WO2019169863A1 - Use of gene krtap20-1 - Google Patents

Abstract

Disclosed in the present invention is a use of a gene KRTAP20-1. The human gene KRTAP20-1 is used for preparing or screening tumor treatment medicines. Small hairpin RNA for restraining the expression of the gene KRTAP20-1 is provided, and the design target spot of the small hairpin RNA is any one selected from SEQ ID NO.1, SEQ ID NO.4 and SEQ ID NO.7. The human gene KRTAP20-1 as the tumor diagnosis index is used for preparation of tumor diagnosis reagents. The gene is related to the tumor generation and development, cell proliferation and angiogenesis. A new basis is provided for further researching the relation between the gene KRTAP20-1 and tumors, developing a new anti-tumor medicine and creating a new clinical diagnosis, treatment effect evaluation and prognosis indexes.

Description

Application of gene KRTAP20-1 Technical field

The present invention relates to the field of biotechnology, and in particular to the use of the gene KRTAP20-1.

Background technique

At present, the main methods for clinical treatment of cancer are surgical resection and radiotherapy and chemotherapy. However, radiotherapy and chemotherapy also cause serious damage to normal human cells while killing cancer cells.

With the deepening of research on the biological characteristics of tumors at the molecular level, people have begun to try to use biological methods to treat different levels of the tumor development process and have achieved gratifying effects, some can specifically block tumor growth. Biological agents have gradually moved to the clinic.

Tumors develop special biological functions during the process of progression, including immortalization, escape from growth-suppressing genes, inhibition of apoptosis, induction of angiogenesis, and activation of invasion and metastasis. In the process of the formation of these biological features, related coding genes play an important role.

Bio-gene targeted therapy is a ground-breaking targeted biogene therapy that will bring new hope to cancer patients. This epoch-making biological gene-targeted therapy will greatly reduce the side effects of patients in treatment, reduce pain, and effectively extend life while improving the quality of life.

Genes that play a decisive role in tumor progression are necessary for early diagnosis of tumors, assessment of malignant progression and prognosis, and the development of effective biogene-targeted therapeutic drugs.

At present, a lot of research work has been done on various aspects of tumor-related genes at home and abroad, and relevant targeted drugs have been developed in a targeted manner, and some progress has been made in the treatment of tumors, and the curative effect in treating breast cancer and lung cancer is particularly prominent. However, the therapeutic effect on other tumors is still unsatisfactory. In the treatment of glioma, biological gene-targeted therapy is still in the blank.

Summary of the invention

The present invention aims to provide an application of the gene KRTAP20-1.

The object of the invention can be achieved by the following technical solutions:

The gene KRTAP20-1 (keratin associated protein 20-1, KAP20.1) of the present invention is derived from human, and only the report of the gene sequence in the Pubmed gene library is mRNA having the following gene sequence: Gene ID: 337975; located on human chromosome 21q22.11, exon 1; belongs to KRTAP20 family. Length: 56; mass (Da): 6,202.

The application of the human KRTAP20-1 gene in the preparation or screening of tumor therapeutic drugs; the tumor is selected from the group consisting of glioma, lung cancer, colon cancer, liver cancer, gastric cancer, esophageal cancer, pancreatic cancer, breast cancer, cervical cancer, prostate cancer, Melanoma.

The human KRTAP20-1 gene is used for the preparation or screening of tumor therapeutic drugs, including two aspects: First, the human KRTAP20-1 gene is used as a drug or a preparation for targeting tumor cells to prepare a tumor therapeutic drug; The KRTAP20-1 gene is used as a drug or preparation for targeting tumor cells and is used for screening tumor therapeutic drugs.

The application of the human KRTAP20-1 gene as a drug or a preparation target for tumor cells to prepare a tumor therapeutic drug specifically means that the KRTAP20-1 gene is used as a target of RNA interference, and a tumor therapeutic drug or preparation capable of targeting the gene is developed. Thereby reducing the expression level of the KRTAP20-1 gene in tumor cells.

