WO2019175477A1 - A subunit vaccine against porcine post-weaning diarrhoea - Google Patents

A subunit vaccine against porcine post-weaning diarrhoea Download PDF

Info

Publication number
WO2019175477A1
WO2019175477A1 PCT/FI2019/050207 FI2019050207W WO2019175477A1 WO 2019175477 A1 WO2019175477 A1 WO 2019175477A1 FI 2019050207 W FI2019050207 W FI 2019050207W WO 2019175477 A1 WO2019175477 A1 WO 2019175477A1
Authority
WO
WIPO (PCT)
Prior art keywords
faeg
seq
vaccine
acid sequence
host cell
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/FI2019/050207
Other languages
French (fr)
Inventor
Jussi Joensuu
Marika Vitikainen
Christopher Landowski
Markku Saloheimo
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
VTT Technical Research Centre of Finland Ltd
Original Assignee
VTT Technical Research Centre of Finland Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by VTT Technical Research Centre of Finland Ltd filed Critical VTT Technical Research Centre of Finland Ltd
Publication of WO2019175477A1 publication Critical patent/WO2019175477A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/02Bacterial antigens
    • A61K39/025Enterobacteriales, e.g. Enterobacter
    • A61K39/0258Escherichia
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/12Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from bacteria
    • C07K16/1203Gram-negative bacteria
    • C07K16/1228Enterobacterales (O), e.g. Citrobacter (G), Serratia (G), Proteus (G), Providencia (G), Morganella (G) or Yersinia (G)
    • C07K16/1232Escherichia (G)
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02ATECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • the present invention relates to a subunit vaccine, especially an edible subunit vaccine, against porcine post-weaning diarrhoea, and to the production thereof in filamentous fungi, especially in Trichoderma reesei.
  • PWD post-weaning diarrhoea
  • ETEC enterotoxigenic Escherichia coli
  • Diet containing e.g. acidifiers, enzymes and bacterial probiotics, can help to prevent the incidence of PWD but cannot control the outbreaks (Fairbrother et al., 2015).
  • PWD is one of the most common reasons for antibiotic usage in pig industry. Antibiotics and antimicrobials work against PWD; however, they are overused in meat production and their usage needs to be limited in the future due to the risks of developing multiresistant pathogenic strains and preventing outbreaks of these ln addition, multidrug resistance has transferred to human pathogens causing a severe threat to human health (Van Boeckel et al., 2015; Ye et al., 2016).
  • Suckling piglets are usually protected by the maternal antibodies transferred through milk but become vulnerable for E.coli infections post weaning (Rutter and Jones, 1973). Breeding of resistant pigs is hard and excludes the lactogenic protection during suckling period. Furthermore, passive immunotherapy remains not economically feasible.
  • An object of the present invention is to provide a vaccine and a method of producing and using the vaccine so as to overcome the above problems associated with conventional treatment or prevention of PWD.
  • the object of the invention are achieved by a vaccine and a method which are characterized by what is stated in the independent claims.
  • the preferred embodiments of the invention are disclosed in the dependent claims.
  • the present invention provides a vaccine for porcine post- weaning diarrhea, comprising a filamentous fungus-derived FaeG subunit of a F4 fimbriae of enterotoxigenic Escherichia coli (ETEC).
  • ETEC enterotoxigenic Escherichia coli
  • the present invention also provides a method of producing vaccine for porcine post-weaning diarrhoea, the method comprising transforming a filamentous fungal host cell with a polynucleotide encoding FaeG, cultivating the transformed host cell under cultivation conditions suitable for expression and secretion of FaeG into conditioned culture medium, and recovering the conditioned culture medium comprising FaeG. Also provided is a vaccine composition obtainable by this method.
  • Figure 1 A schematic presentation of expression constructs for FaeG production in Trichoderma reesei.
  • FIG. 1 Detection of FaeG protein from small scale cultivations and from 151 fermentation samples.
  • M1351 parent strain w/o FaeG
  • M1779 FaeG- producing strain transformed with pJJJ783.
  • M1779 was used for fermentation culture and culture supernatants were collected in different time points and analyzed by total protein staining or by FaeG specific immunodetection.
  • FIG. 1 Purification of FaeG from Trichoderma culture supernantant by immobilized metal ion affinity column chromatography.
  • Figure 4. Detection of FaeG protein in F4 specific double sandwich enzyme linked immunosorbent assay.
  • Figure 6 Oral immunization with monomeric FaeG protein evokes F4- specific immune response in pigs.
  • Figure 6A shows that F4 specific antibodies were found in the serum of FaeG vaccinated (grey bars) piglets already 7 days post first immunization. The control group (white bars) raised a serum response only after the challenge that was done 10 days after the first immunization.
  • the present invention relates to the prevention of porcine post- weaning diarrhea (PWD) outbreaks caused by enterotoxigenic Escherichia coli (ETEC) that express F4 (K88) adhesive fimbriae and produce enterotoxins that induce secretory diarrhoea.
  • PWD porcine post- weaning diarrhea
  • ETEC enterotoxigenic Escherichia coli
  • K88 F4 adhesive fimbriae
  • F4 fimbriae refers to long filamentous polymeric surface proteins of ETEC, consisting of so-called major (FaeG) and minor (FaeF, FaeH, FaeC, and probably Fael) subunits.
  • major (FaeG) and minor (FaeF, FaeH, FaeC, and probably Fael) subunits Three antigenic variants of the F4 fimbriae have been described, namely serotypes F4ab, F4ac, and F4ad, with F4ac being the most prevalent. All these variants are herein encompassed by the term “F4", unless otherwise indicated.
  • the F4 fimbriae allow the microorganisms to adhere to F4-specific receptors present on brush borders of villous enterocytes and consequently to colonize the small intestine.
  • the present invention provides a PWD vaccine that is a subunit vaccine comprising a FaeG polypeptide of one or more F4 serotypes in any desired combination
  • the vaccine comprises FaeG of serotype F4ac and/or serotypes, F4ab F4ad.
  • the vaccine elicits a protective immunogenic response, i.e. provokes acquired immunity, against F4-expressing ETEC.
  • the FaeG polypeptide comprises an amino acid sequence set forth in SEQ 1D NO: 2, SEQ 1D NO: 4, or SEQ 1D NO: 5.
  • FaeG antigens that are uptaken via gut receptors, will evoke a protective mucosal immune response against ETEC in the gut. ln addition, free antigen subunits can outcompete ETEC bacteria from gut receptors immediately after administration of the vaccine thus providing also a passive protection.
  • FaeG is produced in a fungal host, preferably in isolated cells of a filamentous fungus.
  • filamentous fungus and “filamentous fungal host” refer to any filamentous fungal cell that is suitable for producing the present subunit vaccine.
  • Such fungal cells include, but are not limited to, cells from the genera Acremonium, Aspergillus, Fusarium, Humicola, Mucor, Myceliophthora, Neurospora, Penicillium , Scytalidium, Thielavia, Tolypocladium , and Trichoderma.
  • particularly useful species from Neurospora include N. intermedia, N. crassa, N. sitopula, and N. tetraspora
  • examples of particularly useful species from Aspergillus include A. nidulans, A.
  • T. reesei is the most preferred filamentous fungal host.
  • Filamentous fungal cells to be employed for producing the present vaccine may be derived from a wild-type fungal strain or from a genetically modified fungal strain, such as a protease deficient fungal strain.
  • WO 2013/102674 discloses Trichoderma fungal cells having reduced or no detectable activity of at least three endogenous proteases selected from pepl, pep2, pep3, pep4, pep5, pep8, pepll, pep!2, tspl, slpl, slp2, slp3, slp7, gapl, and gap2, resulting in increased expression and stability of recombinantly expressed heterologous proteins.
  • Trichoderma fungal cells having reduced or no detectable activity of one or more endogenous proteases including amp2, mpl, mp2, mp3, mp4, mp5, pep9, ampl, and sepl are disclosed in WO 2015/004241.
  • the filamentous fungal host cells are wild-type Trichoderma cells, preferably T reesei cells ln some other embodiments, the filamentous fungal host cells are Trichoderma cells, preferably T reesei cells, having reduced or no detectable activity of one or more, preferably at least three, extracellular proteases including, but not limited to, aspartic proteases, trypsin like serine proteases, subtilisin proteases, glutamic proteases, metalloproteases, and sedolisin proteases ln a more specific embodiment, the filamentous fungal host cells are Trichoderma cells, preferably T reesei cells, carrying deletions for one to three extracellular protease genes selected from aspartic protease genes pepl and pep4, and trypsin-like serine protease gene tspl. Alternatively or additionally, the host cells may carry a mus53 deletion for enhanced homologous integration.
  • one aspect of the invention provides a method of producing the present subunit vaccine in a filamentous fungal host cell.
  • the method comprises transforming the host cell with a polynucleotide encoding FaeG, cultivating the transformed host cell under cultivation conditions suitable for expressing FaeG, and recovering the conditioned culture medium comprising FaeG.
  • Transformation of a fungal host cell i.e. incorporation of a polynucleotide encoding FaeG into the host cell, may be carried out by any suitable transformation technique available in the art.
  • suitable transformation technique include, but are not limited to, protoplast-mediated transformation, Agrobacterium- mediated transformation, electroporation, biolistic method and shock-wave-mediated transformation.
  • a FaeG-encoding polynucleotide may be produced by any suitable technique available in the art. Such techniques include, but are not limited to, chemical synthesis, cloning, isolation from natural sources, and DNA amplification, such as PCR amplification.
  • the FaeG-encoding polynucleotide may be incorporated into an expression vector, such as a plasmid, using means and methods well known in the art.
  • the vector is a self-replicating vector that is maintained extra- chromosomally in the host cells after transformation ln some other embodiments, the vector is an integrating vector ln such embodiments, the entire expression cassette integrates into the genome of a fungal host transformed with the vector.
  • the expression cassette is typically surrounded by homology flanks that enable insertion of the expression cassette to a desired locus in the host genome.
  • the transformation results in stable transformation.
  • an expression vector for use in the present invention comprises a nucleic acid sequence encoding FaeG (e.g. a polynucleotide sequence set forth in SEQ 1D NO: 1, or SEQ 1D NO: 3) operably linked to an expression regulating region comprising nucleic acid sequences that encode a functional promoter and a terminator sequence (including a polyadenylation sequence).
