WO2019175802A1 - Anti-cxcr4 antibody combined with activated and expanded natural killer cells for cancer immunotherapy - Google Patents
Anti-cxcr4 antibody combined with activated and expanded natural killer cells for cancer immunotherapy Download PDFInfo
- Publication number
- WO2019175802A1 WO2019175802A1 PCT/IB2019/052042 IB2019052042W WO2019175802A1 WO 2019175802 A1 WO2019175802 A1 WO 2019175802A1 IB 2019052042 W IB2019052042 W IB 2019052042W WO 2019175802 A1 WO2019175802 A1 WO 2019175802A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- cancer
- cells
- cxcr4
- cell
- antigen
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
- C07K16/2866—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against receptors for cytokines, lymphokines, interferons
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
- A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
- A61K35/14—Blood; Artificial blood
- A61K35/17—Lymphocytes; B-cells; T-cells; Natural killer cells; Interferon-activated or cytokine-activated lymphocytes
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K40/00—Cellular immunotherapy
- A61K40/10—Cellular immunotherapy characterised by the cell type used
- A61K40/15—Natural-killer [NK] cells; Natural-killer T [NKT] cells
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K40/00—Cellular immunotherapy
- A61K40/40—Cellular immunotherapy characterised by antigens that are targeted or presented by cells of the immune system
- A61K40/41—Vertebrate antigens
- A61K40/42—Cancer antigens
- A61K40/4202—Receptors, cell surface antigens or cell surface determinants
- A61K40/4214—Receptors for cytokines
- A61K40/4219—Receptors for chemokines
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/54—Medicinal preparations containing antigens or antibodies characterised by the route of administration
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/545—Medicinal preparations containing antigens or antibodies characterised by the dose, timing or administration schedule
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/55—Medicinal preparations containing antigens or antibodies characterised by the host/recipient, e.g. newborn with maternal antibodies
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K2239/00—Indexing codes associated with cellular immunotherapy of group A61K40/00
- A61K2239/38—Indexing codes associated with cellular immunotherapy of group A61K40/00 characterised by the dose, timing or administration schedule
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K2239/00—Indexing codes associated with cellular immunotherapy of group A61K40/00
- A61K2239/46—Indexing codes associated with cellular immunotherapy of group A61K40/00 characterised by the cancer treated
- A61K2239/55—Lung
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/20—Immunoglobulins specific features characterized by taxonomic origin
- C07K2317/21—Immunoglobulins specific features characterized by taxonomic origin from primates, e.g. man
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
- C07K2317/73—Inducing cell death, e.g. apoptosis, necrosis or inhibition of cell proliferation
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
- C07K2317/76—Antagonist effect on antigen, e.g. neutralization or inhibition of binding
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/90—Immunoglobulins specific features characterized by (pharmaco)kinetic aspects or by stability of the immunoglobulin
- C07K2317/92—Affinity (KD), association rate (Ka), dissociation rate (Kd) or EC50 value
Definitions
- This invention relates to methods for treating a cancer in a subject comprising administering to the subject an anti-C-X-C Chemokine Receptor 4 (CXCR4) antibody (Ab) in combination with Activated and Expanded Natural Killer (NKAE) cell immunotherapy.
- CXCR4 anti-C-X-C Chemokine Receptor 4
- NKAE Expanded Natural Killer
- Metastasis the spread of cancer cells from the primary tumor to surrounding tissues and to distant organs, is the primary cause of cancer morbidity and mortality, estimated to be responsible for about 90% of cancer deaths (Chaffer and Weinberg, 2011; Seyfried and Huysentruyt, 2013).
- Sarcomas primarily affect children and young adults, but despite aggressive treatment, nearly half of children with solid tumors such as rhabdomyosarcoma, osteosarcoma, Ewing sarcoma, and neuroblastoma have progressive disease.
- the prognosis is particularly poor for those patients with metastatic disease, at least two thirds of whom have disease progression (Oberlin et al ., 2008; Heare et al ., 2009; Matthay et al ., 2009). Therefore, new therapeutic approaches that bypass the cellular mechanisms of drug resistance are urgently needed, particularly for patients with high-risk features, such as metastatic disease.
- Metastasis is a complex multistep process that includes local tissue invasion of metastatic cells, their survival in the circulation,“homing” to and extravasation in a secondary organ, and proliferation/growth at the metastatic sites (Nguyen et al ., 2009).
- Chemokines interacting with chemokine receptors expressed by metastasizing tumor cells have crucial roles in directing migrating cells towards secondary organs. This is well documented for the chemokine CXCL12 and its receptor, CXCR4.
- Miiller and co- workers initially postulated and discovered the CXCL12-CXCR4 homing axis in cancer metastasis (Miiller et al ., 2001). They demonstrated that CXCR4 expressing breast cancer cells preferentially migrated towards protein extracts of the lung, which expresses CXCL12 abundantly.
- a novel immunotherapeutic approach for treating cancer including metastatic cancer, comprising administering to a cancer patient an anti-CXCR4 Ab in combination with NKAE cell therapy.
- CXCR4 also known as CD 184
- CD 184 is a seven-transmembrane domain, G-protein coupled, cell surface receptor that is over-expressed in the majority of human cancers and, together with its endogenous ligand CXCL12, plays a fundamental role in cancer pathogenesis, including contributing to tumor growth and proliferation, adhesion, invasion, metastasis, angiogenesis and survival (Domanska et al ., 2013; Duda et al .,
- CXCL12 The binding of CXCL12 to CXCR4 stimulates intracellular calcium flux, activates ART and ERK signaling pathways, and up-regulates the formation of focal adhesions, which ultimately results in increased migration along gradients of locally expressed and secreted chemokines (Chatterjee at al ., 2014). It also leads to gene transcription that promotes cell survival and proliferation.
- CXCR4 is found in various tissues with predominant expression on hematopoietic lineage cells including B and T cells, monocytes, macrophages, natural killer (NK), and dendritic cells, as well as CD34 + bone marrow progenitor cells (Lee et al ., 1999).
- Ulocuplumab (previously designated BMS-936564 or MDX-1338, and designated F7GL in WO 2008/060367) is a fully human IgG4 (S224P) monoclonal antibody (mAb) that specifically binds to CXCR4 expressed on the surface of a cell.
- Ulocuplumab comprises VH and VL regions comprising consecutively linked amino acids having the sequences shown as SEQ ID NOs: 33 and 37, respectively. Blockade of CXCR4 signaling by ulocuplumab may disrupt tumor-stromal interactions, sensitize tumor cells to cytotoxic agents, and reduce metastatic burden.
- ulocuplumab directly inhibits tumor growth and proliferation, and induces apoptosis, of CXCR4-expressing tumor cells (WO 2008/060367; WO 2013/071068; Kuhne et al. , 2013).
- NK cells are a sub-population of mononuclear lymphocytes, involved in immunity and in the host immune surveillance system. Their biological properties include targeting and killing cells that fail to express “self’ major histocompatibility complex (MHC)/human leukocyte antigen (HLA) proteins, and/or tumor cells or other diseased cells that express ligands for activating NK receptors.
- MHC major histocompatibility complex
- HLA human leukocyte antigen
- NK cell activity is regulated by complex mechanisms that involve both stimulating and inhibitory signals, and a balance between activating and inhibitory receptors plays a role in tumor recognition and killing by NK cells and, thus, in their therapeutic efficacy.
- KARs Membrane bound Killer-cell Activation Receptors
- KIRs Killer-cell Immunoglobulin-like Receptors
- KIRL KIR ligands
- NK cell activation status a decrease in suppressive signals (e.g ., using altered or mismatched MHC class I), or both, should result in heightened NK cell cytotoxicity.
- the magnitude of NK cell cytotoxicity is directly proportional to the ratio between the number of NK cells and target cells (i.e., effector/target ratio or E:T).
- E:T effector/target ratio
- haploidentical donor NK cells may exert antitumor activity in patients with solid tumors undergoing allogeneic hematopoietic stem cell transplantation, partially based on an allograft-vs-tumor effect associated with KIR-HLA donor-recipient mismatch (Pende et al., 2009; Moretta et al., 2011). Accordingly, the use of NKAE cells is being actively explored in clinical trials on patients with hematologic malignancies and solid tumors (see, e.g, the Clinical Trials Website,
- the disclosed invention relates to in vitro and in vivo preclinical studies demonstrating synergy between NKAE cell therapy and treatment with an anti-CXCR4 Ab in preventing tumor cell migration, invasion, implant and metastasis.
- the ability of this combination therapy to inhibit the migration and invasion of CXCR4 + tumor cells was analyzed in vitro.
- mice was used to evaluate the anti-tumoral and anti-metastatic synergistic effect in vivo. Additionally, CXCR4 expression was analyzed in pediatric rhabdomyosarcoma patients’ tumors. Data presented herein suggest that this combination immunotherapy is effective to treat diverse cancers and prevent metastasis.
- the present disclosure provides a method for treating a subject afflicted with a cancer comprising administering to the subject a combination of therapeutically effective amounts of: (a) an isolated population of NK cells; and (b) an isolated Ab or an antigen binding portion thereof that binds specifically to CXCR4 expressed on the surface of a cancer cell.
- the population of NK cells comprises activated and expanded NK (NKAE) cells.
- the Ab or an antigen-binding portion thereof disrupts the interaction between CXCR4 and C-X-C motif chemokine 12 (CXCL12) and inhibits CXCR4/CXCL12 signaling.
- the Ab is ulocuplumab, comprising VH and VL regions having the amino acid sequences shown as SEQ ID NOs: 33 and 37, respectively.
- the cancer is a solid tumor, including a pediatric tumor such as a rhabdomyosarcoma, osteosarcoma, neuroblastoma, retinoblastoma, or Ewing sarcoma.
- the cancer is a hematological malignancy.
- kits for treating a subject afflicted with a cancer comprising: (a) one or more dosages ranging from about 50 to about 2000 mg of an Ab or an antigen-binding portion thereof that binds specifically to CXCR4 expressed on the surface of a cancer cell; (b) one or more dosages ranging from 10 6 to 10 14 of a population of NKAE cells; and (c) instructions for using theAb or portion thereof and the NKAE cells in any of the methods disclosed herein.
- Figure 1 shows an analysis of CXCR4 expression in six sarcoma cell lines (RH30, CW9019, A4573, A673, MG-63 and 143B) by (A) flow cytometry, and (B) quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR).
- sarcoma cell lines RH30, CW9019, A4573, A673, MG-63 and 143B
- A flow cytometry
- qRT-PCR quantitative reverse transcriptase-polymerase chain reaction
- rhabdomyosarcoma RH30 cell line showed the highest CXCR4 expression.
- Figure 2 shows the migration and invasion capacity of the different sarcoma cell lines (RH30, CW9019, A4573, A673, MG-63 and 143B) towards (A) fetal bovine serum (FBA) or (B) CXCL12 (100 ng/ml).
- RH30 cell line showed the highest migration and invasion indices towards CXCL12 ( Figure 2B).
- Migration capacity was tested using 8 pm-pore membranes Transwell assays, and invasion capacity was measured under the same conditions using Matrigel-coated Transwell membranes.
- Figure 3 shows the cytotoxicity and inhibition of migration and invasion by NKAE and anti-CXCR4 therapy, individually or in combination, on rhabdomyosarcoma (RH30) cells in vitro.
- RH30 rhabdomyosarcoma
- NKAE RH30 effector Target (E:T) ratios.
- B-C, ETlocuplumab (MDX1338) and NKAE cells each efficiently reduced RH30 cells migration and invasion towards CXCL12, but only the combination of both agents completely abrogated it.
- RH30 cells migration towards a gradient of human recombinant CXCL12 chemokine was tested using Transwell plates.
- Ab concentration was 100 pg/ml and NKAE: RH30 E:T ratio was 5: 1 (B).
- Invasion capacity was measured under the same conditions using Matrigel-coated Transwell membranes (C).
- Figure 4 shows the effects of NKAE cell and anti-CXCR4 therapy, individually or in combination, on the growth of GFP + Luc + RH30 rhabdomyosarcoma tumor implants in the abdominal region of immunodeficient NSG mice.
- A Growth of RH30 tumor implants. Five treatment arms were established: untreated; IgG4; ulocuplumab
- mice received 6 doses of mAh (15 mg/kg, twice a week), and 3 doses of NKAE (5 x 10 6 cells, once a week). Luminescent tumors were monitored for 35 days.
- B Quantification of the presence of tumor cells measured by luminescence of implanted GFP + Luc + RH30 cells in the treated mice. The ulocuplumab treatment alone moderately inhibited growth of the RH30 tumor implants, whereas NKAE treatment completely prevented it.
- Figure 5 shows the effects of NKAE cells and ulocuplumab, individually or in combination, on the formation of lung micrometastasis from RH30 tumors in mice.
- A Relative expression of human CXCR4 in RH30 lung metastatic lesions in mice measured by qRT-PCR using a human CXCR4 specific probe. Indicated values are relative to the expression of the indicated gene by a 10 6 RH30 cells pellet.
- Ulocuplumab (MDX1338) reduced RH30 lung micrometastasis incidence, while the combination of ulocuplumab and NKAE completely eliminated it.
- B Relative expression of human GUS in RH30 lung metastatic lesions in mice measured by qRT-PCR. The combination of both NKAE cell therapy and treatment with ulocuplumab (MDX1338) is required to completely suppress RH30 lung micrometastasis in vivo.
- FIG. 6 shows the confirmation of the inhibition of rhabdomyosarcoma RH30 micrometastases by histological methods.
- Lung micrometastases in untreated mice lungs were identified by hematoxylin and eosin staining (a), Ahx sequence in situ hybridization (b), and CXCR4-specific mAh stain (c). Arrows identify detected micrometastases.
- the combination of both NKAE cell therapy and treatment with ulocuplumab is required to completely suppress RH30 lung micrometastasis in vivo (d).
- Figure 7 shows the level of CXCR4 expression on rhabdomyosarcoma patients’ tumors
- A Representative stainings corresponding to samples with negative (a), medium (b) and high (c) CXCR4 cytoplasmic expression.
- a specimen with high nuclear CXCR4 staining is also shown (d).
- B CXCR4 expression score of specimens at diagnosis.
- C Diagnostic versus post-chemotherapy and relapse specimens.
- Median ⁇ SD is shown. Non-parametric unpaired Mann-Whitney test applied.
- the present invention relates to methods for treating cancer in a subject comprising administering a combination of NKAE cell immunotherapy and an anti- CXCR4 Ab to the subject.
- administering refers to the physical introduction of a composition comprising a therapeutic agent to a subject, using any of the various methods and delivery systems known to those skilled in the art.
- a preferred route for administration of a therapeutic Ab such as an anti-CXCR4 Ab is intravenous or subcutaneous administration.
- Other routes of administration include intramuscular, intraperitoneal, or other parenteral routes of administration, for example by injection or infusion.