The application of the human KRTAP20-1 gene as a drug or a preparation for targeting tumor cells to screen tumor therapeutic drugs specifically refers to: screening the drug with the human KRTAP20-1 gene, and finding that it can affect (inhibit) The human KRTAP20-1 gene is expressed as a drug and then used as a tumor treatment alternative composition drug. The small hairpin RNA of the KRTAP20-1 gene according to the present invention can be used as a drug having an action of inhibiting tumor cell proliferation. In addition, human KRTAP20-1 gene and its protein can also be targeted, such as antibody drugs, small molecule drugs and the like.

The tumor therapeutic agent of the present invention is a molecule capable of specifically inhibiting transcription or translation of the human KRTAP20-1 gene, or capable of specifically inhibiting the expression or activity of the human KRTAP20-1 gene, thereby reducing the tumor cell human KRTAP20-1 gene. The expression level achieves the purpose of inhibiting the proliferation, growth, differentiation and survival of tumor cells.

The tumor therapeutic drugs prepared or screened by the present invention include, but are not limited to, nucleic acid molecules, carbohydrates, lipids, small molecule chemicals (such as inhibitors), antibody drugs, polypeptides, proteins or interfering lentiviruses, adenoviruses, retroviruses. Wait.

The KRTAP20-1 gene expressed by the present invention, or a cell expressing the same, can be used as an antigen to produce an antibody, and is clinically used for clinical diagnosis, treatment, therapeutic evaluation, etc. of a tumor, and can also be used for a molecular mechanism related to KRTAP20-1. the study. The antibody may be a monoclonal antibody, or a polyclonal antibody, and also includes chimeric, single-stranded and humanized antibodies as well as Fab fragments, or products of a Fab expression library. KRTAP20-1 monoclonal and polyclonal antibodies can be prepared by existing methods, such as immunizing animals, culturing hybridoma methods. This antibody can be used to detect the presence or level of KRTAP20-1 of the invention.

A small hairpin RNA that inhibits expression of the KRTAP20-1 gene, and the design target of the small hairpin RNA is selected from any one of SEQ ID NO. 1, SEQ ID NO. 4, and SEQ ID NO.

The small hairpin RNA is preferably any complementary double-stranded RNA consisting of a sense strand and an antisense strand having the sequence:

1. Carrier name: pGPU6/GFP/Neo-KRTAP20-1-Homo-44

Target sequence: GCAACTATTATGGTGGCTATG (SEQ ID NO. 1)

Justice chain: 5'CACCGCAACTATTATGGTGGCTATGTTCAAGAGACATAGCCACCATAATAGTTGCTTTTTTG 3' (SEQ ID NO. 2)

Antisense strand: 5'GATCCAAAAAAGCAACTATTATGGTGGCTATGTCTCTTGAACATAGCCACCATAATAGTTGC 3' (SEQ ID NO. 3)

2. Carrier name: pGPU6/GFP/Neo-KRTAP20-1-Homo-137

Target sequence: GCTATGGAAATGGCTACTACT (SEQ ID NO. 4)

Justice chain: 5'CACCGCTATGGAAATGGCTACTACTTTCAAGAGAAGTAGTAGCCATTTCCATAGCTTTTTTG 3' (SEQ ID NO. 5)

Antisense strand: 5'GATCCAAAAAAGCTATGGAAATGGCTACTACTTCTCTTGAAAGTAGTAGCCATTTCCATAGC 3' (SEQ ID NO. 6)

3. Carrier name: pGPU6/GFP/Neo-KRTAP20-1-Homo-243

Target sequence: GGATTCTCATGCTGCTCTTGT (SEQ ID NO. 7)

Justice chain: 5'CACCGGATTCTCATGCTGCTCTTGTTTCAAGAGAACAAGAGCAGCATGAGAATCCTTTTTTG 3' (SEQ ID NO. 8)

Antisense strand: 5'GATCCAAAAAAGGATTCTCATGCTGCTCTTGTTCTCTTGAAACAAGAGCAGCATGAGAATCC 3' (SEQ ID NO. 9)

An interference plasmid for the human KRTAP20-1 gene comprising a small hairpin RNA encoding the expression of the KRTAP20-1 gene of the present invention.

