WO2019237381A1 - Modification vector for human alps5 gene editing and preparation method and application thereof - Google Patents

Abstract

Provided are a modification vector for human ALPS5 gene editing and a preparation method and application thereof. By editing human ALPS5 gene at a cellular level using a CRISPR/Cpf1 system, ALPS5 gene editing-positive cells are obtained.

Description

Modified vector for human ALPS5 gene editing, preparation method and application thereof Technical field

 The invention relates to the technical field of genetic engineering, in particular to a modified vector for editing human ALPS5 gene, a preparation method and application thereof.

Background technique

The human anti-cancer immune mechanism includes two aspects of cellular immunity and humoral immunity. However, it is mainly based on cellular immunity. The effector cells that play a major role in the cellular immune mechanism are T cells, of which CD8 + T cells are the most important effect in tumor immunity. Perform the cell. T-cell activation requires dual signal recognition. The tumor antigen first binds to MHC molecules on antigen-presenting cells or target cells, and then binds to T-lymphocyte surface antigen recognition receptors to provide the first signal for T-cell activation; CD28 on the T-cell surface Binding to B7 molecules on the surface of antigen presenting cells or on the surface of target cells provides a second signal. After the dual signal recognition, the T cells are fully activated, and the activated T cells first proliferate, generating a large number of antigen-specific T cells, which migrate to the tumor site to play a killing role. After 2 to 3 days of activated T cells, negative regulatory molecules such as ALPS5 began to be upregulated.

technical problem

 ALPS5 is a transmembrane protein and belongs to the CD28 family. The ligand of ALPS5 is a member of the B7 family. It competes with CD28 molecules and binds to B7-1 and B7-2. It inhibits the proliferation of activated T cells and negatively regulates immunity. Under physiological conditions, it can prevent the immune from being enlarged. It maintains a dynamic balance between health and disease, but is often used by tumor cells to achieve the purpose of immune escape. Therefore, the research on the role of ALPS5 in tumorigenesis and development can promote the development of tumor therapy. However, the lack of targeted knockout of ALPS5 gene expression in the prior art has caused certain obstacles to the progress of related research.

Technical solutions

A first object of the present invention is to provide a modified vector for human ALPS5 gene editing.

A second object of the present invention is to provide a method for preparing a modified vector for human ALPS5 gene editing.

The present invention provides a targeted sgRNA for human ALPS5 gene editing, and its sequence is 5'- AATTTCTACTCTTGTAGATCTGATCCCAGATATGTATTACAC -3 ’.

The invention also provides a method for preparing the modified vector for editing human ALPS5 gene, which includes the following steps:

(1) performing an annealing complementary pairing of the sense strand and the antisense strand of the sgRNA targeting the ALPS5 gene;

(2) Digest the core vector with BamHI and EcoRI endonuclease, and recover the linearized core vector by agarose gel electrophoresis;

(3) ligating the sgRNA obtained in step (1) to a linearized core vector with T4 DNA ligase;

(4) The ligation product is transformed into competent E. coli Stbl3. After a large amount of culture, the recombinant vector is extracted and commissioned for sequencing. The correct sequencing result is the modified vector for human ALPS5 gene editing.

Further, in step (2) and step (3), the core vector is pLVX-ascpf1-puro.

Beneficial effect

The modified vector for human ALPS5 gene editing provided by the present invention has strong specificity, can edit human ALPS5 gene through the CRISPR / Cpf1 system very efficiently, and can be used in research and development of drugs related to abnormal expression of ALPS5 gene.

BRIEF DESCRIPTION OF THE DRAWINGS

 Figure 1 is a vector map of pLVX-AsCpf1-puro;

Figure 2 T7 Endonuclease I test results of Jurkat cells in the control group and the experimental group, wherein: 1-experimental group, 2-control group.

Embodiments of the invention

The methods used in the following examples are conventional methods unless otherwise specified. Primers and DNA used The sequences were synthesized by Shanghai Shengong Company.

Examples 1 : Target people ALPS5 genetic pLVX-AsCpf1-puro-ALPS5 Preparation of the carrier

a. According to Bernd Zetsche et al. (Cpf1 Is a Single RNA-Guided Endonuclease of a Class 2 CRISPR-Cas System) provides crRNA design rules and gRNA sequences that target the ALPS5 gene, design crRNAs that target the ALPS5 gene, and according to the actual situation of the pLVX-AsCpf1-puro vector in its 5 ' The sticky ends of BamHI and EcoRI digestion sites were added at the 3 'and 3' ends, respectively. The forward sequence was 5'-GATCCTAATTTCTACTCTTGTAGATCTGTCATCTGGCACGTAAGGCCG -3 ', the reverse sequence is 5'-GCGGCCTTACGTGCCAGATGACAGATCTACAAGAGTAGAAATTC-3', and these two sequences were synthesized. After dissolution, 5 μL of each was mixed, heated at 95 ° C for 5 minutes, and then naturally cooled to room temperature to form a double-stranded DNA with sticky ends of BamHI and EcoRI.

b. Digest pLVX-AsCpf1-puro vector with BamHI and EcoRI, and recover linearized pLVX-AsCpf1-puro vector by PCR Cleanup kit.

c. T4 DNA ligase was used to ligate a and b products. The ligated product was then transformed into E. coli Stbl3 and identified by sequencing. The recombinant vector contained in the correct strain was the pLVX-AsCpf1-puro-ALPS5 vector.

