WO2019209912A2 - Therapeutic genome editing in x-linked hyper igm syndrome - Google Patents

Therapeutic genome editing in x-linked hyper igm syndrome Download PDF

Info

Publication number
WO2019209912A2
WO2019209912A2 PCT/US2019/028858 US2019028858W WO2019209912A2 WO 2019209912 A2 WO2019209912 A2 WO 2019209912A2 US 2019028858 W US2019028858 W US 2019028858W WO 2019209912 A2 WO2019209912 A2 WO 2019209912A2
Authority
WO
WIPO (PCT)
Prior art keywords
cell
cells
nucleic acid
nuclease
vector
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2019/028858
Other languages
English (en)
French (fr)
Other versions
WO2019209912A3 (en
Inventor
David J. Rawlings
Daniel THOMSON
Iram F. KHAN
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Seattle Childrens Hospital
Original Assignee
Seattle Childrens Hospital
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Seattle Childrens Hospital filed Critical Seattle Childrens Hospital
Priority to JP2020560340A priority Critical patent/JP2021521850A/ja
Priority to CN201980042296.4A priority patent/CN112312931A/zh
Priority to EP19793005.0A priority patent/EP3784292A4/en
Priority to KR1020207034098A priority patent/KR20210005178A/ko
Priority to US17/050,601 priority patent/US20210324381A1/en
Priority to AU2019261385A priority patent/AU2019261385A1/en
Priority to CA3098489A priority patent/CA3098489A1/en
Publication of WO2019209912A2 publication Critical patent/WO2019209912A2/en
Publication of WO2019209912A3 publication Critical patent/WO2019209912A3/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/43Enzymes; Proenzymes; Derivatives thereof
    • A61K38/46Hydrolases (3)
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/43Enzymes; Proenzymes; Derivatives thereof
    • A61K38/46Hydrolases (3)
    • A61K38/465Hydrolases (3) acting on ester bonds (3.1), e.g. lipases, ribonucleases
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70575NGF/TNF-superfamily, e.g. CD70, CD95L, CD153, CD154
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86Viral vectors
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/87Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/87Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/90Stable introduction of foreign DNA into chromosome
    • C12N15/902Stable introduction of foreign DNA into chromosome using homologous recombination
    • C12N15/907Stable introduction of foreign DNA into chromosome using homologous recombination in mammalian cells
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/16Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22Ribonucleases [RNase]; Deoxyribonucleases [DNase]
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2227/00Animals characterised by species
    • A01K2227/10Mammal
    • A01K2227/105Murine
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2267/00Animals characterised by purpose
    • A01K2267/03Animal model, e.g. for test or diseases
    • A01K2267/035Animal model for multifactorial diseases
    • A01K2267/0387Animal model for diseases of the immune system
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/20Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPR]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011Details
    • C12N2750/14011Parvoviridae
    • C12N2750/14111Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14141Use of virus, viral particle or viral elements as a vector
    • C12N2750/14143Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00Nucleic acids vectors
    • C12N2800/80Vectors containing sites for inducing double-stranded breaks, e.g. meganuclease restriction sites