- parenteral administration as used herein means modes of administration other than enteral and topical
- a preferred route for administration of NKAE cells is intravenous administration.
- Other routes of administration include intraarterial, intrafemoral, intraperitoneal, or intrathecal injection, intratumoral or injection into a tumor resection cavity.
- Administering can also be performed, for example, once, a plurality of times, and/or over one or more extended periods.
- An“antibody” shall include, without limitation, a glycoprotein
- immunoglobulin which binds specifically to an antigen and comprises at least two heavy (H) chains and two light (L) chains interconnected by disulfide bonds, or an antigen-binding portion thereof.
- Each H chain comprises a heavy chain variable region (abbreviated herein as YH) and a heavy chain constant region.
- the heavy chain constant region of an IgG Ab comprises three constant domains, Cm, Cm and Cm.
- Each light chain comprises a light chain variable region (abbreviated herein as YL) and a light chain constant region.
- the light chain constant region of an IgG Ab comprises one constant domain, CL.
- the YH and YL regions can be further subdivided into regions of
- CDRs complementarity determining regions
- FR framework regions
- Each YH and YL comprises three CDRs and four FRs, arranged from amino-terminus to carboxy-terminus in the following order: FR1-CDR1-FR2-CDR2-FR3-CDR3-FR4.
- the variable regions of the heavy and light chains contain a binding domain that interacts with an antigen.
- the constant regions of the Abs may mediate the binding of the immunoglobulin to host tissues or factors, including various cells of the immune system (e.g ., effector cells) and the first component (Clq) of the classical complement system.
- An immunoglobulin may derive from any of the commonly known isotypes, including but not limited to IgA, secretory IgA, IgG and IgM.
- IgG subclasses are also well known to those in the art and include but are not limited to human IgGl, IgG2, IgG3 and IgG4.
- “Isotype” refers to the Ab class or subclass (e.g., IgM, IgGl, or IgG4) that is encoded by the heavy chain constant region genes.
- the term“antibody” includes, by way of example, both naturally occurring and non-naturally occurring Abs; monoclonal and polyclonal Abs; chimeric and humanized Abs; human or nonhuman Abs; wholly synthetic Abs; and single chain Abs.
- a nonhuman Ab may be humanized partially or fully by recombinant methods to reduce its immunogenicity in man.
- the term“antibody” also includes an antigen-binding fragment or an antigen-binding portion of any of the aforementioned immunoglobulins, and includes a monovalent and a divalent fragment or portion, and a single chain Ab.
- An“isolated” Ab refers to an Ab that is substantially free of other Abs having different antigenic specificities (e.g ., an isolated Ab that binds specifically to CXCR4 is substantially free of Abs that bind specifically to antigens other than CXCR4).
- An isolated Ab that binds specifically to, for example, human CXCR4 may, however, have cross-reactivity to other antigens, such as CXCR4 molecules from different species.
- an“isolated” Ab may also refer to an Ab that is purified so as to be substantially free of other cellular material and/or chemicals.
- the term“monoclonal” Ab refers to a non-naturally occurring preparation of Ab molecules of single molecular composition, i.e ., Ab molecules whose primary sequences are essentially identical, which exhibits a single binding specificity and affinity for a particular epitope.
- a mAh is an example of an isolated Ab.
- MAbs may be produced by hybridoma, recombinant, transgenic or other techniques known to those skilled in the art.
- A“chimeric” Ab refers to an Ab in which the variable regions are derived from one species and the constant regions are derived from another species, such as an Ab in which the variable regions are derived from a mouse Ab and the constant regions are derived from a human Ab.
- A“human” mAh refers to a mAh having variable regions in which both the framework and CDR regions are derived from human germline immunoglobulin sequences. Furthermore, if the Ab contains a constant region, the constant region also is derived from human germline immunoglobulin sequences.
- the human Abs of the invention may include amino acid residues not encoded by human germline
- immunoglobulin sequences e.g., mutations introduced by random or site-specific mutagenesis in vitro or by somatic mutation in vivo.
- the term“human” Ab is not intended to include Abs in which CDR sequences derived from the germline of another mammalian species, such as a mouse, have been grafted onto human framework sequences.
- the terms“human” Abs and“fully human” Abs are used synonymously.
- A“humanized” mAh refers to a mAh in which some, most or all of the amino acids outside the CDR domains of a non-human mAh are replaced with corresponding amino acids derived from human immunoglobulins.
- some, most or all of the amino acids outside the CDR domains have been replaced with amino acids from human immunoglobulins, whereas some, most or all amino acids within one or more CDR regions are unchanged.
- Small additions, deletions, insertions, substitutions or modifications of amino acids are permissible as long as they do not abrogate the ability of the Ab to bind to a particular antigen.
- A“humanized” Ab retains an antigenic specificity similar to that of the original Ab.
- an“anti-antigen” Ab refers to an Ab that binds specifically to an antigen.
- an anti-CXCR4 Ab is an Ab that binds specifically to CXCR4.
- An“antigen-binding portion” of an Ab refers to one or more fragments of an Ab that retain the ability to bind specifically to the antigen bound by the whole Ab.
- A“cancer” refers a broad group of various diseases characterized by the uncontrolled growth of abnormal cells in the body. Unregulated cell division and growth divide and grow results in the formation of malignant tumors that invade neighboring tissues and may also metastasize to distant parts of the body through the lymphatic system or bloodstream.
- CX-C Chemokine Receptor 4 (CXCR4; also known in the art as, for example, LESTR, Fusin or CD 184) refers to a 7-transmembrane G-protein coupled receptor expressed on leukocytes, platelets and other non-hematopoietic cells that comprise the tumor stromal microenvironment. It is also over-expressed in the majority of human cancers and on Tregs and MDSCs. CXCR4 binds to a single ligand, CXCL12.
- CXCR4 as used herein includes human CXCR4 (hCXCR4), variants, isoforms, and species homologs of hCXCR4, and analogs having at least one common epitope with hCXCR4.
- hCXCR4 amino acid sequence can be found under
- immunotherapy refers to the treatment of a subject afflicted with, or at risk of contracting or suffering a recurrence of, a disease by a method comprising inducing, enhancing, suppressing or otherwise modifying an immune response.
- Treatment or“therapy” of a subject refers to any type of intervention or process performed on, including the administration of an active agent to, the subject with the objective of reversing, alleviating, ameliorating, inhibiting, slowing down or preventing the onset, progression, development, severity or recurrence of a symptom, complication or condition, or biochemical indicia associated with a disease.
- A“subject” includes any human or nonhuman animal.
- the term“nonhuman animal” includes, but is not limited to, vertebrates such as nonhuman primates, sheep, dogs, and rodents such as mice, rats and guinea pigs. In preferred embodiments, the subject is a human.
- the terms“subject” and“patient” are used interchangeably herein.
- A“therapeutically effective amount” or“therapeutically effective dosage” of a drug or therapeutic agent is any amount of the drug or agent that, when used alone or in combination with another therapeutic agent, protects a subject against the onset of a disease or promotes disease regression evidenced by a decrease in severity of disease symptoms, an increase in frequency and duration of disease symptom-free periods, or a prevention or reduction of impairment or disability due to the disease affliction.
- the terms“effective” and“effectiveness” with regard to a treatment includes both pharmacological effectiveness and physiological safety. Pharmacological effectiveness refers to the ability of the drug to promote disease regression, e.g ., cancer regression, in the patient.
- Physiological safety refers to an acceptable level of toxicity, or other adverse physiological effects at the cellular, organ and/or organism level (adverse effects) resulting from administration of the drug.
- the efficacy of a therapeutic agent can be evaluated using a variety of methods known to the skilled practitioner, such as by assaying the activity of the agent in in vitro assays, in animal model systems predictive of efficacy in humans, or in human subjects during clinical trials.
- a therapeutically effective amount of an anti-cancer agent preferably inhibits cell growth or tumor growth by at least about 20%, more preferably by at least about 40%, even more preferably by at least about 60%, and still more preferably by at least about 80% relative to untreated subjects.
- tumor regression may be observed and continue for a period of at least about 20 days, more preferably at least about 40 days, or even more preferably at least about 60 days.
- a therapeutically effective amount of a drug includes a prophylactically effective amount, which is any amount of the drug that, when administered alone or in combination with an another therapeutic agent to a subject at risk of developing a disease (e.g ., a subject having a pre-malignant condition who is at risk of developing a cancer) or of suffering a recurrence of the disease, inhibits the development or
- the prophylactically effective amount prevents the development or recurrence of the disease entirely.
- “Inhibiting” the development or recurrence of a disease means either lessening the likelihood of the disease’s development or recurrence, or preventing the development or recurrence of the disease entirely.
- “about” refers to a numeric value, composition or characteristic that is within an acceptable error range for the particular value, composition or characteristic as determined by one of ordinary skill in the art, which will depend in part on how the value, composition or characteristic is measured or determined, i.e., the limitations of the measurement system.
- “about” can mean within 1 or within more than 1 standard deviation per the practice in the art. Alternatively, it can mean a range of plus or minus 20%, more usually a range of plus or minus 10%.
- the meaning of“about” should be assumed to be within an acceptable error range for that particular value, composition or characteristic.
- the terms“once about every week,”“once about every two weeks,” or any other similar dosing interval terms as used herein mean approximate numbers.
- “once about every week” can include every 7 days ⁇ one day, i.e., every 6 days to every 8 days.
- “Once about every 2 weeks” can include every 14 days ⁇ 3 days, i.e., every 11 days to every 17 days. Similar approximations apply, for example, to once about every 3 weeks, once about every 4 weeks, or once about every month.
- numeric values being measured may, for example, be less than about 30%, preferably less than about 20%, and more preferably less than about 10%.
- any concentration range, percentage range, ratio range or integer range is to be understood to include the value of any integer within the recited range and, when appropriate, fractions thereof (such as one tenth and one hundredth of an integer), unless otherwise indicated.
- Sarcomas primarily including Ewing sarcoma, osteosarcoma and soft tissue sarcomas, are a group of relatively rare mesenchymal-derived tumors (Stiller et al ., 2013). Despite their low incidence among human malignancies and advances in adjuvant chemotherapy and surgical-wide resection, prognosis remains poor, mainly due to the high propensity for lung metastasis, which is the leading cause of mortality in patients with sarcomas.
- Chemokines and their interaction with their corresponding receptors have been shown to play a fundamental role in the mechanisms of cancer development and the appearance of metastasis (Vela et al., 2015).
- the expression levels of chemokines and their receptors are altered in malignant cells. This is the case of CXCR4, the chemokine receptor most frequently overexpressed in tumor cells.
- CXCR4 the chemokine receptor most frequently overexpressed in tumor cells.
- NK cells mainly resting NK cells (Rubnitz et al ., 2010; Curti et al ., 2011) or IL-2-cultured NK cells (Bachanova et al ., 2014; Shi et al ., 2013; Miller et al ., 2005) have been used in clinical trials.
- the use of activated and expanded NK cells co-cultured with human-derived antigen presenting cells is an emerging alternative (Szmania et al., 2015; Leivas et al., 2016; Ishikawa et al., 2004; Vela et al., 2018).
- the results of these trials show that both autologous and haploidentical NKAE is a safe therapy with no serious adverse effects and is a feasible approach for the treatment of different cancer types.
- this disclosure provides a method for treating a subject afflicted with a cancer comprising administering to the subject a combination of therapeutically effective amounts of: (a) an isolated population of NK cells, preferably NKAE cells; and (b) an isolated Ab or an antigen binding portion thereof that binds specifically to CXCR4 expressed on the surface of a cancer cell.
- the subject is a human patient.
- an anti-CXCR4 Ab (ulocuplumab) and NKAE cell therapy, administered as monotherapy, each potently reduced both the migration of RH30 alveolar rhabdomyosarcoma cells towards CXCL12 in vitro ( Figure 3B) and the invasion capacity of these cells in vitro ( Figure 3C).
- Figure 3B an anti-CXCR4 Ab
- NKAE cell therapy administered as monotherapy, each potently reduced both the migration of RH30 alveolar rhabdomyosarcoma cells towards CXCL12 in vitro
- Figure 3C the invasion capacity of these cells in vitro
- an even greater level of inhibition of migration and invasion of the RH30 cells was exhibited by the combination of anti- CXCR4 and NKAE cell therapy, i.e., anti-CXCR4 interacted synergistically with NKAE cell therapy to completely abrogate both migration and invasion ( Figures 3B and C).
- a combination of two therapies is considered synergistic if the antitumor effect of the combination is greater than the effect observed with monotherapy using the more efficacious treatment or greater than the sum of the level of inhibition exhibited by each treatment individually. It has been demonstrated that the anti-CXCR4 Ab, ulocuplumab, directly inhibits growth and proliferation and induces apoptosis of cancer cells (WO 2008/060367; WO 2013/071068; Kuhne et al., 2013), and these tumor-inhibitory properties may contribute to the efficacy of the combination therapy disclosed herein.
- NKAE therapy had only a very modest effect on lung metastasis whereas ulocuplumab had a more pronounced effect (Figure 5), but the combination of both therapies exhibited a strong synergistic effect in completely eliminated lung metastasis ( Figures 5 and 6).
- NK cell activity is regulated by complex mechanisms that involve both stimulating and inhibitory signals.
- An important set of regulatory receptors is the HLA class I-restricted, Killer-cell Immunoglobulin-like Receptor (KIR) family which comprises both inhibitory and activating family members that recognize allotypic variants of HLA class I alleles as KIR ligands (KIRL).
- KIR Killer-cell Immunoglobulin-like Receptor
- the NK cells of a single individual typically express different combinations of KIRs, providing a repertoire of NK cells with different specificities for HLA class I molecules.
- KARs Membrane bound Killer-cell Activation Receptors
- DNAM1 (CD226) Activator PVRL2 (CD 112), PVR (CD 155) NKp46 (CD335) Activator Heparan sulfate, hemagglutinin, etc.
- NKp44 (CD336) Activator Heparan sulfate, PCNC, etc.
- NKp30 (CD337) Activator B7-H6, etc.
- NK cells can kill leukemic cells and have been administered either in the setting of hematopoietic stem cell transplantation or after non-myeloablative immunosuppressive therapy to enhance the effect of chemotherapy in patients with acute leukemia, yielding encouraging results (Hsu et al ., 2005; Miller et al ., 2005; Rubnitz et al ., 2010).
- Miller et al. s study, 5 of 19 poor-prognosis patients with acute myeloid leukemia (AML) achieved complete remission after haploidentical NK-cell therapy. The results were even better in the study by Rubnitz et al. (2010), reporting 100% remission of 10 patients with intermediate and low risk AML.
- NK cells can also lyse malignant non-hematopoietic cells as shown by reports indicating NK cell cytotoxicity against Ewing sarcoma, neuroblastoma, osteosarcoma and hepatocellular carcinoma cell lines in vitro and in vivo (Fernandez et al., 2015; Cho et al., 2010; Verhoeven et al., 2008; Perez-Martinez et al., 20l5b; Kamiya et al., 2016).
