 1 ml of PBS, the binding force with PD-L1 was analyzed by measuring the fluorescence signal value using GUAVA equipment (FIG. 10). In addition, since the expression level of PD-1 protein displayed by E. coli may affect the fluorescence intensity, 300 μl of the remaining E. coli was collected after resuspension with PBS to confirm the expression level, 700 μl of PBS and 1 μl of anti -FLAG-FITC was put together and rotated at room temperature to label the fluorescent probe on the spheroplast. After 1 hour of labeling, centrifugation was performed at 13,500 rpm for 1 minute. The supernatant was discarded and centrifuged E. coli was washed once with 1 ml of PBS, followed by further centrifugation at 13,500 rpm for 1 minute. After resuspension of the centrifuged Escherichia coli with 1 ml of PBS, the expression level of the protein through binding to anti-FLAG-FITC was indirectly analyzed by fluorescence signal value measurement using a flow cytometer (FIG. 11).

Example 13. Cloning for Exploration of Variants with Novel Mutations

Based on CKJ 41, which has the newest mutation and the high binding capacity, the C69S of CKJ 41 was selected from several amino acids (C, T, Y, A, G). Substituted. The genome was amplified by Quikchange PCR using primers designed for this purpose and Pfu turbo polymerase (Agilent). The sequence was confirmed by transforming the amplified gene into Jude1.

Example 14 Screening for Variants with Novel Mutations by Flow Cytometry Analysis

CKJ 41 and the control HAC-V variant, CKJ 41C, CKJ 41T, CKJ 41Y, CKJ 41A, and CKJ 41G, which changed the 69th amino acid of CKJ 41, were added to TB medium containing 2% glucose and 40 μg / ml chloramphenicol, respectively. After inoculation, the cells were incubated at 37 ° C. and 250 rpm for 16 hours. The cultured cells were inoculated by diluting 1: 100 in 6 ml of TB medium containing 40 μg / ml of chloramphenicol. After incubation to OD ₆₀₀ = 0.5, after cooling for 20 minutes at 25 ° C and 250 rpm, 1 mM IPTG was added to overexpress the protein at 25 ° C, 250 rpm and 5 hours. Escherichia coli were recovered by centrifugation at 14,000 rpm for 1 minute in an equal amount of e-tubes through OD ₆₀₀ normalize. Experiments were carried out in the same manner as in the spheroplasting method described in Example 5, 12.5 nM tetrameric PD-L1-Alexa488 probe was put together in the spheroplast produced by this to rotate at room temperature to label the fluorescent probe. After 1 hour of labeling, centrifugation was performed at 13,500 rpm for 1 minute. The supernatant was discarded and centrifuged E. coli was washed once with 1 ml of PBS, followed by further centrifugation at 13,500 rpm for 1 minute. After centrifuged Escherichia coli was resuspensioned with 1 ml of PBS, the binding force with PD-L1 was analyzed by measuring the fluorescence signal value using GUAVA equipment (FIG. 12).

Example 15. Preparation of secondary PD-1 error prone library to secure PD-1 variants with increased binding force

To rapidly detect PD-1, which has a higher binding capacity with PD-L1, it is based on pMopac12-NlpA-PD-1 CKJ 41T-FLAG, which has a small number of mutations and high fluorescence value, so that all sites may contain errors. We have prepared an insert so that we can Amplification of the genome using Error Prone PCR using primers (JY # 3, JY # 4) and Taq Polymerase (TAKARA) and dNTPs (Invitrogen), MgCl ₂ and MnCl ₂ (SIGMA) containing both SFI I sites I wanted to make a library. The amplified genome is Sfi I Enzyme Treated Like Sfi I Enzyme-treated pMopac12-NlpA-FLAG vector was inserted into the ligation and transformed into Jude1 cells. Transformed E. coli was spread on a square plate and incubated at 37 ° C. for 16 hours to recover E. coli with TB containing 2% glucose to secure an initial library (FIG. 13).