Definitions

  • aspects of the disclosure provided herein are generally related to endonuclease-based gene editing systems and methods. More particularly, alternatives herein relate to nucleic acids and vectors that are configured to provide efficient homology directed repair of genes and methods of repairing genetic deficiencies, such as X-linked hyper IgM syndrome.
  • X-linked hyper IgM syndrome is a recessive primary immunodeficiency caused by an inactivating mutation in the CD40LG gene.
  • Patients lack class-switched memory B cells and immunoglobulins G, A, and E (IgG, IgA, and IgE), making them susceptible to recurrent and opportunistic infections (Allen, R.C., et al., Science, 1993. 259(5097): p. 990-993; Aruffo, A., et al., Cell, 1993. 72(2): p. 291-300; Korthauer, U, et al., Nature, 1993. 361(6412): p.
  • X-HIGM is currently treated with immunoglobulin replacement therapy or allogeneic bone marrow transplant.
  • Endonuclease-based systems have rapidly become significant gene editing tools in biomedical research, with their application for gene disruption and/or gene targeting demonstrated in a variety of cultured cell and model organism systems.
  • Endonuclease-based systems for gene editing allow scientists to edit genomes with unprecedented precision, efficiency, and flexibility.
  • Examples of endonuclease-based approaches for gene editing include systems comprising, without limitations, zinc finger nucleases (ZFNs), TAL effector nucleases (TALENs), meganucleases (such as MegaTALs), and CRISPR/Cas9.
  • ZFNs zinc finger nucleases
  • TALENs TAL effector nucleases
  • meganucleases such as MegaTALs
  • CRISPR/Cas9 CRISPR/Cas9.
  • Some embodiments provided herein relate systems, methods, and compositions for therapeutic genome editing of X-linked hyper IgM syndrome. Some embodiments include a method for editing an CD40LG gene in a cell, comprising: (i) introducing a polynucleotide encoding a guide RNA (gRNA) into the cell, and (ii) introducing a template polynucleotide into the cell.
  • the gRNA comprises a nucleic acid having at least 95% identity to the nucleotide sequence of SEQ ID NO: 12.
  • the gRNA comprises a nucleic acid having the nucleotide sequence of SEQ ID NO: 12.
  • introducing a polynucleotide encoding a gRNA into the cell comprises contacting the cell with a ribonucleoprotein (RNP) comprising a CAS9 protein and the polynucleotide encoding the gRNA.
  • RNP ribonucleoprotein
  • the CAS9 protein and the polynucleotide encoding the gRNA have a ratio between 0.1 : 1 and 1 : 10.
  • the CAS9 protein and the polynucleotide encoding the gRNA have a ratio between 1 : 1 and 1 : 5.
  • the CAS9 protein and the polynucleotide encoding the gRNA have a ratio of about 1 : 1.2.
  • the template polynucleotide encodes at least a portion of the CD40LG gene, or complement thereof. In some embodiments, the template polynucleotide encodes at least a portion of a wild-type CD40LG gene, or complement thereof. In some embodiments, the template polynucleotide comprises at least about 1 kb of the CD40LG gene. In some embodiments, the template polynucleotide comprises a nucleic acid having at least 95% identity to the nucleotide sequence of SEQ ID NO: 15. In some embodiments, the template polynucleotide comprises the nucleotide sequence of SEQ ID NO: 15.
  • a viral vector comprises the template polynucleotide.
  • the vector is an adeno-associated viral (AAV) vector.
  • the vector is a self-complementary AAV (scAAV) vector.
  • step (i) is performed before step (ii). In some embodiments, steps (i) and (ii) are performed simultaneously. In some embodiments, steps (i) and/or (ii) comprise performing nucleofection. In some embodiments, performing nucleofection comprises use of a LONZA system. In some embodiments, the system comprises use of a square wave pulse.
  • Some embodiments also include contacting the cell with IL-6.
  • the IL-6 has a concentration from about or at 20 ng/ml to 500 mg/ml. In some embodiments, the IL-6 has a concentration from about or at 50 ng/ml to 150 mg/ml. In some embodiments, the IL-6 has a concentration of about or at 100 mg/ml.
  • the cell is incubated in a SLEMII medium.
  • a population of cells comprises the cell, the population having a concentration from about or at 1 X 10 5 cells/ml to 1 X 10 6 cells/ml. In some embodiments, the population has a concentration from about or at 1 X 10 5 cells/ml to 5 X 10 5 cells/ml. In some embodiments, the population has a concentration from about or at 2.5 X 10 5 cells/ml.
  • Some embodiments also include diluting the population of cells after steps (i) and (ii) are performed. In some embodiments, the population of cells is diluted about or at 16 hours after steps (i) and (ii) are performed. In some embodiments, the population of cells is diluted to about or at 250,000 cells/ml.
  • Some embodiments also include contacting the cell with stem cell factor (SCL), LMS-like tyrosine kinase-3 (Llt-3), thrombopoietin (TPO), a TPO receptor agonist, UM171, or stemregenin (SR1).
  • SCL stem cell factor
  • Llt-3 LMS-like tyrosine kinase-3
  • TPO thrombopoietin
  • SR1 stemregenin
  • the TPO receptor agonist comprises Eltrombopag.
  • steps (i) and/or (ii) comprise contacting the cell with an HDM2 protein.
  • the HDM2 protein has a concentration from about or at 1 nM to 50 nM. In some embodiments, the HDM2 protein has a concentration from about or at 6.25 nM to 25 nM.
  • the cell is contacted with at least about or at 1000 MOI of the AAV. In some embodiments, the cell is contacted with at least about or at 2500 MOI of the AAV.
  • the cell is contacted with at least about or at 100 pg/ml of the RNP. In some embodiments, the cell is contacted with at least about or at 200 pg/ml of the RNP.
  • steps (i) and/or (ii) comprise contacting about or at 1,000,000 cells /20 pl nucleofection reaction, wherein the nucleofection reaction comprises the gRNA and/or the template polynucleotide.
  • the nucleofection reaction is performed in a volume of about or at 1 ml.
  • the cell is mammalian. In some embodiments, the cell is human. In some embodiments, the cell is a primary cell. In some embodiments, the cell is a hematopoietic stem cell (HSC). In some embodiments, the cell is a T cell or a B cell. In some embodiments, the cell is a CD34+ cell. In some embodiments, the cell is ex vivo.
  • HSC hematopoietic stem cell
  • the cell is a T cell or a B cell.
  • the cell is a CD34+ cell. In some embodiments, the cell is ex vivo.
  • the CD40LG gene has at least 95% identity with the nucleotide sequence of SEQ ID NO: 13.
  • Some embodiments include a nucleic acid for homology directed repair (HDR) of CD40LG gene.
  • the nucleic acid comprises a first sequence encoding a CD40LGgene, a second sequence encoding one or more guide RNA cleavage sites, and a third sequence encoding one or more nuclease binding sites.
  • the CD40LG gene comprises the nucleic acid sequence set forth in SEQ ID NO: 13.
  • the second sequence comprises the nucleic acid sequence set forth in SEQ ID NO: 12.
  • the one or more nuclease binding sites comprises a forward and reverse transcription activator-like effector nuclease (TALEN) binding site.
  • TALEN forward and reverse transcription activator-like effector nuclease
  • the one or more nucleic binding sites is a clustered regularly interspaced short palindromic repeats (CRISPR) associated protein 9 (Cas9) binding site.
  • the nucleic acid further comprises one or more enhancer elements.
  • the nucleic acid further comprises homology arm sequences.
  • the nucleic acid further comprises a nucleic acid sequence encoding a promoter.
  • the vector comprises a first sequence encoding a CD40LG gene, a second sequence encoding one or more guide RNA cleavage sites, and a third sequence encoding one or more nuclease binding sites.
  • the CD40LG gene comprises the nucleic acid sequence set forth in SEQ ID NO: 13.
  • the second sequence comprises the nucleic acid sequence set forth in SEQ ID NO: 12.
  • the one or more nuclease binding sites comprises a forward and reverse transcription activator-like effector nuclease (TALEN) binding site.
  • the one or more nucleic binding sites is a clustered regularly interspaced short palindromic repeats (CRISPR) associated protein 9 (Cas9) binding site.
  • the vector further comprises one or more enhancer elements.
  • the vector is an adeno-associated viral vector (AAV).
  • the vector is a self-complementary AAV (scAAV).
  • the cell is a human cell.
  • the cell is a primary cell.
  • the cell is an autologous cell.
  • the cell is a T cell.
  • the cell is a hematopoietic stem cell (HSC).
  • the cell is a CD34 + HSC.
  • Some embodiments provided herein relate to a system for promoting HDR of CD40L protein expression in a cell.
  • the system comprising a vector as described herein and a nucleic acid encoding a nuclease.
  • the nuclease is a TALEN nuclease.
  • the nuclease is a Cas nuclease.
  • the vector and nucleic acid are configured for co-delivery to the cell.
  • co-delivery to the cell modifies endogenous CD40LG locus.
  • the cell is a primary human hematopoietic cell.
  • the cell comprising a nucleic acid, which comprises a first sequence encoding a CD40LG gene, a second sequence encoding a promoter, a third sequence encoding one or more guide RNA cleavage sites, and a fourth sequence encoding one or more nuclease binding sites.
  • the nucleic acid is in a vector.
  • the vector is an AAV.
  • the AAV is a scAAV.
  • the cell is a human cell.
  • the cell is a primary cell.
  • the cell is an autologous cell.
  • the cell is a T cell.
  • the cell is a HSC.
  • the cell is a CD34 + HSC.
  • Some embodiments provided herein relate to a method of promoting HDR of a CD40LG gene in a subject in need thereof.
  • the method comprises administering to a subject a cell as described herein or a vector as described herein and administering to the subject a nuclease.
  • the nuclease is a TALEN nuclease.
  • the nuclease is a Cas nuclease.
  • the nuclease is co-administered to the subject with the cell or with the vector.
  • the cell is from the subject and, wherein the cell is genetically modified by introducing a nucleic acid as described herein or a vector as described herein into the cell.
  • the administering is performed by adoptive cell transfer.
  • the cell is a human cell.
  • the cell is a primary cell.
  • the cell is an autologous cell.
  • the cell is a T cell.
  • the cell is a HSC.
  • the cell is a CD34 + HSC.
  • the subject is male.
  • the subject is suffering from X-linked hyper IgM (X-HIGM) syndrome.
  • Some embodiments provided herein relate to a method of treating, inhibiting, or ameliorating X-linked hyper IgM syndrome (X-HIGM) or disease symptoms associated with X-HIGM in a subject in need thereof.
  • the method comprises administering to a subject a cell as described herein or a vector as described herein and administering to the subject a nuclease.
  • the method further comprises identifying the subject as one that would benefit from receiving a therapy for X- HIGM or disease symptoms associated with X-HIGM and/or, optionally measuring an improvement in the progression of X-HIGM or an improvement in a disease symptom associated with X-HIGM in said subject.
  • the nuclease is a TALEN nuclease. In some embodiments, the nuclease is a CRISPR/Cas nuclease. In some embodiments, the nuclease is co-administered to the subject with the cell or with the vector. In some embodiments, the cell is from the subject, wherein the cell is genetically modified by introducing a nucleic acid as described herein or a vector as described herein into the cell. In some embodiments, the administering is performed by adoptive cell transfer. In some embodiments, the cell is a human cell. In some embodiments, the cell is a primary cell. In some embodiments, the cell is an autologous cell.
  • the cell is a T cell. In some embodiments, the cell is a HSC. In some embodiments, the cell is a CD34 + HSC. In some embodiments, the subject is male. In some embodiments, the method reduces bacterial or opportunistic infections. In some embodiments, the method reduces intermittent neutropenia.
  • FIG. 1 is a schematic illustrating that mutations in the CD40LG gene result in normal-elevated IgM, low IgG, and no IgE or IgA.
  • X-linked hyper IgM (X-HIGM) patients suffer from bacterial/opportunistic infections and intermittent neutropenia.
  • FIG. 2 depicts a schematic illustrating human CD40FG locus showing ribonucleoprotein (RNP) recognition site relative to exons and translation start site, and also depicts AAV donor template with promoter-less CD40F cDNA and chimeric 3’UTR; shaded dashed lines show location of CD40FG homology. Talen and CRISPR nuclease sites and AAV6 donor template with lKb CD40FG homology arms are also shown.
  • the targeting construct contains deletions in the 5’ UTR that render it non-cleavable by either nuclease.
  • the MND promoter allows tracking of editing events as the CD40FG locus is silent in hematopoietic stem cells (HSCs).
  • HSCs hematopoietic stem cells
  • FIG. 3 is a schematic representation of an alternative of a method of CD34 + cell editing protocol.
  • Cryopreserved CD34 + cells enriched from peripheral blood mononuclear cell (PBMC) mobilized adult donors were thawed and plated at 1 x 10 6 cells/ml in serum- free stem cell growth media [CellGenix GMP SCGM medium (CellGenix Inc.) with thrombopoietin, stem cell factor, and FFT3 ligand (PeproTech) all at 100 ng/ml].
  • Either IF-3 (60 ng/ml) or IF-6 (100 ng/ml) was added to the media as noted.
  • CD34 + cells were prestimulated in media for 48 hours at 37°C, then electroporated with the Neon Transfection System. Cells were dispensed into a 24 well plate containing 400 mE of media with donor template AAV at MOI between 1000 and 5000. Twenty-four hours after electroporation and AAV transduction, AAV containing media was removed and replaced with fresh stem cell growth media. Analysis of viability and GFP was performed at days 2 and 5 after editing.
  • FIG. 4A-and FIG. 4B depict results of efficient editing to introduce a GFP reporter at the CD40FG locus in CD34 + hematopoietic stem cells.
  • FIG. 4A depicts representative flow cytometry plots for mock, AAV only of 1000 MOI, and AAV of 1000 MOI plus 50 pg/ml TALEN or 100 pg/ml RNP conditions showing gating for viability (left column) and GFP expression (right column) at 2 and 5 days post editing.
  • FIG. 4B depicts cell viability and % GFP.
  • FIG. 6A, FIG. 6B, FIG. 6C and FIG. 6D depict bar graphs showing results of methylcellulose colony forming unit assay on cells used to transplant NSG mice.
  • FIG. 6 A shows the total colony number, by type, counted 14 days after plating 500 mock or AAV + RNP treated cells in methylcellulose.
  • FIG. 6B shows the total GFP + colonies by colony type.
  • FIG. 6C shows the percentage of GFP + cells for each colony type.
  • FIG. 6D shows the percentage of HDR-edited cells as determined by FACS.
  • FIG. 7 A, FIG. 7B, FIG. 7C, FIG. 7D, FIG. 7E, FIG. 7F depict representative results comparing addition of IF-3 and IF-6 to culture media.
  • Representative FACS plots depict cells grown in media containing either 60 ng/ml IF-3 (FIG. 7A) or 100 ng/ml IF-6 (FIG. 7B), 24 hours after treatment with AAV plus RNP.
  • FIG. 7C depicts bar graphs that show cell viability measured by forward/side scatter 48 hours after editing. Cells receiving 1K MOI of AAV were electroporated with 100 ng/ml RNP, cells receiving 2.5K MOI of AAV were electroporated with 200 pg/ml RNP. Data are presented as mean ⁇ SEM.
  • FIG. 7D depicts percentage of HDR- edited cells, measured by % GFP + 5 days after editing. Data are presented as mean ⁇ SEM.
  • FIG. 7E depicts percentage of cells that stain CD34 + CD38 CDl33 + CD90 + , 48 hours after editing. Data presented as mean ⁇ SEM of fold change relative to mock, as different donors vary significantly in CD34 + CD38 CDl 33 + CD90 + staining.
  • FIG. 8 depicts a schematic illustrating an AAV donor template containing identical 1 kb homology arms flanking human codon-optimized CD40L cDNA, a WPRE3 element and a synthetic polyadenylation sequence.
  • FIG. 9A and FIG. 9B depicts results of targeted integration of cDNA in edited cells.
  • FIG. 9A depicts a bar graph showing cell viability as measured by flow cytometry (FSC/SSC live cell gate), 48 hours after editing for mock, AAV alone, or AAV + RNP treated cells. Data are presented as mean ⁇ SEM.
  • FIG. 10A and FIG. 10B depict bar graphs showing input transplant into NSG mice.
  • FIG. 10A shows cell viability measured 2 days after editing (and 1 day after transplant) for the subset of cells maintained in vitro from NSG engraftment experiments.
  • FIG. 10B shows that rate of HDR (% GFP + measured at day 5) for cells from engraftment experiment maintained in vitro. All data shown represent mean ⁇ SEM.
  • FIG. 11 depicts an example gating strategy for cells harvested from NSG bone marrow and spleen. Lymphocyte and granulocyte populations were discriminated based on their size (forward scatter) and granularity (side scatter). These two major populations were then divided into separate lineages as defined by the expression of cell-type specific surface markers. GFP expression within each cell type is shown. For spleen samples, granulocyte population and CD34 + /CD38 populations were not analyzed.
  • FIG. 12 A, FIG. 12B, FIG. 12C, FIG. 12D, FIG. 12E depict results of engraftment of edited cells in the bone marrow of NSG mice.
  • FIG. 12A and FIG. 12B depict representative flow plots of cells harvested from the bone marrow of NSG mice 16 weeks following transplant using the gating strategy set forth in FIG. 11.
  • FIG. 12A shows bone marrow harvested from mouse transplanted with untreated cells.
  • FIG. 12B shows bone marrow harvested from mouse transplanted with cells treated with 2.5K MOI AAV + 200 pg/ml RNP.
  • FIG. 12C shows total hCD45 + engraftment in bone marrow of NSG mice transplanted with mock, 1K MOI AAV + 100 pg/ml RNP, or 2.5K MOI AAV + 200 mg/ml RNP treated cells. Dots represent individual mice. Mean ⁇ SEM shown on graph.
  • FIG. 12D shows percent HDR-edited cells (GFP + ) of total hCD45 + population.