- haploidentical donor NK cells may exert antitumor activity in children with solid tumors undergoing allogeneic hematopoietic stem cell transplantation partially based on an allograft-vs-tumor effect associated with KIR-HLA donor-recipient mismatch (Perez-Martinez et al ., 2009; Perez-Martinez et al, 20l5a).
- the present methods combine the demonstrated cytotoxicity of NK cells against tumors with the blockade of CXCR4/CXCL12 signaling by an anti-CXCR4 Ab.
- the population of NK cells comprises NKAE cells.
- IL-2 and other cytokines, including IL-12, IL-15 and/or IL- 21 can induce proliferative responses in human NK cells, but only a minor fraction sustains continued growth (London et al., 1986; Lanier et al., 1988).
- NK cells sustained expansions require additional signals, such as the presence of b-lymphoblastoid cells (London et al., 1986; Rabinowich et al., 1991; Igarashi et al., 2004).
- Methods that allow specific activation and expansion of human NK cells from peripheral blood has been developed, for example, methods based on the use of genetically modified K562 cells as a feeder for peripheral mononuclear cells of healthy donors allowing the expansion and activation of the NK cell population (Imai et al., 2005; Fujisaki et al., 2009; Somanchi and Lee, 2016).
- NKAE cells are produced by coculturing peripheral blood mononuclear cells (PBMCs) from healthy donors with (i) irradiated b-lymphoblastoid cells modified to express a membrane-bound form of an activating cytokine such as interleukin- 15 (IL-15) or interleukin-21 (IL-21), and (ii) interleukin-2 (IL-2).
- PBMCs peripheral blood mononuclear cells
- IL-15 interleukin- 15
- IL-21 interleukin-21
- IL-2 interleukin-2
- the b-lymphoblastoid cells are K562-mbl5-4lBBL cells (Fujisaki et al, 2009).
- the K562-mbl5-4lBBL cell line lacks MHC-I ligands for inhibitory KIR NK cells receptors and comprise K562 cells modified to express a membrane-bound form of the NK activating cytokine IL-15 and the activating ligand CD137 for the 4-1BB receptor on NK cells.
- NKAE cells were obtained by coculturing healthy donors’ PBMCs with K562-mbl5-4lBBL cells (Fujisaki et al, 2009) and IL-2 (see Example 3).
- the b-lymphoblastoid cells used to prepare NKAE cells are K562 mb.IL2l cells (Somanchi and Lee, 2016), which comprise K562 cells modified to express a membrane-bound form of IL-21.
- Anti-CXCR4 Abs suitable for use in the disclosed methods are K562 mb.IL2l cells (Somanchi and Lee, 2016), which comprise K562 cells modified to express a membrane-bound form of IL-21.
- the present invention provides a novel immunotherapeutic approach for treating cancer, including metastatic cancer, by combining anti-CXCR4 therapy with the demonstrated cytotoxicity of NK cells against tumors in vitro and in vivo.
- This combination therapy method employs an anti-CXCR4 Ab to block CXCR4/CXCL12 signaling, thereby disrupting tumor-stromal interactions, sensitizing sarcoma cells to the cytotoxicity of NK cells, and reducing tumor growth and metastatic burden.
- CXCR4 is over-expressed in more than 23 human cancers, and its overexpression contributes to tumor growth, invasion, angiogenesis, metastasis, relapse, and therapeutic resistance.
- cancer types associated with CXCR4 expression or the CXCR4/CXCL12 pathway include solid tumors such as breast (Dewan et al ., 2006), ovarian (Kajiyama et al., 2008), prostate (Hirata et al ., 2007; Miki et al., 2007), lung (Cavallaro, 2013; Gangadhar et al ., 2010), pancreatic (Billadeau et al ., 2006), kidney (Jones et al ., 2007; Pan et al ., 2006), oral (Ishikawa et al ., 2006; Onoue et al ., 2006), esophageal (Wu et al ., 2014), gastric (Han et al ., 2014), colorec
- CXCR4 The interaction between CXCR4 and CXCL12 is essential for homing and maintaining hematopoietic stem cells within the BM microenvironment (Mohle et al ., 1998).
- the prognostic significance of CXCR4 in patients with bone and soft tissue sarcomas has been extensively studied. In certain situations an inverse correlation has been established between CXCR4 expression and patient prognosis or survival, and in clinical studies, CXCR4 has been associated with increased propensity for metastasis and decreased survival. In a recent meta-analysis, including 12 studies with 997 sarcoma patients, CXCR4 expression was found to be significantly associated with poor overall survival (HR 2.37, 95% Cl 1.86-3.01; P ⁇ 0.001).
- TICs Tumor-initiating cells
- Example 1 shows that, among six different sarcoma cell lines tested, the RH30 alveolar rhabdomyosarcoma cell line showed the highest level of CXCR4 expression (Figure 1), concomitant with highest migration and invasion index towards CXCL12 ( Figure 2). Metastasis occurs in 20-55% of sarcoma patients and, like other cancers (Chaffer and Weinberg, 2011; Seyfried and Huysentruyt, 2013), remains the main cause of death.
- Anti-CXCR4 Abs suitable for use in the disclosed methods are Abs or antigen binding portions thereof that bind specifically to CXCR4 with high specificity and affinity.
- the Ab or antigen-binding portion thereof is a mAb or an antigen-binding portion thereof.
- the anti-CXCR4 Ab or antigen-binding portion thereof is a chimeric Ab, preferably a humanized Ab or, more preferably, a human Ab or a portion thereof.
- Such chimeric, humanized or human mAbs can be prepared and isolated by methods well known in the art, e.g ., as described in WO 2008/060367.
- the subject is a human and the Ab or fragment thereof binds to a human CXCR4 receptor.
- the anti- CXCR4 Ab or antigen-binding portion thereof blocks the binding of CXCR4 and
- CXCL12 and inhibits the activity of CXCR4, /. e. , the Ab or antigen-binding portion thereof disrupts the interaction between CXCR4 and CXCL12 and inhibits
- the anti-CXCR4 Ab or antigen-binding portion thereof induces apoptosis and/or inhibits growth of CXCR4 + tumor cells in vivo (as described in WO 2013/071068).
- Anti-CXCR4 mAbs that bind specifically to CXCR4 with high affinity specifically mAbs F7GL (ulocuplumab; also previously designated BMS-936564 and MDX-1338), F7, F9, F9GL, Dl, D1GL, E2 and E2GL, have been exemplified and described in detail in WO 2008/060367. Methods of using these Abs to treat
- hematological malignancies are also described, for example, in WO 2008/060367, WO 2013/071068 and WO 2015/069874.
- Other anti-CXCR4 mAbs that are suitable for use in the present therapeutic methods in combination with NKAE cells, have been described in, for example, WO 2008/142303, WO 2010/037831, WO 2009/140124, WO 2013/013025, and U.S. Publication No. 2015/0037328.
- Anti-CXCR4 Abs suitable for use in the present methods preferably exhibit one or more of the following characteristics that are desirable for therapeutic applications: (a) binding with high affinity to human CXCR4 expressed on a cell surface; (b) inhibiting binding of SDF-l to CXCR4; (c) inhibiting SDF-l-induced calcium flux in cells expressing CXCR4; (d) inhibiting SDF-l-induced migration of cells expressing CXCR4;
- the anti-CXCR4 mAbs disclosed in WO 2008/060367 which are suitable for use in the present methods, have been demonstrated to exhibit one or more of the following characteristics: (a) binding to human CXCR4 on a surface of a cell with an ECso of less than about 100 nM (e.g, about 20-80 nM); (b) inhibiting binding of CXCL12 to CXCR4 with an ECso equal to or less than about 30 nM (e.g, about 1-30 nM); (c) inhibiting CXCLl2-induced calcium flux in cells expressing CXCR4 with an ECso equal to or less than about 1 nM (e.g, about 0.1-1.0 nM); (d) inhibiting CXCLl2-induced migration of cells expressing CXCR4 with an EC so equal to or less than about 20 nM (e.g, about 10- 20 nM); (e) inhibiting capillary tube formation by human umbilical vein endothelial cells;
- Anti-CXCR4 Abs usable in the methods of the present invention include mAbs that bind specifically to human CXCR4 expressed on a cell surface with high affinity, for example, with a KD of 1 x 10 8 M or less as determined by surface plasmon resonance (SPR), preferably with a KD of 5 x 10 9 M or less, and exhibit at least five, and preferably all, of the other preceding characteristics.
- SPR surface plasmon resonance
- an anti-CXCR4 Ab suitable for use in the disclosed methods of treatment (a) binds to human CXCR4 with a KD of about 5 x 10 9 to 1 x 10 10 M, as determined by surface plasmon resonance (Biacore); (b) inhibits binding of CXCL12 to CXCR4 with an ECso of less than about 10 nM (e.g, about 1-10 nM); (c) induces apoptosis in cells expressing CXCR4; (d) inhibits proliferation of CXCR4 + tumor cells in vitro ; (e) inhibits CXCR4 + tumor cell proliferation and/or induces CXCR4 + tumor cell apoptosis in vivo ; and (f) inhibits metastases of CXCR4 + tumor cells.
- this disclosure provides a method for treating a subject afflicted with a cancer comprising administering to the subject a combination of therapeutically effective amounts of: (a) an isolated population of NKAE cells; and (b) an isolated Ab or an antigen-binding portion thereof that: (i) binds specifically to CXCR4 expressed on the surface of a cancer cell with high affinity, for example, with a KD of about 5 x 10 9 M or less, (ii) inhibits binding of CXCL12 to CXCR4, for example, with an ECso of less than about 10 nM, and (iii) inhibits CXCR4/CXCL12 signaling, for example, inhibits
- the Ab or an antigen-binding portion thereof also induces apoptosis in cells expressing CXCR4.
- the anti-CXCR4 Abs disclosed herein for therapeutic use comprise the heavy chain and light chain CDRl’s, CDR2’s and CDR3’s of F7, F9, Dl or E2, or combinations thereof.
- the amino acid sequences of the VH CDRl’s of F7, F9, Dl and E2 are shown in SEQ ID NOs. 1-4, respectively.
- the amino acid sequences of the VH CDR2’s of F7, F9, Dl and E2 are shown in SEQ ID NOs. 5-8, respectively.
- the amino acid sequences of the VH CDR3’S of F7, F9, Dl and E2 are shown in SEQ ID NOs. 9-12, respectively.
- the amino acid sequences of the Vk CDRl’s of F7, F9, Dl and E2 are shown in SEQ ID NOs. 13-16, respectively.
- the amino acid sequences of the Vk CDR2's of F7, F9, Dl and E2 are shown in SEQ ID NOs. 17-20, respectively.
- the amino acid sequences of the VkCDR3’s of F7, F9, Dl and E2 are shown in SEQ ID NOs. 21-24, respectively.
- the germline back-mutated“GL” variants, i.e., F7GL, F9GL, D1GL and E2GL have the same CDRs as F7, F9, Dl and E2, respectively.
- the CDR regions identified throughout this disclosure were delineated using the Kabat system (Kabat et a/. , 1991).
- the anti-CXCR4 Abs disclosed herein for therapeutic use comprise:
- the anti-CXCR4 Abs of this disclosure comprise:
- a heavy chain variable region CDR1 comprising consecutively linked amino acids having the sequence set forth in SEQ ID NO: 3 or conservative modifications thereof; a heavy chain variable region CDR2 comprising consecutively linked amino acids having the sequence set forth in SEQ ID NO: 7 or conservative modifications thereof; a heavy chain variable region CDR3 comprising consecutively linked amino acids having the sequence set forth in SEQ ID NO: 11; a light chain variable region CDR1 comprising consecutively linked amino acids having the sequence set forth in SEQ ID NO: 15 or conservative modifications thereof; a light chain variable region CDR2 comprising consecutively linked amino acids having the sequence set forth in SEQ ID NO: 19 or conservative modifications thereof; and a light chain variable region CDR3 comprising consecutively linked amino acids having the sequence set forth in SEQ ID NO: 23 or conservative modifications thereof; or
- a heavy chain variable region CDR1 comprising consecutively linked amino acids having the sequence set forth in SEQ ID NO: 4 or conservative modifications thereof; a heavy chain variable region CDR2 comprising consecutively linked amino acids having the sequence set forth in SEQ ID NO: 8 or conservative modifications thereof; a heavy chain variable region CDR3 comprising consecutively linked amino acids having the sequence set forth in SEQ ID NO: 12; a light chain variable region CDR1 comprising consecutively linked amino acids having the sequence set forth in SEQ ID NO: 16 or conservative modifications thereof; a light chain variable region CDR2 comprising consecutively linked amino acids having the sequence set forth in SEQ ID NO: 20 or conservative modifications thereof; and a light chain variable region CDR3 comprising consecutively linked amino acids having the sequence set forth in SEQ ID NO: 24 or conservative modifications thereof.
- the anti-CXCR4 Ab or antigen-binding portion thereof comprises a heavy chain variable region CDR1 comprising consecutively linked amino acids having the sequence set forth in SEQ ID NO: 1, a heavy chain variable region CDR2 comprising consecutively linked amino acids having the sequence set forth in SEQ ID NO: 5, a heavy chain variable region CDR3 comprising consecutively linked amino acids having the sequence set forth in SEQ ID NO: 9, a light chain variable region CDR1 comprising consecutively linked amino acids having the sequence set forth in SEQ ID NO: 13, a light chain variable region CDR2 comprising consecutively linked amino acids having the sequence set forth in SEQ ID NO: 17, and a light chain variable region CDR3 comprising consecutively linked amino acids having the sequence set forth in SEQ ID NO: 21.
- the anti-CXCR4 Abs or antigen-binding portions thereof comprise:
- a heavy chain variable region CDR1 comprising consecutively linked amino acids having the sequence set forth in SEQ ID NO: 2; a heavy chain variable region CDR2 comprising consecutively linked amino acids having the sequence set forth in SEQ ID NO: 6; a heavy chain variable region CDR3 comprising consecutively linked amino acids having the sequence set forth in SEQ ID NO: 10; a light chain variable region CDR1 comprising consecutively linked amino acids having the sequence set forth in SEQ ID NO: 14; a light chain variable region CDR2 comprising consecutively linked amino acids having the sequence set forth in SEQ ID NO: 18; and a light chain variable region CDR3 comprising consecutively linked amino acids having the sequence set forth in SEQ ID NO: 22;
- a heavy chain variable region CDR1 comprising consecutively linked amino acids having the sequence set forth in SEQ ID NO: 3; a heavy chain variable region CDR2 comprising consecutively linked amino acids having the sequence set forth in SEQ ID NO: 7; a heavy chain variable region CDR3 comprising consecutively linked amino acids having the sequence set forth in SEQ ID NO: 11; a light chain variable region CDR1 comprising consecutively linked amino acids having the sequence set forth in SEQ ID NO: 15 a light chain variable region CDR2 comprising consecutively linked amino acids having the sequence set forth in SEQ ID NO: 19; and a light chain variable region CDR3 comprising consecutively linked amino acids having the sequence set forth in SEQ ID NO: 23; or
- a heavy chain variable region CDR1 comprising consecutively linked amino acids having the sequence set forth in SEQ ID NO: 4; a heavy chain variable region CDR2 comprising consecutively linked amino acids having the sequence set forth in SEQ ID NO: 8; a heavy chain variable region CDR3 comprising consecutively linked amino acids having the sequence set forth in SEQ ID NO: 12; a light chain variable region CDR1 comprising consecutively linked amino acids having the sequence set forth in SEQ ID NO: 16; a light chain variable region CDR2 comprising consecutively linked amino acids having the sequence set forth in SEQ ID NO: 20; and a light chain variable region CDR3 comprising consecutively linked amino acids having the sequence set forth in SEQ ID NO: 24.