  • FaeG e.g. a polynucleotide sequence set forth in SEQ 1D NO: 1, or SEQ 1D NO: 3
  • an expression regulating region comprising nucleic acid sequences that encode a functional promoter and a terminator sequence (including a polyadenylation sequence).
  • the FaeG-encoding nucleic acid molecule is also operably linked to a signal sequence resulting in the expression of FaeG as a secreted fusion protein ln some embodiments, the signal sequence comprises or consists of an amino acid sequence set forth in SEQ 1D NO: 7, or is encoded by a nucleic acid sequence set forth in SEQ 1D NO: 6.
  • promoter refers to a nucleic acid sequence which is recognized by the particular filamentous fungus for expression purposes. lt is operably linked to a nucleic acid sequence encoding the signal sequence and FaeG. Such linkage comprises positioning of the promoter with respect to the initiation codon of the nucleic acid sequence encoding the signal sequence of the expression vector.
  • the promoter sequence contains transcription and translation control sequences which mediate the expression of the signal sequence and FaeG polypeptide as a fusion polypeptide. Examples include the promoter from A. niger glucoamylase and alpha-glycosidase, A.
  • nidulans trpC Trichoderma cellulases such as cellobiohydrolase (cbh), preferably T. reesei cbhl.
  • cellobiohydrolase cbh
  • T. reesei cbhl Trichoderma cellulases
  • suitable promoters are readily available in the art. ln some embodiments, the promoter is an inducible promoter ln some other embodiments, the promoter is a constitutively active promoter.
  • terminator refers to a nucleic acid sequence which is recognized by the expression host to terminate transcription lt is operably linked to the 3' end of the nucleic acid encoding the FaeG to be expressed.
  • Examples include the terminator from A niger glucoamylase or alpha-glycosidase, A nidulans trpC, and Trichoderma cellulases such as cellobiohydrolase (cbh), preferably T. reesei cbhl.
  • cbh cellobiohydrolase
  • the terminator sequence comprises a "polyadenylation sequence", a nucleic acid sequence which when transcribed is recognized by the expression host to add polyadenosine residues to transcribed mRNA.
  • the term "signal sequence" refers to an amino acid sequence which when operably linked to the amino-terminus of a FaeG polypeptide permits the secretion of the FaeG polypeptide from the host filamentous fungus.
  • a signal sequence can be operably linked to the FaeG polypeptide by joining a nucleic acid sequence encoding the signal sequence to a nucleic acid sequence encoding the FaeG polypeptide in a proper reading frame to permit translation of the signal sequence and the FaeG polypeptide as a fusion polypeptide ln
  • the signal sequence is a fungal signal sequence of a fungal gene encoding a protein selected from the group consisting of cellulase, cellobiohydrolase, beta-galactosidase, xylanase, pectinase, esterase, protease, amylase, chitinase, chitosanase, polygalacturonase and hydrophobin
  • suitable fungal signal sequences include A niger glucoamylase and Trichoderma cellulases, such as cellobiohydrolase (cbh), preferably T. reesei cbhl.
  • cbh cellobiohydrolase
  • any signal sequence capable of permitting secretion of the FaeG polypeptide may be employed in the present invention ln some embodiments, the expression-regulating region and the signal sequence are from the same source.
  • carrier protein is linked to the FaeG polypeptide through a protein-processing site ln some embodiments, the protein-processing site is a Kex2 cleavage site having an amino acid sequence set forth in SEQ 1D NO: 11 or encoded by a nucleic acid sequence set forth in SEQ 1D NO: 10. Accordingly, later in the secretion pathway, FaeG is released from the fusion by endogenous cleavage by Kex2 protease that recognizes the site NV1SKR between the fusion partners.
  • FaeG is not expressed as a fusion with a signal sequence, the FaeG polypeptide is not secreted ln such embodiments, FaeG may be obtained from cell lysates using means and methods well known in the art.
  • FaeG may be produced as a fusion with a carrier protein, such as CBH1 carrier ln some preferred embodiments, the CHB1 carrier protein comprises or consists of an amino acid sequence set forth in SEQ 1D NO: 9 or encoded by a nucleic acid sequence set forth in SEQ 1D NO: 8.
  • the invention also encompasses functionally equivalent variants and fragments of the given amino acid sequences and nucleic acid sequences encoding said amino acid sequences.
  • functionally equivalent variant refers to a sequence having minor changes in the amino acid or nucleic acid sequence as compared to a given sequence but it still functions in substantially the same manner as the given polypeptide or polynucleotide.
  • Functionally equivalent nucleotide sequence variants include variants arising from the degeneration of the genetic code and from silent mutations. Nucleotide substitutions, deletions and additions are also included.
  • Functionally equivalent amino acid sequence variants include variants arising from amino acid substitutions with similar amino acids well known in the art. Amino acid deletions and additions are also included. As used herein, the term “functionally equivalent variant” is interchangeable with the term “conservative sequence variant”. Such variants may occur naturally e.g. as an allelic variant within the same strain, species or genus, or it may be generated by mutagenesis or other gene modification.
  • polypeptides and polynucleotides disclosed herein include those, which have at least 80% sequence identity, or at least 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity to the given sequence provided that functional equivalency is retained ln other words, functionally equivalent sequence variants refer to FaeG polypeptides capable of eliciting a protective immunogenic response against F4-expressing ETEC, and to polynucleotides encoding said FaeG polypeptides.
  • the percent identity between two sequences is equivalent to the percent homology between the two sequences.
  • the comparison of sequences and determination of percent identity between two sequences can be accomplished using standard methods known in the art.
  • viable transformants may be identified by screening for the expression and secretion of the FaeG polypeptide.
  • an expressible selection characteristic may be used to isolate transformants by employing an expression vector that encodes for a selection marker.
  • suitable selection characteristics include resistance to various antibiotics (e.g. hygromycin) and sequences encoding genes which confer a nutritional (e.g. acetamidase) or morphological marker in the expression host.
  • the host cells are cultivated in a suitable culture medium under conditions allowing the expression of the FaeG polypeptide using methods well known in the art. Suitable conditions are readily understood by a skilled person and include variables such as pH, temperature, and duration of the cultivation. Moreover, culture media suitable for cultivating filamentous fungal cells are available in the art and can be easily adjusted depending on different variables such as the fungal strain in question and specifics of the polynucleotide used for transforming the host cells (e.g. use of an inducible promoter, a selection marker, etc.) as is well known to skilled persons. Cultivation may be carried out, for example, as shake flask cultivation, continuous fermentation, batch fermentation, fed-batch fermentation, or solid state fermentation in any desired scale.
  • conditioned culture medium refers to a culture or fermentation supernatant obtained by cultivating filamentous fungal host cells in a culture medium suitable for said cultivation and allowing the expression of FaeG.
  • the conditioned medium comprises products secreted by the host cells during their cultivation.
  • the conditioned medium can be recovered, i.e. separated from the host cells, by conventional techniques such as centrifugation.
  • the method of producing the present subunit vaccine may comprise, after recovering the conditioned medium comprising FaeG, one or more additional steps of isolating and/or purifying FaeG.
  • Said isolating and/or purifying may be carried out using any appropriate technique available in the art and well known to a skilled person.
  • suitable isolation techniques include extraction, filtration, centrifugation, evaporation, and precipitation
  • suitable purification techniques include extraction, techniques based on differential solubility, electrophoretic techniques such as gel electrophoresis and preparative isoelectric focusing, and chromatography, such as ion exchange chromatography, affinity chromatography, and size exclusion chromatography.
  • the conditioned culture medium is recovered and used as such as a subunit vaccine ln other words, no isolation and/or purification of FaeG is carried out.
  • the vaccine so prepared comprises not only FeaG but also a cocktail of other extracellular proteins, such as various cellulolytic enzymes and proteases (including, but not limited to, cellulases such as cellobiohydrolases, endoglucanases and beta-glucosidases, and hemicellulases such as endoxylanases and endomannanases) secreted by the host cells.
  • various cellulolytic enzymes and proteases including, but not limited to, cellulases such as cellobiohydrolases, endoglucanases and beta-glucosidases, and hemicellulases such as endoxylanases and endomannanases
  • the composition of the present vaccine may be adjusted by way of selecting the fungal host to be employed.
  • Cellulolytic enzymes and proteases comprised in the present vaccine have a probiotic effect in the porcine gut, and aid the immature digestion system to adapt to solid food during the weaning period of suckling piglets ln those embodiments, wherein FeaG is isolated and/or purified from the conditioned culture medium, desired cellulolytic enzymes and proteases may be added into the final vaccine formulation in order to achieve a corresponding probiotic effect.
  • the present vaccine acts through three different modes of action, namely i) active protection by activating pigs own immune defence against ETEC, ii) passive protection by outcompeting pathogenic ETEC from gut receptors, and in) probiotic protection by enhanced digestion of solid food and faster gut transit time.
  • the conditioned culture medium is used as the present vaccine composition without isolating and/or purifying FaeG
  • the recovered conditioned culture medium may be dried prior to being used as a vaccine for easy formulation and to facilitate storage, for example.
  • the method of producing the present subunit vaccine may comprise, after recovering the conditioned medium comprising FaeG, one or more additional drying steps. Suitable drying methods include, but are not limited to, vacuum drying, freeze-drying (lyophilization), and spray-drying.
  • the present vaccine composition may com-prise an effective amount of one or more adjuvants.