The interference plasmid of the human KRTAP20-1 gene, preferably from: pGPU6/GFP/Neo-KRTAP20-1-Homo-44, pGPU6/GFP/Neo-KRTAP20-1-Homo-137, pGPU6/GFP/Neo-KRTAP20- Any of 1-Homo-243. The pGPU6/GFP/Neo-KRTAP20-1-Homo-44 is based on pGPU6/GFP/Neo-KRTAP20-1 and contains a small hairpin RNA shRNA44 which inhibits KRTAP20-1 gene expression; the pGPU6/GFP/ Neo-KRTAP20-1-Homo-137 is based on pGPU6/GFP/Neo-KRTAP20-1 and contains a small hairpin RNA shRNA137 that inhibits KRTAP20-1 gene expression; the pGPU6/GFP/Neo-KRTAP20-1-Homo -243 is a plasmid based on pGPU6/GFP/Neo-KRTAP20-1 and contains a small hairpin RNA shRNA243 which inhibits the expression of the KRTAP20-1 gene.

A pharmaceutical composition for treating a tumor, the active ingredient of the pharmaceutical composition comprising an isolated nucleic acid molecule which reduces KRTAP20-1 gene expression in a tumor cell, an antibody encoding a KRTAP20-1 encoded protein or an KRTAP20-1 gene encoding A small molecule compound of protein activity; the tumor is selected from the group consisting of glioma, lung cancer, colon cancer, liver cancer, gastric cancer, esophageal cancer, pancreatic cancer, breast cancer, cervical cancer, prostate cancer, melanoma.

The isolated nucleic acid molecule that reduces KRTAP20-1 gene expression in tumor cells is selected from the group consisting of an antisense oligonucleotide of the KRTAP20-1 gene or a small interfering RNA or small hairpin RNA, sgRNA that inhibits KRTAP20-1 expression.

The isolated nucleic acid molecule that reduces KRTAP20-1 gene expression in tumor cells is selected from the small hairpin RNAs of the present invention that inhibit KRTAP20-1 gene expression.

The tumor is selected from any one of glioma, lung cancer, colon cancer, liver cancer, gastric cancer, esophageal cancer, pancreatic cancer, breast cancer, cervical cancer, prostate cancer, and melanoma.

The above drugs may also contain adjuvants DDA and/or MPL and/or Quil-A and/or RIBI adjuvants and/or saline (physiological saline) or other adjuvants such as aluminum adjuvants, Freund's adjuvant and the like.

The medicament of the present invention can be prepared into various forms such as an injection solution, a tablet, a capsule, a powder, a paste, a nano preparation, and the like. The above various dosage forms of the drug can be prepared according to the method of the gene drug/oligonucleotide drug field.

Application of human KRTAP20-1 gene in the preparation of tumor diagnostic reagents. The use of the human KRTAP20-1 gene for the preparation of a tumor diagnostic reagent refers to the preparation of a KRTAP20-1 gene expression product as a tumor diagnostic indicator for the preparation of a tumor diagnostic reagent. For example, the gene is used as a standard for preparing a tumor diagnostic reagent.

The human KRTAP20-1 gene is used as a tumor diagnostic indicator in preparing a tumor diagnostic reagent; the tumor is selected from the group consisting of glioma, lung cancer, colon cancer, liver cancer, gastric cancer, esophageal cancer, pancreatic cancer, breast cancer, cervical cancer, prostate Cancer, melanoma.