- the anti-CXCR4 Ab or antigen-binding portion thereof comprises the heavy and light chain variable regions of the F7GL, F7, F9GL, F9, D1GL, Dl, E2GL and E2 mAbs.
- the anti-CXCR4 Ab or antigen-binding portion thereof comprises a heavy chain variable region comprising consecutively linked amino acids having the sequence set forth in SEQ ID Nos. 25 or 33 and a light chain variable region comprising consecutively linked amino acids having the sequence set forth in SEQ ID Nos. 29 or 37.
- the anti-CXCR4 Abs or antigen-binding portions thereof comprise:
- the anti-CXCR4 Ab or antigen binding portion thereof comprises a heavy chain constant region which is of a human IgGl, IgG2, IgG3, or IgG4 isotype.
- the Ab or antigen-binding portion thereof comprises a heavy chain constant region (e.g ., human IgGl or IgG3) that possesses effector functions including ADCC, ADCP and/or CDC, for example it is of a human IgG3 or, preferably, human IgGl isotype, or comprises a mutation (e.g., E333A or E333S; Idusogie et al, 2001) that increases effector functions, and mediates the depletion of immunosuppressant regulatory T cells (Tregs) and myeloid-derived suppressor cells (MDSCs).
- Tregs immunosuppressant regulatory T cells
- MDSCs myeloid-derived suppressor cells
- the anti-CXCR4 Ab comprises a heavy chain constant region (e.g, human IgG2 or, preferably, IgG4) that does not possesses effector functions.
- the IgG4 heavy chain constant region of the anti- CXCR4 Ab or antigen-binding portion thereof contains an S228P mutation (numbered using the Rabat system; Rabat et al, 1991), which replaces a serine residue in the hinge region with the proline residue normally found at the corresponding position in IgGl isotype Abs. This mutation, which is present in ulocuplumab, prevents Fab arm exchange with endogenous IgG4 Abs, while retaining the low affinity for activating Fc receptors associated with wild-type IgG4 Abs.
- the Ab comprises a light chain constant region which is a human kappa or lambda constant region.
- a suitable anti-CXCR4 Ab for use in the methods disclosed herein is ulocuplumab.
- ETlocuplumab has been evaluated in two Phase 1 clinical trials in subjects with various hematological malignancies including acute myeloid leukemia (AML), multiple myeloma (MM), chronic lymphocytic leukemia (CLL), follicular lymphoma (FL) and diffuse large B cell lymphoma (DLBCL) with a safe and tolerable profile.
- AML acute myeloid leukemia
- MM multiple myeloma
- CLL chronic lymphocytic leukemia
- FL follicular lymphoma
- DLBCL diffuse large B cell lymphoma
- Efficacy data from the AML and MM cohorts has been presented and show encouraging results for the addition of ulocuplumab to standard therapy (Becker et al ., 2014; Ghobrial et al ., 2014), and Phase 1/2 clinical trials in AML and mutated CXCR4 Waldenstrom’s macroglobulinemia ( see patients are ongoing ( see NCT02305563 and NCT03225716 on the Clinical Trials Website, http://www.clinicaltrials.gov).
- a human IgGl variant of ulocuplumab is used.
- anti-CXCR4 Abs include, for example, the Abs designated c4l4H5 and c5l5H7 (WO 2010/037831), the Abs designated Antibody I, Antibody II, Antibody III, Antibody IV, and Antibody V (U.S. Patent No. 7,892,546), the Ab designated 6C7 (WO 2013/013025), and humanized 3G10 Abs, e.g ., the Abs designated h3Gl
- Anti-CXCR4 Abs usable in the methods of the disclosed invention also include antigen-binding portions of the above Abs. It has been amply demonstrated that the antigen-binding function of an Ab can be performed by fragments of a full-length Ab. Examples of binding fragments encompassed within the term“antigen-binding portion” of an Ab include (i) a Fab fragment, a monovalent fragment consisting of the YL, V/ /, CL and Cm domains; (ii) a F(ab’)2 fragment, a bivalent fragment comprising two Fab fragments linked by a disulfide bridge at the hinge region; (iii) a Fd fragment consisting of the YH and Cm domains; and (iv) a Fv fragment consisting of the YL and V/ / domains of a single arm of an Ab.
- fragments obtained initially through proteolysis with enzymes such as papain and pepsin, have been subsequently engineered into monovalent and multivalent antigen-binding fragments.
- enzymes such as papain and pepsin
- YL and YH are coded for by separate genes, they can be joined, using recombinant methods, by a synthetic linker peptide that enables them to be made as a single protein chain in which the YL and YH regions pair to form monovalent molecules known as single chain variable fragments (scFv).
- Divalent or bivalent scFvs can be engineered by linking two scFvs in within a single peptide chain known as a tandem scFv which contains two YH and two VL regions.
- ScFv dimers and higher multimers can also be created using linker peptides of fewer than 10 amino acids that are too short for the two variable regions to fold together, which forces the scFvs to dimerize and produce diabodies or form other multimers.
- Diabodies have been shown to bind to their cognate antigen with much higher affinity than the corresponding scFvs, having dissociation constants up to 40-fold lower than the KD values for the scFvs.
- Very short linkers ( ⁇ 3 amino acids) lead to the formation of trivalent triabodies or tetravalent tetrabodies that exhibit even higher affinities for to their antigens than diabodies.
- minibodies which are scFv-Cm dimers, and larger scFv-Fc fragments (scFv-C/ /2 -C/ / dimers), and even an isolated CDR may exhibit antigen-binding function.
- the Ab fragment is selected from a Fab, F(ab’)2, Fd and Fv fragment, a single domain Ab (sdAb), a single-chain variable fragment (scFv), a divalent scFv (di-scFv) and bivalent scFv (bi-scFv), a diabody, a minibody, and an isolated CDR.
- the Ab fragment is selected from a Fab, F(ab’)2, Fd and Fv fragment and a single chain variable fragment (scFv).
- Ab fragments are engineered using conventional recombinant techniques known to those of skill in the art, and the fragments are screened for utility in the same manner as are intact Abs. All of the above proteolytic and engineered fragments of Abs and related variants (see Hollinger and Hudson, 2005; Olafsen and Wu, 2010, for further details) are intended to be encompassed within the term“antigen-binding portion” of an Ab.
- Additional anti-CXCR4 Abs usable in the disclosed methods include Abs that bind specifically to human CXCR4 and cross-compete for binding to human CXCR4 with a reference Ab, for example, ulocuplumab (F7GL) or any of the Abs designated F7, F9, Dl and E2 (see, e.g. , WO 2008/060367; WO 2013/071068).
- a reference Ab for example, ulocuplumab (F7GL) or any of the Abs designated F7, F9, Dl and E2 (see, e.g. , WO 2008/060367; WO 2013/071068).
- the ability of a pair of Abs to“cross-compete” for binding to an antigen indicates that a first Ab binds to
- anti-CXCR4 Abs usable in the disclosed methods include Abs that bind specifically to substantially the same epitope region of the antigen as a reference Ab, for example, ulocuplumab.
- a first Ab is considered to bind to“substantially the same epitope” or
- the first Ab reduces the binding of the second Ab to an antigen by at least about 40%.
- the first Ab reduces the binding of the second Ab to the antigen by more than about 50% (e.g ., at least about 60% or at least about 70%).
- the first Ab reduces the binding of the second Ab to the antigen by more than about 70% (e.g., at least about 80%, at least about 90%, or about 100%).
- the order of the first and second Abs can be reversed, i.e. the“second” Ab can be first bound to the surface and the“first” is thereafter brought into contact with the surface in the presence of the“second” Ab.
- the Abs are considered to“cross-compete” if a competitive reduction in binding to the antigen is observed irrespective of the order in which the Abs are added to the antigen.
- Cross-competing Abs are expected to have similar functional properties by virtue of their binding to substantially the same epitope region of an antigen such as a CXCR4 receptor. The higher the degree of cross-competition, the more similar will the functional properties be. For example, two cross-competing Abs are expected to have essentially the same functional properties if they each inhibit binding of the other to an epitope by at least about 80%. This similarity in function is expected to be even closer if the cross- competing Abs exhibit similar affinities for binding to the epitope as measured by the dissociation constant (KD).
- KD dissociation constant
- Cross-competing anti-antigen Abs can be readily identified based on their ability to detectably compete in standard antigen binding assays, including surface plasmon resonance (BIAcore®) analysis, ELISA assays or flow cytometry, using either recombinant antigen molecules or cell-surface expressed antigen molecules.
- standard antigen binding assays including surface plasmon resonance (BIAcore®) analysis, ELISA assays or flow cytometry, using either recombinant antigen molecules or cell-surface expressed antigen molecules.
- a simple competition assay to identify whether a test Ab competes with ulocuplumab for binding to human CXCR4 may involve: (1) measuring the binding of ulocuplumab, applied at saturating concentration, to a BIAcore chip (or other suitable medium for surface plasmon resonance analysis) onto which human CXCR4 is immobilized, and (2) measuring the binding of ulocuplumab to a human CXCR4-coated BIAcore chip (or other medium suitable) to which the test Ab has been previously bound. The binding of ulocuplumab to the CXCR4-coated surface in the presence and absence of the test Ab is compared.
- a significant (e.g, more than about 40%) reduction in binding of ulocuplumab in the presence of the test Ab indicates that both Abs recognize substantially the same epitope such that they compete for binding to the CXCR4 target.
- the percentage by which the binding of a first Ab to an antigen is inhibited by a second Ab can be calculated as: [l-(detected binding of first Ab in presence of second Ab)/(detected binding of first Ab in absence of second Ab)] x 100.
- the competitive binding assay is repeated except that the binding of the test Ab to the CXCR4-coated chip in the presence of ulocuplumab is measured.
- anti-CXCR4 Abs for use in the methods of this disclosure cross- compete for binding to CXCR4 with any of mAh F7GL (ulocuplumab; having VH and VL sequences as shown in SEQ ID Nos. 33 and 37, respectively), F7, having VH and VL sequences as shown in SEQ ID Nos. 25 and 29, respectively), mAh 79GL (having VH and VL sequences as shown in SEQ ID Nos. 34 and 38, respectively), mAh F9 (having VH and VL sequences as shown in SEQ ID Nos. 26 and 30, respectively), mAh D1GL (having VH and VL sequences as shown in SEQ ID Nos.
- Abs that cross-compete for binding to CXCR4 bind to the same epitope region (i.e., the same or an overlapping epitope) on CXCR4.
- the cross-competing anti-CXCR4 mAh comprises a VH region comprising consecutively linked amino acids having a sequence derived from a human VH 3-48 germline sequence as set forth in SEQ ID NO: 41 and/or a VL region comprising consecutively linked amino acids having a sequence derived from a human VK L15 germline sequence as set forth in SEQ ID NO: 42.
- Immuno-oncology which relies on using the flexibility of the immune system to attack and destroy cancer cells, is applicable to treating a very broad range of cancers (see, e.g., Guillerey et al ., 2016; Lowry and Zehring, 2017; Callahan et al., 2016; Kamta et al ., 2017; Farkona et al ., 2016). Accordingly, the disclosed methods employing the administration of NK cells, preferably NKAE cells, combined with blockade of the CXCR4/CXCL12 signaling pathway is applicable to treating a wide variety of both solid and liquid tumors.
- the disclosed combination therapy methods may be used to treat a cancer which is a solid tumor.
- the solid tumor is a pediatric tumor.
- the pediatric tumor is a rhabdomyosarcoma, osteosarcoma, neuroblastoma, retinoblastoma, or Ewing sarcoma.
- a rhabdomyosarcoma is particularly poor for those patients with metastatic disease, at least two thirds of whom have disease progression. Outcomes after recurrence are generally dismal.
- the solid tumor is a cancer selected from small cell lung cancer (SCLC), non-small cell lung cancer (NSCLC), squamous NSCLC, non-squamous NSCLC, squamous cell cancer, non-small cell lung cancer (NSCLC), pancreatic cancer, pancreatic ductal adenocarcinoma (PD AC), ovarian cancer, cervical cancer, carcinoma of the fallopian tubes, uterine (endometrial) cancer, carcinoma of the endometrium, uterine sarcoma, carcinoma of the cervix, carcinoma of the vagina, carcinoma of the vulva, cancer of the urethra, cancer of the ureter, prostate cancer, metastatic castration-resistant prostate cancer (mCRPC), testicular cancer, penile cancer, bladder cancer, breast cancer, triple negative breast cancer (TNBC), male breast cancer, germ cell tumor, sarcoma, skin cancer, basal cell carcinoma, squamous cell carcinoma, Merkel cell carcinoma, bone cancer, melanom
- SCLC
- the cancer is an advanced, unresectable, metastatic, refractory cancer, and/or recurrent cancer.
- the present combination therapy methods may be used to treat a cancer which is a hematological malignancy.
- Hematological malignancies include liquid tumors derived from either of the two major blood cell lineages, i.e., the myeloid cell line (which produces granulocytes, erythrocytes, thrombocytes,
- lymphoid cell line which produces B, T, NK and plasma cells
- leukemias lymphomas
- myelomas myelomas
- Hematological malignancies that may be treated using the present combination therapy methods include, for example, cancers selected from acute lymphoblastic leukemia (ALL), AML, CLL, chronic myelogenous leukemia (CML), Hodgkin’s lymphoma (HL), non-Hodgkin’s lymphomas (NHLs), MM, smoldering myeloma, monoclonal
- MGUS gammopathy of undetermined significance
- advanced, metastatic, refractory and/or recurrent hematological malignancies and any combinations of said hematological malignancies.