Example 16. Secondary Screening of PD-1 Variants Using Flow Cytographers

After adding 40 μg / ml of chloramphenicol to 25 ml of Glucose-containing 2% TB medium, the prepared library was inoculated into a 250 mL flask, incubated for 4 hours at 37 ° C and 250 rpm, and containing 40 μg / ml of chloramphenicol. E. coli cultured in 100 ml of TB medium was inoculated in a 1: 100 ratio. After incubation to OD ₆₀₀ = 0.5, after 20 minutes of cooling at 25 ° C and 250 rpm, 1 mM IPTG was added to overexpress the protein at 25 ° C, 250 rpm and 5 hours, and then centrifuged at 14000 rpm for 1 minute. The cells were recovered. Experiments were carried out in the same manner as in the spheroplasting method described in Example 5, 12.5 nM tetrameric PD-L1-Alexa488 probe was put together in the spheroplast produced by this to rotate at room temperature to label the fluorescent probe. After 1 hour of labeling, centrifugation was performed at 13,500 rpm for 1 minute. The supernatant was discarded and centrifuged E. coli was washed once with 1 ml of PBS, followed by further centrifugation at 13,500 rpm for 1 minute. After resuspension of the centrifuged Escherichia coli with 1 ml PBS, E. coli having a higher binding force to PD-L1 was recovered using S3 sorter (Bio-Rad). The recovered Escherichia coli were obtained by PCR amplification using primers (JY # 3, JY # 4), and the genomes were sfi I restriction enzyme-treated and ligated to restriction enzyme-treated pMopac12-NlpA-FLAG vector. After transforming the plasmid to Jude1, E. coli was spread on a square plate, incubated at 37 ° C for 16 hours, recovered, and stored in a deep freezer. The screening process was repeated three additional times, gradually decreasing the concentration of the probe.

Example 17 Escherichia Coli Culture for Confirmation of Enrichment of PD-L1 Affinity Secondary PD-1 Variants

After adding 40 μg / ml of chloramphenicol to 25 ml of TB containing 2% glucose, initial library, 1 round library, 2 round library, 3 round library, and 4 round library were added to a 250 mL flask. After 4 hours of incubation at 250 ° C. at 37 ° C., E. coli was inoculated 1: 100 in 100 ml of TB containing 40 μg / ml chloramphenicol. After incubation to OD ₆₀₀ = 0.5, after cooling for 20 minutes at 25 ° C and 250 rpm, 1 mM IPTG was added to overexpress the protein at 25 ° C, 250 rpm and 5 hours. In addition, 40 μg / ml of chloramphenicol was added to 4 ml of TB medium containing 2% glucose and inoculated with wild type PD-1 and HAC-V-PD-1 cells, respectively, and used at 37 ° C. and 250 rpm. Time incubation. The cultured cells were inoculated 1: 100 in 6 ml of TB medium containing 40 μg / ml chloramphenicol. After incubation to OD ₆₀₀ = 0.5, after cooling for 20 minutes at 25 ° C and 250 rpm, 1 mM IPTG was added to overexpress the protein at 25 ° C, 250 rpm and 5 hours. Escherichia coli were recovered by centrifugation at 14,000 rpm for 1 minute in an equal amount of e-tubes through OD ₆₀₀ normalize.

Example 18. Enrichment of PD-L1 Affinity Increase PD-1 Variants Using Flow Cytometry

The experiment was performed in the same manner as in the spheroplasting method described in Example 5, and 4 nM tetrameric PD-L1-Alexa488 probe was put together in the spheroplast thus formed, and the fluorescent probe was labeled by rotating at room temperature. After 1 hour of labeling, centrifugation was performed at 13,500 rpm for 1 minute. The supernatant was discarded and centrifuged E. coli was washed once with 1 ml of PBS, followed by further centrifugation at 13,500 rpm for 1 minute. After centrifuged Escherichia coli was resuspensioned with 1 ml of PBS, binding ability with PD-L1 was analyzed by flow cytometry (Guava, Millipore) through measurement of fluorescence signal (Mean fluorescence intensity, MFI). As screening progressed, it was possible to analyze the amplification of the variants in the library with high binding capacity to PD-L1 (Fig. 14).

Example 19 Additional PD-1 Variants with Better PD-L1 Adhesion Through Flow Cytometry Analysis

Last round single colonies (APD1-CKJ 41T: aglycosylated form of CKJ 41T, APD1-JY 101: aglycosylated form of JY 101) and wild type PD-1 and HAC-V, respectively, 2% glucose and 40 μg / ml After inoculation into TB medium containing chloramphenicol was incubated for 16 hours at 37 ℃, 250 rpm. The cultured cells were inoculated by diluting 1: 100 in 6 ml of TB medium containing 40 μg / ml of chloramphenicol. After incubation to OD ₆₀₀ = 0.5, after cooling for 20 minutes at 25 ° C and 250 rpm, 1 mM IPTG was added to overexpress the protein at 25 ° C, 250 rpm and 5 hours. Escherichia coli were recovered by centrifugation at 14,000 rpm for 1 minute in an equal amount of e-tubes through OD ₆₀₀ normalize. The experiment was performed in the same manner as in the spheroplasting method described in Example 5, and 4 nM tetrameric PD-L1-Alexa488 probe was put together in the spheroplast thus formed, and the fluorescent probe was labeled by rotating at room temperature. After 1 hour of labeling, centrifugation was performed at 13,500 rpm for 1 minute. The supernatant was discarded and centrifuged E. coli was washed once with 1 ml of PBS, followed by further centrifugation at 13,500 rpm for 1 minute. After centrifuged Escherichia coli was resuspensioned with 1 ml of PBS, the binding force with PD-L1 was analyzed by measuring the fluorescence signal value using GUAVA equipment (FIG. 15).

