WO2019237380A1 - Lentivirus-based crispr/cpf1 gene editing vector and application thereof - Google Patents

Abstract

A lentivirus-based CRISPR/Cpf1 gene editing vector and application thereof. On the basis of a conventional lentivirus vector pLVX-shRNA1, an expression cassette constituted by a PGK promoter-puromycin resistance gene is completely replaced by an expression cassette constituted by a CAG promoter-Cpf1 gene-2A peptide-puromycin resistance gene, so as to obtain a recombinant lentivirus vector which can be used for Cpf1 gene editing. Recombinant lentivirus obtained by a lentivirus packaging process can infect a target cell in vitro and edit a target gene.

Description

Lentivirus-based CRISPR / Cpf1 gene editing vector and application thereof Technical field

 The invention relates to the fields of gene editing and molecular biology, and specifically discloses a lentivirus-based CRISPR / Cpf1 gene editing vector and application thereof.

Background technique

In recent years, the field of gene editing technology has developed rapidly, and new types of gene editing tools have been continuously developed, especially the emergence of the CRISPR gene editing system, which has brought gene editing technology into a new era. At present, genetic engineering fixed-point gene editing tools can be designed. There are three main types of site-directed endonucleases, namely: ZFN (zinc finger nuclease), TALEN (transcription activator-like effector nuclease) and CRISPR (regularly clustered short interval palindrome repeat) systems. Among them, CRISPR The system is widely used in gene editing research due to its advantages of convenient design and construction, high knock-out efficiency, and wide application range.

Since Jinek et al. Demonstrated in 2012 that the CRISPR / Cas9 system can bind to specific sites of DNA target sequences and cut in vitro, CRISPR / Cas9 technology has brought a huge impact to the biological field. In 2013, it was published by Science Magazine. Named one of the top ten scientific breakthroughs, and topped the list in 2015. Using CRISPR / Cas9 technology, scientists can efficiently and accurately trim, replace or add DNA sequences, and can quickly achieve microbial genome editing, animal and plant species optimization, animal model construction, and even promote a disruptive revolution in disease treatment. .

technical problem

However, with the continuous research, the CRISPR / Cas9 system has also exposed its defects and limitations, such as severe off-target effects, and can only identify GC-rich PAM sites.

In 2015, the FengZhang group at MIT in the United States reported a new type 2 V-type CRISPR effector protein, Cpf1, which is an endonuclease that binds to and cleaves specific sites of target DNA under the guidance of single-stranded guide RNA. Compared with Cas9, Cpf1 has lower non-specific and off-target effects; Cpf1 only needs a segment of single-stranded RNA consisting of 42-44 nucleotides to recognize and cut DNA, which simplifies the experimental design steps and is more conducive to Multi-gene editing; Cpf1 can recognize AT-rich PAM sites, which can expand the editing range of CRISPR; In addition, Cpf1 cleavage will produce sticky ends, which can promote the insertion of target genes into target loci through non-homologous recombination. The development of CRISPR / Cpf1 is helpful to break through and overcome some limitations in CRISPR / Cas9 applications, so it is called a new generation of CRISPR genome editing tools. However, the lack of lentivirus-based CRISPR / Cpf1 gene editing vectors in the prior art has hampered the application of the CRISPR / Cpf1 system in difficult-to-transfect cells and slowed down the related research process.

Technical solutions

The invention provides a lentivirus-based CRISPR / Cpf1 gene editing vector and its application to solve the above problems.

A lentivirus-based CRISPR / Cpf1 gene editing vector, the full sequence of which is as SEQ ID No.1.

The above vector is based on the pLVX-shRNA1 plasmid, and the entire expression frame composed of the PGK promoter-puromycin resistance gene is replaced with the expression frame composed of the CAG promoter-Cpf1 gene-nuclear localization sequence-2A peptide-puromycin resistance gene. Its sequence is shown in SEQ ID No.2.

In the above vector, the Cpf1 gene is AsCpf1 and its sequence is shown in SEQ ID No. 3; the 2A peptide is T2A and its sequence is shown in SEQ ID No. 4.