- the hematological malignancy is a cancer selected from acute, chronic, lymphocytic (lymphoblastic) and/or myelogenous leukemias, such as ALL, AML, CLL, and CML; lymphomas, such as HL, NHLs, of which about 85% are B cell lymphomas, including DLBCL, FL, CLL/small lymphocytic lymphoma (SLL), mantle cell lymphoma, marginal zone B-cell lymphomas (mucosa-associated lymphoid tissue (MALT) lymphoma, nodal marginal zone B-cell lymphoma, and splenic marginal zone B-cell lymphoma), Burkitt lymphoma, lymphoplasmacytoid lymphoma (LPL; also known as Waldenstrom’s macroglobulinemia (WM)), hairy cell lymphoma, and primary central nervous system (CNS) lymphoma, NHLs that are T cell lymphomas, including precursor T-lymph
- lymphoma/leukemia angioimmunoblastic T-cell lymphoma, extranodal natural killer/T- cell lymphoma nasal type, enteropathy-associated intestinal T-cell lymphoma (EATL), anaplastic large-cell lymphoma (ALCL), and peripheral T-cell lymphoma unspecified, acute myeloid lymphoma, lymphoplasmacytoid lymphoma, monocytoid B cell lymphoma, angiocentric lymphoma, intestinal T-cell lymphoma, primary mediastinal B- cell lymphoma, post-transplantation lymphoproliferative disorder, true histiocytic lymphoma, primary effusion lymphoma, diffuse histiocytic lymphoma (DHL), immunoblastic large cell lymphoma, and precursor B-lymphoblastic lymphoma; myelomas, such as multiple myeloma, smoldering myeloma (also called indo
- Abs and NK cells used in the methods disclosed herein may be constituted in a composition, e.g. , a pharmaceutical composition containing an Ab or a population of NKAE cells and a pharmaceutically acceptable carrier.
- a composition e.g. , a pharmaceutical composition containing an Ab or a population of NKAE cells and a pharmaceutically acceptable carrier.
- “pharmaceutically acceptable carrier” includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like that are physiologically compatible.
- the carrier for a composition containing an Ab is suitable for intravenous, subcutaneous, intramuscular, parenteral, spinal or epidermal administration (e.g, by injection or infusion).
- the carrier for a composition containing NK cells is suitable for intravenous, intraarterial, intraperitoneal, intrafemoral, intrathecal, or intratumoral injection, or injection into a tumor resection cavity.
- a pharmaceutical composition of the invention may include one or more pharmaceutically acceptable salts, anti-oxidants, aqueous and non-aqueous carriers, and/or adjuvants such as preservatives, wetting agents, emulsifying agents and dispersing agents.
- Dosage regimens are adjusted to provide the optimum desired response, e.g, a maximal therapeutic response and/or minimal adverse effects.
- the dosage for administration of an anti-CXCR4 Ab may range from about 0.01 to about 20 mg/kg, preferably from about 1.0 to about 15 mg/kg, of the subject’s body weight.
- dosages can be about 0.1, 0.3, 1, 2, 3, 5, 10, 15 or 20 mg/kg body weight, and preferably, about 1, 3, 5, 10 or 15 mg/kg body weight.
- a fixed or flat dose e.g, about 50 to about 2000 mg of the Ab, instead of a dose based on body weight, may be administered.
- dosages can be about 200, about 400, about 800, about 1600, or about 2000 mg, and preferably, about 400, about 800, about 1600.
- the NKAE cells may be administered to the patient in a dose based on absolute numbers of cells ranging from about 10 6 to about 10 14 cells.
- cells may be administered to the subject in doses of about 1 x 10 5 , 5 x 10 5 , 1 x 10 6 , 5 x 10 6 , 1 x 10 7 , 5 x 10 7 , 1 x 10 8 , 5 x 10 8 , 1 x 10 9 , 5 x 10 9 , 1 x 10 10 , 5 x 10 10 , 1 x 10 11 , 5 x 10 11 , 1 x 10 12 , 5 x 10 12 , 1 x 10 13 , 5 x 10 13 , or 1 x 10 14 cells.
- NKAE cells are administered to the subject in doses of about 1 x 10 7 to 5 x 10 10 cells, preferably 1 x 10 8 to 5 x 10 9 cells, more preferably about 5 x 10 8 cells. In other embodiments, NKAE cells are administered to the subject in doses of about 1 x 10 5 to 1 x 10 8 cells/kg body weight, preferably about 1 x 10 6 to 5 x 10 7 cells/kg, more preferably about 7.5 c 10 6 cells/kg. NKAE cells may be administered multiple times to the patient. For example, the patient may receive one to four infusions, typically two or three infusions. These infusions are generally spaced at least one week apart.
- the dosing schedule for an Ab is typically designed to achieve exposures that result in sustained receptor occupancy (RO) based on typical pharmacokinetic properties of the Ab.
- An exemplary treatment regime entails administration of the anti-CXCR4 Ab or antigen-binding portion thereof twice about every week, once about every week, once about every 2 weeks, once about every 3 weeks, once about every 4 weeks, or once about every month.
- the anti-CXCR Ab is administered to the subject approximately weekly.
- the Ab is administered once about every 2 weeks or once about every 3 weeks.
- the NK cells are administered about weekly to the patient.
- the NK cells are administered to the patient twice about every week or once about every 2 weeks.
- the dosage and scheduling may change during a course of treatment.
- the anti-CXCR4 Ab or antigen-binding portion thereof is administered to the patient by intravenous or subcutaneous administration.
- the NK cells and the Ab or antigen binding portion thereof are administered sequentially to the subject.“Sequential” administration means that one of the NK cells and anti-CXCR4 Ab or antigen-binding portion thereof is administered before the other. Either therapeutic may be administered first; i.e., in certain embodiments, the NK cells are administered before the Ab or antigen- binding portion thereof, whereas in other embodiments, the anti-CXCR4 Ab or antigen binding portion thereof is administered before the NK cells.
- the Ab is administered by intravenous infusion over a period of about 60 minutes.
- the NK cells and the Ab or antigen-binding portion thereof are administered concurrently in separate compositions, whereas in other embodiments, the NK cells and the Ab or antigen-binding portion thereof are admixed in a single composition and administered concurrently.
- administering is continued for as long as clinical benefit is observed or until unmanageable toxicity or disease progression occurs.
- This disclosure also provides a population ofNK cells, preferably NKAE cells, and an anti-CXCR4 Ab or an antigen-binding portion thereof for use in combination in treating a subject afflicted with cancer.
- NKAE cells preferably NKAE cells
- an anti-CXCR4 Ab or an antigen-binding portion thereof for use in combination in treating a subject afflicted with cancer.
- These therapeutic agents may be used in combination therapy of the full range of cancers disclosed herein.
- the cancer is a pediatric tumor, for example, a rhabdomyosarcoma, osteosarcoma, neuroblastoma, retinoblastoma, or Ewing sarcoma.
- One aspect of the disclosed invention is the combined use of a population ofNK cells, preferably NKAE cells, and an anti-CXCR4 Ab or an antigen-binding portion thereof for the preparation of a medicament for treating a subject afflicted with a cancer.
- a population ofNK cells preferably NKAE cells
- an anti-CXCR4 Ab or an antigen-binding portion thereof for the preparation of a medicament for treating a subject afflicted with a cancer.
- the cancer is a pediatric tumor, for example, a rhabdomyosarcoma, osteosarcoma, neuroblastoma, retinoblastoma, or Ewing sarcoma.
- This disclosure also provides medical uses of a population of NKAE cells in combination with an anti-CXCR4 Ab corresponding to all the embodiments of the methods of treatment employing this combination of therapeutic agents described herein.
- kits comprising a population of NK cells, preferably NKAE cells, and an anti-CXCR4 Ab or an antigen-binding portion thereof for therapeutic use.
- Kits typically include a label indicating the intended use of the contents of the kit and instructions for use.
- the term label includes any writing, or recorded material supplied on or with the kit, or which otherwise accompanies the kit.
- this disclosure provides a kit for treating a subject afflicted with a cancer, the kit comprising: (a) one or more dosages ranging from about 50 to about 2000 mg of an Ab or an antigen-binding portion thereof that binds specifically to CXCR4 expressed on the surface of a cancer cell; (b) one or more dosages ranging from about 10 6 to about 10 14 of a population of NK cells, preferably NKAE cells; and (c) instructions for using the Ab or portion thereof and the NK cells in any of the combination therapy methods disclosed herein.
- the Abs may be co-packaged in unit dosage form.
- the kit comprises any one of the anti-human CXCR4 Abs disclosed herein, e.g ., ulocuplumab or an Ab that competes with ulocuplumab for binding to human CXCR4.
- CXCR4 was analyzed by flow cytometry on confluent cell cultures of different sarcoma cell lines: two rhabdomyosarcoma cell lines (RH30 and CW9019), two Ewing sarcoma cell lines (A4573 and A673) and two osteosarcoma cell lines (MG-63 and 143B).
- 143B (CRL-8303), MG-63 (CRL-1427) and A673 (CRL1598) cell lines were from the American Type Culture Collection.
- RH30 (ACC-489) was from the Leibniz-Institut DSMZ.
- A4573 and CW9019 were kind gifts from Dr. Javier Alonso (Institute of Health Carlos III) and Dr.
- RNA was obtained using RNeasy Mini Kit (Qiagen) according to the manufacturer’s protocol. The RNA was quantified by measuring the absorbance of extracts at 260 nm. The relative expression level of mRNA encoding human CXCR4 was determined by qRT-PCR using GUS gene expression as internal control. cDNA was synthesized from 1 pg of total RNA with the Superscript IV First- Strand Synthesis System (Invitrogen) and the supplier’s protocol.
- the cDNA was amplified in duplicate with primers for human CXCR4 (Hs00237052_ml, Applied Biosystems) and for human GUS (Fw: 5’-GAAAATATGTGGTTGGAGAGCTCATT-3’, Rv: 5’-CCGAGTGAAGATCCCCTTTTTA-3’; Probe: 5’- [6FAM]CCAGC ACTCTCGTCGGTGACTGTTC A[TAMRA]-3’ ; all from Sigma).
- DMEM-1% human serum albumin (HSA); Grifols placed in the upper compartment of 96-well transwell plates (8.0 pm pore size, Neuroprobe).
- the lower compartment was tilled with 300 pi of migration buffer alone (unconditioned medium), migration buffer with 100 ng/ml CXCL12 (R&D Systems), or migration buffer with 10% FBS.
- Invasion capacity was measured under the same conditions, with the upper part of the Tran swell membranes coated with 20 pi of 0.2 mg/ml Matrigel (Coming).
- NKAE CELS ARE CYTOTOXIC AGAINST RH30 CELLS, AND ANTI-CXCR4 IN COMBINATION WITH NKAE CELLS SYNERGISTICALLY ABROGATE
- ulocuplumab is a fully human IgG4 anti-CXCR4 mAb, it is not expected to induce ADCC (Davies and Sutton, 2015).
- the cytolytic activity of NKAE cells was measured as the percentage of killing of RH30 cells pre-coated with ulocuplumab, with an isotype control mAb, or with no mAb.
- NK cells from a healthy donor were activated and expanded with irradiated K562-mbl5-41BBL cells (Fujisaki et al ., 2009) and IL-2.
- peripheral blood mononuclear cells from healthy donors were isolated by centrifugation over a density gradient (Ficoll-Paque, GE Healthcare) (400 g, 30 min).
- the genetically modified K562mbILl5-4lBBL cell line kindly provided by Professor D. Campana (National University of Singapore), was irradiated with 100 Gy.
- NKAE cells were obtained by co-culturing donor's PBMCs with irradiated K562-mbl5-4lBBL cells in a 1 : 1.5 ratio plus 100 U/ml of IL-2 over 14-21 days in stem cell growth medium (SCGM, Cellgenix) supplemented with 10% human AB serum (Sigma) and 100 IU/mL IL-2 (Miltenyi). Fresh medium was added every 2-3 days to a final concentration of 1 x 10 6 cells/ml.
- SCGM stem cell growth medium
- NK cells CD3 , CD56 +
- T cells CD3 + , CD56
- NKT cells CD3 + , CD56 +
- Labelled Abs used in this study are listed in Table 2.
- RH30-GFP-Luc bioluminescent RH30 cells
- GFP green fluorescent protein
- Luc firefly luciferase
- Infected cells expressing high GFP levels were isolated by fluorescence activated cell sorting, cloned, expanded, and used for in vivo bioluminescence assays.
- RH-30-GFP-Luc cells retained surface CXCR4 expression and exhibited growth kinetics similar to parental RH30 cells.
- Cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM, Lonza) supplemented with 10% heat-inactivated fetal bovine serum (FBS, Gibco), 2 mM L-glutamine, 50 U/ml penicillin, and 50 pg/ml streptomycin (complete medium).
- DMEM Dulbecco’s modified Eagle’s medium
- FBS heat-inactivated fetal bovine serum
- 2 mM L-glutamine 50 U/ml penicillin
- 50 pg/ml streptomycin complete medium.
- RH30-GFP-Luc cells were pre-incubated (30 min) with indicated mAb concentrations.
- NKAE and target cells were co-cultured (4 h) at a 20: 1 or a 5: 1 ratio in DMEM- 10% FBS, then stained with 7-AAD (10 min, 4°C) and analyzed by flow cytometry. Gating on 7-AAD-positive cells within the GFP + population indicated the proportion of dead target cells. Specific killing was calculated as 100 c [(% dead target cells in sample - % spontaneous dead target clls)/(l00 - % spontaneous dead target cells)]. Target cells incubated without effector cells were used to assess spontaneous cell death.
- NKAE cells induced 23.0 ⁇ 1.8 specific RH30 cell killing in a 20: 1 E:T ratio, while ulocuplumab and control mAbs had little or no effect on the observed cytotoxicity.
- ANTI-CXCR4 ENHANCES IN VIVO ANTI-TUMOR ACTIVITY OF NKAE CELLS
- NSGTM mice (NOD.Cg-Prkdc scld I12rg tm l Wjl /SzJ, Charles River Laboratories) were maintained in the Alberto Sols Biomedical Research Institute animal facility. All procedures were approved by Considad de Madrid Animal Protection Area (PROEX 220/16) and CSIC Ethics Committee.
- NKAE cells were prepared from PBMCs using K562-mbl5-4lBBL cells as described in Example 3.
- Lentiviral particles expressing GFP and luciferase were used to transduce RH30 alveolar rhabdomyosarcoma cells.
- Six-weeks-old female mice were inoculated intravenously (i.v.) with 0.5 x 10 6 RH30- GFP + Luc + cells on Day 0 to generate an in vivo model of metastatic sarcoma.
- Five treatment groups were established (5 mice/group): untreated; isotype control IgG4 mAh; anti CXCR4 ulocuplumab; NKAE cells;
- NKAE cells Three doses of NKAE cells (5 x 10 6 cells each, weekly) were administered to the mice on Days 0 (day of tumor implant), 7 and 14; and 6 doses of ulocuplumab (15 mg/kg twice per week) were administered on Days 0, 3, 7, 10, 14 and 18. The size of developing tumors as determined by luminescent signal, was measured until Day 35, when mice were sacrificed.