  • One of the main features of the adjuvant substances in general is to broaden or enhance the immune response induced by the vaccine antigens.
  • the term "effective amount of adjuvant" includes an amount of adjuvant which is capable of stimulating the immune response against an administered antigen, i.e. an amount that increases the immune response of an administered antigen composition. Suitable effective increases include those by more than 5%, preferably by more than 25%, and in particular by more than 50%, as compared to the same antigen composition with no adjuvant.
  • Adjuvants suitable for use in vaccine formulations are known to those skilled in the art. ln some embodiments, sugar moieties on fungal cell surface or on secreted fungal enzymes may serve as vaccine adjuvants.
  • the present vaccine composition may be provided in various forms including, but not limited to, aqueous solutions and dry powders, e.g. as lyophilized, vacuum dried, or spray dried formulations.
  • aqueous solutions and dry powders may be provided in a form suitable to be administered by oral delivery, i.e. as an edible vaccine.
  • the present vaccine may be formulated as a feed or drink product or simply added to the food or drink supply for piglets.
  • the present invention also provides a method of preventing and/or reducing the risk of PWD in a piglet in need thereof, wherein the method comprises administering an efficient amount of a vaccine composition of the present invention to the piglet ln some embodiments, the method induces a protective immunogenic response against ETEC or PWD.
  • the method provides passive protection against ETEC or PWD by occupying gut F4 receptors ln some still further embodiments, the method provides probiotic protection against ETEC or PWD by enhanced digestion of solid food and faster gut transfer time of the food ln some even further embodiments, the method provides protection against ETEC or PWD through one or more, preferably all, mechanisms of action set forth above.
  • the term “piglet” refers to a young porcine to be administered with a vaccine of the invention. Unless otherwise indicated, the term “piglet” encompasses post-weaning piglets and suckling piglets. As used herein, the term “post-weaning piglet” refers to a piglet weaned from the sow, preferably aged from about 10 to about 28 days old.
  • the term "effective amount” refers to an amount, which is able to elicit an immune response that protects the vaccine recipient against the ETEC or reduces the risk of PWD either by eliciting neutralizing antibodies or a cell- mediated response, or both.
  • the term also encompasses an amount, which is able to provide passive protection against the ETEC by occupying gut F4 receptors.
  • the effective amount to be used may vary according to a number of factors including, but not limited to, initial weight of the piglets, growth phase of the piglets, age of the piglets, hygienic status of the animal facilities, stress after weaning, feed and supplements used, health of the piglets and accompanying diseases or treatment.
  • the effective amount may be administered to the animal, preferably by feeding, as a single dosage or may be given according to a regimen, whereby it is effective.
  • the piglets may receive the vaccine of the invention for substantially the whole of their growing period, or for only a part of their growing period, for example the early part and/or the suckling period.
  • the present vaccine may be used in combination with any other appropriate treatment modality, such as traditional preventive antimicrobial biocides including zinc oxide.
  • FaeG carrying modifications for N-terminal deletion and donor strand complementation were adapted for Thchoderma reesei codon usage and generated synthetically omitting restriction sites for Bsal, BsmBl, Btg ZI, Pad, Notl and Pme 1 endonucleases.
  • the FaeG sequences were surrounded by matching flanking regions that enabled insertion to pJJJ395 expression vector with Golden Gate reaction (Engler, Kandzia and Marillonnet, 2008) by using Bsal.
  • the pJJJ395 plasmid carries a gene construct for high level protein expression in T. reesei.
  • lt has promoter, secretion signal sequence and gene terminator from cellobiohydrolase 1 (cbh) and antibiotic resistance marker for hygromycin.
  • the expression cassette is surrounded by homology flanks that enable insertion to chbl locus in T. reesei genome ln the created expression vectors pJJJ783 (serotype F4ac) and pJJJ784 (serotype F4ad) the FaeG protein is translated as fusion with CBH1 carrier protein for high secretion.
  • FaeG is released from the fusion by endogenous cleavage by Kex2 protease that recognizes the site NV1SKR (SEQ 1D NO: 11) between the fusion partners.
  • Kex2 protease that recognizes the site NV1SKR (SEQ 1D NO: 11) between the fusion partners.
  • Relevant sequences of the exemplary constructs are shown in Table 1 below. Table 1.
  • Protoplasts were prepared from T. reesei strain Ml 351 carrying deletions for tree extracellular protease genes, pepl, tspl and pep4.
  • the strain carries also a mus53 deletion for enhanced homologous integration (Steiger et al., 2011.
  • the FaeG expression constructs pJJJ783 and pJJJ784 were transformed as described previously (Penttila et al. 1987). Transformants were selected with hygromycin and purified through single spore cultures. The pure cultures were sporulated on potato dextrose agar plates to be stored as spore suspensions at - 80°C in the presence of 20% glycerol (pJJJ783 was used to create T. reesei strain
  • M1779 and pJJJ784 was used to create M1780).
  • the expression constructs aimed integration to CBH1 locus to replace the endogenous cellobiohydrolase 1 gene.
  • the locus was confirmed with primer pairs (GCTGTTCCTACAGCTCTTTC (SEQ 1D NO: 12) & AGCCGCACGGCAGC (SEQ 1D NO: 13)) and (GGTTGACTTACTCCAGATCG (SEQ 1D NO: 14) & AGTCGTTTACCCAGAATGC (SEQ 1D NO: 15)) for 5’ and 3’ integration, respectively.
  • To confirm dislocation of the endogenous chbl gene primer pair (CAACTCAGATCCTCCAGGAGAC (SEQ 1D NO: 16) & GCTCGTTGCCAGAGTAACTAC (SEQ 1D NO: 17)) was used.
  • Trichoderma strains transformed with pJJJ783 and pJJJ784 expression constructs were cultivated on 24-well plates in 24-well plates in 4% (w/v) lactose, 2% spent grain extract, HOmM KH2PO4, 38mM Na2S04, lOOmM P1PPS, 2.4mM Mg 2 S04, 4.1mM CaCl 2 , Trichoderma trace elements (Penttila et al., 1987) and 38 mM di-ammonium hydrogen citrate, pH 4.5 for 4 days on a humidity controlled rotary shaker (800 rpm) at 28°C. Culture supernatants were collected by centrifugation and analysed on SDS-PAGE gels ( Figure 2).
  • the gels were detected either for total protein (Gel Code Blue Stain, Pierce) or after blotting to nitrocellulose filters with immunodetection. Shortly, the membranes were blocked with 5% non-fat milk in TBS buffer (50 mM Tris, 150 mM NaCl, pH 7.4) and then probed with anti-FaeG rabbit serum (1:1000 in TBS) and followed by goat anti rabbit lRDye 680RD (1:30000 in TBS, Li-cor) and imaged with Odyssey infrared imaging system (Li- cor).
  • the fermentation was done in New Brunswick BioFlo 510 fermentor in 15 litre volume.
  • the culture media contained 6.25% (w/v) lactose, 1% spent grain extract, 3% spent grain, HOmM KH2PO4, 38mM Na 2 S04, 2.4mM Mg 2 S04, 4.1mM CaCl 2 and Trichoderma trace elements and the pH control was set at 4.5 ⁇ 0.2, and feed was done with lactose solution.
  • Three days after the inoculation the culture was sampled daily and harvested 167 hours after inoculation. Culture supernatants were collected by centrifugation and analysed on SDS-PAGE gels.
  • the gels were detected ( Figure 2) either for total protein (Gel Code Blue Stain, Pierce) or after blotting to nitrocellulose filters with immunodetection. Shortly, the membranes were blocked with 5% non-fat milk in TBS buffer (50 mM Tris, 150 mM NaCl, pH 7.4) and then probed with anti-FaeG rabbit serum (1:1000 in TBS) and followed by goat anti rabbit lRDye 680RD (1:30000 in TBS, Li-cor) and imaged with Odyssey infrared imaging system (Li-cor).
  • the FaeG protein containing 6xHistidine tag was captured from culture supernatant by immobilized metal ion affinity column chromatography.
  • the culture supernatant was adjusted to match conductivity and pH of binding buffer (20mM Na-phosphate, 500mM NaCl, pH 7.4).
  • the adjusted supernantant was filtered (0.20gm) and loaded to the column (25x column volume).
  • the column was washed with five column volumes of binding buffer. FaeG protein was eluted from the column with 250mM imidazole in binding buffer (3x column volume).
  • 96-well plates (Nunc Maxisorb) were coated with anti-F4-ac monoclonal antibody (1MM01) lgg/ml, 100 gg/ well, diluted in PBS buffer for two hours at 37°C. To block unspecific binding plates were incubated over night with PBS+Tween 80 (0.2%) 300gl/well at 4°C. Then the plates were washed three times with PBS including 0.2% Tween 20. FaeG samples were diluted in PBS+0.2% Tween 20 and 3% BSA to 10 000; 1000; 100; 10; 1; 0.1 ng/ml and incubated lh at 37°C.
  • Villi were isolated as described by Van den Broeck et al. 1999b. Briefly, a segment (15 cm) from the mid jejunum was excised. This segment was washed twice with cold PBS and once with cold Krebs-Henseleit buffer (0.12 M NaCl, 0.014 M KC1, 0.001 M KH 2 P0 4 , 0.025 M NaHCOs, pH 7.4) containing 1% (v/v) formaldehyde.
  • the villi were scraped off with glass slides and washed 4x in Krebs-Henseleit buffer.
  • the villi were exchanged to PBS buffer containing 1% D-mannose. Protein samples were added to 50 gg/ml and 20gg/ml concentration and incubated lh at room temperature on a rotary shaker. F4ac positive fimbriae from G1S26 ETEC strain were used as positive control and PBS as negative control. After 1 h incubation, 4*10 A 8 bact/ml F4ac positive ETEC bacteria (strain G1S26) were added to the mixture and again incubated at room temperature for lh. Then, the inhibition of bacteria binding to brush borders was evaluated quantitatively by counting the number of bacteria adhering along a 50gm villous brush border at 20 randomly selected places using phase-contrast microscopy at a magnification of 600x.
  • Example 7 In vivo animal testing
  • F4 specific antibodies in blood serum were sampled for blood on 0, 7, 10, 17 and 29 days post first immunization.
  • F4+ ETEC faecal samples were taken daily from challenge until 6 days post challenge. The presence of F4-specific antibodies in blood serum was determined with F4 EL1SA. The serum samples were screened on microtiter plates coated with F4 fimbriae and after washing step probed for bound F4 antibodies with a labelled anti-swine secondary antibody.
  • F4+ E. coli were enumerated in diluted faecal samples by dot blotting visualized by a F4-specific antibody.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Immunology (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Mycology (AREA)
  • Genetics & Genomics (AREA)
  • Epidemiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The present invention relates to a subunit vaccine, especially an edible subunit vaccine, against porcine post-weaning diarrhoea, and to the production thereof in filamentous fungi, especially in Trichoderma reesei.