The use of an agent for detecting a human KRTAP20-1 gene expression amount for preparing a tumor diagnostic reagent; the tumor is selected from the group consisting of glioma, lung cancer, colon cancer, liver cancer, gastric cancer, esophageal cancer, pancreatic cancer, breast cancer, cervical cancer, Prostate cancer, melanoma.

The use of primers, probes or gene chips for detecting the expression level of human KRTAP20-1 gene in the preparation of tumor diagnostic reagents.

A tumor diagnostic reagent for detecting a primer, probe or gene chip of human KRTAP20-1 gene expression; the tumor is selected from the group consisting of glioma, lung cancer, colon cancer, liver cancer, gastric cancer, esophageal cancer, pancreatic cancer, breast cancer , cervical cancer, prostate cancer, melanoma.

The KRTAP20-1 gene expressed by the present invention, or a cell expressing the same, can be used as an antigen to produce an antibody, and is clinically used for clinical diagnosis, treatment, therapeutic evaluation, etc. of a tumor, and can also be used for a molecular mechanism related to KRTAP20-1. the study. The antibody may be a monoclonal antibody, or a polyclonal antibody, and also includes chimeric, single-stranded and humanized antibodies as well as Fab fragments, or products of a Fab expression library. KRTAP20-1 monoclonal and polyclonal antibodies can be prepared by existing methods, such as immunizing animals, culturing hybridoma methods. This antibody can be used to detect the presence or level of KRTAP20-1 of the invention.

Beneficial effects:

The tumor-associated coding gene KRTAP20-1 of the present invention has a function of aggravating tumors; stable and high expression of KRTAP20-1 in mouse fibroblasts can significantly cause malignant transformation of the cells; and its expression in cell lines is detected by qPCR. It is indicated that the expression level in glioma cell line is significantly higher than that in normal transformed cell line; the expression level in glioma clinical surgical tissue specimens indicates that the expression level of glioma tissue is low and high level. The expression level of glioma tissues from low to high showed a gradual increase, and normal tissues did not express. The tumor-associated coding gene KRTAP20-1 and its protein and KRTAP20-1 antibody can be used for in vitro diagnosis and prognosis evaluation of tumors. The tumor-associated protein KRTAP20-1 and its coding gene can be used as targets for anti-tumor drugs, such as establishing a drug screening model using KRTAP20-1 expressed in vitro, screening for drugs that inhibit the expression of KRTAP20-1, such as small molecule compounds; KRTAP20-1 The coding gene is constructed into an adenovirus, a retrovirus, or a lentiviral vector, infecting a cell or an experimental animal, establishing an in vitro and in vivo model of the tumor, and the like. The small hairpin RNA designed by the KRTAP20-1 encoding gene of the present invention can induce apoptosis and growth inhibition of the glioma cell line alone after being introduced into the glioma cell line, and therefore, other KRTAP20-1 inhibitors, such as Antisense oligonucleotides of KRTAP20-1 can be used to treat tumors.

The KRTAP20-1 gene is involved in tumor development, cell proliferation, and angiogenesis. The present invention provides a new basis for further research on the relationship between KRTAP20-1 and tumors, as well as the development of new anti-tumor drugs, and opening up new clinical diagnosis, therapeutic evaluation and prognostic indicators.

DRAWINGS

Figure 1 Expression of KRTAP20-1 in tumor cells

Figure 2 KRTAP20-1 expression in U251 cells after 24 h inhibition by KRTAP20-1-shRNA

Figure 3 KRTAP20-1 expression in U251 cells after 48h inhibition by KRTAP20-1-shRNA

Figure 4 Analysis of shRNA inhibition of KRTAP20-1 expression in U251 cells

Figure 5 Analysis of cell proliferation ability of HUVEC cells co-cultured with U251 cells inhibiting KRTAP20-1 expression

a. HUVEC cells were cultured separately; b. Normal U251 cells were co-cultured with HUVEC cells; c. U251 cells knocked out of KRTAP20-1 were co-cultured with HUVEC cells.