  • FIG. 12E shows the ratio of CD33 + cells and CDl9 + cells in total hCD45 + population. Data are presented as mean ⁇ SEM. Significance determined by two-way ANOVA.
  • FIG. 13 A, FIG. 13B, FIG. 13C, FIG. 13D, FIG. 13E, FIG. 13F, FIG. 13G depicts results showing the impact of small molecules on engraftment of edited cells in NSG mice.
  • FIG. 13 A depicts bar graphs of cell viability 48 hours after editing determined by forward/side scatter. Data are presented as mean ⁇ SEM.
  • FIG. 13C depicts representative flow plots of cells harvested from the bone marrow of NSG mice 16 weeks following transplant of CD34 + cells grown in culture media containing F0VI171 and SR1 and treated with AAV plus RNP.
  • FIG. 13 A depicts bar graphs of cell viability 48 hours after editing determined by forward/side scatter. Data are presented as mean ⁇ SEM.
  • FIG. 13D shows total hCD45 + engraftment in the bone marrow of NSG mice 12-16 weeks post transplantation with mock or edited (2.5K MOI AAV plus 200 pg/ml RNP treated) cells. Prior to transplant, cells were grown in media that contained various combinations of indicated small molecules. Each dot represents individual mouse, mean ⁇ SEM shown.
  • FIG. 13E shows HDR-editing rate (% GFP + ) among hCD45 + cells recovered from the bone marrow of NSG mice. Mean ⁇ SEM shown on graph.
  • FIG. 13F shows percent CD33 + or CDl9 + among total hCD45 + cells recovered from the bone marrow. Data are presented as mean ⁇ SEM. Significance determined by two-way ANOVA.
  • FIG. 13G shows HDR-editing rate (% GFP + ) among CDl9 + cells, CD33 + cells, and CD34 + cells recovered from the bone marrow of NSG mice. Significance determined by paired T-test.
  • FIG. 14A, FIG. 14B, FIG 14C, FIG. 14D depict results of engraftment of edited cells in the spleen of NSG mice.
  • FIG. 14A and FIG. 14B show representative flow plots of cells harvested from the spleen of NSG mice 16 weeks following transplantation.
  • Flow plots of FIG. 14A are from mouse transplanted with mock-treated cells. Top row, from left to right: hCD45:mCD45 chimerism, and human CD33 + and CDl9 + staining.
  • Bottom row plot shows GFP expression among, from left to right: hCD45 + cells, CD33 + cells, and CDl9 + cells.
  • FIG. 14B are from mouse transplanted with cells treated with 2.5K MOI AAV + 200 pg/ml RNP.
  • FIG. 14C shows total hCD45 + engraftment in spleen of NSG mice transplanted with mock, 1K MOI AAV + 100 pg/ml RNP, or 2.5K MOI AAV + 200 pg/ml RNP treated cells. Each dot represents individual mouse. Mean ⁇ SEM shown on graph.
  • FIG. 14D shows percent HDR-edited cells among total hCD45 + population. Mean ⁇ SEM is shown on graph.
  • FIG. 15A, FIG. 15B, FIG. 15C, FIG. 15D, FIG. 15E show effects of small molecules F0VI171 and SR1 in vitro.
  • FIG. 15A and FIG. 15B depicts representative flow plots from 48 hours after editing of FT-HSCs that show staining and GFP expression for cells grown without (FIG. 15A) or with (FIG. 15B) F0VI171 and SR1.
  • FIG. 15C shows GFP expression in the bulk population of indicated group 48 hours after editing, presented as mean ⁇ SEM.
  • FIG. 15D shows GFP expression among cells staining as FT-HSCs 48 hours post editing.
  • FIG. 15E shows the rate of HDR-editing as measured by GFP expression 5 days post editing. Data are presented as mean ⁇ SEM.
  • FIG. 16E, FIG. 16F, FIG. 16G show the impact of eltrombopag on engraftment of edited cells.
  • FIG. 16A shows bar graphs that depict cell viability 48 hours after editing for mock or 1K MOI AAV + 100 pg/ml RNP treated cells, grown with or without 3 pg/ml eltrombopag. Data shown represent mean ⁇ SEM.
  • FIG. 16B shows the rate of HDR (%GFP + ) as measured by FACS 5 days after editing. Data shown represent mean ⁇ SEM.
  • FIG. 16C shows the percentage of FT-HSCs 48 hours after editing, presented as mean ⁇ SEM.
  • FIG. 16D shows human CD45 engraftment in the bone marrow of NSG mice 12 weeks after transplant of cells. Each dot represents individual mouse, with mean shown.
  • FIG. 16E shows the rate of HDR (% GFP + ) among human cells harvested from the bone marrow of NSG mice.
  • FIG. 16F shows hCD45 + engraftment in the spleen of NSG mice 12 weeks after the transplant of cells.
  • FIG. 16G shows the rate of HDR (% GFP + ) among human cells harvested from the spleen of NSG mice.
  • FIG. 17A and FIG. 17B depict the impact of time in culture after editing on engraftment of edited cells.
  • CD34 + cells were transplanted into mice 1, 2 or 4 days post editing.
  • FIG. 17A shows human CD45 engraftment in the bone marrow of NSG mice 12 weeks after transplant of cells. Each dot represents individual mouse, with mean shown.
  • FIG. 17B shows the rate of HDR (% GFP + ) among human cells harvested from the bone marrow of NSG mice.
  • FIG. 18 depicts a comparison of the effect of 48- and 72-hours pre stimulation of CD34+ cells on the total human cells recovered from the bone marrow of NSGW41 recipient mice.
  • FIG. 19 depicts a comparison of the effect of 48- and 72-hours pre stimulation of CD34+ cells on engraftment of edited (GFP+) cells in the bone marrow of W41 mice.
  • FIG. 20 depicts a comparison of the effect of 48- and 72-hours pre stimulation of CD34+ cells on the total human cell engraftment in the spleens of W41 mice.
  • FIG. 21 depicts a comparison of the effect of 48- and 72-hours pre stimulation of CD34+ cells on engraftment of edited (GFP+) cells in the spleens of NSGW41 mice.
  • FIG. 22 depicts a schematic showing the design of in vivo experimental studies established using Protocols A and B.
  • FIG. 23 depicts a comparison of percent hCD45+ cells recovered from the bone marrow of NSGW41 mice transplanted with CD34 + cells cultured using protocol A (dots) or B (squares).
  • FIG. 24 depicts a comparison of percent GFP+ among total hCD45+ cells recovered from the bone marrow of NSGW41 mice transplanted with CD34 + cells cultured using protocol A (dots) or B (squares).
  • FIG. 25 depicts a comparison of percent CD 19+ cells among human CD45+ cells recovered from the bone marrow of NSGW41 mice engrafted CD34 + cells cultured using protocol A (dots) or B (squares).
  • FIG. 26 depicts a comparison of percent GFP+ cells among human CD 19+ cells recovered from the bone marrow of NSGW41 mice transplanted with CD34 + cells cultured using protocol A (dots) or B (squares).
  • FIG. 27 depicts a comparison of percent CD33+ cells among human CD45+ cells recovered from the bone marrow of NSGW41 mice engrafted with CD34 + cells cultured using protocol A (dots) or B (squares).
  • FIG. 28 depicts a comparison of percent GFP+ cells among human CD33+ cells recovered from the bone marrow of NSGW41 mice engrafted with CD34 + cells cultured using protocol A (dots) or B (squares).
  • FIG. 29 depicts representative flow plots of cells harvested from the bone marrow of NSGW41 mice at 16 weeks following transplant.
  • Upper panel shows bone marrow harvested from mouse transplanted with mock untreated cells: top row, from left to right: hCD45:mCD45 chimerism, human CD45-gated CD33+ and CD19+ staining; and bottom row, from left to right: GFP expression among hCD45+, CD33+ and CD19+ cells.
  • Lower panel shows bone marrow harvested from mouse transplanted with cells treated with AAV plus RNP: top row, from left to right: hCD45:mCD45 chimerism, human CD45-gated CD33+ and CD19+ staining; and bottom row, from left to right: GFP expression among hCD45+, CD33+ and CD 19+ cells.
  • GFP+ human cells were present in all hematopoietic lineages consistent with sustained engraftment of long-term human HSC with HDR-editing of the CD40L locus.
  • FIG. 30 depicts a comparison of percent human CD45+ cells recovered from the spleens of NSGW41 mice transplanted with CD34 + cells cultured using protocol A (dots) or B (squares).
  • FIG. 31 depicts a comparison of percent GFP+ cells among human CD45+ cells recovered from the spleens of NSGW41 mice transplanted with CD34 + cells cultured using protocol A (dots) or B (squares).
  • FIG. 32 depicts a comparison of cell viability using various nucleofection programs on a LONZA system versus electroporation on a NEON system. Data from a single CD34+ donor is shown on the bar graph.
  • FIG. 33 depicts a comparison of percent HDR (GFP expression) using various nucleofection programs on a LONZA system versus electroporation on a NEON system. Data from a single CD34+ donor is shown on the bar graph.
  • FIG. 34 depicts a comparison of percent CD 19+ cells among human CD45+ cells recovered from the spleens of NSGW41 mice transplanted with CD34 + cells cultured using protocol A (dots) or B (squares).
  • FIG. 35 depicts a comparison of percent GFP+ cells among human CD 19+ cells recovered from the spleens of NSGW41 mice transplanted with CD34 + cells cultured using protocol A (dots) or B (squares).
  • FIG. 36 depicts a comparison of percent CD33+ cells among human CD45+ cells recovered from the spleens of NSGW41 mice transplanted with CD34 + cells cultured using protocol A (dots) or B (squares).
  • FIG. 37 depicts a comparison of percent GFP+ cells among human CD33+ cells recovered from the spleens of NSGW41 mice transplanted with CD34 + cells cultured using protocol A (dots) or B (squares).
  • FIG. 38 depicts representative flow plots of cells harvested from the spleens of NSGW41 mice 16 weeks following transplant.
  • Upper panel shows spleen harvested from mouse transplanted with mock untreated cells: top row, from left to right: hCD45:mCD45 chimerism, human CD45-gated CD33+ and CD19+ staining; bottom row, from left to right: GFP expression among hCD45+, CD33+ and CD19+ cells.
  • Lower panel shows spleen harvested from mouse transplanted with cells treated with AAV plus RNP: top row, from left to right: hCD45:mCD45 chimerism, human CD45-gated CD33+ and CD19+ staining; and bottom row, from left to right: GFP expression among hCD45+, CD33+ and CD19+ cells.
  • GFP+ human cells were present in all hematopoietic lineages consistent with derivation of these cells from human HSC with HDR-editing of the CD40L locus.
  • FIG. 39 depicts a comparison of percent CD34+CD38low cells among human CD45+ cells recovered from the bone marrow of NSGW41 mice transplanted with CD34 + cells cultured using protocol A (dots) or B (squares).
  • FIG. 40 depicts a comparison of percent GFP+ cells among human CD34+CD38low CD45+ cells recovered from the bone marrow of NSGW41 mice transplanted with CD34 + cells cultured using protocol A (dots) or B (squares).
  • FIG. 41 depicts representative flow cytometry analysis of CD34+ gated on total human CD45+ cells from NSGW41 mice transplanted with mock or edited cells.
  • FIG. 42 depicts improvement in HDR rates by nucleofection of recombinant
  • articles“a” and“an” are used herein to refer to one or to more than one (for example, to at least one) of the grammatical object of the article.
  • “an element” means one element or more than one element.
  • “about” is meant a quantity, level, value, number, frequency, percentage, dimension, size, amount, weight or length that varies by as much as 30, 25, 20, 15, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1% to a reference quantity, level, value, number, frequency, percentage, dimension, size, amount, weight, or length.
  • the terms“comprise(s)” and“comprising” are to be interpreted as having an open- ended meaning. That is, the terms are to be interpreted synonymously with the phrases“having at least” or“including at least.”
  • the term“comprising” means that the process comprises at least the recited steps, but may include additional steps.
  • the term“comprising” means that the compound, composition or device comprises at least the recited features or components, but may also include additional features or components.
  • a“subject” or a“patient” as described herein have their plain and ordinary meaning when read in light of the specification, and may include but is not limited to, for example, an animal that is the object of treatment, observation or experiment.
  • “Animal” comprises cold- and warm-blooded vertebrates and invertebrates such as fish, shellfish, reptiles and, in particular, mammals.
  • “Mammal” comprises, without limitation, mice, rats, rabbits, guinea pigs, dogs, cats, sheep, goats, cows, horses, primates, such as monkeys, chimpanzees, and apes, and, in particular, humans.
  • the subject is human.
  • a patient is selected who is in need of treatment, amelioration, inhibition, progression, or improvement in disease symptoms or who is in need of curative therapy.
  • a patient is selected who has symptoms of X-linked hyper IgM syndrome (X-HIGM), who has been diagnosed with X-HIGM, or who is suspected of having X-HIGM.
  • X-HIGM X-linked hyper IgM syndrome
  • X-HIGM refers to a primary immune deficiency disorder characterized by defective CD40 signaling as a result of mutations in the CD40LG gene.
  • the cell surface molecule CD40 is a member of the tumor necrosis factor receptor superfamily and is broadly expressed by immune, hematopoietic, vascular, epithelial, and other cells, including a wide range of tumor cells.
  • CD40 itself lacks intrinsic kinase or other signal transduction activity, but rather mediates its diverse effects via an intricate series of downstream adapter molecules that differentially alter gene expression depending on cell type and microenvironment.
  • CD40 may mediate tumor regression through both an indirect effect of immune activation and a direct cytotoxic effect on the CD40-expressing tumor.
  • CD40 is known as a critical regulator of cellular and humoral immunity via its expression on B lymphocytes, dendritic cells, and monocytes (Grewal and Flavell, Annu Rev Immunol., 16: 111 (1998); van Kooten and Banchereau, J Leukoc Biol., 67:2 (2000)).
  • CD40 is also expressed on the cell surface of many other non-immune cells, including endothelial cells, fibroblasts, hematopoietic progenitors, platelets and basal epithelial cells (Grewal and Flavell, Annu Rev Immunol., 16: 111 (1998); van Kooten and Banchereau, J Leukoc Biol., 67:2 (2000); Young et al, Immunol Today, 9:502 (1998); Quezada et al., Annu Rev Immunol., 22:307 (2004)0.
  • CD40L The CD40 ligand (CD40L), also known as CD154, is the chief ligand described for CD40 and is expressed primarily by activated T lymphocytes and platelets (van Kooten and Banchereau, J Leukoc Biol., 67:2 (2000); Armitage et al, Nature, 357:80 (1992)). Atherosclerosis, graft rejection, coagulation, infection control, and autoimmunity are all regulated by CD40-CD40L interactions (Grewal and Flavell, Annu Rev Immunol., 16: 111 (1998); van Kooten and Banchereau, J Leukoc Biol., 67:2 (2000)).
  • costimulatory molecule encompasses any single molecule or combination of molecules which, when acting together with a MHC/peptide complex bound by a T cell antigen receptor (TCR) on the surface of a T cell, provides a co-stimulatory effect which achieves activation of the I cell that binds the peptide.
  • TCR T cell antigen receptor
  • treatment has its plain and ordinary meaning when read in light of the specification, and may include but is not limited to, for example, an intervention made in response to a disease, disorder or physiological condition manifested by a subject, particularly a subject suffering from X-FUGM.
  • the aim of treatment may include, but is not limited to, one or more of the alleviation or prevention of symptoms, slowing or stopping the progression or worsening of a disease, disorder, or condition, curative treatment of the disease, disorder, or condition, and the remission of the disease, disorder, or condition.
  • “treatment” refers to both treatment of the underlying disease or treatment of the disease symptoms.
  • treatments reduce, alleviate, ameliorate, or eradicate the symptom(s) of the disease and/or provide curative therapy of the disease.
  • adoptive cellular therapy or“adoptive cell transfer,” as described herein, have their plain and ordinary meaning when read in light of the specification, and may include but is not limited to, for example, transfer of cells, most commonly immune-derived cells, back into the same patient or into a new recipient host with the goal of transferring the immunologic functionality and characteristics into the new host.
  • adoptive cellular therapy or adoptive cell transfer comprises administering cells for promoting homology directed repair of a CD40LG gene in a subject.
  • HDR homology-directed repair
  • DSB double- stranded break
  • HDR requires nucleotide sequence homology and uses a donor polynucleotide to repair the sequence where the DSB (e.g., within a target DNA sequence) occurred.
  • the donor polynucleotide generally has the requisite sequence homology with the sequence flanking the DSB so that the donor polynucleotide can serve as a suitable template for repair.
  • HDR results in the transfer of genetic information from, for example, the donor polynucleotide to the DNA target sequence.
  • HDR may result in alteration of the DNA target sequence (e.g., insertion, deletion, mutation) if the donor polynucleotide sequence differs from the DNA target sequence and part or all of the donor polynucleotide is incorporated into the DNA target sequence.
  • an entire donor polynucleotide, a portion of the donor polynucleotide, or a copy of the donor polynucleotide is integrated at the site of the DNA target sequence.
  • nucleic acid or “nucleic acid molecule” refers to polynucleotides, such as deoxyribonucleic acid (DNA) or ribonucleic acid (RNA), oligonucleotides, fragments generated by the polymerase chain reaction (PCR), and fragments generated by any of ligation, scission, endonuclease action, and exonuclease action.
  • DNA deoxyribonucleic acid
  • RNA ribonucleic acid
  • PCR polymerase chain reaction
  • Nucleic acid molecules can be composed of monomers that are naturally-occurring nucleotides (such as DNA and RNA), or analogs of naturally-occurring nucleotides (e.g., enantiomeric forms of naturally-occurring nucleotides), or a combination of both.
  • Modified nucleotides can have alterations in sugar moieties and/or in pyrimidine or purine base moieties.
  • Sugar modifications include, for example, replacement of one or more hydroxyl groups with halogens, alkyl groups, amines, and azido groups, or sugars can be functionalized as ethers or esters.