Description

A SUBUNIT VACCINE AGAINST PORCINE POST- WEANING DIARRHOEA
F1ELD OF THE INVENTION
The present invention relates to a subunit vaccine, especially an edible subunit vaccine, against porcine post-weaning diarrhoea, and to the production thereof in filamentous fungi, especially in Trichoderma reesei.
BACKGROUND OF THE INVENTION
Demand of dietary animal protein is rising with the expanding human population lntensive animal farming brings challenges in animal health care, e.g. post-weaning diarrhoea (PWD) is an important enteric disease that usually occurs shortly after weaning lt is characterized by watery diarrhoea, dehydration, loss of body weight and death of e.g. infected pigs. PWD is induced by enterotoxigenic Escherichia coli (ETEC), and it is a major cause of mortality, morbidity and deceased growth of young born piglets, and can cause severe economical losses in pig farming (Fairbrother et al., 2015).
Diet, containing e.g. acidifiers, enzymes and bacterial probiotics, can help to prevent the incidence of PWD but cannot control the outbreaks (Fairbrother et al., 2015). lndeed, PWD is one of the most common reasons for antibiotic usage in pig industry. Antibiotics and antimicrobials work against PWD; however, they are overused in meat production and their usage needs to be limited in the future due to the risks of developing multiresistant pathogenic strains and preventing outbreaks of these ln addition, multidrug resistance has transferred to human pathogens causing a severe threat to human health (Van Boeckel et al., 2015; Ye et al., 2016).
Suckling piglets are usually protected by the maternal antibodies transferred through milk but become vulnerable for E.coli infections post weaning (Rutter and Jones, 1973). Breeding of resistant pigs is hard and excludes the lactogenic protection during suckling period. Furthermore, passive immunotherapy remains not economically feasible.
Therefore, vaccination of the piglets is desired. Current parenteral vaccines do not elicit protective defence in piglet gut (Van den Broeck et al. 1999a). There is an oral vaccine available for use for the piglets but it is based on live- attenuated bacteria, which limits the usability (Anonymous, 2015). Thus, there is an identified need in the art for vaccines against PWD that overcome the problems associated with the current vaccines and treatment modalities against PWD. BR1EF DESCRIPTION OF THE INVENTION
An object of the present invention is to provide a vaccine and a method of producing and using the vaccine so as to overcome the above problems associated with conventional treatment or prevention of PWD. The object of the invention are achieved by a vaccine and a method which are characterized by what is stated in the independent claims. The preferred embodiments of the invention are disclosed in the dependent claims.
Accordingly, the present invention provides a vaccine for porcine post- weaning diarrhea, comprising a filamentous fungus-derived FaeG subunit of a F4 fimbriae of enterotoxigenic Escherichia coli (ETEC).
The present invention also provides a method of producing vaccine for porcine post-weaning diarrhoea, the method comprising transforming a filamentous fungal host cell with a polynucleotide encoding FaeG, cultivating the transformed host cell under cultivation conditions suitable for expression and secretion of FaeG into conditioned culture medium, and recovering the conditioned culture medium comprising FaeG. Also provided is a vaccine composition obtainable by this method.
Further aspects provided by the present invention include a vector comprising a FaeG-encoding nucleic acid sequence, and filamentous fungal host cell genetically modified to express FaeG.
Further aspects, specific embodiments, object, details, and advantages of the invention are set forth in the following drawings, detailed description, and examples.
BR1EF DESCRIPTION OF THE DRAW1NGS
ln the following the invention will be described in greater detail by means of preferred embodiments with reference to the attached drawings.
Figure 1. A schematic presentation of expression constructs for FaeG production in Trichoderma reesei.
Figure 2. Detection of FaeG protein from small scale cultivations and from 151 fermentation samples. M1351, parent strain w/o FaeG; M1779, FaeG- producing strain transformed with pJJJ783. M1779 was used for fermentation culture and culture supernatants were collected in different time points and analyzed by total protein staining or by FaeG specific immunodetection.
Figure 3. Purification of FaeG from Trichoderma culture supernantant by immobilized metal ion affinity column chromatography. Figure 4. Detection of FaeG protein in F4 specific double sandwich enzyme linked immunosorbent assay.
Figure 5. lnhibition of E. coli binding to villous brush borders after preincubation with FaeG protein or F4 fimbriae.
Figure 6. Oral immunization with monomeric FaeG protein evokes F4- specific immune response in pigs. Figure 6A shows that F4 specific antibodies were found in the serum of FaeG vaccinated (grey bars) piglets already 7 days post first immunization. The control group (white bars) raised a serum response only after the challenge that was done 10 days after the first immunization. Figure 6B shows that the piglets that had been immunized with FaeG (grey bars) secreted 10-1000 times (days 1-4 post challenge) less ETEC bacteria following the ETEC challenge than the unvaccinated group (white bars). n=7, error bars indicate standard error of the mean.
DETA1LED DESCRIPTION OF THE INVENTION
The present invention relates to the prevention of porcine post- weaning diarrhea (PWD) outbreaks caused by enterotoxigenic Escherichia coli (ETEC) that express F4 (K88) adhesive fimbriae and produce enterotoxins that induce secretory diarrhoea.
As used herein the term "F4 fimbriae" or "F4" refer to long filamentous polymeric surface proteins of ETEC, consisting of so-called major (FaeG) and minor (FaeF, FaeH, FaeC, and probably Fael) subunits. Three antigenic variants of the F4 fimbriae have been described, namely serotypes F4ab, F4ac, and F4ad, with F4ac being the most prevalent. All these variants are herein encompassed by the term "F4", unless otherwise indicated. The F4 fimbriae allow the microorganisms to adhere to F4-specific receptors present on brush borders of villous enterocytes and consequently to colonize the small intestine.
The present invention provides a PWD vaccine that is a subunit vaccine comprising a FaeG polypeptide of one or more F4 serotypes in any desired combination ln some embodiments, the vaccine comprises FaeG of serotype F4ac and/or serotypes, F4ab F4ad. The vaccine elicits a protective immunogenic response, i.e. provokes acquired immunity, against F4-expressing ETEC. ln some embodiments, the FaeG polypeptide comprises an amino acid sequence set forth in SEQ 1D NO: 2, SEQ 1D NO: 4, or SEQ 1D NO: 5.
Accordingly, FaeG antigens that are uptaken via gut receptors, will evoke a protective mucosal immune response against ETEC in the gut. ln addition, free antigen subunits can outcompete ETEC bacteria from gut receptors immediately after administration of the vaccine thus providing also a passive protection.
ln some embodiments, FaeG is produced in a fungal host, preferably in isolated cells of a filamentous fungus.
As used herein, the terms "filamentous fungus" and "filamentous fungal host" refer to any filamentous fungal cell that is suitable for producing the present subunit vaccine. Such fungal cells include, but are not limited to, cells from the genera Acremonium, Aspergillus, Fusarium, Humicola, Mucor, Myceliophthora, Neurospora, Penicillium , Scytalidium, Thielavia, Tolypocladium , and Trichoderma. Examples of particularly useful species from Neurospora include N. intermedia, N. crassa, N. sitopula, and N. tetraspora,· examples of particularly useful species from Aspergillus include A. nidulans, A. niger, A. oryzae, A. terreus, and A. fumegatus ; whereas examples of particularly suitable species from Trichoderma include T. harzianum, T. koningii, T. longibrachiatum, T. atroviride, T. virens, T. viride, and T. reesei. ln some embodiments, T. reesei is the most preferred filamentous fungal host.
Filamentous fungal cells to be employed for producing the present vaccine may be derived from a wild-type fungal strain or from a genetically modified fungal strain, such as a protease deficient fungal strain. WO 2013/102674 discloses Trichoderma fungal cells having reduced or no detectable activity of at least three endogenous proteases selected from pepl, pep2, pep3, pep4, pep5, pep8, pepll, pep!2, tspl, slpl, slp2, slp3, slp7, gapl, and gap2, resulting in increased expression and stability of recombinantly expressed heterologous proteins. Further genetically modified Trichoderma fungal cells having reduced or no detectable activity of one or more endogenous proteases including amp2, mpl, mp2, mp3, mp4, mp5, pep9, ampl, and sepl are disclosed in WO 2015/004241.
ln some embodiments, the filamentous fungal host cells are wild-type Trichoderma cells, preferably T reesei cells ln some other embodiments, the filamentous fungal host cells are Trichoderma cells, preferably T reesei cells, having reduced or no detectable activity of one or more, preferably at least three, extracellular proteases including, but not limited to, aspartic proteases, trypsin like serine proteases, subtilisin proteases, glutamic proteases, metalloproteases, and sedolisin proteases ln a more specific embodiment, the filamentous fungal host cells are Trichoderma cells, preferably T reesei cells, carrying deletions for one to three extracellular protease genes selected from aspartic protease genes pepl and pep4, and trypsin-like serine protease gene tspl. Alternatively or additionally, the host cells may carry a mus53 deletion for enhanced homologous integration.
ln accordance with the above, one aspect of the invention provides a method of producing the present subunit vaccine in a filamentous fungal host cell. The method comprises transforming the host cell with a polynucleotide encoding FaeG, cultivating the transformed host cell under cultivation conditions suitable for expressing FaeG, and recovering the conditioned culture medium comprising FaeG.
Transformation of a fungal host cell, i.e. incorporation of a polynucleotide encoding FaeG into the host cell, may be carried out by any suitable transformation technique available in the art. Such techniques include, but are not limited to, protoplast-mediated transformation, Agrobacterium- mediated transformation, electroporation, biolistic method and shock-wave-mediated transformation.
A FaeG-encoding polynucleotide may be produced by any suitable technique available in the art. Such techniques include, but are not limited to, chemical synthesis, cloning, isolation from natural sources, and DNA amplification, such as PCR amplification.
For transformation, the FaeG-encoding polynucleotide may be incorporated into an expression vector, such as a plasmid, using means and methods well known in the art. The skilled person knows which of the expression vectors available are suitable for transforming a selected fungal host cell ln some embodiments, the vector is a self-replicating vector that is maintained extra- chromosomally in the host cells after transformation ln some other embodiments, the vector is an integrating vector ln such embodiments, the entire expression cassette integrates into the genome of a fungal host transformed with the vector. To this end, the expression cassette is typically surrounded by homology flanks that enable insertion of the expression cassette to a desired locus in the host genome. Preferably, the transformation results in stable transformation.
ln general, an expression vector for use in the present invention comprises a nucleic acid sequence encoding FaeG (e.g. a polynucleotide sequence set forth in SEQ 1D NO: 1, or SEQ 1D NO: 3) operably linked to an expression regulating region comprising nucleic acid sequences that encode a functional promoter and a terminator sequence (including a polyadenylation sequence). Preferably, the FaeG-encoding nucleic acid molecule is also operably linked to a signal sequence resulting in the expression of FaeG as a secreted fusion protein ln some embodiments, the signal sequence comprises or consists of an amino acid sequence set forth in SEQ 1D NO: 7, or is encoded by a nucleic acid sequence set forth in SEQ 1D NO: 6.
As used herein, the term "promoter" refers to a nucleic acid sequence which is recognized by the particular filamentous fungus for expression purposes. lt is operably linked to a nucleic acid sequence encoding the signal sequence and FaeG. Such linkage comprises positioning of the promoter with respect to the initiation codon of the nucleic acid sequence encoding the signal sequence of the expression vector. The promoter sequence contains transcription and translation control sequences which mediate the expression of the signal sequence and FaeG polypeptide as a fusion polypeptide. Examples include the promoter from A. niger glucoamylase and alpha-glycosidase, A. nidulans trpC, and Trichoderma cellulases such as cellobiohydrolase (cbh), preferably T. reesei cbhl. Further suitable promoters are readily available in the art. ln some embodiments, the promoter is an inducible promoter ln some other embodiments, the promoter is a constitutively active promoter.