Fig.6 Analysis of cell invasion ability of HUVEC cells co-cultured with U251 cells inhibiting KRTAP20-1 expression a. HUVEC cells were cultured alone; b. Normal U251 cells were co-cultured with HUVEC cells; c. U251 cells knocked out of KRTAP20-1 Co-culture group with HUVEC cells

Detailed ways

The invention is further illustrated by the following examples, and it is to be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention. It is within the scope of protection of the present invention. The experimental methods in the following examples which do not specify the specific conditions are generally in accordance with well-known means in the art.

Example 1. Detection of KRTAP20-1 expression in tumor cells by real-time PCR

KRTAP20-1 expression in tumor cells was detected by real-time PCR, and KRTAP20-1 expression was found in the following tumor cell lines.

1.1 Total RNA extraction from cells

Tumor cell lines were digested and planted in six-well plates for 24 hours. Add 1 mL of TRIzol reagent to each well of the six-well plate, violently shake and mix to fully lyse, and let it stand at low temperature for 5 min until the lysate is clear and transparent, and transfer to 1.5 mL EP tube. Note that low temperature should be kept during the whole lysis process to prevent RNA degradation. Add 200 μL of chloroform, mix by inversion, let stand for 5 min at room temperature, centrifuge at 12000 g/min for 15 min, and take 400 μL of the upper colorless aqueous phase to another EP tube. Further, 400 μL of isopropanol was added, and the mixture was thoroughly mixed, allowed to stand for 10 minutes, and then centrifuged at 12000 g/min for 10 minutes at 4 °C. The supernatant was discarded, and the precipitate was washed by adding 1 mL of 75% DEPC ethanol, and then centrifuged at 7400 g/min for 5 min at 4 ° C, and the supernatant was discarded. The ethanol in the washing process is dried and washed, and an appropriate amount of RNA lysate is added according to the amount of the precipitate to dissolve the RNA precipitate.

1.2 reverse transcription

According to the instructions of Takara PrimeScript RT Master Mix (Code No. RR036A) reverse transcription kit, the reaction system is shown in Table 1-1. The whole process is carried out on ice, taking care to prevent RNA from being degraded by RNase. All experimental equipment such as EP tubes, tweezers, and tips are required to be immersed in 0.1% DEPC to destroy RNase. The reaction solution was uniformly mixed and placed in a PCR machine, and the procedure was set at 37 ° C for 15 min to complete the reverse transcription process. After the end of the reaction, the mixture was heated at 85 ° C for 5 s to inactivate the reverse transcriptase, and the reaction was terminated to obtain cDNA for the amplification reaction.

Table 1-1. cDNA synthesis system

1.3 Real-time PCR analysis

The design of the fluorescent quantitative PCR primers is shown in Table 1-2, and the PCR reaction system is 15 μL, as shown in Table 1-3. The PCR reaction system was reacted on an Eppendorf fluorescence meter. The reaction conditions were pre-denaturation at 95 ° C for 5 min, then at 95 ° C for 10 s, 58 ° C for 40 s, 72 ° C for 15 s for 40 cycles, and 72 ° C for 7 min to terminate the reaction. The double-stranded DNA of the product was quantified by binding to SYBR Green I dye, and GAPDH was used as the internal reference gene. The relative expression of mRNA was calculated by the formula 2 - ^ΔΔCt :

ΔCt _{calibration sample} = PPAR (Mean Ct) ₁ - reference gene GAPDH (Mean Ct) ₁

ΔCt _{sample to be tested} = PPAR (Mean Ct) ₂ - reference gene GAPDH (Mean Ct) ₂

ΔΔCt=ΔCt _{sample to be tested –} ΔCt _{calibration sample}

Relative expression of mRNA = 2 - ^ΔΔCt

Table 1-2. Fluorescent quantitative PCR primers

Table 1-3. PCR reaction system

1.4 Expression of KRTAP20-1 in tumor cells

The expression of KRTAP20-1 in tumor cell lines was detected by real-time PCR, and it was found that the expression levels of KRTAP20-1 were different in different tumor cell lines, as shown in Figure 1.