  • the entire sugar moiety can be replaced with sterically and electronically similar structures, such as aza-sugars or carbocyclic sugar analogs.
  • modifications in a base moiety include alkylated purines and pyrimidines, acylated purines or pyrimidines, or other well-known heterocyclic substitutes.
  • Nucleic acid monomers can be linked by phosphodiester bonds or analogs of such linkages. Analogs of phosphodiester linkages include phosphorothioate, phosphorodithioate, phosphoroselenoate, phosphorodiselenoate, phosphoroanilothioate, phosphoranilidate, or phosphoramidate, and the like.
  • nucleic acid molecule also includes so-called“peptide nucleic acids,” which comprise naturally-occurring or modified nucleic acid bases attached to a polyamide backbone. Nucleic acids can be either single stranded or double stranded. Nucleic acid sequences may be described herein with a SEQ ID NO, and are described throughout the application and included in Appendix I.
  • a nucleotide sequence described herein is 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical, or is within a range defined by any two of the aforementioned percentages, to a sequence of any one of SEQ ID NOs: 1-9 or 12-27.
  • the term“fusion” or“fused” have their plain and ordinary meaning when read in light of the specification, and may include but is not limited to, for example, a first nucleic acid linked to a second nucleic acid by a phosphodiester bond, so that a coding sequence at the 3’ end of the first nucleic acid is in frame with a coding sequence at the 5’ end of the second nucleic acid, and by extension can further refer to a first polypeptide linked by a peptide bond to a second polypeptide at the C-terminus of the first polypeptide.
  • a“fused” (or“fusion of a”) nucleic acid or peptide as used herein refers to a configuration of molecules, and does not necessarily involve performing the act of joining two molecules together.
  • the fusion of a first nucleic acid to a second nucleic acid can encode a single polypeptide in which a first polypeptide sequence (encoded by the first nucleic acid) is fused to a second polypeptide sequence (encoded by the second nucleic acid).
  • the molecule comprising the fused nucleic acids is referred to as a fusion nucleic acid.
  • the term“variant” has its plain and ordinary meaning when read in light of the specification, and may include but is not limited to, for example, a polynucleotide (or polypeptide) having a sequence substantially similar to a reference polynucleotide (or polypeptide).
  • a variant can have deletions, substitutions, or additions of one or more nucleotides at the 5’ end, 3’ end, and/or one or more internal sites in comparison to the reference polynucleotide.
  • variants and/or differences in sequences between a variant and the reference polynucleotide can be detected using conventional techniques known in the art, for example polymerase chain reaction (PCR) and hybridization techniques.
  • variant polynucleotides also include synthetically derived polynucleotides, such as those generated, for example, by using site-directed mutagenesis.
  • a variant of a polynucleotide including, but not limited to, a DNA, can have at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or more sequence identity to the reference polynucleotide as determined by sequence alignment programs known by skilled artisans, or an amount within a range defined by any two of the aforementioned values.
  • a variant can have deletions, substitutions, or additions of one or more amino acids in comparison to the reference polypeptide.
  • a variant of a polypeptide can have at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or more sequence identity to the reference polypeptide as determined by sequence alignment programs known by skilled artisans, or an amount within a range defined by any two of the aforementioned values.
  • A“regulatory element” is a nucleotide sequence that modulates the activity of a core promoter.
  • a regulatory element may contain a nucleotide sequence that binds with cellular factors enabling transcription exclusively or preferentially in particular cells, tissues, or organelles. These types of regulatory elements are normally associated with genes that are expressed in a“cell-specific,”“tissue-specific,” or“organelle-specific” manner.
  • a system for editing at least one target gene in a cell comprising a first nucleic acid sequence encoding a CRISPR guide RNA, wherein the CRISPR guide RNA is complimentary to at least one target gene in a cell and, wherein said first nucleic acid sequence is present in a vector; said system also comprising a second nucleic acid sequence encoding a Cas9 protein, a third nucleic acid sequence encoding a first adenoviral protein, and a fourth nucleic acid sequence encoding a second adenoviral protein.
  • the first, second, third and fourth nucleic acid sequences are joined to regulatory elements that are operable in a eukaryotic cell, such as a human cell.
  • operably linked is used to describe the connection between regulatory elements and a gene or its coding region.
  • gene expression is placed under the control of one or more regulatory elements, for example, without limitation, constitutive or inducible promoters, tissue-specific regulatory elements, or enhancers.
  • a gene or coding region is said to be“operably linked to” or“operatively linked to” or“operably associated with” the regulatory elements, meaning that the gene or coding region is controlled or influenced by the regulatory element.
  • a promoter is operably linked to a coding sequence if the promoter effects transcription or expression of the coding sequence.
  • upstream have its plain and ordinary meaning when read in light of the specification, and may include but is not limited to, for example, positions 5’ of a location on a polynucleotide, and positions toward the N-terminus of a location on a polypeptide.
  • downstream refers to positions 3’ of a location on nucleotide, and positions toward the C-terminus of a location on a polypeptide.
  • construct has its plain and ordinary meaning when read in light of the specification, and may include but is not limited to, for example, a recombinant nucleic acid that has been generated for the purpose of the expression of a specific nucleotide sequence(s), or that is to be used in the construction of other recombinant nucleotide sequences.
  • A“promoter” is a nucleotide sequence that directs the transcription of a structural gene.
  • a promoter is located in the 5' non-coding region of a gene, proximal to the transcriptional start site of a structural gene. Sequence elements within promoters that function in the initiation of transcription are often characterized by consensus nucleotide sequences. These promoter elements include RNA polymerase binding sites, TATA sequences, CAAT sequences, differentiation-specific elements (DSEs; McGehee et al, Mol. Endocrinol.
  • CREs cyclic AMP response elements
  • SREs serum response elements
  • GREs glucocorticoid response elements
  • binding sites for other transcription factors such as CRE/ATF (O'Reilly et al, J. Biol. Chem. 267: 19938 (1992)), AP2 (Ye et al., J. Biol. Chem. 269:25728 (1994)), SP1, cAMP response element binding protein (CREB; Loeken, Gene Expr.
  • CRE/ATF O'Reilly et al, J. Biol. Chem. 267: 19938 (1992)
  • AP2 Ye et al., J. Biol. Chem. 269:25728 (1994)
  • SP1, cAMP response element binding protein CREB; Loeken, Gene Expr.
  • a promoter may be constitutively active, repressible or inducible. If a promoter is an inducible promoter, then the rate of transcription increases in response to an inducing agent. In contrast, the rate of transcription is not regulated by an inducing agent if the promoter is a constitutive promoter. Repressible promoters are also known.
  • a regulatory element can be an untranslated region.
  • an untranslated region is a 5’ untranslated region.
  • an untranslated region is a 3’ untranslated region.
  • either 5’ or 3’ untranslated region is used.
  • both 5’ and 3’ untranslated regions are used.
  • the promoter described herein can be an MND promoter.
  • An MND promoter derives its name from myeloproliferative sarcoma virus enhancer, negative control region deleted, dl587rev primer binding site substituted, and is a gamma retroviral synthetic promoter that contains the U3 region of a modified MoMulv LTR with myeloproliferative sarcoma virus enhancer.
  • the term“enhancer” refers to a type of regulatory element that can modulate the efficiency of transcription, regardless of the distance or orientation of the enhancer relative to the start site of transcription.
  • transfection has its plain and ordinary meaning when read in light of the specification, and may include but is not limited to, for example, introduction of a nucleic acid into a host cell, such as by contacting the cell with a recombinant AAV vector as described herein.
  • transient transfection refers to the introduction of exogenous nucleic acid(s) into a host cell by a method that does not generally result in the integration of the exogenous nucleic into the genome of the transiently transfected host cell.
  • the nucleic acid is RNA.
  • the nucleic acid is DNA.
  • the nucleic acid when the nucleic acid is RNA, the nucleic acid does not generally integrate in the genome of the transiently transfected cell. In some alternatives, when the nucleic acid is DNA, the nucleic acid can integrate in the genome of the transiently transfected cell.
  • the term“vector” has its plain and ordinary meaning when read in light of the specification, and may include but is not limited to, for example, a polynucleotide construct, typically a plasmid or a virus, used to transmit genetic material to a host cell.
  • Vectors can be, for example, viruses, plasmids, cosmids, or phage.
  • a vector as used herein can be composed of either DNA or RNA. In some alternatives, a vector is composed of DNA.
  • An“expression vector” is a vector that is capable of directing the expression of a protein encoded by one or more genes carried by the vector when it is present in the appropriate environment. Vectors are preferably capable of autonomous replication.
  • an expression vector comprises a transcription promoter, a gene, and a transcription terminator. Gene expression is usually placed under the control of a promoter, and a gene is said to be “operably linked to” the promoter.
  • AAV system or“AAV expression system” have their plain and ordinary meaning when read in light of the specification, and may include but is not limited to, for example, nucleic acids for expressing at least one transcript-encoding nucleic acid, and which are disposed on one or more AAV vectors.
  • activity-dependent expression refers to nucleic acid expression that will be induced upon a change in a particular type of activity of a cell containing the nucleic acid, for example depolarization of the cell.
  • the cell is a neuron, and depolarization of the neuron in response to a stimulus induces“activity-dependent” nucleic acid expression.
  • an AAV vector includes a sequence as set forth in SEQ ID NOs: 15, 16, or 17.
  • host cell has its plain and ordinary meaning when read in light of the specification, and may include but is not limited to, for example, a cell that is introduced with Cas9-mRNA/AAV-guide RNA according to the present alternatives, as well as, cells that are provided with the systems herein.
  • Host cells can be prokaryotic cells or eukaryotic cells. Examples of prokaryotic host cells include, but are not limited to E.
  • eukaryotic host cells include, but are not limited to, protozoa, fungi, algae, plant, insect, amphibian, avian and mammalian cells.
  • a system for editing at least one target gene in a cell wherein the cell is a eukaryotic cell.
  • the cell is a mammalian cell.
  • the cell is a human cell.
  • the cell is a primary cell.
  • the cell is not a transformed cell.
  • the cell is a primary lymphocyte.
  • the cell is a primary lymphocyte, a CD34 + stem cell, a hepatocyte, a cardiomyocyte, a neuron, a glial cell, a muscle cell or an intestinal cell.
  • prokaryotic cells lack a true nucleus.
  • prokaryotic cells are bacteria (e.g., cyanobacteria, Lactobacillus acidophilus, Nitrogen-Fixing Bacteria, Helicobacter pylori, Bifidobacterium, Staphylococcus aureus, Bacillus anthrax, Clostridium tetani, Streptococcus pyogenes, Staphylococcus pneumoniae, Klebsiella pneumoniae and/or Escherichia coli) and/or archaea (e.g., Crenarchaeota, Euryarchaeota, and/or Korarchaeota).
  • the Cas9 protein described herein is a protein from a prokaryotic cell.
  • Eukaryotic cells include, but are not limited to, algae cells, fungal cells (such as yeast), plant cells, animal cells, mammalian cells, or human cells (e.g., T-cells).
  • T cell precursors as described herein, has its plain and ordinary meaning when read in light of the specification, and may include but is not limited to, for example, lymphoid precursor cells that can migrate to the thymus and become T cell precursors, which do not express a T cell receptor. All T cells originate from hematopoietic stem cells in the bone marrow. Hematopoietic progenitors (lymphoid progenitor cells) from hematopoietic stem cells populate the thymus and expand by cell division to generate a large population of immature thymocytes. The earliest thymocytes express neither CD4 nor CD8, and are therefore classed as double-negative (CD4 CD8 ) cells.
  • CD4 CD8 double-negative
  • Hematopoietic stem cells or“HSC” as described herein, have their plain and ordinary meaning when read in light of the specification, and may include but is not limited to, for example, precursor cells that can give rise to myeloid cells such as, for example, macrophages, monocytes, macrophages, neutrophils, basophils, eosinophils, erythrocytes, megakaryocytes/platelets, dendritic cells or lymphoid lineages (such as, for example, T-cells, B-cells, NK-cells).
  • precursor cells that can give rise to myeloid cells such as, for example, macrophages, monocytes, macrophages, neutrophils, basophils, eosinophils, erythrocytes, megakaryocytes/platelets, dendritic cells or lymphoid lineages (such as, for example, T-cells, B-cells, NK-cells).
  • HSCs have a heterogeneous population in which three classes of stem cells exist, which are distinguished by their ratio of lymphoid to myeloid progeny in the blood (L/M).
  • the cells provided are HSC cells.
  • the cell is a primary lymphocyte or a CD34 + stem cell.
  • autologous refers to the donor and recipient of the stem cells being the same, for example, the patient or subject is the source of the cells.
  • “Primary human cells” as described herein, are directly cultured from their source organ tissue or blood cells. Compared to immortalized cell lines, primary human cells provide enhanced replication of in vivo. In some alternatives, the cells provided are primary human cells.
  • the term“co-delivery” as described herein has its plain and ordinary meaning when read in light of the specification, and may include but is not limited to, for example, delivery of two or more separate chemical entities, whether in vitro or in vivo. Co-delivery refers to the simultaneous delivery of separate agents; to the simultaneous delivery of a mixture of agents; as well as to the delivery of one agent followed by delivery of a second agent or additional agents. In all cases, agents that are co-delivered are intended to work in conjunction with each other. In some alternatives, for example, co-delivery comprises delivery of an mRNA of interest and an AAV vector.
  • the term“endonuclease” as described herein, has its plain and ordinary meaning when read in light of the specification, and may include but is not limited to, for example, enzymes that cleave the phosphodiester bond within a polynucleotide chain.
  • the polynucleotide may be double-stranded DNA (dsDNA), single-stranded DNA (ssDNA), RNA, double- stranded hybrids of DNA and RNA, or synthetic DNA (for example, containing bases other than A, C, G, and T).
  • An endonuclease may cut a polynucleotide symmetrically, leaving “blunt” ends, or in positions that are not directly opposing, creating overhangs, which may be referred to as“sticky ends.”
  • the methods and compositions described herein may be applied to cleavage sites generated by endonucleases.
  • the system can further provide nucleic acids that encode an endonuclease, including zinc finger nucleases (ZFNs), TAL effector nucleases (TALENs), meganucleases (such as MegaTALs), or CRISPR/Cas9 or a fusion protein comprising a domain of an endonuclease, for example, Cas9, TALEN, or MegaTAL, or one or more portion thereof.
  • ZFNs zinc finger nucleases
  • TALENs TAL effector nucleases
  • MegaTALs meganucleases
  • CRISPR/Cas9 or a fusion protein comprising a domain of an endonuclease, for example, Cas9, TALEN, or MegaTAL, or one or more portion thereof.
  • TALEN transcription activator- like effector nuclease
  • TAL-effector DNA binding domains may be engineered to bind to a desired target and fused to a nuclease domain, such as the Fokl nuclease domain, to derive a TAL effector domain-nuclease fusion protein.
  • the methods and systems described herein may be applied to cleavage sites generated by TAL effector nucleases.
  • the systems can further comprise a TALEN nuclease or a vector or nucleic acid encoding a TALEN nuclease.
  • the method can further comprise providing a nuclease, such as a TALEN nuclease.
  • MegaTALs are derived from the combination of two distinct classes of DNA targeting enzymes. Meganucleases (also referred to as homing endonucleases) are single peptide chains that have the feature of both DNA recognition and nuclease functions in the same domain. In some alternatives of the systems provided herein, the systems can further comprise a MegaTAL nuclease or a vector or nucleic acid encoding a MegaTAL nuclease. In some alternatives of the methods provided herein, the methods can further comprise providing MegaTAL nuclease or a vector or nucleic acid encoding a MegaTAL nuclease.
  • CRISPRs (clustered regularly interspaced short palindromic repeats) are segments of prokaryotic DNA containing short repetitions of base sequences. Each repetition is followed by short segments of“spacer DNA” from previous exposures to a bacterial virus or plasmid.