As used herein, the term "terminator" refers to a nucleic acid sequence which is recognized by the expression host to terminate transcription lt is operably linked to the 3' end of the nucleic acid encoding the FaeG to be expressed. Examples include the terminator from A niger glucoamylase or alpha-glycosidase, A nidulans trpC, and Trichoderma cellulases such as cellobiohydrolase (cbh), preferably T. reesei cbhl. Further suitable terminator sequences are readily available in the art. The terminator sequence comprises a "polyadenylation sequence", a nucleic acid sequence which when transcribed is recognized by the expression host to add polyadenosine residues to transcribed mRNA.
As used herein, the term "signal sequence" refers to an amino acid sequence which when operably linked to the amino-terminus of a FaeG polypeptide permits the secretion of the FaeG polypeptide from the host filamentous fungus. A signal sequence can be operably linked to the FaeG polypeptide by joining a nucleic acid sequence encoding the signal sequence to a nucleic acid sequence encoding the FaeG polypeptide in a proper reading frame to permit translation of the signal sequence and the FaeG polypeptide as a fusion polypeptide ln some embodiments, the signal sequence is a fungal signal sequence of a fungal gene encoding a protein selected from the group consisting of cellulase, cellobiohydrolase, beta-galactosidase, xylanase, pectinase, esterase, protease, amylase, chitinase, chitosanase, polygalacturonase and hydrophobin. More specific examples of suitable fungal signal sequences include A niger glucoamylase and Trichoderma cellulases, such as cellobiohydrolase (cbh), preferably T. reesei cbhl. However, any signal sequence capable of permitting secretion of the FaeG polypeptide may be employed in the present invention ln some embodiments, the expression-regulating region and the signal sequence are from the same source.
ln some embodiments, carrier protein is linked to the FaeG polypeptide through a protein-processing site ln some embodiments, the protein-processing site is a Kex2 cleavage site having an amino acid sequence set forth in SEQ 1D NO: 11 or encoded by a nucleic acid sequence set forth in SEQ 1D NO: 10. Accordingly, later in the secretion pathway, FaeG is released from the fusion by endogenous cleavage by Kex2 protease that recognizes the site NV1SKR between the fusion partners.
lf FaeG is not expressed as a fusion with a signal sequence, the FaeG polypeptide is not secreted ln such embodiments, FaeG may be obtained from cell lysates using means and methods well known in the art.
ln some embodiments, FaeG may be produced as a fusion with a carrier protein, such as CBH1 carrier ln some preferred embodiments, the CHB1 carrier protein comprises or consists of an amino acid sequence set forth in SEQ 1D NO: 9 or encoded by a nucleic acid sequence set forth in SEQ 1D NO: 8.
lt is well known that deletion, addition or substitution of one or a few amino acids does not necessarily change the properties of a protein. Therefore the invention also encompasses functionally equivalent variants and fragments of the given amino acid sequences and nucleic acid sequences encoding said amino acid sequences. As used herein, the terms "functionally equivalent variant" refers to a sequence having minor changes in the amino acid or nucleic acid sequence as compared to a given sequence but it still functions in substantially the same manner as the given polypeptide or polynucleotide. Functionally equivalent nucleotide sequence variants include variants arising from the degeneration of the genetic code and from silent mutations. Nucleotide substitutions, deletions and additions are also included. Functionally equivalent amino acid sequence variants include variants arising from amino acid substitutions with similar amino acids well known in the art. Amino acid deletions and additions are also included. As used herein, the term "functionally equivalent variant" is interchangeable with the term "conservative sequence variant". Such variants may occur naturally e.g. as an allelic variant within the same strain, species or genus, or it may be generated by mutagenesis or other gene modification.
Accordingly, the polypeptides and polynucleotides disclosed herein include those, which have at least 80% sequence identity, or at least 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity to the given sequence provided that functional equivalency is retained ln other words, functionally equivalent sequence variants refer to FaeG polypeptides capable of eliciting a protective immunogenic response against F4-expressing ETEC, and to polynucleotides encoding said FaeG polypeptides.
As used herein, the percent identity between two sequences is equivalent to the percent homology between the two sequences. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences (i.e., % identity = # of identical positions/total # of positions x 100), taking into account the number of gaps, and the length of each gap, which need to be introduced for optimal alignment of the two sequences. The comparison of sequences and determination of percent identity between two sequences can be accomplished using standard methods known in the art.
After transformation, viable transformants may be identified by screening for the expression and secretion of the FaeG polypeptide. Alternatively, an expressible selection characteristic may be used to isolate transformants by employing an expression vector that encodes for a selection marker. Non-limiting examples of suitable selection characteristics include resistance to various antibiotics (e.g. hygromycin) and sequences encoding genes which confer a nutritional (e.g. acetamidase) or morphological marker in the expression host.
After transformation, the host cells are cultivated in a suitable culture medium under conditions allowing the expression of the FaeG polypeptide using methods well known in the art. Suitable conditions are readily understood by a skilled person and include variables such as pH, temperature, and duration of the cultivation. Moreover, culture media suitable for cultivating filamentous fungal cells are available in the art and can be easily adjusted depending on different variables such as the fungal strain in question and specifics of the polynucleotide used for transforming the host cells (e.g. use of an inducible promoter, a selection marker, etc.) as is well known to skilled persons. Cultivation may be carried out, for example, as shake flask cultivation, continuous fermentation, batch fermentation, fed-batch fermentation, or solid state fermentation in any desired scale.
As used herein, the term "conditioned culture medium" refers to a culture or fermentation supernatant obtained by cultivating filamentous fungal host cells in a culture medium suitable for said cultivation and allowing the expression of FaeG. The conditioned medium comprises products secreted by the host cells during their cultivation. The conditioned medium can be recovered, i.e. separated from the host cells, by conventional techniques such as centrifugation.
ln some embodiments, the method of producing the present subunit vaccine may comprise, after recovering the conditioned medium comprising FaeG, one or more additional steps of isolating and/or purifying FaeG. Said isolating and/or purifying may be carried out using any appropriate technique available in the art and well known to a skilled person. Non-limiting examples of suitable isolation techniques include extraction, filtration, centrifugation, evaporation, and precipitation, while non-limiting examples of suitable purification techniques include extraction, techniques based on differential solubility, electrophoretic techniques such as gel electrophoresis and preparative isoelectric focusing, and chromatography, such as ion exchange chromatography, affinity chromatography, and size exclusion chromatography.
ln some alternative embodiments, the conditioned culture medium is recovered and used as such as a subunit vaccine ln other words, no isolation and/or purification of FaeG is carried out. The vaccine so prepared comprises not only FeaG but also a cocktail of other extracellular proteins, such as various cellulolytic enzymes and proteases (including, but not limited to, cellulases such as cellobiohydrolases, endoglucanases and beta-glucosidases, and hemicellulases such as endoxylanases and endomannanases) secreted by the host cells. Thus, the composition of the present vaccine may be adjusted by way of selecting the fungal host to be employed. Proteins and enzymes secreted by Trichoderma reesei are reviewed e.g. by Saloheimo and Pakula, 2012. Cellulolytic enzymes and proteases comprised in the present vaccine have a probiotic effect in the porcine gut, and aid the immature digestion system to adapt to solid food during the weaning period of suckling piglets ln those embodiments, wherein FeaG is isolated and/or purified from the conditioned culture medium, desired cellulolytic enzymes and proteases may be added into the final vaccine formulation in order to achieve a corresponding probiotic effect.
Accordingly, the present vaccine acts through three different modes of action, namely i) active protection by activating pigs own immune defence against ETEC, ii) passive protection by outcompeting pathogenic ETEC from gut receptors, and in) probiotic protection by enhanced digestion of solid food and faster gut transit time.
Further advantages associated with those embodiments, wherein the conditioned culture medium is used as the present vaccine composition without isolating and/or purifying FaeG include cost-effectiveness and simple manufacturing as no further production steps are required. However, if desired, the recovered conditioned culture medium may be dried prior to being used as a vaccine for easy formulation and to facilitate storage, for example. Accordingly, in some embodiments, the method of producing the present subunit vaccine may comprise, after recovering the conditioned medium comprising FaeG, one or more additional drying steps. Suitable drying methods include, but are not limited to, vacuum drying, freeze-drying (lyophilization), and spray-drying.
ln some embodiments, the present vaccine composition may com-prise an effective amount of one or more adjuvants. One of the main features of the adjuvant substances in general is to broaden or enhance the immune response induced by the vaccine antigens. The term "effective amount of adjuvant" includes an amount of adjuvant which is capable of stimulating the immune response against an administered antigen, i.e. an amount that increases the immune response of an administered antigen composition. Suitable effective increases include those by more than 5%, preferably by more than 25%, and in particular by more than 50%, as compared to the same antigen composition with no adjuvant. Adjuvants suitable for use in vaccine formulations are known to those skilled in the art. ln some embodiments, sugar moieties on fungal cell surface or on secreted fungal enzymes may serve as vaccine adjuvants.
The present vaccine composition may be provided in various forms including, but not limited to, aqueous solutions and dry powders, e.g. as lyophilized, vacuum dried, or spray dried formulations. Preferably, said aqueous solutions and dry powders may be provided in a form suitable to be administered by oral delivery, i.e. as an edible vaccine. Thus, the present vaccine may be formulated as a feed or drink product or simply added to the food or drink supply for piglets.
ln accordance with the above, the present invention also provides a method of preventing and/or reducing the risk of PWD in a piglet in need thereof, wherein the method comprises administering an efficient amount of a vaccine composition of the present invention to the piglet ln some embodiments, the method induces a protective immunogenic response against ETEC or PWD. ln some further embodiments, the method provides passive protection against ETEC or PWD by occupying gut F4 receptors ln some still further embodiments, the method provides probiotic protection against ETEC or PWD by enhanced digestion of solid food and faster gut transfer time of the food ln some even further embodiments, the method provides protection against ETEC or PWD through one or more, preferably all, mechanisms of action set forth above.
As used herein, the term "piglet" refers to a young porcine to be administered with a vaccine of the invention. Unless otherwise indicated, the term "piglet" encompasses post-weaning piglets and suckling piglets. As used herein, the term "post-weaning piglet" refers to a piglet weaned from the sow, preferably aged from about 10 to about 28 days old.
As used herein, the term "effective amount" refers to an amount, which is able to elicit an immune response that protects the vaccine recipient against the ETEC or reduces the risk of PWD either by eliciting neutralizing antibodies or a cell- mediated response, or both. The term also encompasses an amount, which is able to provide passive protection against the ETEC by occupying gut F4 receptors.