- D-luciferin 150 mg/kg; Perkin Elmer
- mice were anesthetized with isoflurane in a lightproof chamber using a IVIS-Lumina II (Caliper Lifesciences). Exposure time was 100 s. Living Image v4.5.2 (Perkin Elmer) was used to quantify the data and produce pseudocolor images.
- mice dissected organs were used for total RNA extraction using RNAeasy Mini kit (Qiagen) according to the manufacturer’s protocol.
- the RNA was quantified by measuring the absorpance of extracts at 260 nm.
- the relative expression levels of mRNA encoding human CXCR4 and human GUS were determined by semi-quantitative RT-PCR.
- cDNA synthesis and human CXCR4 and human GUS amplification was performed as described in Example 1. Indicated values are relative to hCXCR4 and hGUS expression by a pellet of 10° RH30 cells.
- Micrometastasis was also detected by immunohistochemistry using hematoxylin- eosin staining and hCXCR4-specific Ab, and by fluorescence in situ hybridization using A/w-DNA as the probe. Mice dissected organs were fixed overnight in 4%
- hematoxylin/eosin For in situ hybridization, antigen retrieval was first performed with low pH buffer (RiboCC, Roche) and protease III (Roche). Slides were then incubated with the probe Alu positive control probe II (Ventana, Roche 05272041001). Three stringency washes were performed and slides were incubated with an intermediate, rabbit anti-DNP. An OmniRabbit (Ventana, Roche) conjugated with horseradish peroxidase was used for visualization. The immunohistochemical reaction was developed using silver as the chromogen (Silver kit, Ventana, Roche), and nuclei were counterstained with Carazzi’s hematoxylin. All images were captured on a Carl Zeiss Lab.Al microscope with a AxioCam ERC5S digital camera (Carl Zeiss).
- NKAE therapy had minimal effect on lung metastasis whereas ulocuplumab administered as monotherapy had a more pronounced effect in reducing the incidence of lung micrometastasis as measured by relative expression of hCXCR4 (Figure 5 A) and hGUS ( Figure 5B).
- hCXCR4 relative expression levels
- untreated mice showed 11.4 x 10 3 ⁇ 4.7 x 10 3 vs. 2.0 x 10 3 ⁇ 0.6 x 10 3 of ulocuplumab (MDXl338)-treated mice.
- Human GUS relative expression was 14.5 x 10 3 ⁇ 5.4 x 10 3 in untreated mice vs. 2.5 x 10 3 ⁇ 1.1 x 10 3 in ulocuplumab -treated mice.
- CXCR4 The expression of CXCR4 was evaluated by immunohistochemistry in 23 pediatric rhabdomyosarcoma specimens deposited in La Paz ETniversity Hospital Biobank from 2010 to 2017. The median follow up period was 7.9 years (range 0.6-18.4) and the median age of patients was 6.6 years (range 0.2-14.1). 14 specimens were diagnostic samples, 5 specimens were collected after chemotherapeutic treatment, and 4 specimens were relapse samples. Human cell samples were obtained after informed patient consent in accordance with the Helsinki Declaration. Research was approved by the La Paz Hospital Ethics Committee for Clinical Research (PI-2295). For tumor CXCR4 immunohistochemistry, formalin-fixed, paraffin-embedded tumor slides were
- Heavy chain CDR3 sequence of F9 Heavy chain CDR3 sequence of Dl 12 Heavy chain CDR3 sequence of E2
- BMS-936564 (ulocuplumab), an anti-CXCR4 antibody, in relapsed refractory acute myeloid leukemia.
- ASH American Society of Hematology
- Hsu KC Keever-Taylor CA, Wilton A et al. (2005) Improved outcome in HLA-identical sibling hematopoietic stem-cell transplantation for acute myelogenous leukemia predicted by KIR and HLA genotypes. Blood 105(12):4878-84.
- CML chronic myelogenous leukemia
- SDF-l stromal cell-derived factor-l
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Organic Chemistry (AREA)
- Immunology (AREA)
- Medicinal Chemistry (AREA)
- Epidemiology (AREA)
- Pharmacology & Pharmacy (AREA)
- Biochemistry (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biophysics (AREA)
- Genetics & Genomics (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Cell Biology (AREA)
- Hematology (AREA)
- Virology (AREA)
- Zoology (AREA)
- Developmental Biology & Embryology (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Engineering & Computer Science (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Peptides Or Proteins (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicinal Preparation (AREA)
Priority Applications (7)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US16/979,968 US20230181635A1 (en) | 2018-03-13 | 2019-03-13 | Anti-cxcr4 antibody combined with activated and expanded natural killer cells for cancer immunotherapy |
| ES19719623T ES2973728T3 (es) | 2018-03-13 | 2019-03-13 | Anticuerpo anti-CXCR4 combinado con linfocitos citolíticos naturales activados y expandidos para inmunoterapia contra el cáncer |
| EP19719623.1A EP3765519B1 (en) | 2018-03-13 | 2019-03-13 | Anti-cxcr4 antibody combined with activated and expanded natural killer cells for cancer immunotherapy |
| KR1020207029169A KR102693317B1 (ko) | 2018-03-13 | 2019-03-13 | 암 면역요법을 위한, 활성화되고 확장된 자연 킬러 세포와 조합된 항-cxcr4 항체 |
| JP2020571917A JP7561631B2 (ja) | 2018-03-13 | 2019-03-13 | 癌免疫療法のための活性化および拡張ナチュラルキラー細胞と組み合わせた抗cxcr4抗体 |
| CN201980018712.7A CN112513079A (zh) | 2018-03-13 | 2019-03-13 | 用于癌症免疫疗法的联合激活和扩增的自然杀伤细胞的抗cxcr4抗体 |
| JP2024067425A JP2024105305A (ja) | 2018-03-13 | 2024-04-18 | 癌免疫療法のための活性化および拡張ナチュラルキラー細胞と組み合わせた抗cxcr4抗体 |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201862642313P | 2018-03-13 | 2018-03-13 | |
| US62/642,313 | 2018-03-13 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2019175802A1 true WO2019175802A1 (en) | 2019-09-19 |
| WO2019175802A9 WO2019175802A9 (en) | 2019-12-12 |
Family
ID=66286540
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/IB2019/052042 Ceased WO2019175802A1 (en) | 2018-03-13 | 2019-03-13 | Anti-cxcr4 antibody combined with activated and expanded natural killer cells for cancer immunotherapy |
Country Status (7)
| Country | Link |
|---|---|
| US (1) | US20230181635A1 (enExample) |
| EP (1) | EP3765519B1 (enExample) |
| JP (2) | JP7561631B2 (enExample) |
| KR (1) | KR102693317B1 (enExample) |
| CN (1) | CN112513079A (enExample) |
| ES (1) | ES2973728T3 (enExample) |
| WO (1) | WO2019175802A1 (enExample) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US11066644B2 (en) | 2018-02-01 | 2021-07-20 | Nkmax Co., Ltd. | Method of producing natural killer cells and composition for treating cancer |
| CN115836666A (zh) * | 2021-09-20 | 2023-03-24 | 上海中医药大学附属龙华医院 | 原位骨肉瘤和肺转移瘤小鼠模型及其制法和应用 |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN117715647A (zh) * | 2021-04-08 | 2024-03-15 | 埃迪瓦生物治疗公司 | 用nk细胞和cd38靶向抗体治疗癌症 |
Citations (13)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2008060367A2 (en) | 2006-10-02 | 2008-05-22 | Medarex, Inc. | Human antibodies that bind cxcr4 and uses thereof |
| WO2008142303A2 (fr) | 2007-04-23 | 2008-11-27 | Pierre Fabre Medicament | Utilisation d'un anticorps anti-cxcr4 pour le traitement du cancer |
| WO2009140124A1 (en) | 2008-05-14 | 2009-11-19 | Eli Lilly And Company | Anti-cxcr4 antibodies |
| WO2010037831A1 (en) | 2008-10-01 | 2010-04-08 | Pierre Fabre Medicament | Anti cxcr4 antibodies and their use for the treatment of cancer |
| US7767429B2 (en) | 2003-03-05 | 2010-08-03 | Halozyme, Inc. | Soluble hyaluronidase glycoprotein (sHASEGP), process for preparing the same, uses and pharmaceutical compositions comprising thereof |
| US7892546B2 (en) | 2008-05-14 | 2011-02-22 | Eli Lilly And Company | Anti-CXCR4 antibodies |
| WO2013013025A2 (en) | 2011-07-20 | 2013-01-24 | Medimmune Limited | Anti-cxcr4 antibodies and methods of use |
| WO2013071068A2 (en) | 2011-11-09 | 2013-05-16 | Bristol-Myers Squibb Company | Treatment of hematologic malignancies with an anti-cxcr4 antibody |
| US20150037328A1 (en) | 2013-08-02 | 2015-02-05 | Pfizer Inc. | Anti-cxcr4 antibodies and antibody-drug conjugates |
| WO2015069874A1 (en) | 2013-11-06 | 2015-05-14 | Bristol-Myers Squibb Company | Treatment of c1013g/cxcr4-associated waldenström's macroglobulinemia with an anti-cxcr4 antibody |
| WO2016077734A2 (en) * | 2014-11-14 | 2016-05-19 | The United States Of America, As Represented By The Secretary, Department Of Health And Human Services | Nk cells with an increased antibody-dependent cellular toxicity (adcc) against tumors |
| WO2016201425A1 (en) | 2015-06-12 | 2016-12-15 | Bristol-Myers Squibb Company | Treatment of cancer by combined blockade of the pd-1 and cxcr4 signaling pathways |
| WO2017049228A1 (en) * | 2015-09-18 | 2017-03-23 | The General Hospital Corporation Dba Massachusetts General Hospital | Modified natural killer cells having anti-fugetactic properties and uses thereof |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102428173B (zh) * | 2009-03-26 | 2014-07-30 | 细胞维护北欧制药公司 | Nk细胞的扩增 |
| US20140120555A1 (en) | 2011-06-20 | 2014-05-01 | Pierre Fabre Medicament | Anti-cxcr4 antibody with effector functions and its use for the treatment of cancer |
| US11639384B2 (en) * | 2014-10-28 | 2023-05-02 | University Children's Hospital Tübingen | Treatment of pediatric BCP-ALL patients with an anti-KIR antibody |
-
2019
- 2019-03-13 ES ES19719623T patent/ES2973728T3/es active Active
- 2019-03-13 EP EP19719623.1A patent/EP3765519B1/en active Active
- 2019-03-13 KR KR1020207029169A patent/KR102693317B1/ko active Active
- 2019-03-13 CN CN201980018712.7A patent/CN112513079A/zh active Pending
- 2019-03-13 WO PCT/IB2019/052042 patent/WO2019175802A1/en not_active Ceased
- 2019-03-13 JP JP2020571917A patent/JP7561631B2/ja active Active
- 2019-03-13 US US16/979,968 patent/US20230181635A1/en active Pending
-
2024
- 2024-04-18 JP JP2024067425A patent/JP2024105305A/ja not_active Withdrawn
Patent Citations (13)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7767429B2 (en) | 2003-03-05 | 2010-08-03 | Halozyme, Inc. | Soluble hyaluronidase glycoprotein (sHASEGP), process for preparing the same, uses and pharmaceutical compositions comprising thereof |
| WO2008060367A2 (en) | 2006-10-02 | 2008-05-22 | Medarex, Inc. | Human antibodies that bind cxcr4 and uses thereof |
| WO2008142303A2 (fr) | 2007-04-23 | 2008-11-27 | Pierre Fabre Medicament | Utilisation d'un anticorps anti-cxcr4 pour le traitement du cancer |
| WO2009140124A1 (en) | 2008-05-14 | 2009-11-19 | Eli Lilly And Company | Anti-cxcr4 antibodies |
| US7892546B2 (en) | 2008-05-14 | 2011-02-22 | Eli Lilly And Company | Anti-CXCR4 antibodies |
| WO2010037831A1 (en) | 2008-10-01 | 2010-04-08 | Pierre Fabre Medicament | Anti cxcr4 antibodies and their use for the treatment of cancer |
| WO2013013025A2 (en) | 2011-07-20 | 2013-01-24 | Medimmune Limited | Anti-cxcr4 antibodies and methods of use |
| WO2013071068A2 (en) | 2011-11-09 | 2013-05-16 | Bristol-Myers Squibb Company | Treatment of hematologic malignancies with an anti-cxcr4 antibody |
| US20150037328A1 (en) | 2013-08-02 | 2015-02-05 | Pfizer Inc. | Anti-cxcr4 antibodies and antibody-drug conjugates |
| WO2015069874A1 (en) | 2013-11-06 | 2015-05-14 | Bristol-Myers Squibb Company | Treatment of c1013g/cxcr4-associated waldenström's macroglobulinemia with an anti-cxcr4 antibody |
| WO2016077734A2 (en) * | 2014-11-14 | 2016-05-19 | The United States Of America, As Represented By The Secretary, Department Of Health And Human Services | Nk cells with an increased antibody-dependent cellular toxicity (adcc) against tumors |
| WO2016201425A1 (en) | 2015-06-12 | 2016-12-15 | Bristol-Myers Squibb Company | Treatment of cancer by combined blockade of the pd-1 and cxcr4 signaling pathways |
| WO2017049228A1 (en) * | 2015-09-18 | 2017-03-23 | The General Hospital Corporation Dba Massachusetts General Hospital | Modified natural killer cells having anti-fugetactic properties and uses thereof |
Non-Patent Citations (96)
| Title |
|---|
| ALSAYED Y; NGO H; RUNNELS J; LELEU X; SINGHA UK ET AL.: "Mechanisms of regulation of CXCR4/SDF-1 (CXCL12)-dependent migration and homing in multiple myeloma", BLOOD, vol. 109, no. 7, 2007, pages 2708 - 17 |