  • Cas9 (CRISPR associated protein 9) is an RNA-guided DNA endonuclease enzyme associated with the CRISPR adaptive immunity system in Streptococcus pyogenes, among other bacteria.
  • S. pyogenes utilizes Cas9 to memorize and later interrogate and cleave foreign DNA, such as invading bacteriophage DNA or plasmid DNA.
  • Cas9 performs this interrogation by unwinding foreign DNA and checking for complementarity to the 20 base pair spacer region of the guide RNA. If the DNA substrate is complementary to the guide RNA, Cas9 cleaves the invading DNA.
  • the CRISPR/Cas system as described herein is used for gene editing (adding, disrupting, or changing the sequence of specific genes) and gene regulation.
  • the organism By delivering the Cas9 protein, a derivative, or fragment thereof and appropriate guide RNAs into a cell, the organism’s genome can be cut at any desired location. It can be possible to use CRISPR to build RNA-guided genes capable of altering the genomes of entire populations.
  • the basic components of CRISPR/Cas9 system comprise a target gene, a guide RNA, and a Cas9 endonuclease, derivative, or fragment thereof.
  • CRISPR/Cas9 for gene editing is the need for a system to deliver the guide RNAs efficiently to a wide variety of cell types. This could for example involve delivery of an in vitro generated guide RNA as a nucleic acid (the guide RNA generated by in vitro transcription or chemical synthesis).
  • the nucleic acid encoding the guide RNA is rendered nuclease resistant by incorporation of modified bases, such as 2’0-methyl bases.
  • the CRISPR/Cas9 system described herein whereby the polynucleotide encoding the Cas9 nuclease or a derivative or functional fragment thereof (for example, a 20 nucleic acid sequence of an mRNA vector with Cas9) is provided with a poly(T) or poly(A) tail of a desired length and prepared in accordance with the teachings described herein, for example, is provided with a guide RNA that comprises one or more modified bases, such as any one or more of the modified bases described herein.
  • RNAs have been used in CRISPR-Cas genome editing in human primary cells (Hendel, A. et al., Nat Biotechnol. 2015 Sep; 33(9):985-9). Chemical modifications of guide RNAs can include modifications that confer nuclease resistance. Nucleases can be endonucleases, or exonucleases, or both.
  • Some chemical modification include 2’-fluoro, 2’O-methyl, phosphorothioate dithiol 3’- 3’ end linkage, 2-amino-dA, 5-methyl-dC, C-5 propynyl-C, or C-5 propynyl-U, morpholino, etc. These examples are not meant to be limiting and other chemical modifications and variants and modifications of these exemplary alternatives are also contemplated.
  • Exemplary guide RNAs useful with the alternatives described herein which may contain one or more of the modified bases set forth herein.
  • the guide RNAs include a sequence as set forth in SEQ ID NOs: 12
  • AAV adeno-associated virus
  • exonuclease refers to enzymes that cleave phosphodiester bonds at the end of a polynucleotide chain via a hydrolyzing reaction that breaks phosphodiester bonds at either the 3' or 5' end.
  • the polynucleotide may be double-stranded DNA (dsDNA), single-stranded DNA (ssDNA), RNA, double-stranded hybrids of DNA and RNA, or synthetic DNA (for example, containing bases other than A, C, G, and T).
  • dsDNA double-stranded DNA
  • ssDNA single-stranded DNA
  • RNA double-stranded hybrids of DNA and RNA
  • synthetic DNA for example, containing bases other than A, C, G, and T.
  • 5' exonuclease refers to exonucleases that cleave the phosphodiester bond at the 5' end.
  • exonucleases refers to exonucleases that cleave the phosphodiester bond at the 3' end.
  • Exonucleases may cleave the phosphodiester bonds at the end of a polynucleotide chain at endonuclease cut sites or at ends generated by other chemical or mechanical means, such as shearing (for example by passing through fine-gauge needle, heating, sonicating, mini bead tumbling, or nebulizing), ionizing radiation, ultraviolet radiation, oxygen radicals, chemical hydrolysis or chemotherapy agents.
  • Exonucleases may cleave the phosphodiester bonds at blunt ends or sticky ends.
  • coli exonuclease I and exonuclease III are two commonly used 3 '-exonucleases that have 3'-exonucleolytic single-strand degradation activity.
  • Other examples of 3 '-exonucleases include Nucleoside diphosphate kinases (NDKs), NDK1 (NM23-H1), NDK5, NDK7, and NDK8 (Yoon J-H, et al, Characterization of the 3' to 5' exonuclease activity found in human nucleoside diphosphate kinase 1 (NDK1) and several of its homologues.
  • coli exonuclease VII and T7-exonuclease Gene 6 are two commonly used 5 '-3' exonucleases that have 5% exonucleo lytic single-strand degradation activity.
  • the exonuclease can be originated from prokaryotes, such as E. coli exonucleases, or eukaryotes, such as yeast, worm, murine, or human exonucleases.
  • the systems can further comprise an exonuclease or a vector or nucleic acid encoding an exonuclease.
  • the exonuclease is Trex2.
  • the methods can further comprise providing exonuclease or a vector or nucleic acid encoding an exonuclease, such as Trex2.
  • a“guide” as described herein has its plain and ordinary meaning when read in light of the specification, and may include but is not limited to, for example, any polynucleotide that site-specifically guides a nuclease to a target nucleic acid sequence.
  • a guide comprises RNA, DNA, or combinations of RNA and DNA.
  • Exemplary guide RNAs useful with the alternatives described herein, which may contain one or more of the modified bases set forth herein are provided in sequence as set forth in SEQ ID NO: 12.
  • A‘‘genomic region” is a segment of a chromosome in the genome of a host cell that is present on either side of the target nucleic acid sequence site or, alternatively, also comprises a portion of the target site.
  • the homology arms of the donor polynucleotide have sufficient homology to undergo homologous recombination with the corresponding genomic regions.
  • the homology arms of the donor polynucleotide share significant sequence homology to the genomic region immediately flanking the target site; it is recognized that the homology arms can be designed to have sufficient homology to genomic regions farther from the target site.
  • NHEJ non-homolog ous end joining
  • “cleavage site” refers to a sequence that mediates the separation of a first polypeptide that would otherwise be in cis to a second polypeptide. Accordingly, for simplicity,“cleavage,”“cleavage site,” and the like as used herein refer to the separation of any two polypeptides that are encoded by a single polynucleotide in cis. Thus, “cleavage” and“cleavage site,” can, but do not necessarily refer to proteolytic sites and events, and can also refer to other mechanisms for mediating the separation of polypeptides, for example ribosomal skipping.
  • Cleavage can be initiated by a variety of methods including, but not limited to, enzymatic or chemical hydrolysis of a phosphodiester bond. Both single- stranded cleavage and double-stranded cleavage are possible, and double-stranded cleavage can occur as a result of two distinct single-stranded cleavage events. Double stranded DNA, RNA, or DNA/RNA hybrid cleavage can result in the production of either blunt ends or staggered ends.
  • the term“complementary to” means that the complementary sequence is homologous to all or one or more portions of a reference polynucleotide sequence.
  • the nucleotide sequence “CATTAG” corresponds to a reference sequence “CATTAG” and is complementary to a reference sequence“GTAATC.”
  • the term“label” refers to a detectable molecule.
  • a number of suitable labels comprise polypeptides.
  • a“label nucleic acid” refers to a nucleic acid encoding a label.
  • the AAV vector systems comprise a label polynucleotide.
  • a promoter (such as an MND promoter) is operatively linked to a label polynucleotide, such that the AAV vectors described herein comprise a reporter.
  • Example labels that are suitable in accordance with alternatives herein include, but are not limited to, green fluorescent protein (GFP), including, for example, Aequoria victoria GFP, Renilla muelleri GFP, Renilla reniformis GFP, Renilla ptilosarcus, blue fluorescent protein (BFP), yellow fluorescent protein (YFP), red fluorescent protein (RFP), cyan fluorescent protein (CFP), or orange fluorescent proteins (OFP).
  • GFP green fluorescent protein
  • BFP blue fluorescent protein
  • YFP yellow fluorescent protein
  • RFP red fluorescent protein
  • CFP cyan fluorescent protein
  • OFP orange fluorescent proteins
  • Additional reporter genes include, but are not limited to neomycin, phosphoro-transferase, chloramphenicol acetyl transferase, thymidine kinase, luciferase, b-glucuronidase, aminoglycoside, phosphotransferase, hygromycin B, xanthine-guanine phosphoribosyl, luciferases (e.g., renilla, firefly, etc.), DHFR/methotrexate, b-galactosidase, alkaline phosphatase, turbo and/or tagRFP, or nuclear targeted versions of any of the aforementioned reporter genes.
  • neomycin phosphoro-transferase
  • chloramphenicol acetyl transferase thymidine kinase
  • luciferase b-glucuronidase
  • aminoglycoside aminoglycoside
  • the polypeptide of interest comprises the label itself, for example when production of label in active cells is desired.
  • an AAV construct provided herein comprises an MND promoter driven GFP cassette and wherein the MND promoter driven GFP cassette provides for tracking of AAV transduction efficiency.
  • gene expression as described herein, has its plain and ordinary meaning when read in light of the specification, and may include but is not limited to, for example, biosynthesis of a gene product.
  • gene expression involves transcription of the structural gene into mRNA and the translation of mRNA into one or more polypeptides.
  • A“polypeptide” is a polymer of amino acid residues joined by peptide bonds, whether produced naturally or synthetically. Polypeptides of less than about 10 amino acid residues are commonly referred to as“peptides.” A polypeptide can be considered as a protein.
  • A“protein” is a macromolecule comprising one or more polypeptide chains.
  • a protein may also comprise non-peptide components, such as carbohydrate groups. Carbohydrates and other non-peptide substituents may be added to a protein by the cell in which the protein is produced, and will vary with the type of cell. Proteins are defined herein in terms of their amino acid backbone structures; substituents such as carbohydrate groups are generally not specified, but may be present nonetheless.
  • a system for editing at least one target gene in a cell comprising a first nucleic acid sequence encoding a CRISPR guide RNA, wherein the CRISPR guide RNA is complimentary to at least one target gene in a cell and, wherein said first nucleic acid sequence is present in a vector; said system also comprising a second nucleic acid sequence encoding a Cas9 protein, a third nucleic acid sequence encoding a first adenoviral protein and a fourth nucleic acid sequence encoding a second adenoviral protein.
  • Amino acid sequences may be described herein with a SEQ ID NO, and are described throughout the application and included in Appendix I.
  • an amino acid sequence described herein is 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical, or is within a range defined by any two of the aforementioned percentages, to a sequence of any one of SEQ ID NOs : 10- 11.
  • X-linked hyper-immunoglobulin M (IgM) syndrome arises in humans carrying mutations in CD40LG, and is characterized by recurrent infections, low serum immunoglobulins G, A, and E (IgG, IgA, and IgE) with normal or elevated IgM levels, reduced numbers of memory B cells, and the absence of class-switched memory B cells (FIG. 1).
  • a genetic therapy that could reconstitute CD40L function to the appropriate hematopoietic lineages could greatly improve treatment options for these patients.
  • a gene therapy may provide clinical benefit even with a relatively low percentage of corrected cells (Hollenbaugh, D., et al, The Journal of clinical investigation, 1994. 94(2): p. 616-622; de Saint Basile, G., et al, European journal of immunology, 1999. 29(1): p. 367-373).
  • CD40:CD40 ligand (CD40L) co-stimulatory signals play an essential role in cross-talk between B cells and T cells upon antigen recognition (Banchereau, J., et al, Annual review of immunology, 1994. 12(1): p. 881-926; Foy, T.M., et al., Annual review of immunology, 1996. 14(1): p. 591-617; Elgueta, R., et al., Immunol Rev, 2009. 229(1): p. 152- 72).
  • CD40L is expressed primarily on activated T cells, but is also expressed by other immune cells such as dendritic cells and macrophages under inflammatory conditions, while CD40 is constitutively expressed on B cells (Schonbeck, El. and P. Libby, The CD40/CD154 receptor/ligand dyad. Cellular and Molecular Life Sciences CMLS, 2001. 58(1): p. 4-43; van Kooten, C. and J. Banchereau, Current opinion in immunology, 1997. 9(3): p. 330-337).
  • Activation of CD40 by CD40L is an essential step of B cell development, promoting B cell proliferation and acting as a critical checkpoint for immunoglobulin class switching and somatic hypermutation (Clark, E.A.
  • some alternatives provided herein relate to treating, ameliorating, inhibiting, or improving X-HIGM using a therapeutic genome editing approach.
  • systems and methods for the introduction of an intact CD40LG cDNA under control of the endogenous promoter and enhancer in HSPCs are provided.
  • the systems and methods described herein rescue immunologic and functional defects in CD40L and provide a curative therapy.
  • Some alternatives relate to a homology directed repair-based gene editing approach in CD34 + hematopoietic stem cells, wherein a cDNA encoding CD40L is under control of the endogenous promoter.
  • GFP-expressing CD34 + cells were transplanted into immunodeficient mice.
  • the transplanted human cells constituted a substantial proportion of the cells recovered from the mouse bone marrows, with 1.5% of them containing the desired edit.
  • the recovered edited cells included cells of different lineages including myeloid, B, and CD34 + cells.
  • the disclosure provided herein relates to methods, systems, and compositions for efficient culturing and editing the CD40LG locus of human peripheral blood HSPCs, and the engraftment of edited pluripotent stem cells in immunodeficient mice.
  • the efficiency of AAV-assisted HDR in human hematopoietic stem cells is shown between two nuclease platforms: Cas9 RNP and TALEN.
  • the RNP guide RNA (gRNA) was designed to target Cas9 cleavage to within 15 bp of that of the TALEN in order to compare the nucleases using the same donor template.
  • the AAV6 donor was designed to deliver an MND promoter-GFP expression cassette with 1 kb of CD40LG homology on either side (FIG. 2) (Challita, P.-M., et al, Journal of virology, 1995. 69(2): p. 748-755).
  • the CD40LG homology arms in the targeting construct had the TALEN and Cas9 gRNA binding sites deleted, rendering it non-cleavable by both nucleases.
  • Some alternatives concern methods for using adult mobilized CD34 + cells and co-delivery of either TALEN mRNA or Cas9/gRNA ribonucleoprotein complexes (RNPs) and an AAV donor for targeted integration of a promoter-driven fluorescent marker.
  • RNPs Cas9/gRNA ribonucleoprotein complexes
  • the methods provided herein achieve efficient homology directed repair rates across multiple donors at an efficiency of 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 60%, 70%, 80%, or greater, or an efficiency within a range defined by any two of the aforementioned values for TALEN and an efficiency of 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 60%, 70%, 80%, or greater, or an efficiency within a range defined by any two of the aforementioned values for RNP.
  • the highest levels of cell viability is observed using RNP/AAV co-delivery.
  • edited HSC retain their potential to give rise to multiple lineages in colony forming unit assays.
  • the systems provided herein provide long-term engraftment and differentiation potential in immune-deficient mice.
  • AAV vectors carrying CD40LG cDNA restore expression in CD40LG deficient cells.
  • the systems and methods described herein provide therapeutic correction of the disease or a disease symptom in patients. Homology Directed Repair
  • HDR Homology directed repair
  • a homologous nucleic acid e.g., a sister chromatid or an exogenous nucleic acid
  • HDR typically involves a series of steps such as recognition of the break, stabilization of the break, resection, stabilization of single stranded DNA, formation of a DNA crossover intermediate, resolution of the crossover intermediate, and ligation.
  • HDR can be used to alter a target sequence and correct (e.g., repair or edit) a mutation in the genome. While not wishing to be bound by theory, it is believed that alteration of the target sequence occurs by HDR with a donor template or template nucleic acid. For example, the donor template or the template nucleic acid provides for alteration of the target position.
  • the gene is a CD40LG gene.
  • the method comprises HDR of the CD40LG gene in human hematopoietic cells.
  • the method and systems include nuclease- based HDR of the CD40LG gene.
  • the nuclease based HDR comprises a TALEN based nuclease.
  • the nuclease based HDR comprises a CRISPR/Cas based nuclease.
  • TALEN Transcription activator-like effector-DNA modifying enzyme
  • TALENs are made by fusing a TAL-effector domain to a DNA cleavage domain.
  • the CD40LG locus used in targeting with CD40LG TALENs is co-delivered with an AAV donor.
  • the CD40LG TALEN forward sequence is defined by SEQ ID NO: 10 and 21.
  • the CD40LG TALEN reverse sequence is defined by SEQ ID NO: 11 and 22.
  • a forward sequence and/or the reverse sequence is 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical, or is within a range defined by any two of the aforementioned percentages, to a sequence of any one of SEQ ID NO: 10, 21, 11, or 22.
  • the AAV donor comprises a GFP cassette under control of an MND promoter.