The construction method of the above vectors is as follows:

1. Design the expression box composed of the CAG promoter-AsCpf1 gene-T2A-puromycin resistance gene, and add EcoRI and MluI restriction sites at its 5 'and 3' ends, respectively. The sequence is as shown in SEQ ID No. 2 As shown. Commissioned to synthesize the sequence.

2. The synthetic sequence and pLVX-shRNA1 vector were treated with EcoRI and MluI, respectively, and the digested product was recovered by electrophoresis to obtain the expression frame and linearized pLVX-shRNA1 vector.

3. Mix the linearized pLVX-shRNA1 vector with the expression cassette sequence in a ratio of 1: 5 (wherein the linearized pLVX-shRNA1 vector is 50 μg), and then ligate with T4 DNA ligase overnight.

4. The ligation product is transformed into E. coli. A large number of transformed E. coli were cultured and the recombinant plasmids were extracted. The correct sequence was identified as the lentivirus-based CRISPR / Cpf1 gene editing vector pLVX-AsCpf1-puro, and its map is shown in FIG. 1.

Beneficial effect

The lentivirus-based CRISPR / Cpf1 gene editing vector provided by the present invention can conveniently and efficiently perform gene editing on various cell lines (especially difficult-to-transfect cell lines) and accelerate related research processes.

BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1 is a vector map of pLVX-AsCpf1-puro;

Figure 2 T7 Endonuclease I test results of 293T cells in the control and experimental groups, where: M-Marker, 1-experimental group, 2-control group.

Embodiments of the invention

 The following is a preferred embodiment of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principles of the present invention, several improvements and retouches can be made. It is the protection scope of the present invention.

The methods used in the following examples are conventional methods unless otherwise specified. The primers and DNA sequences used were synthesized by Shanghai Shengong Company.

The pLVX-shRNA1 lentiviral vector used in the examples of the present invention was purchased from Clontech, and the Stbl3 competent E. coli used was purchased from Beijing Quanshijin, and the reagents used were all commercially available products.

Examples 1 : pLVX-AsCpf1-puro Construction of vectors

a. Design the CAG promoter-AsCpf1 gene-T2A-puromycin resistance gene expression frame, and add EcoRI and MluI restriction sites at its 5 ’and 3’ ends, respectively, whose sequence is as SEQ ID No.2. Commissioned to synthesize the sequence.

b. The synthetic sequence is integrated into the pUC57 vector. This vector and pLVX-shRNA1 vector were digested with EcoRI and MluI endonucleases respectively, and the desired fragments were recovered after agarose gel electrophoresis to obtain a purified expression frame sequence and a linearized pLVX-shRNA1 vector.

c. Mix the linearized pLVX-shRNA1 vector with the purified expression cassette sequence in a ratio of 1: 5 (the linearized pLVX-shRNA1 vector is 50 μg), and then use T4 DNA ligase was ligated overnight.

d. The ligation product is transformed into E. coli Stbl3. A large number of transformed E. coli were cultured and the recombinant plasmids were extracted. The correct sequence was identified as the lentivirus-based CRISPR / Cpf1 gene editing vector pLVX-AsCpf1-puro.

Examples 2 : Targeting people DNMT1 genetic pLVX-AsCpf1-puro-DNMT1 Preparation of the carrier

a. According to Bernd Zetsche et al. (Cpf1 Is a Single RNA-Guided Endonuclease of a Class 2 CRISPR-Cas System) provides crRNA design rules and gRNA sequences that target the DNMT1 gene, design crRNAs that target the DNMT1 gene, and according to the actual situation of the pLVX-AsCpf1-puro vector in its 5 ' The sticky ends of BamHI and EcoRI digestion sites were added at the 3 'and 3' ends, respectively. The forward sequence was 5'-GATCCTAATTTCTACTCTTGTAGATCTGATGGTCCATGTCTGTTACTCG-3 ', and the reverse sequence was 5'- GGAGTAACAGACATGGACCATCAGATCTACAAGAGTAGAAATTAAATTC-3'. . After dissolution, 5 μL of each was mixed, heated at 95 ° C. for 5 min, and then naturally cooled to room temperature to form a double-stranded DNA with sticky ends of BamHI and EcoRI.

b. Digest pLVX-AsCpf1-puro vector with BamHI and EcoRI, and recover linearized pLVX-AsCpf1-puro vector by PCR Cleanup kit.

c. T4 DNA ligase was used to ligate a and b products. The ligated product was then transformed into E. coli Stbl3 and identified by sequencing. The recombinant vector contained in the correct strain was the pLVX-AsCpf1-puro-DNMT1 vector.