Example 2. KRTAP20-1-shRNA transfection into glioma U25 cell experiment

2.1 Construction of recombinant plasmid shRNA (short hairpin RNA, short hairpin RNA)

2.1.1 Design of the plasmid

First, the gene sequence of human KRTAP20-1 (gene ID: 337975) was obtained from the gene bank. According to the design principle of RNA interference sequence, three pairs of KRTAP20-1-shRNA interference sequences were designed by using online design software: shRNA44, shRNA137 and shRNA243 . The specificity was determined by BLAST comparison, and finally shRNA was constructed by Shanghai Jima Pharmaceutical Technology Co., Ltd. The positive and negative controls were also designed and synthesized by Shanghai Jima.

1. Carrier name: pGPU6/GFP/Neo-KRTAP20-1-Homo-44

Target sequence: GCAACTATTATGGTGGCTATG

Justice chain: 5'CACCGCAACTATTATGGTGGCTATGTTCAAGAGACATAGCCACCATAATAGTTGCTTTTTTG 3’

Antisense strand: 5'GATCCAAAAAAGCAACTATTATGGTGGCTATGTCTCTTGAACATAGCCACCATAATAGTTGC 3'

2. Carrier name: pGPU6/GFP/Neo-KRTAP20-1-Homo-137

Target sequence: GCTATGGAAATGGCTACTACT

Justice Chain: 5'CACCGCTATGGAAATGGCTACTACTTTCAAGAGAAGTAGTAGCCATTTCCATAGCTTTTTTG 3’

Antisense strand: 5'GATCCAAAAAAGCTATGGAAATGGCTACTACTTCTCTTGAAAGTAGTAGCCATTTCCATAGC 3'

3. Carrier name: pGPU6/GFP/Neo-KRTAP20-1-Homo-243

Target sequence: GGATTCTCATGCTGCTCTTGT

Justice Chain: 5'CACCGGATTCTCATGCTGCTCTTGTTTCAAGAGAACAAGAGCAGCATGAGAATCCTTTTTTG 3’

Antisense strand: 5'GATCCAAAAAAGGATTCTCATGCTGCTCTTGTTCTCTTGAAACAAGAGCAGCATGAGAATCC 3'

4. Carrier name: pGPU6/GFP/Neo-shNC

Target sequence: TTCTCCGAACGTGTCACGT

Justice Chain: 5'-CACCGTTCTCCGAACGTGTCACGTTTCAAGAGAACGTGACACGTTCGGAGAATTTTTTG-3’

Antisense strand: 5'-GATCCAAAAAATTCTCCGAACGTGTCACGTTCTCTTGAAACGTGACACGTTCGGAGAAC-3'

5, the carrier name: pGPU6/GFP/Neo-homo-GAPDH

Target sequence: GTATGACAACAGCCTCAAG

Justice chain: 5'-CACCGTATGACAACAGCCTCAAGTTCAAGAGACTTGAGGCTGTTGTCATACTTTTTTG-3’

Antisense strand: 5'-GATCCAAAAAAGTATGACAACAGCCTCAAGTCTCTTGAACTTGAGGCTGTTGTCATAC-3'

2.1.2 Transfection method

(1) U251 cells were seeded in a 6-well plate at a density of 1 × 10 ⁵ /ml, cultured in a medium without a double antibody, and transfected when the cell confluence was about 80%;

(2) Pipetting 10 μl of shRNA (0.4 ug/ul) in 250 μl

I mixed in low serum medium, and allowed to stand at room temperature for 5 min;

(3) According to the recommended dosage, take another 10μl Lipofectamine ^TM 2000 at 250μl

I in low serum medium, mix and incubate for 5 min at room temperature;

(4) mixing the shRNA and the diluted Lipofectamine ^TM 2000, incubated at room temperature for 20min, to ensure the formation of the transfection complex of shRNA-Lipofectamine ^TM 2000.