  • the AAV donor has a 1 kb homology arm flanking an MND promoter driven GFP cassette (SEQ ID NO: 14).
  • the AAV donor comprises one or more nucleotide mutations to abolish cleavage by TALENs and guide sequences as set forth in SEQ ID NOs: 14 and 15.
  • a nucleotide sequence of the MND promoter is 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical, or is within a range defined by any two of the aforementioned percentages, to a sequence of any one of SEQ ID NOs: 14 or 15.
  • TALEN nuclease for use in HDR of a CD40LG gene (SEQ ID NO: 13).
  • the TALEN binds to a TALEN binding site in the CD40LG gene.
  • a CD40LG TALEN binds to native CD40LG sequence (SEQ ID NO: 13).
  • a nucleotide sequence of the CD40LG gene is 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical, or is within a range defined by any two of the aforementioned percentages, to a sequence of any one of SEQ ID NO: 13.
  • the CD40LG locus used in targeting with CD40LG TALENs comprises the following components from 5’ to 3’: upstream homology arm (SEQ ID NO: 18); exon 1 (SEQ ID NO: 26), including a guide RNA (SEQ ID NO: 12); T-for (TALEN forward binding site; SEQ ID NO: 23); cleavage site (SEQ ID NO: 25); T-rev (TALEN reverse binding site; SEQ ID NO: 24); exon 2 (SEQ ID NO: 27); and downstream homology arm (SEQ ID NO: 19).
  • upstream homology arm SEQ ID NO: 18
  • exon 1 SEQ ID NO: 26
  • SEQ ID NO: 12 including a guide RNA (SEQ ID NO: 12); T-for (TALEN forward binding site; SEQ ID NO: 23); cleavage site (SEQ ID NO: 25); T-rev (TALEN reverse binding site; SEQ ID NO: 24); exon 2 (SEQ ID NO: 27); and downstream homology arm (SEQ ID NO:
  • a nucleotide sequence of any one of the aforementioned components is 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical, or is within a range defined by any two of the aforementioned percentages, to a sequence of any one of the respective SEQ ID NOs, including SEQ ID NO: 18, SEQ ID NO: 26, SEQ ID NO: 12, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 24, SEQ ID NO: 27, and SEQ ID NO: 19 respectively.
  • the CD40LG locus used in targeting with CD40LG TALENs is co-delivered with an AAV donor.
  • the CD40LG TALEN forward sequence is defined by SEQ ID NO: 10.
  • the CD40LG TALEN reverse sequence is defined by SEQ ID NO: 11.
  • the AAV donor comprises a GFP cassette under control of an MND promoter.
  • the AAV donor has a 1 kb homology arm flanking an MND promoter driven GFP cassette (SEQ ID NO: 14).
  • the AAV donor comprises one or more nucleotide mutations to abolish cleavage by TALENs and guide sequences as set forth in SEQ ID NOs: 14 and 15.
  • Cas nuclease for use in HDR of a gene of interest.
  • the Cas nuclease is a Cas9 nuclease.
  • Cas9 is an RNA-guided DNA endonuclease enzyme associated with the CRISPR (Clustered Regularly Interspersed Palindromic Repeats) adaptive immunity system in Streptococcus pyogenes, among other bacteria.
  • CRISPR Clustered Regularly Interspersed Palindromic Repeats
  • S. pyogenes utilizes Cas9 to memorize and later interrogate and cleave foreign DNA, such as invading bacteriophage DNA or plasmid DNA. Cas9 performs this interrogation by unwinding foreign DNA and checking for if it is complementary to the 20 base pair spacer region of the guide RNA. If the DNA substrate is complementary to the guide RNA, Cas9 cleaves the invading DNA.
  • the Cas nuclease is delivered in a complex with a single guide RNA as a ribonucleoprotein complex (RNP).
  • RNP ribonucleoprotein complex
  • the CRISPR guide sequence is defined by SEQ ID NO: 12.
  • the RNP is co-delivered with an AAV donor.
  • the AAV donor is a self-complementary AAV (scAAV).
  • the AAV donor comprises a GFP cassette under control of an MND promoter wherein a protospacer adjacent motif (PAM) site is deleted.
  • the nucleic acid includes a single guide RNA (sgRNA) such as one that is encoded by any one of SEQ ID NO: 12.
  • sgRNA single guide RNA
  • the nucleotide sequence encoding the sgRNA is 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical, or within a range defined by any two of the aforementioned percentages, to a sequence of SEQ ID NO: 12.
  • the cell is a mammalian cell. In some alternatives, the cell is a human cell. In some alternatives, the cell is an autologous cell. In some alternatives, the cell is a primary cell. In some alternatives, the cell is a lymphocyte. In some alternatives, the cell is not a transformed cell. In some alternatives, the cell is a primary lymphocyte. In some alternatives, the cell is a lymphocyte precursor cell. In some alternatives, the cell is a T cell. In some alternatives, the cell is a hematopoietic cell. In some alternatives, the cell is a CD34 + cell. In some alternatives, the cell is a primary human hematopoietic cell.
  • the cell is transformed by co-delivery of a nuclease, such as a TALEN nuclease or Cas nuclease, and an AAV donor template to modify endogenous CD40LG locus in a cell.
  • a nuclease such as a TALEN nuclease or Cas nuclease
  • a method of editing a CD40LG gene in a cell comprises introducing into a cell a first vector that comprises a first nucleic acid sequence encoding a guide RNA, such as a TALEN guide RNA or a CRISPR guide RNA, wherein the guide RNA is complimentary to at least one target gene in said cell, and introducing into said cell a second nucleic acid sequence encoding a nuclease, such as a TALEN nuclease or a Cas nuclease, a derivative, or fragment thereof.
  • a cell is provided, wherein the cell is manufactured by the said methods.
  • the method includes providing to the cell one or more of the nucleic acid compositions described herein such as a sequence in accordance with, or encoded by, one or more of SEQ ID NOS: 1-27, or, for example, a sequence that is 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical, or within a range defined by any two of the aforementioned percentages, to a sequence in accordance with, or encoded by, any one of SEQ ID NOS: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, and/or 27.
  • the method comprises selecting or identifying a subject in need thereof.
  • a selected or identified subject in need thereof is a subject that presents with symptoms of X-HIGM, or a subject that has been diagnosed with X-HIGM. Such evaluations can be made clinically or by diagnostic test.
  • the method comprises adoptive cellular therapy or adoptive cell transfer of treated cells to a subject in need.
  • adoptive cellular therapy or adoptive cell transfer comprises administering cells for promoting homology directed repair of a CD40LG gene in a subject.
  • the method comprises obtaining cells from the subject in need thereof.
  • the cells from the subject in need are primary human hematopoietic cells.
  • the cells are transformed by co-delivery of a nuclease, such as a TALEN nuclease or a Cas nuclease, and an AAV donor, which modifies the endogenous CD40LG locus in the cell.
  • the method comprises expanding the transformed cells.
  • the method comprises selecting transformed cells that have successful modification of the CD40LG locus in the cell.
  • the transformed cells are administered to the patient.
  • administration of the transformed cells to the patient comprises administration of autologous cells to the patient. In some alternatives, administration of the transformed cells to the patient treats, inhibits, or ameliorates symptoms of X-HIGM. In some alternatives, administration of the transformed cells to the patient treats X-HIGM. In some alternatives, the method reduces bacterial or opportunistic infections. In some alternatives, the method reduces intermittent neutropenia.
  • an amount of treated cells is administered as a composition.
  • the amount of cells administered is 1 X 10 4 , 2 X 10 4 , 3 X 10 4 ,
  • the treated cells are administered to a subject as a co therapy with an additional therapy that is used to treat the symptoms of the disorder or used to treat the disorder.
  • the additional therapy includes immunoglobulin therapy, an antibiotic therapy, an antimicrobial therapy, bone marrow stimulation therapy (such as a granulocyte-colony stimulating factor (G-CSF) therapy), bone marrow transplantation therapy, corticosteroid therapy, or transfusion therapy.
  • G-CSF granulocyte-colony stimulating factor
  • Cells prepared by the systems or methods provided herein can be administered directly to a patient for targeted homology directed repair of a CD40LG locus and for therapeutic or prophylactic applications, for example, for treating, inhibiting, or ameliorating X-HIGM.
  • cells are prepared by the systems provided herein.
  • a composition is provided, wherein the composition comprises the cell.
  • the compositions described herein can be used in methods of treating, preventing, ameliorating, or inhibiting X-HIGM or ameliorating a disease condition or symptom associated with X-HIGM.
  • compositions comprising the cells are administered in any suitable manner, and in some alternatives with pharmaceutically acceptable carriers. Suitable methods of administering such compositions comprising the cells are available and well known to those of skill in the art, and, although more than one route can be used to administer a particular composition, a particular route can often provide a more immediate and more effective reaction than another route.
  • compositions are determined in part by the particular composition being administered, as well as, by the particular method used to administer the composition. Accordingly, there is a wide variety of suitable formulations of pharmaceutical compositions that are available (see, e.g., Remington’s Pharmaceutical Sciences).
  • Formulations suitable for parenteral administration include aqueous and/or non-aqueous, isotonic sterile injection solutions, which can contain antioxidants, buffers, bacteriostats, and/or solutes that render the formulation isotonic with the blood of the intended recipient, and/or aqueous and/or non-aqueous sterile suspensions that can include suspending agents, solubilizers, thickening agents, stabilizers, and/or preservatives.
  • the disclosed compositions can be administered, for example, by intravenous infusion, orally, topically, intraperitoneally, intravesically or intrathecally.
  • the formulations of compounds can be presented in unit-dose or multi-dose sealed containers, such as ampules or vials.
  • Injection solutions and suspensions can be prepared from sterile powders, granules, and/or tablets of the kind previously described.
  • Some embodiments of the methods and compositions provided herein include methods for editing an CD40LG gene in a cell. Some such embodiments, include (i) introducing a polynucleotide encoding a guide RNA (gRNA) into the cell, or introducing a polynucleotide encoding a TALEN in the cell, and (ii) introducing a template polynucleotide into the cell.
  • the CD40LG gene has at least 95% identity with the nucleotide sequence of SEQ ID NO: 13.
  • the gRNA comprises a nucleic acid having at least about 85%, 90%, 95%, 99% or 100% identity to the nucleotide sequence of SEQ ID NO: 12.
  • introducing a polynucleotide encoding a gRNA into the cell comprises contacting the cell with a ribonucleoprotein (RNP) comprising a CAS9 protein and the polynucleotide encoding the gRNA.
  • RNP ribonucleoprotein
  • the RNP comprises the CAS9 protein and the polynucleotide encoding the gRNA having a ratio between 0.1 : 1 and 1 : 10, a ratio between 1 : 1 and 1 : 5, or a ratio of about 1 : 1.2.
  • the template polynucleotide encodes at least a portion of the CD40LG gene, or complement thereof. In some embodiments, the template polynucleotide encodes at least a portion of a wild-type CD40LG gene, or complement thereof. In some embodiments, the template polynucleotide comprises at least or at least about 1 kb of the CD40LG gene. In some embodiments, the template polynucleotide comprises a nucleic acid having at least 95% identity to the nucleotide sequence of SEQ ID NO: 15. In some embodiments, the template polynucleotide comprises the nucleotide sequence of SEQ ID NO: 15.
  • a viral vector comprises the template polynucleotide.
  • the vector is an adeno-associated viral (AAV) vector. In some embodiments, the vector is a self-complementary AAV (scAAV) vector.
  • AAV adeno-associated viral
  • scAAV self-complementary AAV
  • step (i) is performed before step (ii). In some embodiments, steps (i) and (ii) are performed simultaneously. In some embodiments, steps (i) and/or (ii) comprise performing nucleofection. In some embodiments, performing nucleofection comprises use of a LONZA system. In some embodiments, the system comprises use of a square wave pulse.
  • Some embodiments also include contacting the cell with IL-6.
  • the IL-6 has a concentration from about 20 ng/ml to about 500 mg/ml or 20 ng/ml to 500 mg/ml, from about 50 ng/ml to about 150 mg/ml or 50 ng/ml to 150 mg/ml, or of about 100 mg/ml or 100 mg/ml.
  • the IL-6 has a concentration of at least or at least about 1 ng/ml, 10 ng/ml, 50 ng/ml, 100 ng/ml, 200 ng/ml, 500 ng/ml, or a concentration within a range of any two of the foregoing concentrations.
  • the cell is incubated in a Serum-Lree Expansion Medium II (SEEMII) medium.
  • SEEMII Serum-Lree Expansion Medium II
  • a population of cells comprises the cell, the population having a concentration from about 1 X 10 5 cells/ml to about 1 X 10 6 cells/ml or 1 X 10 5 cells/ml to 1 X 10 6 cells/ml, from about 1 X 10 5 cells/ml to about 5 X 10 5 cells/ml or 1 X 10 5 cells/ml to 5 X 10 5 cells/ml, or from about 2.5 X 10 5 cells/ml or 2.5 X 10 5 cells/ml.
  • the population of cells has a density less than or less than about 2,000,000 cells/ml, 1,000,000 cells/ml, 500,000 cells/ml, 250,000 cells/ml, 100,000 cells/ml, 50,000 cells/ml, 10,000 cells/ml, 1000 cells/ml, or a density within a range of any two of the foregoing densities.
  • Some embodiments also include diluting the population of cells after steps (i) and (ii) are performed. In some embodiments, the population of cells is diluted about 16 hours or 16 hours after steps (i) and (ii) are performed. In some embodiments, the population of cells is diluted to about 250,000 cells/ml or 250,000 cells/ml. In some embodiments, the population of cells is diluted to less than or less than about 2,000,000 cells/ml, 1,000,000 cells/ml, 500,000 cells/ml, 250,000 cells/ml, 100,000 cells/ml, 50,000 cells/ml, 10,000 cells/ml, 1000 cells/ml, or a density within a range of any two of the foregoing densities.
  • Some embodiments also include contacting the cell with stem cell factor (SCF), FMS-like tyrosine kinase-3 (Flt-3), thrombopoietin (TPO), a TPO receptor agonist, UM171, or stemregenin (SR1).
  • SCF stem cell factor
  • Flt-3 FMS-like tyrosine kinase-3
  • TPO thrombopoietin
  • SR1 stemregenin
  • the TPO receptor agonist comprises Eltrombopag.
  • steps (i) and/or (ii) comprise contacting the cell with an HDM2 protein.
  • the HDM2 protein has a concentration from about 1 nM to about 50 nM or 1 nM to 50 nM, or from about 6.25 nM to about 25 nM or 6.25 nM to 25 nM.
  • the HDM2 protein has a concentration of at least or at least about 1 nM, 10 nM, 20 nM, 30 nM, 40 nM, 50 nM, 100 nM, 200 nM, 500 nM, 1000 nM, or a concentration within a range of any two of the foregoing concentrations.
  • the cell is contacted with at least or at least about 1000 MOI of the AAV, or at least or at least about 2500 MOI of the AAV.
  • the cell or a population of cells comprising the cell is contacted with an amount or concentration of AAV of at least or at least about 10 MOI, 100 MOI, 200 MOI, 500 MOI, 1000, 2000, 5000 MOI, or 10000 MOI, or an amount or concentration within a range of any two of the foregoing numbers.
  • the cell is contacted with at least or at least about 100 pg/ml of the RNP, or at least or at least about 200 pg/ml of the RNP. In some embodiments, the cell is contacted with RNP having a concentration of at least or at least about 1 pg/ml, 10 pg/ml, 100 pg/ml, 200 pg/ml, 500 pg/ml, or 1000 pg/ml, or a concentration within a range of any two of the foregoing concentrations.
  • steps (i) and/or (ii) comprise contacting about 1,000,000 cells /20 pl nucleofection reaction or 1,000,000 cells /20 pl nucleofection reaction, wherein the nucleofection reaction comprises the gRNA and/or the template polynucleotide.
  • the nucleofection reaction is performed in a volume of at or about 10 pl, 50 pl, 100 pl, 200 pl, 500 pl, 1000 pl, 1500 pl, 2000 pl, 50000 pl, or a volume within a range of any two of the foregoing volumes.
  • the cell is mammalian. In some embodiments, the cell is human In some embodiments, the cell is a primary cell. In some embodiments, the cell is a hematopoietic stem cell (HSC). In some embodiments, the cell is a T cell or a B cell. In some embodiments, the cell is a CD34+ cell. In some embodiments, the cell is ex vivo.
  • HSC hematopoietic stem cell
  • the cell is a T cell or a B cell.
  • the cell is a CD34+ cell. In some embodiments, the cell is ex vivo.
  • Non-obese diabetic (NOD) scid gamma mice mice were purchased from Jackson Laboratory. All animal studies were performed according to the Association for Assessment and Accreditation of Laboratory Animal Care (AAALAC) standards and were approved by the SCRI Institutional Animal Care and Use Committee (IACUC). Six to 10 week old mice were treated with 25 or 35 mg/kg of BUSULFEX (Henry Schein Inc.) via intraperitoneal injection, diluted 1 : 1 in phosphate-buffered saline. Twenty-four hours later, 2 x 10 6 mock or gene edited hematopoietic stem cells in phosphate-buffered saline were delivered via retro-orbital injection. Animals were euthanized 12 to 16 weeks post- transplant, and femurs and spleens were analyzed for engraftment of human cells.
  • CD34 + hematopoietic stem/progenitor cells Ex vivo culture of CD34 + hematopoietic stem/progenitor cells. Cryopreserved CD34 + cells enriched from PBMC mobilized adult donors were obtained from the Core Center for Excellence in Hematology at the Fred Hutchinson Cancer Research Center. Cells were thawed and plated at 1 x 10 6 cells/ml in serum- free stem cell growth media [CellGenix GMP SCGM medium (CellGenix Inc.) with thrombopoietin, stem cell factor, and FLT3 ligand (PeproTech) all at 100 ng/ml]. Either IL-3 (60 ng/ml) or IL-6 (100 ng/ml) was added to the media as noted.