As is readily understood by those skilled in the art, the effective amount to be used may vary according to a number of factors including, but not limited to, initial weight of the piglets, growth phase of the piglets, age of the piglets, hygienic status of the animal facilities, stress after weaning, feed and supplements used, health of the piglets and accompanying diseases or treatment. The effective amount may be administered to the animal, preferably by feeding, as a single dosage or may be given according to a regimen, whereby it is effective. Accordingly, in some embodiments, the piglets may receive the vaccine of the invention for substantially the whole of their growing period, or for only a part of their growing period, for example the early part and/or the suckling period.
As is readily understood by those skilled in the art, the present vaccine may be used in combination with any other appropriate treatment modality, such as traditional preventive antimicrobial biocides including zinc oxide.
lt will be obvious to a person skilled in the art that, as technology advances, the inventive concept can be implemented in various ways. The invention and its embodiments are not limited to the examples described below but may vary within the scope of the claims. EXAMPLES
Example 1. Construction of vectors for FaeG expression in T choderma reesei (Figure 1)
DNA sequences encoding FaeG carrying modifications for N-terminal deletion and donor strand complementation (Van Molle et al., 2009) were adapted for Thchoderma reesei codon usage and generated synthetically omitting restriction sites for Bsal, BsmBl, Btg ZI, Pad, Notl and Pme 1 endonucleases. The FaeG sequences were surrounded by matching flanking regions that enabled insertion to pJJJ395 expression vector with Golden Gate reaction (Engler, Kandzia and Marillonnet, 2008) by using Bsal. The pJJJ395 plasmid carries a gene construct for high level protein expression in T. reesei. lt has promoter, secretion signal sequence and gene terminator from cellobiohydrolase 1 (cbh) and antibiotic resistance marker for hygromycin. The expression cassette is surrounded by homology flanks that enable insertion to chbl locus in T. reesei genome ln the created expression vectors pJJJ783 (serotype F4ac) and pJJJ784 (serotype F4ad) the FaeG protein is translated as fusion with CBH1 carrier protein for high secretion. Later in the secretion pathway, FaeG is released from the fusion by endogenous cleavage by Kex2 protease that recognizes the site NV1SKR (SEQ 1D NO: 11) between the fusion partners. Relevant sequences of the exemplary constructs are shown in Table 1 below. Table 1.
Figure imgf000013_0001
Figure imgf000014_0001
Figure imgf000015_0001
Example 2. Trichoderma transformation and protein expression analysis of FaeG constructs
Protoplasts were prepared from T. reesei strain Ml 351 carrying deletions for tree extracellular protease genes, pepl, tspl and pep4. The strain carries also a mus53 deletion for enhanced homologous integration (Steiger et al., 2011. The FaeG expression constructs pJJJ783 and pJJJ784 were transformed as described previously (Penttila et al. 1987). Transformants were selected with hygromycin and purified through single spore cultures. The pure cultures were sporulated on potato dextrose agar plates to be stored as spore suspensions at - 80°C in the presence of 20% glycerol (pJJJ783 was used to create T. reesei strain
M1779 and pJJJ784 was used to create M1780). The expression constructs aimed integration to CBH1 locus to replace the endogenous cellobiohydrolase 1 gene. The locus was confirmed with primer pairs (GCTGTTCCTACAGCTCTTTC (SEQ 1D NO: 12) & AGCCGCACGGCAGC (SEQ 1D NO: 13)) and (GGTTGACTTACTCCAGATCG (SEQ 1D NO: 14) & AGTCGTTTACCCAGAATGC (SEQ 1D NO: 15)) for 5’ and 3’ integration, respectively. To confirm dislocation of the endogenous chbl gene primer pair (CAACTCAGATCCTCCAGGAGAC (SEQ 1D NO: 16) & GCTCGTTGCCAGAGTAACTAC (SEQ 1D NO: 17)) was used.
Trichoderma strains transformed with pJJJ783 and pJJJ784 expression constructs were cultivated on 24-well plates in 24-well plates in 4% (w/v) lactose, 2% spent grain extract, HOmM KH2PO4, 38mM Na2S04, lOOmM P1PPS, 2.4mM Mg2S04, 4.1mM CaCl2, Trichoderma trace elements (Penttila et al., 1987) and 38 mM di-ammonium hydrogen citrate, pH 4.5 for 4 days on a humidity controlled rotary shaker (800 rpm) at 28°C. Culture supernatants were collected by centrifugation and analysed on SDS-PAGE gels (Figure 2). The gels were detected either for total protein (Gel Code Blue Stain, Pierce) or after blotting to nitrocellulose filters with immunodetection. Shortly, the membranes were blocked with 5% non-fat milk in TBS buffer (50 mM Tris, 150 mM NaCl, pH 7.4) and then probed with anti-FaeG rabbit serum (1:1000 in TBS) and followed by goat anti rabbit lRDye 680RD (1:30000 in TBS, Li-cor) and imaged with Odyssey infrared imaging system (Li- cor).
Example 3. Production of FaeG in bioreactor with strain M1779 (Figure 2)
For primary inoculum 6xlOE7 spores were added to 300ml of 3% (w/v) lactose, 1.5% spent grain extract, HOmM KH2P04, 38mM Na2S04, 2.4mM Mg2S04, 4.1mM CaCl2 and Trichoderma trace elements [11], pH 5.0. The inoculum was cultured in 2 litre erlenmayer flask for four days at 28°C in a rotary shaker (200 rpm). For secondary inoculum, 4x 300ml cultures (same media as above) were started by adding 20ml of the primary culture and grow for three days.
The fermentation (fed-batch process) was done in New Brunswick BioFlo 510 fermentor in 15 litre volume. The culture media contained 6.25% (w/v) lactose, 1% spent grain extract, 3% spent grain, HOmM KH2PO4, 38mM Na2S04, 2.4mM Mg2S04, 4.1mM CaCl2 and Trichoderma trace elements and the pH control was set at 4.5 ± 0.2, and feed was done with lactose solution. Three days after the inoculation the culture was sampled daily and harvested 167 hours after inoculation. Culture supernatants were collected by centrifugation and analysed on SDS-PAGE gels. The gels were detected (Figure 2) either for total protein (Gel Code Blue Stain, Pierce) or after blotting to nitrocellulose filters with immunodetection. Shortly, the membranes were blocked with 5% non-fat milk in TBS buffer (50 mM Tris, 150 mM NaCl, pH 7.4) and then probed with anti-FaeG rabbit serum (1:1000 in TBS) and followed by goat anti rabbit lRDye 680RD (1:30000 in TBS, Li-cor) and imaged with Odyssey infrared imaging system (Li-cor).
Example 4. Purification of FaeG (pJJJ783) protein (Figure 3)
The FaeG protein containing 6xHistidine tag was captured from culture supernatant by immobilized metal ion affinity column chromatography. The culture supernatant was adjusted to match conductivity and pH of binding buffer (20mM Na-phosphate, 500mM NaCl, pH 7.4). The adjusted supernantant was filtered (0.20gm) and loaded to the column (25x column volume). The column was washed with five column volumes of binding buffer. FaeG protein was eluted from the column with 250mM imidazole in binding buffer (3x column volume). After the purification buffer of the FaeG containing fractions was exchanged to PBS (137 mM NaCl, 2.7 mM KC1, 8.1 mM Na2HP04, 1.8 mM KH2P04) with gel filtration (EconoPac, 10DG, BioRad). Quantification was done with SDS PAGE analysis followed by image densitometry.
Example 5. In vitro activity testing of FaeG (pJJJ783) protein with F4 double sandwich ELISA (Figure 4)
96-well plates (Nunc Maxisorb) were coated with anti-F4-ac monoclonal antibody (1MM01) lgg/ml, 100 gg/ well, diluted in PBS buffer for two hours at 37°C. To block unspecific binding plates were incubated over night with PBS+Tween 80 (0.2%) 300gl/well at 4°C. Then the plates were washed three times with PBS including 0.2% Tween 20. FaeG samples were diluted in PBS+0.2% Tween 20 and 3% BSA to 10 000; 1000; 100; 10; 1; 0.1 ng/ml and incubated lh at 37°C. After 3x washes, F4 positive rabbit serum (1/1500 dilution with PBS) was added and incubated lh at 37°C. Detection was done after 3x washes with HRP- conjugated goat anti-rabbit lgG H+L (100 gl/well, 1/1000 diluted in reagent diluent) and incubated for lh at 37°C. After 3x washes ABTS solution was added (50 gl/well) and the plates were incubated for lh at 37°C. The absorbance at 405 nm was measured after 15, 30 and 60 min with a spectrophotometer.
Example 6. In vitro villous adhesion testing (Figure 5)
To assess the capacity of the monomeric FaeG protein to adhere to the brush border of F4 receptor positive small intestine villous enterocytes, an in vitro villus adhesion assay was performed. Villi were isolated as described by Van den Broeck et al. 1999b. Briefly, a segment (15 cm) from the mid jejunum was excised. This segment was washed twice with cold PBS and once with cold Krebs-Henseleit buffer (0.12 M NaCl, 0.014 M KC1, 0.001 M KH2P04, 0.025 M NaHCOs, pH 7.4) containing 1% (v/v) formaldehyde. Subsequently, the villi were scraped off with glass slides and washed 4x in Krebs-Henseleit buffer. For inhibition assay the villi were exchanged to PBS buffer containing 1% D-mannose. Protein samples were added to 50 gg/ml and 20gg/ml concentration and incubated lh at room temperature on a rotary shaker. F4ac positive fimbriae from G1S26 ETEC strain were used as positive control and PBS as negative control. After 1 h incubation, 4*10A8 bact/ml F4ac positive ETEC bacteria (strain G1S26) were added to the mixture and again incubated at room temperature for lh. Then, the inhibition of bacteria binding to brush borders was evaluated quantitatively by counting the number of bacteria adhering along a 50gm villous brush border at 20 randomly selected places using phase-contrast microscopy at a magnification of 600x.
Example 7. In vivo animal testing
To evaluate whether the monomeric FaeG protein could raise F4 specific immune response in pigs following experiment was performed. Fourteen F4 reseptor positive and F4-seronegative conventionally bred piglets from three different litters were used. The piglets were weaned and randomized to two groups and housed in isolation units where they received water and standard piglet food. One week post weaning the piglets (n=7) received intragastric dose of 7mg of purified FaeG protein in PBS buffer supplemented with 50gg of cholera toxin as adjuvant for three consecutive days. A week after the first immunization piglets were boosted for one day with similar dose. Untreated control group (n=7) received PBS buffer alone. Three days after the boost immunization the piglets were challenged intragastrically with 1010 F4+ ETEC bacteria. To support the ETEC colonization, the stomach fluid was neutralized with isotonic bicarbonate solution prior the challenge.
To monitor the development of F4 specific antibodies in blood serum, piglet were sampled for blood on 0, 7, 10, 17 and 29 days post first immunization. To determine the excretion of F4+ ETEC, faecal samples were taken daily from challenge until 6 days post challenge. The presence of F4-specific antibodies in blood serum was determined with F4 EL1SA. The serum samples were screened on microtiter plates coated with F4 fimbriae and after washing step probed for bound F4 antibodies with a labelled anti-swine secondary antibody. To analyze excretion following ETEC challenge, F4+ E. coli were enumerated in diluted faecal samples by dot blotting visualized by a F4-specific antibody.
The results are shown in Figure 6, which demonstrates that oral immunization with monomeric FaeG protein evokes F4-specific immune response in pigs. Similar results are obtained with lyophilized T. reesei culture supernatant containing unpurified FaeG).
Reference List
J. M. Fairbrother, E. Nadeau, and C. L. Gyles, "Escherichia coli in postweaning diarrhea in pigs: an update on bacterial types, pathogenesis, and prevention strategies," Anim. Heal Res. Rev., vol. 6, no. 1, pp. 17-39, 2005.
T. P. Van Boeckel et al, "Global trends in antimicrobial use in food animals," Proc.
Natl. Acad. Set, vol. 112, no. 18, p. 5649 LP-5654, May 2015.
X. Ye et al, "Livestock-associated methicillin and multidrug resistant S. aureus in humans is associated with occupational pig contact, not pet contact," Sci.
Rep., vol. 6, p. 19184, Jan. 2016.
J. M. Rutter and G. W. Jones, "Protection against enteric disease caused by Escherichia coli-a model for vaccination with a virulence determinant?," Nature, vol. 242, no. 5399, pp. 531-532, 1973.
W. Van den Broeck, E. Cox, and B. M. Goddeeris, "Receptor-dependent immune responses in pigs after oral immunization with F4 fimbriae," Infect. Immun., vol. 67, no. 2, pp. 520-526, 1999a.
Anonymous, "CVMP assessment report for Coliprotec F4 (EMEA/V/C/003797/0000)," 2015.
M. Saloheimo and T. M. Pakula, "The cargo and the transport system: secreted proteins and protein secretion in Trichoderma reesei (Hypocrea jecorina)," Microbiology, vol. 158, no. 1, pp. 46-57, 2012.
1. Van Molle et al, "Structural and Thermodynamic Characterization of Pre- and Postpolymerization States in the F4 Fimbrial Subunit FaeG,"/. Mol. Biol., vol. 394, no. 5, pp. 957-967, 2009.
C. Engler, R. Kandzia, and S. Marillonnet, "A One Pot, One Step, Precision Cloning Method with High Throughput Capability," PLoS One, vol. 3, no. 11, p. e3647, May 2008. M. G. Steiger et al, "A transformation system for Hypocrea (Trichoderma) that favors homologous integration and that uses reusable bidirectionally- selectable markers,” Appl. Environ. Microbiol., 2011.
M. Penttila, H. Nevalainen, M. Ratto, E. Salminen, and J. Knowles, "A versatile transformation system for the cellulolytic filamentous fungus Trichoderma reesei," Gene, vol. 61, no. 2, pp. 155-164, 1987.
W. Van den Broeck, E. Cox, and B. M. Goddeeris, "Receptor-specific binding of purified F4 to isolated villi," Vet. Microbiol., vol. 68, no. 3-4, pp. 255-263,