| AZAB AK; RUNNELS JM; PITSILLIDES C; MOREAU AS; AZAB F ET AL.: "CXCR4 inhibitor AMD3100 disrupts the interaction of multiple myeloma cells with the bone marrow microenvironment and enhances their sensitivity to therapy", BLOOD, vol. 113, no. 18, 2009, pages 4341 - 51, XP002663167, DOI: doi:10.1182/blood-2008-10-186668 |
| BACHANOVA V; COOLEY S; DEFOR TE; VERNERIS MR; ZHANG B ET AL.: "Clearance of acute myeloid leukemia by haploidentical natural killer cells is improved using IL-2 diphtheria toxin fusion protein", BLOOD, vol. 123, 2014, pages 3855 - 3863 |
| BALKWILL F: "The significance of cancer cell expression of the chemokine receptor CXCR4", SEMIN CANCER BIOL, vol. 14, 2004, pages 171 - 9 |
| BECKER PS; FORAN J; ALTMAN J ET AL.: "Targeting the CXCR4 pathway: Safety, tolerability and clinical activity of BMS-936564 (ulocuplumab), an anti-CXCR4 antibody, in relapsed refractory acute myeloid leukemia", 56TH AMERICAN SOCIETY OF HEMATOLOGY (ASH) ANNUAL MEETING, 2014 |
| BERTOLINI 1; DELL'AGNOLA C; MANCUSO P ET AL., CXCR4 NEUTRALIZATION , A NOVEL THERAPEUTIC APPROACH FOR NON-HODGKIN'S LYMPHOMA, vol. 62, no. 11, 2002, pages 3106 - 12 |
| BIAN XW; YANG SX; CHEN JH ET AL.: "Preferential expression of chemokine receptor CXCR4 by highly malignant human gliomas and its association with poor patient survival", NEUROSURGERY, vol. 61, 2007, pages 570 - 8 |
| BILLADEAU DD; CHATTERJEE S; BRAMATI P ET AL.: "Characterization of the CXCR4 signaling in pancreatic cancer cells", INT J GASTROINTEST CANCER, vol. 37, 2006, pages 110 - 9, XP055511075, DOI: doi:10.1007/s12029-007-0011-7 |
| BRENNECKE P; ARLT MJ; CAMPANILE C ET AL.: "CXCR4 antibody treatment suppresses metastatic spread to the lung of intratibial human osteosarcoma xenografts in mice", CLIN EXP METASTASIS, vol. 31, 2014, pages 339 - 49 |
| CALLAHAN M; POSTOW MA; WOLCHOK JD: "Targeting T cell co-receptors for cancer therapy", IMMUNITY, vol. 44, no. 5, 2016, pages 1069 - 78, XP029537989, DOI: doi:10.1016/j.immuni.2016.04.023 |
| CAVALLARO S: "CXCR4/CXCL12 in non-small-cell lung cancer metastasis to the brain", INT J MOL SCI, vol. 14, 2013, pages 1713 - 27 |
| CHAFFER CL; WEINBERG RA: "A perspective on cancer cell metastasis", SCIENCE, vol. 331, 2011, pages 1559 - 64, XP055424410, DOI: doi:10.1126/science.1203543 |
| CHATTERJEE S; BEHNAM AZAD B; NIMMAGADDA S: "The intricate role of CXCR4 in cancer", ADV CANCER RES, vol. 124, 2014, pages 31 - 82, XP055369748, DOI: doi:10.1016/B978-0-12-411638-2.00002-1 |
| CHEN DS; MELLMAN I: "Oncology meets immunology: the cancer-immunity cycle", IMMUNITY, vol. 39, no. 1, 2013, pages 1 - 10, XP002742399, DOI: doi:10.1016/j.immuni.2013.07.012 |
| CHEN YING ET AL: "Gene-modified NK-92MI cells expressing a chimeric CD16-BB-[zeta] or CD64-BB-[zeta] receptor exhibit enhanced cancer-killing ability in combination with therapeutic antibody.", ONCOTARGET 06 JUN 2017, vol. 8, no. 23, 6 June 2017 (2017-06-06), pages 37128 - 37139, XP002791835, ISSN: 1949-2553 * |
| CHO D; SHOOK DR; SHIMASAKI N: "Cytotoxicity of activated natural killer cells against pediatric solid tumors", CLIN CANCER RES, vol. 16, no. 15, 2010, pages 3901 - 9 |
| CRAZZOLARA R; KRECZY A; MANN G ET AL.: "High expression of the chemokine receptor CXCR4 predicts extramedullary organ infiltration in childhood acute lymphoblastic leukaemia", BR J HAEMATOL, vol. 115, 2001, pages 545 - 53, XP009128303, DOI: doi:10.1046/j.1365-2141.2001.03164.x |
| DAVIES AM; SUTTON BJ: "Human IgG4: A structural perspective", IMMUNOLOGICAL REVIEWS, vol. 268, 2015, pages 139 - 159 |
| DE FALCO V; GUARINO V; AVILLA E ET AL.: "Biological role and potential therapeutic targeting of the chemokine receptor CXCR4 in undifferentiated thyroid cancer", CANCER RES, vol. 67, 2007, pages 11821 - 9, XP055074171, DOI: doi:10.1158/0008-5472.CAN-07-0899 |
| DEWAN MZ; AHMED S; IWASAKI Y ET AL.: "Stromal cell-derived factor-1 and CXCR4 receptor interaction in tumor growth and metastasis of breast cancer", BIOMED PHARMACOTHER, vol. 60, 2006, pages 273 - 276, XP028022766, DOI: doi:10.1016/j.biopha.2006.06.004 |
| DOMANSKA UM; KRUIZINGA RC; NAGENGAST ET AL.: "A review on CXCR4/CXCL12 axis in oncology: No place to hide", EUR J CANCER, vol. 49, 2013, pages 219 - 30, XP002724533, DOI: doi:10.1016/j.ejca.2012.05.005 |
| DUDA DG; KOZIN SV; KIRKPATRICK ND ET AL.: "CXCL12 (SDF-1)-CXCR4/CXCR7 pathway inhibition: An emerging sensitizer for anticancer therapies?", CLIN CANCER RES, vol. 17, 2011, pages 2074 - 80 |
| FARKONA S; DIAMANDIS EP; BLASUTIG IM ET AL.: "Cancer immunotherapy: the beginning of the end of cancer?", BMC MEDICINE, vol. 14, 2016, pages 73 |
| FERNANDEZ L; PORTUGAL R; VALENTIN J ET AL.: "In vitro natural killer cell immunotherapy for medulloblastoma", FRONT ONCOL, vol. 3, 2013, pages 94 |
| FERNANDEZ L; VALENTIN J; ZALACAIN M: "Activated and expanded natural killer cells target osteosarcoma tumor initiating cells in an NKG2D-NKG2DL dependent manner", CANCER LETT, vol. 368, no. 1, 2015, pages 54 - 63 |
| FUJISAKI H; KAKUDA H; SHIMASAKI N ET AL.: "Expansion of highly cytotoxic human natural killer cells for cancer cell therapy", CANCER RES, vol. 69, no. 9, 2009, pages 4010 - 7, XP002571651, DOI: doi:10.1158/0008-5472.CAN-08-3712 |
| GANGADHAR T; NANDI S; SALGIA R: "The role of chemokine receptor CXCR4 in lung cancer", CANCER BIOL THER, vol. 9, 2010, pages 409 - 16 |
| GELMINI S; MANGONI M; CASTIGLIONE F ET AL.: "The CXCR4/CXCL 12 axis in endometrial cancer", CLIN EXP METASTASIS, vol. 26, 2009, pages 261 - 268, XP019672705 |
| GHOBRIAL I; PEREZ R; BAZ R ET AL.: "Phase Ib study of the novel anti-CXCR4 antibody ulocuplumab (BMS-936564) in combination with lenalidomide plus low-dose dexamethasone, or with bortezomib plus dexamethasone in subjects with relapsed or refractory multiple myeloma", 56TH AMERICAN SOCIETY OF HEMATOLOGY (ASH) ANNUAL MEETING, 6 December 2014 (2014-12-06) |
| GUILLEREY C; HUNTINGTON ND; SMYTH MJ ET AL.: "Targeting natural killer cells in cancer immunotherapy", NATURE IMMUNOL, 2016, pages 1025 - 36 |
| HAN M; LV S; ZHANG Y ET AL.: "The prognosis and clinicopathology of CXCR4 in gastric cancer patients: a meta-analysis", TUMOUR BIOL, vol. 35, 2014, pages 4589 - 97, XP036266613, DOI: doi:10.1007/s13277-013-1603-4 |
| HIRATA H; HINODA Y; KIKUNO N ET AL.: "CXCL12 G801A polymorphism is a risk factor for sporadic prostate cancer susceptibility", CLIN CANCER RES, vol. 13, 2007, pages 5056 - 62 |
| HOFER ERHARD ET AL: "Natural Killer Cell-Based Cancer Immunotherapies: From Immune Evasion to Promising Targeted Cellular Therapies.", FRONTIERS IN IMMUNOLOGY 2017, vol. 8, 2017, pages 745, XP002791836, ISSN: 1664-3224 * |
| HOLLINGER P; HUDSON PJ: "Engineered antibody fragments and the rise of single domains", NATURE BIOTECH, vol. 23, no. 9, 2005, pages 1126 - 36, XP008076746, DOI: doi:10.1038/nbt1142 |
| HSU KC; KEEVER-TAYLOR CA; WILTON A ET AL.: "Improved outcome in HLA-identical sibling hematopoietic stem-cell transplantation for acute myelogenous leukemia predicted by KIR and HLA genotypes", BLOOD, vol. 105, no. 12, 2005, pages 4878 - 84 |
| IDUSOGIE EE; WONG PY; PRESTA LG ET AL.: "Engineered antibodies with increased activity to recruit complement", J, vol. 166, no. 4, 2001, pages 2571 - 5, XP002781370, DOI: doi:10.4049/jimmunol.166.4.2571 |
| IGARASHI T; WYNBERG J; SRINIVASAN R ET AL.: "Enhanced cytotoxicity of allogeneic NK cells with killer immunoglobulin-like receptor ligand incompatibility against melanoma and renal cell carcinoma cells", BLOOD, vol. 104, 2004, pages 170 - 7, XP002382433, DOI: doi:10.1182/blood-2003-12-4438 |
| IMAI C; IWAMOTO S; CAMPANA D: "Genetic modification of primary natural killer cells overcomes inhibitory signals and induces specific killing of leukemic cells", BLOOD, vol. 106, no. 1, 2005, pages 376 - 83, XP002662099, DOI: doi:10.1182/blood-2004-12-4797 |
| ISHIKAWA E; TSUBOI K; SAIJO K ET AL.: "Autologous natural killer cell therapy for human recurrent malignant glioma", ANTICANCER RES, vol. 24, 2004, pages 1861 - 1871 |
| ISHIKAWA T; NAKASHIRO K; HARA S ET AL.: "CXCR4 expression is associated with lymph-node metastasis of oral squamous cell carcinoma", INT J ONCOL, vol. 28, 2006, pages 61 - 66 |
| ISHIKAWA TAKESHI ET AL: "Phase I clinical trial of adoptive transfer of expanded natural killer cells in combination with IgG1 antibody in patients with gastric or colorectal cancer.", INTERNATIONAL JOURNAL OF CANCER 15 06 2018, vol. 142, no. 12, 31 January 2018 (2018-01-31), pages 2599 - 2609, XP002791834, ISSN: 1097-0215 * |
| JIN L; TABE Y; KONOPLEV S ET AL.: "CXCR4 up-regulation by imatinib induces chronic myelogenous leukemia (CML) cell migration to bone marrow stroma and promotes survival of quiescent CML cells", MOL CANCER THER, vol. 7, 2008, pages 48 - 58 |
| JONES J; MARIAN D; WEICH E ET AL.: "CXCR4 chemokine receptor engagement modifies integrin dependent adhesion of renal carcinoma cells", EXP CELL RES, vol. 313, 2007, pages 4051 - 65, XP022317424, DOI: doi:10.1016/j.yexcr.2007.07.001 |
| KABAT EA; WU TT; PERRY H ET AL.: "Sequences of Proteins of Immunological Interest", 1991, U.S. DEPARTMENT OF HEALTH AND HUMAN SERVICES, NIH |
| KAJIYAMA H; SHIBATA K; TERAUCHI M ET AL.: "Involvement of SDF-lalpha/CXCR4 axis in the enhanced peritoneal metastasis of epithelial ovarian carcinoma", INT J CANCER, vol. 122, 2008, pages 91 - 99 |
| KALINKOVICH A; TAVOR S; AVIGDOR A: "Functional CXCR4-expressing microparticles and SDF-1 correlate with circulating acute myelogenous leukemia cells", CANCER RES, vol. 66, 2006, pages 11013 - 20 |
| KAMIYA T; CHANG Y-H; CAMPANA D: "Expanded and activated natural killer cells for immunotherapy of hepatocellular carcinoma", CANCER IMMUNOL RES, vol. 4, no. 7, 2016, pages 547 - 81 |
| KAMTA J; CHAAR M; ANDE A: "Advancing cancer therapy with present and emerging immuno-oncology approaches", FRONT ONCOL, vol. 18, no. 7, 2017, pages 64 |
| KROOK MA; NICHOLLS LA; SCANNELL CA ET AL.: "Stress-induced CXCR4 promotes migration and invasion of ewing sarcoma", MOL CANCER RES, vol. 12, 2014, pages 953 - 64 |
| KUHNE MR; MULVEY T; BELANGER B ET AL.: "BMS-936564/MDX-1338: a fully human anti-CXCR4 antibody induces apoptosis in vitro and shows antitumor activity in vivo in hematologic malignancies", CLIN CANCER RES, vol. 19, 2013, pages 357 - 66, XP055280873, DOI: doi:10.1158/1078-0432.CCR-12-2333 |
| LANIER LL: "NK cell recognition", ANNU REV IMMUNOL, vol. 23, 2005, pages 225 - 74 |
| LANIER LL; BUCK DW; RHODES L ET AL.: "Interleukin 2 activation of natural killer cells rapidly induces the expression and phosphorylation of the Leu-23 activation antigen", JEXPMED, vol. 167, 1988, pages 1572 - 85 |
| LAVERDIERE C; HOANG BH; YANG R ET AL.: "Messenger RNA expression levels of CXCR4 correlate with metastatic behavior and outcome in patients with osteosarcoma", CLIN CANCER RES, vol. 11, no. 7, 2005, pages 2561 - 7 |
| LEAVEY PJ; MASCARENHAS L; MARINA N ET AL.: "Prognostic factors for patients with Ewing sarcoma (EWS) at first recurrence following multi-modality therapy: A report from the Children's Oncology Group", PEDIATR BLOOD CANCER, vol. 51, no. 3, 2008, pages 334 - 8 |
| LEE B; SHARRON, M; MONTANER LJ ET AL.: "Quantification of CD4, CCR5, and CXCR4 levels on lymphocyte subsets, dendritic cells, and differentially conditioned monocyte-derived macrophages", PROC NATL ACAD SCI USA, vol. 96, 1999, pages 5215 - 20, XP055570624, DOI: doi:10.1073/pnas.96.9.5215 |
| LEIVAS A; PEREZ-MARTINEZ A; BLANCHARD MJ ET AL.: "Novel treatment strategy with autologous activated and expanded natural killer cells plus anti-myeloma drugs for multiple myeloma", ONCOIMMUNOLOGY, vol. 5, no. 12, 2016, pages el250051 |
| LESOKHIN AM; CALLAHAN MK; POSTOW MA; WOLCHOK JD: "On being less tolerant: enhanced cancer immunosurveillance enabled by targeting checkpoints and agonists of T cell activation", SCI TRANSL MED, vol. 7, no. 280, 2015, pages 280sr1 |