Examples 3 : Endotoxin-free plasmid DNA Preparation

Take the sequence of Example 2 to identify the correct strain, and place it in LB liquid medium with an Ampicillin concentration of 100 μg / ml, and culture it at 250 rpm and 37 ° C with shaking for 12-16 h. Collect the bacterial solution by centrifugation at 10,000 rpm at 4 ° C, discard the supernatant, collect the bacterial cells, and then extract the plasmid according to the instructions of the Endo-Free Plasmid Mini Kit kit to obtain the endotoxin-free pLVX-AsCpf1-puro-DNMT1 vector.

Examples 4 : Packaging for Lentivirus

293T cells were cultured and transfected after two passages of growth and culture: pLVX-AsCpf1-puro-DNMT1 vector was taken and transfected with the packaging plasmid and transfection reagent provided by the integrase-deficient Lenti-X HTX lentiviral packaging system Stained in 293T cells. 48 hours before transfection, inoculate cells into a well plate or petri dish for lentivirus production. During transfection, the confluence of cells is about 70% -80% is the best infection state, and the viability is ≥95%. The staining time was the starting point. The supernatants were harvested after 48 h and 72 h, filtered through a 0.45 μm filter and stored at -80 ° C.

Examples 5 : 293T Lentiviral infection of cells and puromycin selection

When 293T cells are cultured to a confluency of about 70% -80%, add a mixture of lentivirus and culture medium (containing 4 μg / mL After 24 hours of polybrene treatment, the lentivirus solution was changed to a complete medium containing 1 μg / mL puromycin, and the screening culture was started. The screening time was 7 days. Change the fluid every other day. Cells infected with lentivirus will form single-cell clones, and the cell selection is complete.

Examples 6 : T7 Endonuclease I Test to detect transduction effect

Untreated 293T cells (control group) and lentivirus-treated 293T cells (experimental group) were seeded into six-well plates. After the cells were full, genomic DNA was extracted, and then the high-fidelity PCR enzyme PrimeSTAR HS was used to expand The gene editing site is expected to be amplified, and the PCR product is recovered by electrophoresis.

After the PCR product was re-annealed, it was digested with T7 Endonuclease I at 37 ° C for 1 h, and then subjected to agarose gel electrophoresis. The results are shown in Figure 2. Compared with the control group, the experimental group showed two distinct cutting strips. This indicates that the lentivirus packaged in the pLVX-AsCpf1-puro-DNMT1 vector can edit the human DNMT1 gene, indicating that the pLVX-AsCpf1-puro vector can be used in the gene editing research of cells.

Industrial applicability

The lentivirus-based CRISPR / Cpf1 gene editing vector provided by the present invention can conveniently and efficiently perform gene editing on various cell lines (especially difficult-to-transfect cell lines) and accelerate related research processes.

Claims (3)

1. A lentivirus-based CRISPR / Cpf1 gene editing vector is characterized in that the full sequence of the vector is shown in SEQ ID No.1.
2. The lentivirus-based CRISPR / Cpf1 gene editing vector according to claim 1, characterized in that, based on the pLVX-shRNA1 plasmid, the entire expression frame composed of the PGK promoter-puromycin resistance gene is replaced with CAG The sequence of the promoter-Cpf1 gene-2A peptide-puromycin resistance gene is shown in SEQ ID No. 2.
3. The lentivirus-based CRISPR / Cpf1 gene editing vector according to claim 2, wherein the Cpf1 gene is AsCpf1, and its sequence is as SEQ ID 2 is shown; the 2A peptide is T2A, and its sequence is shown in SEQ ID No. 4.