Example 20 Variant Cloning for Comparative Verification of Mutated Sites of Proven PD-1 Variants

The mutant PD-1_LDSS with overlapping mutations of CKJ 49 and CKJ 50 was cloned to determine if binding activity was affected when new CKJ 49 and 50 mutant amino acids were introduced into LDSS. To generate PD-1_LDSS, the CKJ 49 vector was used as a template and the Quikchange PCR technique was used. Genomes were amplified using designed primers (JY # 21, JY # 22) and Pfu turbo polymerase (Agilent). The sequence was confirmed by transforming the amplified gene into Jude1.

Example 21. Comparison of PD-L1 Avidity of PD-1 Variants and Common Sequence Variants by Flow Cytometry Analysis

Wild type PD-1, the control HAC-V variant, CKJ 49, CKJ 50, and LDSS were inoculated in TB medium containing 2% glucose and 40 μg / ml of chloramphenicol, and then incubated at 37 ° C. and 250 rpm for 16 hours. . The cultured cells were inoculated by diluting 1: 100 in 6 ml of TB medium containing 40 μg / ml of chloramphenicol. After incubation to OD ₆₀₀ = 0.5, after cooling for 20 minutes at 25 ° C and 250 rpm, 1 mM IPTG was added to overexpress the protein at 25 ° C, 250 rpm and 5 hours. Escherichia coli were recovered by centrifugation at 14,000 rpm for 1 minute in an equal amount of e-tubes through OD ₆₀₀ normalize. Experiments were carried out in the same manner as in the spheroplasting method described in Example 5, 12.5 nM tetrameric PD-L1-Alexa488 probe was put together in the spheroplast produced by this to rotate at room temperature to label the fluorescent probe. After 1 hour of labeling, centrifugation was performed at 13,500 rpm for 1 minute. The supernatant was discarded and centrifuged E. coli was washed once with 1 ml of PBS, followed by further centrifugation at 13,500 rpm for 1 minute. After centrifuged Escherichia coli was resuspensioned with 1 ml of PBS, the binding force with PD-L1 was analyzed by using a GUAVA instrument by measuring fluorescence signal values (FIG. 16). In addition, since the expression level of PD-1 protein displayed by E. coli may affect the fluorescence intensity, 300 μl of the remaining E. coli was collected after resuspension with PBS to confirm the expression level, 700 μl of PBS and 1 μl of anti -FLAG-FITC was put together and rotated at room temperature to label the fluorescent probe on the spheroplast. After 1 hour of labeling, centrifugation was performed at 13,500 rpm for 1 minute. The supernatant was discarded and centrifuged E. coli was washed once with 1 ml of PBS, followed by further centrifugation at 13,500 rpm for 1 minute. After centrifuged Escherichia coli was resuspensioned with 1 ml of PBS, the expression level of protein through binding to anti-FLAG-FITC was indirectly analyzed by fluorescence signal measurement using a flow cytometer (FIG. 16).

Sequence Listing	PD-1 variant	PD-1 variant position and substituted amino acid
SEQ ID NO: 90 Sequence		CKJ 41T	S36P / C69T / L114P
SEQ ID NO: 91 Sequence		CKJ 41Y	S36P / C69Y / L114P
SEQ ID NO: 92 Sequence		CKJ 41G	S36P / C69G / L114P
SEQ ID NO: 93 Sequence		CKJ 41A	S36P / C69A / L114P
SEQ ID NO: 94 Sequence	JY101	N1S, F13I, L17M, S36P, M46I, C69T, G79R, G100V, L114P, A139L
SEQ ID NO: 95 Sequence	LDSS	F13L, N25D, C69S, N92S

Additional PD-1 Variants with Enhanced PD-L1 Adhesion

Example 22. Animal Cell Expression, Purification and Binding Verification of PD-1 Variants