Examples 2 : Endotoxin-free plasmid DNA Preparation

The correct strain was sequenced and identified in Example 1 and placed in an LB liquid medium having an ampicillin concentration of 100 μg / ml, and cultured with shaking at 250 rpm and 37 ° C. for 12-16 h. Collect the bacterial solution by centrifugation at 10,000 rpm at 4 ° C, discard the supernatant, collect the bacterial cells, and then extract the plasmid according to the instructions of the Endo-Free Plasmid Mini Kit kit to obtain the endotoxin-free pLVX-AsCpf1-puro-ALPS5 plasmid.

Examples 3 : Packaging for Lentivirus

293T cells were cultured and transfected after two passages of growth and culture: pLVX-AsCpf1-puro-ALPS5 vector was taken and transfected with the packaging plasmid and transfection reagent provided by the integrase-deficient Lenti-X HTX lentiviral packaging system Stained in 293T cells. 48 hours before transfection, inoculate cells into a well plate or petri dish for lentivirus production. During transfection, the confluence of cells is about 70% -80% is the best infection state, and the viability is ≥95%. The staining time was the starting point. The supernatants were harvested after 48 h and 72 h, filtered through a 0.45 μm filter and stored at -80 ° C.

Examples 4 : Jurkat Lentiviral infection of cells and puromycin selection

When culturing Jurkat cells to a confluence of about 70% -80%, add a mixture of lentivirus and culture medium (containing 4 μg / mL After 24 hours of polybrene treatment, the lentivirus solution was changed to a complete medium containing 1 μg / mL puromycin, and the screening culture was started. The screening time was 7 days. Change the fluid every other day. Cells infected with lentivirus will form single-cell clones, and the cell selection is complete.

Examples 5 : T7 Endonuclease I Test to detect transduction effect

Untreated Jurkat cells (control group) and lentivirus-treated Jurkat cells (experimental group) were seeded into six-well plates. After the cells were full, genomic DNA was extracted, and then the high-fidelity PCR enzyme PrimeSTAR HS was used to expand The gene editing site is expected to be amplified, and the PCR product is recovered by electrophoresis.

After the PCR product was re-annealed, it was digested with T7 Endonuclease I at 37 ° C for 1 h, and then subjected to agarose gel electrophoresis. The results are shown in Figure 2. Compared with the control group, the experimental group showed two distinct cutting strips. This indicates that the lentivirus packaged by the pLVX-AsCpf1-puro-ALPS5 vector can edit the human ALPS5 gene, indicating that the pLVX-AsCpf1-puro vector can be used in the gene editing research of cells.

Industrial applicability

The modified vector for human ALPS5 gene editing provided by the present invention has strong specificity, can edit human ALPS5 gene through the CRISPR / Cpf1 system very efficiently, and can be used in research and development of drugs related to abnormal expression of ALPS5 gene.

Claims (5)

1. A modified vector for editing the human ALPS5 gene, which is characterized by comprising a core vector and an sgRNA targeting the human ALPS5 gene.
2. The modified vector for editing human ALPS5 gene according to claim 1, characterized in that the sequence of the sgRNA targeting the ALPS5 gene is 5'-AATTTCTACTCTTGTAGATCTGATCCCAGATATGTATTACAC -3 ’.
3. The method for preparing a modified vector for editing human ALPS5 gene according to claim 2, characterized in that it comprises the following steps:

   (1) performing an annealing complementary pairing of the sense strand and the antisense strand of the sgRNA targeting the ALPS5 gene;

   (2) Digest the core vector with BamHI and EcoRI endonuclease, and recover the linearized core vector by agarose gel electrophoresis;

   (3) ligating the sgRNA obtained in step (1) to a linearized core vector with T4 DNA ligase;

   (4) The ligation product is transformed into competent E. coli Stbl3. After a large amount of culture, the recombinant vector is extracted and commissioned for sequencing. The correct sequencing result is the modified vector for human ALPS5 gene editing.
4. The method for preparing a modified vector for editing human ALPS5 gene according to claim 3, wherein in step (2) and step (3), the core vector is pLVX-ascpf1-puro.
5. The modified vector for editing human ALPS5 gene according to claim 1, wherein the vector is used for human ALPS5 gene knockout.