  • Cryopreserved CD34 + cells enriched from PBMC mobilized adult donors were obtained from the Core Center for Excellence in Hematology at the Fred Hutchinson Cancer Research Center. Cells were tha
  • the small molecules StemRegenin 1 (STEMCELL Technologies), UM171 (ApexBio), and eltrombopag (Selleckchem) were added to the stem cell growth media used throughout entire experiment at 1 mM, 35 nM, and 3 pg/ml respectively.
  • CD34 + hematopoietic stem/progenitor cells were pre-stimulated in stem cell growth media with cytokine for 48 hours at 37°C, then electroporated with the Neon Transfection System and 10-m1 tip (Thermo Fisher Scientific). Cells were dispensed into a 24 well plate containing 400 pL of media with donor template AAV at MOI between 1000 and 5000. Twenty-four hours after electroporation and AAV transduction, AAV containing media was removed and replaced with fresh stem cell growth media. Analysis of viability and GFP was performed at days 2 and 5 after editing.
  • stem cell phenotype (CD34 + CD38 CD90 + CDl33 + ) was performed at 24 or 48 hours after editing.
  • the same editing conditions were used except for the following changes: 100 pL Neon tips were used for electroporations, with identical concentrations of cells and nuclease. Cells were dispensed into 4mL of media containing AAV in a 6 well plate. Twenty-four hours later, cells were collected and washed twice with PBS prior to injection.
  • AAV stocks were produced as previously described (Khan, I.F., R.K. Hirata, and D.W. Russell, Nat Protoc, 2011. 6(4): p. 482-501).
  • the AAV vector, serotype helper, and adenoviral helper (HgTl-adeno) plasmids were transfected in to HEK293T cells. Cells were collected 48 hours later and lysed by 3 freeze-thaw cycles. The lysate was subsequently treated with benzonase and purified over iodixanol density gradient.
  • Titers of the viral stocks were determined by qPCR of AAV genomes using inverted terminal repeat (ITR)-specific primers and probe (Aurnhammer, C, et al., Hum Gene Ther Methods, 2012. 23(1): p. 18-28).
  • ITR inverted terminal repeat
  • a pAAV. CD40L. cDNA. WPRE3 (SEQ ID NO: 15) donor template was designed with lkb regions of homology flanking a codon-optimized CD40L, truncated Woodchuck Hepatitis Virus Post-transcriptional Regulatory Element 3 (WPRE3), and late SV40 polyadenylation signal containing an additional upstream sequence element (Choi, J - H, et al., Molecular brain, 2014. 7(1): p. 17).
  • the full CD40L.cDNA.WPRE3.synPolyA was gene synthesized (GeneArt), and cloned into a pAAV backbone with two flanking lkb regions of homology to the CD40LG locus by Infusion cloning (Clontech).
  • Neon Buffer T a composition of cells that is resuspended in Neon Buffer T such that, after addition of Cas9 RNP (100 or 200 pg of Cas9 protein/ml of total reaction volume) or mRNA (50 pg each CD40L TALEN/ml of total reaction volume), the final concentration is 2.5 x 10 7 cells/ml. After mixing with nuclease, 2.5 x 10 5 cells are electroporated (1400 V, 20 ms, one pulse) per 10 pL Neon tip.
  • Cas9 RNP 100 or 200 pg of Cas9 protein/ml of total reaction volume
  • mRNA 50 pg each CD40L TALEN/ml of total reaction volume
  • Genomic DNA was isolated from hematopoietic stem and progenitor cells (HSPCs) using a DNeasy Blood and Tissue kit (Qiagen).
  • HSPCs hematopoietic stem and progenitor cells
  • Qiagen DNeasy Blood and Tissue kit
  • a control amplicon of similar size (1.3 kb) was generated for the ActB gene (SEQ ID NO: 17) to serve as a control.
  • Probes for both amplicons were labeled with FAM and the reactions were performed in separate wells. Two duplicates were performed in separate wells for each HDR and control reaction.
  • the PCR reactions were partitioned into droplets using a QX200 Droplet Generator (Bio-Rad). Amplification was performed using ddPCR Supermix for Probes without EGTR (Bio-Rad), 900 nM of primers, 250 nM of Probe, 50 ng of genomic DNA, and 1% DMSO. Droplets were analyzed using the QX200 Droplet Digital PCR System (Bio-Rad) and analyzed using QuantaSoft software (Bio-Rad). As CD40LG resides on the X chromosome, the editing rates from male donor cells were calculated as a ratio of copies/m! from CD40LG/ActB positive droplets multiplied by 2.
  • CD34-APCCy7 (clone 581, BioLegend)
  • CD38- PerCPCy5.5 (clone FHT2, BD Biosciences)
  • CD90-APC (clone 5E10, BD Biosciences)
  • CD133-PE clone AC133, Miltenyi Biotec
  • mRNA synthesis [0189] mRNA synthesis.
  • pEVL CD40LG. TALEN (SEQ ID NOs: 21 and 22) constructs were linearized using Bsal. In vitro transcription and 5 '-capping were performed using the T7 mScript Standard mRNA production System (Cellscript) according to manufacturer’s protocols. Linearized template was in vitro transcribed into unmodified mRNA transcripts and capped (5'-7-methylguanylate cap) with cap-l mRNA structure (2’-0- methyltransferase) using provided enzymes. Final purification was performed using NucleoSpin RNA Clean-up kit (Machery Nagel).
  • CD40LG TALENs were identical to those previously described in Hubbard et al, except that they were cloned into a pEVL backbone (SEQ ID NO: 20) rather than a pUC57 backbone (Hubbard, N., et al., Blood, 2016. 127(21): p. 2513-22; Grier, A.E., et al., Molecular Therapy-Nucleic Acids, 2016. 5).
  • CRISPR sgRNA (SEQ ID NO: 12) was designed to generate a double- stranded break (DSB) as close to as possible to the DSB site generated by the CD40LG TALEN pair so as not to bias the comparison of the two nuclease platforms.
  • the synthetic sgRNA (5' - AAAGUUGAAAUGGUAUCUUC - 3', SEQ ID NO:28) was purchased from Synthego (Pleasanton, CA), and was chemically modified with 2'-0-methyl analogs and 3' phosphorothioate internucleotide linkages between the three terminal nucleotides both the 5' and 3' ends.
  • Cas9 RNP was made by incubating Cas9 protein (Integrated DNA Technologies) with sgRNA at a 1 : 1.2 molar ratio for 15 minutes immediately prior to electroporation.
  • Cas9 protein Integrated DNA Technologies
  • sgRNA Integrated DNA Technologies
  • This example demonstrates methods for introducing a GFP reporter at the CD40LG locus in CD34+ hematopoietic stem cells.
  • aspects of the systems, methods, and compositions described herein relate to improving the efficiency for editing blood mobilized CD34 + cells enriched from healthy donors, including cytokine pre-stimulatory conditions, optimal cell density, electroporation conditions, and the relative timing of AAV and nuclease delivery (FIG. 3).
  • Frozen CD34 + cells were thawed and cultured for 48 hours, before dual delivery of nuclease and AAV. Two days after dual delivery of AAV6 donor template and either TAFEN or RNP nuclease, cells were isolated and delivery was analyzed (FIG. 3).
  • cells treated with AAV/RNP did not differ in total colony number or colony type compared to mock treated cells (FIG. 6A and FIG. 6B) as determined by methylcellulose colony forming unit (CFFT) assay.
  • CFFT methylcellulose colony forming unit
  • the percentage of HDR-edited colonies is not skewed by colony type, and is similar to the percentage of GFP + colonies detected by flow cytometry (FIG. 6C, FIG. 6C, FIG. 6D). Due to increased viability and rates of HDR by RNP compared to TAFEN, all subsequent experiments were performed using RNP nuclease.
  • Example 2 Cytokine conditions for HDR in hematopoietic stem cells
  • This example demonstrates methods for modulating cytokine response for HDR in hematopoietic stem cells.
  • Two cytokine cocktails for use in ex vivo culturing for CD34 + cells were tested. Both cocktails included 100 ng/ml of stem cell factor (SCF), FMS- like tyrosine kinase-3 (Flt-3), and thrombopoietin (TPO), to which either 60 ng/ml or interleukin-3 (IF-3) or 100 ng/ml of interleukin-6 (IF-6) were added to promote cell expansion.
  • SCF stem cell factor
  • TPO thrombopoietin
  • IF-3 interleukin-3
  • IF-6 interleukin-6
  • This example demonstrates methods for efficient incorporation of CD40L cDNA downstream of endogenous CD40LG promoter.
  • This example demonstrates endogenous promoter-driven expression of CD40L cDNA for therapeutic purposes.
  • T cells edited with CD40L cDNA introduced downstream of the endogenous promoter demonstrate equivalent surface expression of CD40L as non-edited cells (Hubbard, N., et al., Blood, 2016. 127(21): p. 2513-22).
  • an AAV donor template SEQ ID NO: 15
  • CD40L cDNA was successfully introduced downstream of the endogenous CD40LG promoter.
  • This example demonstrates methods for engraftment of edited cells in the bone marrow of NSG mice.
  • the cells were transplanted into NOD-scid-IL2Rg NULL (NSG) mice to determine the long-term repopulation potential of edited cells.
  • the MND.GFP reporter construct was used to edit these cells in order to easily track, and determine the phenotype of edited cells.
  • editing reagents were used at either a“high dose” (2.5K MOI AAV and 200 pg/ml RNP) or“low dose” (1K MOI AAV and 100 pg/ml RNP).
  • mice transplanted with low-dose edited cells showed minimal reduction in the percentage of splenic hCD45 + cells (27.4% vs. 36%) compared to mice receiving untreated cells (FIG. 14A, FIG. 14B, FIG. 14C, FIG. 14D).
  • the spleens of mice transplanted with high- dose edited cells consisted of 13.1% hCD45 + cells.
  • the GFP-expressing fraction of hCD45 + cells was 0.9% in mice receiving high dose edited cells, while mice receiving low dose edited cells only had 0.03% GFP positivity among hCD45 + cells (FIG. 14A, FIG. 14B, FIG. 14C, FIG. 14D).
  • Example 5 Effect of small molecules on the engraftment of edited cells
  • This example demonstrates the impact of small molecules on engraftment of edited cells in NSG mice. Edited cells were detected in NSG mice up to 16 weeks post transplantation. This example demonstrates methods to further increase the number of LT- HSCs that are edited and able to engraft. Small molecules that promote the self-renewal of LT- HSCs ex vivo were introduced into the culture system (Fares, T, et al., Science, 2014. 345(6203): p. 1509-12; Sun, H., et al, Stem Cell Res, 2012. 9(2): p. 77-86). Inducing self renewal provided a two-fold benefit: it was useful for cells to be cycling (in G or S2 phase) in order to undergo HDR, and self-renewing stem cells maintained their ability to engraft in the bone marrow and persist long term.
  • the small molecules ETM171 and SR-l increase the self-renewal of hematopoietic stem cells, and the combination has recently been used to support engraftment of HDR- edited cells (Schiroli, G., et al, Sci Transl Med, 2017. 9(411); Bak, R.O. and M.H. Porteus, Cell Rep, 2017. 20(3): p. 750-756; Bak, R.O., et al, Elife, 2017, 6; Fares T, et al, (2013) Blood 122:798).
  • the effect of these small molecules on editing rates and engraftment of edited cells was analyzed.
  • eltrombopag can expand CD34 + /CD38 cells (Sun, H., et al., Stem Cell Res, 2012. 9(2): p. 77-86).
  • Eltrombopag an approved drug for the treatment of aplastic anemia, is an agonist of the TPO receptor, c-mpl. Adding eltrombopag increased the percentage of cells that are edited by about 5%, without significantly impacting viability (FIG. 16A, FIG. 16B, FIG. 16C, FIG. 16D, FIG. 16E, FIG. 16F, FIG. 16G). There was a slight increase in the percentage of cells that stained as FT-HSCs with the drug.
  • FIG. 16A, FIG. 16B, FIG. 16C, FIG. 16D, FIG. 16E, FIG. 16F, FIG. 16G When eltrombopag was added to culture media, there was no impact on overall hCD45 engraftment in the bone marrow or spleen (FIG. 16A, FIG. 16B, FIG. 16C, FIG. 16D, FIG. 16E, FIG. 16F, FIG. 16G). However, with low dose AAV + RNP, there was a small increase in the percentage of GFP + cells in both bone marrow and spleen. In contrast, when high dose AAV plus RNP were used along with ETM171 and SR1, there was no increase in the percentage of edited cells with eltrombopag (FIG. 13E).
  • Example 6 Effect of pre-stimulation time on in vivo engraftment potential
  • Protocols A or B Two alternative protocols (Protocols A or B) for culturing CD34 + cells were examined. TABLE 1 and FIG. 22 outline conditions for each protocol for culturing mobilized CD34 + HSCs for HDR-based gene editing.
  • protocol A mobilized human CD34+ cells were cultured in SCGM media supplemented with TPO, SCF, FLT3L and IL6 (100 ng/ml) plus 35 nM UM171 1 mM SR1 for 48 hours at a concentration of 1 xlO 6 cells/ml, followed by nucleofection of 200 pg/ml of RNP using a Lonza system. The cells were subsequently transduced with AAV targeting vector at the MOI of 1K.
  • protocol B CD34+ cells were cultured in SFEMII media containing the same supplements as above. The cell density during pre-stimulation was 2.50E+05/ml.
  • the cells were nucleofected with 200 pg/ml of RNP with the Lonza system and plated at a density of 1 xlO 6 cells/ml prior to transduction with AAV at the MOI of 2.5K.
  • the cells were transplanted into W41 mice the following day. Mice were injected with 12.5 mg/kg Busulfan one day prior to transplantation of cells.
  • protocol A was used, and electroporation was performed using the Neon electroporation system.
  • a comparison of cell viability was performed using various nucleofection programs on the Lonza system, compared to electroporation by Neon system (FIG. 32).
  • Adult mobilized human CD34 + cells were cultured in SCGM media followed by mock transfection or transfection of RNPs (200 pg/ml) by Neon or Lonza instruments.
  • a comparison of percent HDR (GFP expression) using various nucleofection programs on the Lonza system versus electroporation by the Neon system was also performed (FIG. 33).
  • CD34+ cells were cultured using either protocol A or B and were transfected using the Lonza nucleofection system.
  • the percent hCD45 + cells recovered from the bone marrow of NSGW41 mice transplanted with CD34 + cells cultured using protocol A or B was determined (FIG. 23), and the percent GFP+ among the total hCD45+ cells recovered was determined (FIG. 24).
  • the percent CDl9 + cells among the human CD45 + cells was determined (FIG. 25), and the percent GFP+ cells among the human CD 19+ cells was determined (FIG. 26).
  • the percent CD33 + cells among human CD45 + cells recovered from the bone marrow of NSGW41 mice engrafted with CD34 + cells cultured using protocol A or B was determined (FIG. 27), and the percent GFP+ cells among the human CD33+ cells was determined (FIG. 28). Representative flow plots of cells harvested from the bone marrow of NSGW41 mice at 16 weeks following transplant are shown in FIG. 29.
  • the percent human CD45 + cells recovered from the spleens of NSGW41 mice transplanted with CD34 + cells cultured using protocol A or B was determined (FIG. 30), and the percent GFP+ cells among the human CD45+ cells recovered was determined (FIG. 31).
  • the percent CDl9 + cells among human CD45 + cells recovered from the spleens of NSGW41 mice transplanted with CD34 + cells cultured using protocol A or B was determined (FIG. 34), and the percent GFP+ cells among the human CD19+ cells was determined (FIG. 35).
  • the percent CD33 + cells among human CD45 + cells recovered from the spleens of NSGW41 mice transplanted with CD34 + cells cultured using protocol A or B was determined (FIG. 36), and the percent GFP+ cells among the human CD33+ cells was determined (FIG. 37).
  • Representative flow plots of cells harvested from the spleens of NSGW41 mice 16 weeks following transplant are shown in FIG. 38.
  • FIG. 39 The percent CD34 + CD38 low cells among human CD45 + cells recovered from the bone marrow of NSGW41 mice transplanted with CD34 + cells cultured using protocol A or B was determined (FIG. 39), and the percent GFP + cells among the human CD34 + CD38 low CD45 + cells was determined (FIG. 40).
  • FIG. 41 A representative flow cytometry analysis of CD34+ gated on total human CD45+ cells from NSGW41 mice transplanted with mock or edited cells is shown in FIG. 41 in which bone marrow cells from transplanted NSGW41 mice were harvested 16 weeks post-transplant and analyzed for the presence of LT- HSCs (long term repopulating hematopoietic stem cells).
  • the LT-HSCs were characterized by low expression of CD38 and expression of CD34 markers. These cells were further analyzed for the presence of GFP+ cells indicating presence of edited cells within this population. GFP+ cells are present within this long-term HSC population demonstrating sustained HDR-editing of the CD40L locus in human HSC.
  • HDR-edited (GFP+) cells were present in all cell lineages (B and myeloid) and were present in ratios equivalent to mock cells (FIG. 26, FIG. 28, FIG. 35, FIG. 37, FIG. 38).
  • the percent of human CD45+ hematopoietic stem cells (HSC) engrafted within the bone marrow was equivalent in mock and HDR-edited recipients (FIG. 39).
  • GFP+ cells were present within this population consistent with editing of HSC capable of persisting long-term in vivo (FIG. 40, FIG. 41).
  • HDM2 is an E3 ubiquitin-protein ligase that mediates ubiquitination of p53/TP53, leading to its degradation by the proteasome.
  • the effect of co-delivery of HDM2 protein, along with RNPs plus AAV, on the rates of HDR observed in CD34+ cells was tested.
  • Adult mobilized human CD34+ cells were cultured using protocol B for 48 hours followed by nucleofection of RNPs with or without HDM2 (6.25 nM -25 nM). AAV was added at the MOI of 1K. HDR rates were assessed by GFP expression on day 5.
  • HDR rates were remarkably higher (up to 3 -fold) for the cells co-transfected with the HDM2 protein compared to the one treated with only RNPs and AAV vector (FIG. 42). These data indicated that HDM2 can be utilized to improve HDR editing rates at the CD40L locus in CD34+ cells and can be utilized in conjunction with the above methods to increase HDR rates in long-term HSC.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Medicinal Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Cell Biology (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Immunology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Mycology (AREA)
  • Toxicology (AREA)
  • Virology (AREA)
  • Communicable Diseases (AREA)
  • Oncology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
PCT/US2019/028858 2018-04-27 2019-04-24 Therapeutic genome editing in x-linked hyper igm syndrome Ceased WO2019209912A2 (en)