Claims

Claims
1. A vaccine for porcine post-weaning diarrhea, comprising a filamentous fungus-derived FaeG subunit of a F4 fimbriae of enterotoxigenic Escherichia coli (ETEC).
2. The vaccine according to claim 1, wherein the FaeG comprises an amino acid sequence set forth in SEQ 1D NO: 2, SEQ 1D NO: 4 or SEQ 1D NO: 5, or a functionally equivalent variant thereof having at least 80% amino acid sequence identity therewith.
3. The vaccine according to claim 1 or 2, further comprising at least one enzyme selected from the group consisting of cellulases such as cellobiohydrolases, endoglucanases and beta-glucosidases, and hemicellulases such as endoxylanases and endomannanases.
4. The vaccine according to any one of claims 1 to 3, further comprising an adjuvant.
5. The vaccine according to claim 4, wherein the adjuvant is a sugar moiety derived from a fungal cell surface or from a fungal enzyme selected from the group consisting of cellulases such as cellobiohydrolases, endoglucanases and beta-glucosidases, and hemicellulases such as endoxylanases and endomannanases.
6. The vaccine according to any one claims 1 to 5, wherein the filamentous fungus is selected from the group consisting of cells from the genera Acremonium, Aspergillus, Fusarium, Humicola, Mucor, Myceliophthora, Neurospora, Penicillium, Scytalidium, Thielavia, Tolypocladium, and Trichoderma, preferably Trichoderma cell, more preferably Trichoderma reesei cell.
7. The vaccine according to any one of claims 1 to 6, wherein the vaccine is in the form a conditioned culture medium.
8. The vaccine according to claim 7, wherein the vaccine is in a dried form.
9. A method of producing vaccine for porcine post-weaning diarrhoea, the method comprising
a) transforming a filamentous fungal host cell with a polynucleotide encoding FaeG,
b) cultivating the transformed host cell under cultivation conditions suitable for expression and secretion of FaeG into conditioned culture medium, and c) recovering the conditioned culture medium comprising FaeG.
10. The method according to claim 9, wherein the method does not comprise purification of FaeG.
11. The method according to claim 9 or 10, further comprising drying of the conditioned medium.
12. The method according to any one claims 9 to 11, wherein the filamentous fungal host cell is selected from the group consisting of cells from the genera Acremonium, Aspergillus, Fusarium, Humicola, Mucor, Myceliophthora, Neurospora, Penicillium , Scytalidium, Thielavia, Tolypocladium , and Trichoderma, preferably Trichoderma cell, more preferably Trichoderma reesei cell.
13. The method according to claim 12, wherein the host cell is deficient in one or more protease-encoding genes selected from the group consisting of pepl, pep2, pep3, pep4, pep5, pep8, pepll, pepl2, tspl, slpl, slp2, slp3, slp7, gapl, gap2, amp2, mpl, mp2, mp3, mp4, mp5, pep9, ampl, and sepl, preferably deficient in one to three protease-encoding genes selected form the group consisting of pepl, pep4, and tspl.
14. The method according to any one of claims 9 to 13, wherein the polynucleotide encoding FaeG comprises a nucleic acid sequence set forth in SEQ
1D NO: 1 or SEQ 1D NO: 3, or a functionally equivalent variant thereof having at least 80% amino acid sequence identity therewith.
15. The method according to any one of claims 9 to 13, wherein the FaeG comprises an amino acid sequence set forth in SEQ 1D NO: 2, SEQ 1D NO: 4 or SEQ 1D NO: 5, or a functionally equivalent variant thereof having at least 80% amino acid sequence identity therewith.
16. A vaccine composition obtainable by the method according to any one of claims 9 to 15.
17. A vector comprising a FaeG-encoding nucleic acid sequence set forth in SEQ 1D NO: 1 or SEQ 1D NO:3, or a functionally equivalent variant thereof having at least 80% amino acid sequence identity therewith.
18. A filamentous fungal host cell genetically modified to express FaeG.
19. The host cell according to claim 18, wherein the FaeG comprises an amino acid sequence set forth in SEQ 1D NO: 2, SEQ 1D NO: 4, SEQ 1D NO: 5 or a functionally equivalent variant thereof having at least 80% amino acid sequence identity therewith, or is encoded by a polynucleotide comprising a nucleic acid sequence set forth in SEQ 1D NO: 1, SEQ 1D NO: 3 or a functionally equivalent variant thereof having at least 80% amino acid sequence identity therewith.
20. The host cell according to claim 18 or 19, wherein the host cell comprises the vector according to claim 16.
21. The host cell according to any one of claims 18 to 20, wherein the filamentous fungus host cell is selected from the group consisting of cells from the genera Acremonium, Aspergillus, Fusarium, Humicola, Mucor, Myceliophthora, Neurospora, Penicillium , Scytalidium, Thielavia, Tolypocladium , and Trichoderma, preferably Trichoderma cell, more preferably Trichoderma reesei cell.
22. The host cell according to any one of claims 18 to 21, wherein the host cell is deficient in one or more protease-encoding genes selected from the group consisting of pepl, pep2, pep3, pep4, pep5, pep8, pepll, pepl2, tspl, slpl, slp2, slp3, slp7, gapl, gap2, amp2, mpl, mp2, mp3, mp4, mp5, pep9, ampl, and sepl, preferably deficient in one to three protease-encoding genes selected form the group consisting of pepl, pep4, and tspl.
PCT/FI2019/050207 2018-03-12 2019-03-12 A subunit vaccine against porcine post-weaning diarrhoea Ceased WO2019175477A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
FI20185227 2018-03-12
FI20185227 2018-03-12

Publications (1)

Publication Number Publication Date
WO2019175477A1 true WO2019175477A1 (en) 2019-09-19