PD-1 variants were expressed and purified into animal cells and cloned first to verify binding. The control group HAC-V, the discovered variants CKJ 49 and CKJ50 genes were amplified by PCR using primers (CKJ # 1, CKJ # 2) and Vent polymerase. The amplified genome was processed using BssH II and Xba I enzymes and ligated to pMaz vector, which is an animal cell expression vector treated with the same enzyme. The ligated plasmid was transformed into Jude1 Escherichia coli and confirmed the sequence through individual colony analysis. PD-1 glycation variant expression vector (pMaz-PD1 HAC-V-His tag, pMaz-PD1 CKJ 49-His tag, pMaz-PD1 CKJ 50-His tag) was transfected into animal cells (HEK293F) for 6 days After the cell culture was centrifuged for 20 minutes at 6,000 rpm, the supernatant was taken and filtered through a 0.22 μm filter. The filtered supernatant was induced to bind to 1 ml of Ni-NTA resin (Qiagen) for 16 hours at 4 ° C. The combined resin was washed with PBS solution containing 10 CV (column volume) of 10 mM imidazole (Sigma) and then washed once more with PBS solution containing 10 CV of 20 mM imidazole. Finally, the eluate was recovered with PBS solution containing 250 mM imidazole (FIG. 17). ELISA confirmed the change in PD-L1 binding capacity between wild type PD-1 and the control group, two variants (GPD1-CKJ 49: glycosylated form of CKJ 49, GPD1-CKJ 50: glycated form of CKJ 50). Each protein was diluted in 0.05M Na ₂ CO _3, pH9.6 (Junsei) in a high binding 96 well plate (Costar), and bound for 16 hours at 4 ° C. at a concentration of 200 ng / well. After protein removal, the solution was placed in a 5% skim milk-containing PBST solution (PBS containing 0.5% Tween-20) at 5% w / v and each 96 well plate was blocked at room temperature for 1 hour. After discarding the above solution and washed 4 times with 200 μl of tween20 0.5% containing PBS solution, PD-L1 tetramer was diluted in PBS solution and bound to each 96 well plate for 1 hour at room temperature. After washing four times with 200 μl PBST 0.5% solution, anti-streptavidin-HRP (Genetex) was diluted in PBS at a ratio of 1: 2,000, and bound to each 96 well plate for 1 hour at room temperature. The solution was discarded and washed four times with 200 μl of PBST 0.5% solution, followed by reaction with 50 μl TMB (Thermo Scientific). After 20 minutes, the reaction was terminated with 4 NH ₂ SO ₄ . As a result of the reaction, the glycosylation resulted in a change in binding force to PD-L1, but it was confirmed that CKJ 49 had the most excellent binding force (FIG. 18).

Having described the specific part of the present invention in detail, it is apparent to those skilled in the art that the specific technology is merely a preferred embodiment, and the scope of the present invention is not limited thereto. Thus, the substantial scope of the present invention will be defined by the appended claims and equivalents thereof.

[National R & D project supporting this invention]

[Project unique number] 1711053534

[Department name] Ministry of Science and ICT

    [Research Management Specialized Institution] Korea Research Foundation

    [Name of research project] New research support project

    [Project name] Development of protein therapeutic agent and dual antibody using antigen-binding aglycosylated Fc variant

    [Contribution rate] 1/2

    [Host] Kookmin University Industry-Academic Cooperation Foundation

    [Research Period] 2017.06.01 ~ 2018.03.31

[National R & D project supporting this invention]

    [Project unique number] 1711058394

    [Department name] Ministry of Science and ICT

    [Research Management Specialized Institution] Korea Research Foundation

    [Project name] New Drug Development Pipeline Management Project

    [Project name] Discovery of next-generation anticancer antibody targeting endocrine GPCR based on sustained Fc in blood

    [Contribution rate] 1/2

    [Host] Kookmin University Industry-Academic Cooperation Foundation

    [Research Period] 2017.06.30 ~ 2018.03.29

Claims (25)