Priority Applications (7)

Application Number Priority Date Filing Date Title
JP2020560340A JP2021521850A (ja) 2018-04-27 2019-04-24 X連鎖性高IgM症候群のゲノム編集治療
CN201980042296.4A CN112312931A (zh) 2018-04-27 2019-04-24 X连锁高IgM综合征的治疗性基因组编辑
EP19793005.0A EP3784292A4 (en) 2018-04-27 2019-04-24 THERAPEUTIC GENOME EDITING IN HYPER-IGM SEX-LINKED SYNDROME
KR1020207034098A KR20210005178A (ko) 2018-04-27 2019-04-24 X-연관 고 igm 증후군에서의 치료적 게놈 편집
US17/050,601 US20210324381A1 (en) 2018-04-27 2019-04-24 Therapeutic genome editing in x-linked hyper igm syndrome
AU2019261385A AU2019261385A1 (en) 2018-04-27 2019-04-24 Therapeutic genome editing in X-linked hyper IgM syndrome
CA3098489A CA3098489A1 (en) 2018-04-27 2019-04-24 Therapeutic genome editing in x-linked hyper igm syndrome

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201862663485P 2018-04-27 2018-04-27
US62/663,485 2018-04-27

Publications (2)

Publication Number Publication Date
WO2019209912A2 true WO2019209912A2 (en) 2019-10-31
WO2019209912A3 WO2019209912A3 (en) 2020-01-16

Family

ID=68295746

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2019/028858 Ceased WO2019209912A2 (en) 2018-04-27 2019-04-24 Therapeutic genome editing in x-linked hyper igm syndrome

Country Status (8)

Country Link
US (1) US20210324381A1 (https=)
EP (1) EP3784292A4 (https=)
JP (1) JP2021521850A (https=)
KR (1) KR20210005178A (https=)
CN (1) CN112312931A (https=)
AU (1) AU2019261385A1 (https=)
CA (1) CA3098489A1 (https=)
WO (1) WO2019209912A2 (https=)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11643671B2 (en) 2017-04-21 2023-05-09 Seattle Children's Hospital Therapeutic genome editing in Wiskott-Aldrich syndrome and X-linked thrombocytopenia
US11866726B2 (en) 2017-07-14 2024-01-09 Editas Medicine, Inc. Systems and methods for targeted integration and genome editing and detection thereof using integrated priming sites

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20230158110A1 (en) * 2018-05-30 2023-05-25 The Regents Of The University Of California Gene editing of monogenic disorders in human hematopoietic stem cells -- correction of x-linked hyper-igm syndrome (xhim)
WO2025073293A1 (en) * 2023-10-02 2025-04-10 Consorcio Centro De Investigación Biomédica En Red Gene editing methods for cd34+ cells to achieve clinically relevant efficacies

Family Cites Families (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU4102099A (en) * 1998-05-29 1999-12-13 Heska Corporation Canine Interleukin -4 Proteins, Nucleic Acid Molecules, and Uses Thereof
PL3360964T3 (pl) * 2012-12-06 2020-03-31 Sigma-Aldrich Co. Llc Modyfikacja i regulacja genomu oparta na crispr
EP3289080B1 (en) * 2015-04-30 2021-08-25 The Trustees of Columbia University in the City of New York Gene therapy for autosomal dominant diseases
US10179918B2 (en) * 2015-05-07 2019-01-15 Sangamo Therapeutics, Inc. Methods and compositions for increasing transgene activity
CA2985650A1 (en) * 2015-05-13 2016-11-17 Seattle Children's Hospital (dba Seattle Children's Research Institute) Enhancing endonuclease based gene editing in primary cells
WO2018035387A1 (en) * 2016-08-17 2018-02-22 The Broad Institute, Inc. Novel crispr enzymes and systems
WO2018073393A2 (en) * 2016-10-19 2018-04-26 Cellectis Tal-effector nuclease (talen) -modified allogenic cells suitable for therapy
EP3535396A1 (en) * 2016-11-01 2019-09-11 Novartis AG Methods and compositions for enhancing gene editing
GB201618414D0 (en) * 2016-11-01 2016-12-14 Patterson James Regulated cell lines and methods of use thereof
WO2018206577A1 (en) * 2017-05-10 2018-11-15 Aarhus Universitet Interferon primed plasmacytoid dendritic cells
MA50833A (fr) * 2017-10-17 2020-08-26 Bayer Healthcare Llc Compositions et méthodes pour l'édition génique pour l'hémophilie a
DK3701028T3 (da) * 2017-10-24 2024-11-11 Editas Medicine Inc Systemer og fremgangsmåder til behandling af hyper-igm-syndrom
US20200263206A1 (en) * 2017-11-07 2020-08-20 Editas Medicine, Inc. Targeted integration systems and methods for the treatment of hemoglobinopathies
AU2018370217A1 (en) * 2017-11-17 2020-05-28 Memorial Sloan-Kettering Cancer Center Methods and compositions for alleviating Cytokine Release Syndrome

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11643671B2 (en) 2017-04-21 2023-05-09 Seattle Children's Hospital Therapeutic genome editing in Wiskott-Aldrich syndrome and X-linked thrombocytopenia
US11866726B2 (en) 2017-07-14 2024-01-09 Editas Medicine, Inc. Systems and methods for targeted integration and genome editing and detection thereof using integrated priming sites

Also Published As

Publication number Publication date
EP3784292A2 (en) 2021-03-03
US20210324381A1 (en) 2021-10-21
CA3098489A1 (en) 2019-10-31
KR20210005178A (ko) 2021-01-13
EP3784292A4 (en) 2022-01-19
WO2019209912A3 (en) 2020-01-16
JP2021521850A (ja) 2021-08-30
AU2019261385A1 (en) 2020-11-19
CN112312931A (zh) 2021-02-02

Similar Documents

Publication Publication Date Title
EP4176048B1 (en) Genetically engineered t cells with regnase-1 and/or tgfbrii disruption have improved functionality and persistence
KR102630217B1 (ko) 혈색소병증의 치료를 위한 조성물 및 방법
US20240141389A1 (en) Therapeutic genome editing in wiskott-aldrich syndrome and x-linked thrombocytopenia
US20210324381A1 (en) Therapeutic genome editing in x-linked hyper igm syndrome
JP2021521838A (ja) ブルトン型チロシンキナーゼに対するtalenベースのおよびcrispr/casベースのゲノム編集
KR20250029125A (ko) 조작된 t 세포
AU2024226443A1 (en) Compositions and methods for genome editing
US20240318154A1 (en) Gene therapy for the treatment of severe combined immunodeficiency (scid) related to rag1
US20240350628A1 (en) Methods for creating regulatory t cells (tregs) using genome engineering
US20230128917A1 (en) Genetically engineered immune cells having a disrupted cd83 gene
TW202542303A (zh) 經工程改造之t細胞
TW202609050A (zh) 用於car/tcr細胞療程之組成物及方法
WO2025181336A1 (en) Compositions and methods for hbb-editing in hspc
WO2024178055A1 (en) Compositions and methods for genome editing

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 19793005

Country of ref document: EP

Kind code of ref document: A2

ENP Entry into the national phase

Ref document number: 3098489

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2020560340

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2019261385

Country of ref document: AU

Date of ref document: 20190424

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 20207034098

Country of ref document: KR

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 2019793005

Country of ref document: EP

WWR Wipo information: refused in national office

Ref document number: 1020207034098

Country of ref document: KR