Family

ID=65995766

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/FI2019/050207 Ceased WO2019175477A1 (en) 2018-03-12 2019-03-12 A subunit vaccine against porcine post-weaning diarrhoea

Country Status (1)

Country Link
WO (1) WO2019175477A1 (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2023172440A1 (en) * 2022-03-07 2023-09-14 Elanco Us Inc. METHODS, COMPOSITIONS, AND FOOD ADDITIVES COMBINING A F4/F18 VACCINE AND β-MANNANASE AND/OR A PROBIOTIC FOR THE TREATMENT AND PREVENTION OF ENTEROTOXIGENIC ESCHERICHIA COLI (ETEC) IN PIGS
CN118086162A (en) * 2024-03-07 2024-05-28 吉林农业大学 Adhesion-enhanced engineering probiotics and application thereof

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2013102674A2 (en) 2012-01-05 2013-07-11 Novartis International Pharmaceutical Ltd. Protease deficient filamentous fungal cells and methods of use thereof
WO2015004241A2 (en) 2013-07-10 2015-01-15 Novartis Ag Multiple proteases deficient filamentous fungal cells and methods of use thereof

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2013102674A2 (en) 2012-01-05 2013-07-11 Novartis International Pharmaceutical Ltd. Protease deficient filamentous fungal cells and methods of use thereof
WO2015004241A2 (en) 2013-07-10 2015-01-15 Novartis Ag Multiple proteases deficient filamentous fungal cells and methods of use thereof

Non-Patent Citations (17)

* Cited by examiner, † Cited by third party
Title
ANONYMOUS, CVMP ASSESSMENT REPORT FOR COLIPROTEC F4 (EMEA/V/C/003797/0000, 2015
C. ENGLER; R. KANDZIA; S. MARILLONNET: "A One Pot, One Step, Precision Cloning Method with High Throughput Capability", PLOS ONE, vol. 3, no. 11, May 2008 (2008-05-01), pages e3647
I. VAN MOLLE ET AL.: "Structural and Thermodynamic Characterization of Pre- and Postpolymerization States in the F4 Fimbrial Subunit FaeG", J. MOL. BIOL., vol. 394, no. 5, 2009, pages 957 - 967, XP026802533, DOI: doi:10.1016/j.jmb.2009.09.059
IGOR KOLOTILIN ET AL: "Production of a Subunit Vaccine Candidate against Porcine Post-Weaning Diarrhea in High-Biomass Transplastomic Tobacco", PLOS ONE, vol. 7, no. 8, 3 August 2012 (2012-08-03), pages e42405, XP055587390, DOI: 10.1371/journal.pone.0042405 *
J. M. FAIRBROTHER; E. NADEAU; C. L. GYLES: "Escherichia coli in postweaning diarrhea in pigs: an update on bacterial types, pathogenesis, and prevention strategies", ANIM. HEAL. RES. REV., vol. 6, no. 1, 2005, pages 17 - 39, XP008176046, DOI: doi:10.1079/AHR2005105
J. M. RUTTER; G. W. JONES: "Protection against enteric disease caused by Escherichia coli-a model for vaccination with a virulence determinant?", NATURE, vol. 242, no. 5399, 1973, pages 531 - 532
JUSSI J JOENSUU ET AL: "Glycosylated F4 (K88) Fimbrial Adhesin FaeG Expressed in Barley Endosperm Induces ETEC-neutralizing Antibodies in Mice", TRANSGENIC RESEARCH, KLUWER ACADEMIC PUBLISHERS-PLENUM PUBLISHERS, NE, vol. 15, no. 3, 1 June 2006 (2006-06-01), pages 359 - 373, XP019409555, ISSN: 1573-9368, DOI: 10.1007/S11248-006-0010-7 *
M. G. STEIGER ET AL.: "A transformation system for Hypocrea (Trichoderma) that favors homologous integration and that uses reusable bidirectionally-selectable markers", APPL. ENVIRON. MICROBIOL, 2011
M. PENTTILA; H. NEVALAINEN; M. RATTO; E. SALMINEN; J. KNOWLES: "A versatile transformation system for the cellulolytic filamentous fungus Trichoderma reesei", GENE, vol. 61, no. 2, 1987, pages 155 - 164, XP023545070, DOI: doi:10.1016/0378-1119(87)90110-7
M. SALOHEIMO; T. M. PAKULA: "The cargo and the transport system: secreted proteins and protein secretion in Trichoderma reesei (Hypocrea jecorina", MICROBIOLOGY, vol. 158, no. 1, 2012, pages 46 - 57
SHUJIE LIU ET AL: "Immune responses elicited in mice with recombinant Lactococcus lactis expressing F4 fimbrial adhesin FaeG by oral immunization", VETERINARY RESEARCH COMMUNICATIONS ; AN INTERNATIONAL JOURNAL PUBLISHING TOPICAL REVIEWS AND RESEARCH ARTICLES ON ALL ASPECTS OF THE VETERINARY SCIENCES, KLUWER ACADEMIC PUBLISHERS, DO, vol. 34, no. 6, 9 June 2010 (2010-06-09), pages 491 - 502, XP019832139, ISSN: 1573-7446 *
T. P. VAN BOECKEL ET AL.: "Global trends in antimicrobial use in food animals", PROC. NATL. ACAD. SCI., vol. 112, no. 18, May 2015 (2015-05-01), pages 5649
VERDONCK F ET AL: "Oral immunization of piglets with recombinant F4 fimbrial adhesin FaeG monomers induces a mucosal and systemic F4-specific immune response", VACCINE, ELSEVIER, AMSTERDAM, NL, vol. 22, no. 31-32, 22 October 2004 (2004-10-22), pages 4291 - 4299, XP002523295, ISSN: 0264-410X, DOI: 10.1016/J.VACCINE.2004.04.016 *
W. VAN DEN BROECK; E. COX; B. M. GODDEERIS: "Receptor-dependent immune responses in pigs after oral immunization with F4 fimbriae", INFECT. IMMUN., vol. 67, no. 2, 1999, pages 520 - 526
W. VAN DEN BROECK; E. COX; B. M. GODDEERIS: "Receptor-specific binding of purified F4 to isolated villi", VET. MICROBIOL.,, vol. 68, no. 3-4, 1999, pages 255 - 263
WIM VAN DEN BROECK ET AL: "Receptor-Dependent Immune Responses in Pigs after Oral Immunization with F4 Fimbriae", INFECTION AND IMMUNITY, 1 February 1999 (1999-02-01), United States, pages 520 - 526, XP055587380, Retrieved from the Internet <URL:https://www.ncbi.nlm.nih.gov/pmc/articles/PMC96350/pdf/ii000520.pdf> *
X. YE ET AL.: "Livestock-associated methicillin and multidrug resistant S. aureus in humans is associated with occupational pig contact, not pet contact", SCI. REP., vol. 6, January 2016 (2016-01-01), pages 19184

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2023172440A1 (en) * 2022-03-07 2023-09-14 Elanco Us Inc. METHODS, COMPOSITIONS, AND FOOD ADDITIVES COMBINING A F4/F18 VACCINE AND β-MANNANASE AND/OR A PROBIOTIC FOR THE TREATMENT AND PREVENTION OF ENTEROTOXIGENIC ESCHERICHIA COLI (ETEC) IN PIGS
CN118086162A (en) * 2024-03-07 2024-05-28 吉林农业大学 Adhesion-enhanced engineering probiotics and application thereof

Similar Documents

Publication Publication Date Title
AU767143B2 (en) Lactobacilli harboring aggregation and mucin binding genes as vaccine delivery vehicles
RU2474587C2 (en) CLOSTRIDIAL TOXIN NetB
KR101100237B1 (en) Oral recombinant Helicobacter pylori vaccine and preparation method thereof
CN107257853B (en) Novel enterohemorrhagic Escherichia coli phage Esc-CHP-1 and its use in inhibiting the proliferation of enterohemorrhagic Escherichia coli
CN112135630B (en) Swine fever vaccine composition and preparation method thereof
RU2646137C2 (en) Composition for preventing and curing mycoplasma spp infection
CN113354743A (en) Multi-epitope antigen and vaccine for piglet diarrhea as well as preparation method and application of multi-epitope antigen and vaccine
Chu et al. Lactobacillus acidophilus expressing recombinant K99 adhesive fimbriae has an inhibitory effect on adhesion of enterotoxigenic Escherichia coli
CN106146626B (en) A kind of Erysipelothrix rhusiopathiae subunit vaccine and its preparation method and application
CN115725002B (en) Coli specific antigen fusion protein and recombinant lactococcus lactis thereof
CN104988107A (en) Recombinant lactic acid bacillus efficiently expressing foot and mouth disease virus antigen genes and preparation method and application thereof
Leigh Vaccines against bovine mastitis due to Streptococcus uberis current status and future prospects.
CN108330142B (en) Mermaid photorhabditis hemolysin Hly with immune protection effectchProtein
CN111925426B (en) Clostridium perfringens alpha toxin mutant, expression system, preparation method and application
CN104560854A (en) PhoP deleted pasteurella multocida attenuated strain of birds, as well as construction method and application thereof
CN120118932A (en) Recombinant Lactobacillus plantarum oral vaccine for preventing and controlling ASFV mucosal infection and its preparation method and application
CN108641993A (en) A kind of recombinant lactic acid bacteria oral vaccine strain of food-grade expression bovine viral diarrhea virus E2 albumen
KR101765394B1 (en) Epitope protein of PEDV, Recombinant vector contaning genes encoding thereof, Transformnant expressing thereof, and Composition for preventing or treating PEDV comprising thereof
KR20220167577A (en) Vaccine composition for preventing or treating fowl typhoid and salmonellosis simultaneously comprising Salmonella gallinarum mutant expressing FliC-FimA-CD40L fusion antigen as effective component
KR20190053506A (en) Vaccin compsosition for preventing or treating porcine pathogenic colibacillosis comprising ghost enterotoxigenic Escherichia coli as effective componet
KR20190045128A (en) Novel Stx2e epitope protein and vaccine composition comprising the same
KR102018707B1 (en) Vaccine composition for preventing or treating porcine pleuropneumonia
CN113717292B (en) Fusion protein vaccine for necrotic enteritis of chickens and preparation method thereof
KR20180114684A (en) Novel Stx2e epitope protein and vaccine composition comprising the same
US20090304733A1 (en) Vaccine comprising recombinant ct or lt toxin

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 19714705

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 19714705

Country of ref document: EP

Kind code of ref document: A1