1. Programmed cell death protein-1 (PD-1) variant with increased PD-L1 binding capacity, wherein the PD-1 variant comprises a part of the amino acid sequence of wild type PD-1 , PD-1 variant comprising the substitution of C69S, C69T, C69Y, C69G or C69A amino acid of amino acid sequence of wild type PD-1 of SEQ ID NO: 61 sequence.
2. The PD-1 variant according to claim 1, wherein the PD-1 variant further comprises that the 36th amino acid of the amino acid sequence of wild type PD-1 of SEQ ID NO: 61 is replaced with S36P.
3. The PD-1 variant according to claim 2, wherein the PD-1 variant further comprises that the 114th amino acid in the amino acid sequence of wild type PD-1 of SEQ ID NO: 61 is substituted with L114P.
4. 4. The group of claim 3, wherein the PD-1 variant consists of the 12th, 34th, 92th, 107th, 131th, 132th, and 142th amino acids of the amino acid sequence of the wild type PD-1 of SEQ ID NO: 61. PD-1 variant, characterized in that it further comprises that at least one amino acid selected from is substituted with a sequence different from the amino acid of the wild type.
5. 5. The PD-1 variant according to claim 4, wherein said PD-1 variant comprises at least one amino acid substitution selected from the group consisting of T12S, N34T, N92K or N92S, K107N, H131R, P132L and F142L.
6. According to claim 1, wherein the PD-1 variant of the amino acid sequence of the wild-type PD-1 of SEQ ID NO: 61, the 13th amino acid in the F13I or F13L, characterized in that the 46th amino acid is further replaced with M46I, characterized in that PD-1 variant.
7. The method of claim 6, wherein the PD-1 variant is 1, 17, 36, 50, 79, 100, 114, 127 and the amino acid sequence of the wild type PD-1 of SEQ ID NO: 61 PD-1 variant, characterized in that it further comprises that one or more amino acids selected from the group consisting of the 139th amino acid is substituted with a sequence different from the amino acid of the wild type.
8. 8. The PD-1 variant according to claim 7, wherein said PD-1 variant comprises at least one amino acid substitution selected from the group consisting of N1S, L17M, S36P, N50S, G79R, G100V, L114P, V127A and A139L. .
9. According to claim 1, wherein the PD-1 variant of the amino acid sequence of the wild type PD-1 of SEQ ID NO: 61 SEQ ID NO: 25 amino acid and N92S or N92S or 92 N92K is characterized in that it further comprises a substitution PD-1 variant.
10. The PD-1 variant according to claim 9, wherein the PD-1 variant further comprises that the 13th amino acid of the amino acid sequence of wild type PD-1 of SEQ ID NO: 61 is substituted with F13I or F13L.
11. The amino acid sequence of claim 9 or 10, wherein the PD-1 variant is selected from the group consisting of the 9th, 88th, 101th, 125th, and 137th amino acids of the amino acid sequence of the wild type PD-1 of SEQ ID NO: 61. PD-1 variant, characterized in that it further comprises that one or more amino acids are substituted with a sequence different from the amino acid of the wild type.
12. 12. The PD-1 variant according to claim 11, wherein said PD-1 variant comprises at least one amino acid substitution selected from the group consisting of N9D, R88K, A101V, A125S and R137K.
13. The PD-1 variant according to claim 1, wherein the PD-1 variant is an aglycosylated PD-1 variant.
14. A nucleic acid molecule encoding the PD-1 variant of claim 1.
15. A vector comprising the nucleic acid molecule of claim 14.
16. A host cell comprising the vector of claim 15.
17. The host cell of claim 16, wherein the host cell is a bacterial cell.
18. 15. A wild type PD-1 (Programmed cell death protein-1) and a PD-L1 (Programmed death-ligand 1) comprising the PD-1 variant of claim 1, the nucleic acid molecule of claim 14 or the vector of claim 15 as an active ingredient. ) Liver binding inhibitors.
19. A composition comprising the PD-1 variant of claim 1, the nucleic acid molecule of claim 14, or the vector of claim 15 as an active ingredient.
20. 20. The composition according to claim 19, wherein the composition is a pharmaceutical composition for preventing or treating cancer diseases or infectious diseases.
21. 15. Programmed cell death protein-1 (PD-1) and PD-L1 (Programmed), comprising administering an effective amount of the PD-1 variant of claim 1, the nucleic acid molecule of claim 14, or the vector of claim 15 to a subject death-ligand 1) Method of inhibiting liver binding.
22. A method of increasing an immune response comprising administering to a subject an effective amount of a PD-1 variant of claim 1, a nucleic acid molecule of claim 14, or a vector of claim 15.
23. A method of treating cancer or infectious disease, comprising administering to a subject a therapeutically effective amount of the PD-1 variant of claim 1, the nucleic acid molecule of claim 14, or the vector of claim 15.
24. Method for producing a PD-1 variant comprising the following steps:

    a) culturing a host cell comprising a vector comprising a nucleic acid molecule encoding the PD-1 variant of claim 1; And

    b) recovering the PD-1 variant expressed by the host cell.
25. Screening method of PD-1 variant comprising the following steps:

    a) constructing a library of PD-1 variants or nucleic acid molecules encoding the PD-1 variant of claim 1, wherein the random addition point mutation is added to the PD-1 variant or the nucleic acid molecule encoding the same; And

    b) selecting PD-1 variants that inhibit binding between wild type Programmed cell death protein-1 (PD-1) and Programmed death-ligand 1 (PD-L1) in the library.

Images