| LI Y-J; DAI Y-L; ZHANG WB ET AL.: "Clinicopathological and prognostic significance of chemokine receptor CXCR4 in patients with bone and soft tissue sarcoma: a meta-analysis", CLIN EXP MED, vol. 9, 2015, pages 11101 - 12 |
| LIBURA J; DRUKALA J; MAJKA M ET AL.: "CXCR4-SDF-1 signaling is active in rhabdomyosarcoma cells and regulates locomotion, chemotaxis, and adhesion", BLOOD, vol. 100, 2002, pages 2597 - 606 |
| LONDON L; PERUSSIA B; TRINCHIERI G: "Induction of proliferation in vitro of resting human natural killer cells: IL 2 induces into cell cycle most peripheral blood NK cells, but only a minor subset of low density T cells", J, vol. 137, 1986, pages 3845 - 54 |
| LONG EO; KIM HS; LIU D ET AL.: "Controlling natural killer cell responses: integration of signals for activation and inhibition", ANNU REV IMMUNOL, vol. 31, 2013, pages 227 - 58, XP055543963, DOI: doi:10.1146/annurev-immunol-020711-075005 |
| LOWRY LE; ZEHRING WA: "Potentiation of natural killer cells for cancer immunotherapy: a review of literature", FRONT IMMUNOL, vol. 8, 2017, pages 1061 |
| LV S; YANG Y; KWON S ET AL.: "The association of CXCR4 expression with prognosis and clinicopathological indicators in colorectal carcinoma patients: a meta-analysis", HISTOPATHOL, vol. 64, 2014, pages 701 - 712 |
| MIKI J; FURUSATO B; LI H: "Identification of putative stem cell markers, CD 133 and CXCR4, in hTERT-immortalized primary nonmalignant and malignant tumor-derived human prostate epithelial cell lines and in prostate cancer specimens", CANCER RES, vol. 67, 2007, pages 3153 - 61 |
| MILLER JS; SOIGNIER Y; PANOSKALTSIS-MORTARI A ET AL.: "Successful adoptive transfer and in vivo expansion of human haploidentical NK cells in patients with cancer", BLOOD, vol. 105, no. 8, 2005, pages 3051 - 7, XP002452476, DOI: doi:10.1182/blood-2004-07-2974 |
| MOHLE R; FAILENSCHMID C; BAUTZ F ET AL.: "Overexpression of the chemokine receptor CXCR4 in B cell chronic lymphocytic leukemia is associated with increased functional response to stromal cell-derived factor-1 (SDF-1", LEUKEMIA, vol. 13, 1999, pages 1954 - 9 |
| MORETTA L; LOCATELLI F; PENDE D ET AL.: "Killer Ig-like receptor-mediated control of natural killer cell alloreactivity in haploidentical hematopoietic stem cell transplantation", BLOOD, vol. 117, no. 3, 2011, pages 764 - 71 |
| NAUSCH N; CERWENKA A: "NKG2D ligands in tumor immunity", ONCOGENE, vol. 27, no. 45, 2008, pages 5944 - 58 |
| NGUYEN DX; BOS PD; MASSAGUE J: "Metastasis: From dissemination to organ-specific colonization", NAT REV CANCER, vol. 9, 2009, pages 274 - 84, XP055359862, DOI: doi:10.1038/nrc2622 |
| OLAFSEN T; WU AM: "Antibody vectors for imaging", SEMIN NUCL MED, vol. 40, no. 3, 2010, pages 167 - 81 |
| ONOUE T; UCHIDA D; BEGUM NM ET AL.: "Epithelial-mesenchymal transition induced by the stromal cell-derived factor-1/CXCR4 system in oral squamous cell carcinoma cells", INT J ONCOL, vol. 29, 2006, pages 1133 - 8 |
| PAN J; MESTAS J; BURDICK MD ET AL.: "Stromal derived factor-1 (SDF-1/CXCL12) and CXCR4 in renal cell carcinoma metastasis", MOL CANCER, vol. 5, 2006, pages 56, XP021024371, DOI: doi:10.1186/1476-4598-5-56 |
| PASSARO D; IRIGOYEN M; CATHERINET C ET AL.: "CXCR4 Is Required for Leukemia-Initiating Cell Activity in T Cell Acute Lymphoblastic Leukemia", CANCER CELL, vol. 27, no. 6, 2015, pages 769 - 79, XP029166211, DOI: doi:10.1016/j.ccell.2015.05.003 |
| PEGRAM HJ; ANDREWS DM; SMYTH MJ ET AL.: "Activating and inhibitory receptors of natural killer cells", IMMUNOL CELL BIOL, vol. 89, no. 2, 2011, pages 216 - 24, XP055395388, DOI: doi:10.1038/icb.2010.78 |
| PENDE D; MARCENARO S; FALCO M ET AL.: "Anti-leukemia activity of alloreactive NK cells in KIR ligand-mismatched haploidentical HSCT for pediatric patients: evaluation of the functional role of activating KIR and redefinition of inhibitory KIR specificity", BLOOD, vol. 113, no. 13, 2009, pages 3119 - 29, XP055244362, DOI: doi:10.1182/blood-2008-06-164103 |
| PEREZ-MARTINEZ A; DE PRADA VICENTE I; FERNANDEZ L ET AL.: "Natural killer cells can exert a graft-vs-tumor effect in haploidentical stem cell transplantation for pediatric solid tumors", EXP HEMATOL, vol. 40, no. 11, 2012, pages 882 - 91 |
| PEREZ-MARTINEZ A; FERNANDEZ L; VALENTIN J ET AL.: "A phase I/II trial of interleukin-15-stimulated natural killer cell infusion after haploidentical stem cell transplantation for pediatric refractory solid tumors", CYTOTHERAPY, vol. 17, no. 11, 2015, pages 1594 - 603 |
| PEREZ-MARTINEZ A; LEUNG W; MUNOZ E ET AL.: "KIR-HLA receptor-ligand mismatch associated with a graft-versus-tumor effect in haploidentical stem cell transplantation for pediatric metastatic solid tumors", PEDIATR BLOOD CANCER, vol. 53, no. 1, 2009, pages 120 - 4 |
| PEREZ-MARTINEZ A; VALENTIN J; FERNANDEZ L ET AL.: "Arabinoxylan rice bran (MGN-3/Biobran) enhances natural killer cell-mediated cytotoxicity against neuroblastoma in vitro and in vivo", CYTOTHERAPY, vol. 17, no. 5, 2015, pages 601 - 12 |
| PITT LA; TIKHONOVA AN; HU H ET AL.: "CXCL12-Producing Vascular Endothelial Niches Control Acute T Cell Leukemia Maintenance", CANCER CELL, vol. 27, no. 6, 2015, pages 755 - 68, XP029166210, DOI: doi:10.1016/j.ccell.2015.05.002 |
| RABINOWICH H; SEDLMAYR P; HERBERMAN RB; WHITESIDE TL: "Increased proliferation, lytic activity, and purity of human natural killer cells cocultured with mitogen-activated feeder cells", CELL IMMUNOL, vol. 135, 1991, pages 454 - 70, XP024001917, DOI: doi:10.1016/0008-8749(91)90290-R |
| RIKA FUJII ET AL: "A potential therapy for chordoma via antibody-dependent cell-mediated cytotoxicity employing NK or high-affinity NK cells in combination with cetuximab", JOURNAL OF NEUROSURGERY, vol. 128, no. 5, 28 July 2017 (2017-07-28), US, pages 1419 - 1427, XP055488734, ISSN: 0022-3085, DOI: 10.3171/2017.1.JNS162610 * |
| RUBNITZ JE; INABA H; RIBEIRO RC; POUNDS S ET AL.: "NKAML: a pilot study to determine the safety and feasibility of haploidentical natural killer cell transplantation in childhood acute myeloid leukemia", J CLIN ONCOL, vol. 28, no. 6, 2010, pages 955 - 9, XP055310282, DOI: doi:10.1200/JCO.2009.24.4590 |
| SCALA S; OTTAIANO A; ASCIERTO PA ET AL.: "Expression of CXCR4 predicts poor prognosis in patients with malignant melanoma", CLIN CANCER RES, vol. 11, 2005, pages 1835 - 41 |
| SCHIMANSKI CC; BAHRE R; GOCKEL I ET AL.: "Dissemination of hepatocellular carcinoma is mediated via chemokine receptor CXCR4", BR J CANCER, vol. 95, 2006, pages 210 - 7 |
| SEYFRIED TN; HUYSENTRUYT LC: "On the origin of cancer metastasis", CRIT REV ONCOG, vol. 18, no. 1-2, 2013, pages 43 - 73 |
| SOMANCHI SS; LEE DA: "Ex vivo expansion of human NK cells using K562 engineered to express membrane bound IL21", METHODSMOL BIOL, vol. 1441, 2016, pages 175 - 93 |
| STILLER CA; TRAMA A; SERRAINO D ET AL.: "Descriptive epidemiology of sarcomas in Europe: Report from the RARECARE project", EUR J CANCER, vol. 49, 2013, pages 684 - 695 |
| SZMANIA S; LAPTEVA N; GARG T ET AL.: "Fresh ex vivo expanded natural killer cells demonstrate robust proliferation in vivo in high-risk relapsed multiple myeloma (MM) patients", JIMMUNOTHER, vol. 38, no. 1, 2015, pages 24 - 36, XP055497771, DOI: doi:10.1097/CJI.0000000000000059 |
| TAVOR S; PETIT I; POROZOV S ET AL.: "CXCR4 regulates migration and development of human acute myelogenous leukemia stem cells in transplanted NOD/SCID mice", CANCER RES, vol. 64, 2004, pages 2817 - 24 |
| VELA M; ARIS M; LLORENTE M ET AL.: "Chemokine receptor-specific antibodies in cancer immunotherapy: Achievements and challenges", FRONT IMMUNOL, vol. 6, 2015, pages 12, XP055455872, DOI: doi:10.3389/fimmu.2015.00012 |
| VELA M; CORRAL D; CARRASCO P ET AL.: "Haploidentical IL-15/41BBL activated and expanded natural killer cell infusion therapy after salvage chemotherapy in children with relapsed and refractory leukemia", CANCER LETT, vol. 422, 2018, pages 107 - 17 |
| VERHOEVEN DHJ; DE HOOGE ASK; MOOIMAN ECK ET AL.: "NK cells recognize and lyse Ewing sarcoma cells through NKG2D and DNAM-1 receptor dependent pathways", MOL IMMUNOL, vol. 45, no. 15, 2008, pages 3917 - 25, XP023976263, DOI: doi:10.1016/j.molimm.2008.06.016 |
| VIVIER E; RAULET DH; MORETTA A ET AL.: "Innate or adaptive immunity? The example of natural killer cells", SCIENCE, vol. 331, no. 6013, 2011, pages 44 - 9 |
| WU J; WU X; LIANG W ET AL.: "Clinicopathological and prognostic significance of chemokine receptor CXCR4 overexpression in patients with esophageal cancer: a meta-analysis", TUMOUR BIOL, vol. 35, 2014, pages 3709 - 15 |
| ZHENG Y; DOU Y; DUAN L ET AL.: "Using chemo-drugs or irradiation to break immune tolerance and facilitate immunotherapy in solid cancer", CELL IMMUNOL, vol. 294, 2015, pages 54 - 59, XP055437747, DOI: doi:10.1016/j.cellimm.2015.02.003 |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US11066644B2 (en) | 2018-02-01 | 2021-07-20 | Nkmax Co., Ltd. | Method of producing natural killer cells and composition for treating cancer |
| US12098388B2 (en) | 2018-02-01 | 2024-09-24 | Nkmax Co., Ltd. | Method of producing natural killer cells and composition for treating cancer |
| CN115836666A (zh) * | 2021-09-20 | 2023-03-24 | 上海中医药大学附属龙华医院 | 原位骨肉瘤和肺转移瘤小鼠模型及其制法和应用 |
Also Published As
| Publication number | Publication date |
|---|---|
| JP7561631B2 (ja) | 2024-10-04 |
| CN112513079A (zh) | 2021-03-16 |
| WO2019175802A9 (en) | 2019-12-12 |
| JP2021517588A (ja) | 2021-07-26 |
| KR102693317B1 (ko) | 2024-08-07 |
| EP3765519A1 (en) | 2021-01-20 |
| ES2973728T3 (es) | 2024-06-24 |
| JP2024105305A (ja) | 2024-08-06 |
| EP3765519B1 (en) | 2024-01-17 |
| KR20200132915A (ko) | 2020-11-25 |
| US20230181635A1 (en) | 2023-06-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP3344658B1 (en) | Antibodies specific to human t-cell immunoglobulin and itim domain (tigit) | |
| ES3053745T3 (en) | Neutralization of inhibitory pathways in lymphocytes | |
| JP2021008487A (ja) | 抗nkg2a抗体を使用した治療計画 | |
| US20220185866A1 (en) | Tnfrsf14 / hvem proteins and methods of use thereof | |
| JP6649941B2 (ja) | Fstl1を利用した抗がん剤・転移抑制剤およびその併用剤 | |
| US20220324965A1 (en) | Combination therapy involving antibodies against claudin 18.2 and immune checkpoint inhibitors for treatment of cancer | |
| WO2017149538A1 (en) | Antibodies specific to human poliovirus receptor (pvr) | |
| TW201806619A (zh) | 嵌合抗原受體及pd-1抑制劑之組合療法 | |
| CA2989144A1 (en) | Treatment of cancer by combined blockade of the pd-1 and cxcr4 signaling pathways | |
| TW201625270A (zh) | 用於治療贅瘤形成的治療組合及方法 | |
| JP2024105305A (ja) | 癌免疫療法のための活性化および拡張ナチュラルキラー細胞と組み合わせた抗cxcr4抗体 | |
| CN111094982A (zh) | 用于治疗和诊断癌症的tim-3拮抗剂 | |
| EP3066128A1 (en) | Combination of anti-kir and anti-cs1 antibodies to treat multiple myeloma | |
| JP2020519579A (ja) | Lrrc33阻害剤およびその使用 | |
| US20240252472A1 (en) | Combinations for treating cancer | |
| TW201825119A (zh) | 使用抗ccr4抗體及抗pd-1抗體治療癌症之方法 | |
| US20240374644A1 (en) | Herv-k antibody therapeutics | |
| JP7148151B2 (ja) | 抗レナラーゼ抗体および抗pd-1抗体を用いる、がんを処置するための組成物および方法 | |
| WO2014143835A1 (en) | Combination/adjuvant therapy for wt-1-positive disease | |
| JP2025506731A (ja) | Kir3dl3阻害剤及び免疫細胞活性化剤 | |
| TW202504922A (zh) | 用於治療癌症之涉及grem1拮抗劑之組合療法 | |
| HK40119948A (zh) | 与eva1蛋白质结合的人源化抗体或其功能性片段、抗体药物缀合物和嵌合抗原受体 | |
| NZ760009B2 (en) | Means and methods for counteracting myeloproliferative or lymphoproliferative disorders |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 19719623 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 2020571917 Country of ref document: JP Kind code of ref document: A |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 20207029169 Country of ref document: KR Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 2019719623 Country of ref document: EP Effective date: 20201013 |