(5) The shRNA-Lipofectamine ^TM 2000 complex was added to 6-well plates, mixed gently, 37 ℃, 5% CO ₂ incubator;

(6) After 6 hours, the cells were replaced with a complete medium, observed under a fluorescent inverted microscope, and counted, and the transfection efficiency was calculated according to Formula 1.

2.1.3 Effective sequence screening

The expression of KRTAP20-1 in U251 cells transfected with plasmid was detected by real-time PCR, and the best shRNA sequence with the best inhibitory effect of KRTAP20-1 was screened out.

As shown in Figure 2, the expression level of KRTAP20-1 in U251 cells was shown 24 h after transfection of three KRTAP20-1-shRNAs, respectively.

As shown in Figure 3, the expression level of KRTAP20-1 in U251 cells was shown 48 h after transfection of three KRTAP20-1-shRNAs, respectively.

It can be seen from the screening results that KRTAP20-1-shRNA137 and KRTAP20-1-shRNA243 have a better inhibitory effect; the optimal time for inhibition is 24 hours.

2.1.4 MTT cell proliferation experiment:

(1) KRTAP20-1-shRNA was transfected into U251, and cells were collected 24 hours later. The cell suspension concentration was adjusted and transferred to a 96-well plate at 1×10 ⁷ /well. Each well was repeated for 3 wells, 100 μL/well. Incubate in a incubator at 5% CO ₂ at 37 ° C;

(2) After incubation for 48 hours, add 20 μL of MTT (5 mg/mL) per well and incubate at 37 °C;

(3) After 4 hours, discard the culture medium in the well, pat dry, add 150 μL of DMSO to each well, carefully shake to make the purple blue formazan crystals completely dissolved;

(4) OD value of each well was measured on an enzyme-linked immunosorbent detector, and the detection wavelength was 570 nm, and the relative survival rate was calculated according to Formula 2:

Cell viability (%) = (OD treatment / OD control) × 100% 2

(5) The experimental results shown in Figure 4 indicate that U251 cells showed a significant decrease in cell proliferation ability after KRTAP20-1-shRNA transfection.

Example 3: KRTAP20-1-shRNA transfection of glioma U251 cells promotes invasion and proliferation of HUVEC cells

Coculture of glioma cells and human umbilical vein endothelial cells HUVEC cells was performed by Transwell co-culture system. Invasiveness assay and MTT assay were used to detect the invasiveness and proliferative activity of vascular endothelial cells under different conditions of glioma cells. Changes were made to observe the effects of glioma cells knocking out KRTAP20-1 on invasive growth and cell viability of vascular endothelial cells.

3.1 Cell grouping:

a. HUVEC cells were cultured separately; b. Normal U251 cells were co-cultured with HUVEC cells; c. U251 cells knocked out of KRTAP20-1 were co-cultured with HUVEC cells.

3.2 Indirect co-culture with Transwell chamber:

HUVECs were inoculated into the lower chamber of Transwell culture plate, and U251 cells were added to the chamber of Transwell culture plate. After 48 hours of co-culture, HUVECs were washed twice with cold PBS, digested with 0.25% Trypsin, and the cells were collected. For the analysis of cell invasion and proliferation experiments.

3.3 Invasive analysis:

Transwell chamber was used to detect the invasiveness of HUVEC cells in each group, and the effect of KRTAP20-1 on the invasiveness of HUVECs cells after co-culture with cells was analyzed.

(1) HUVEC cells collected after co-culture were taken, and the cells were resuspended in serum-free medium, counted, and the cell density was adjusted to 0.8-1.2 × 10 ⁶ /ml.

(2) 600 ul of medium was added to the Transwell lower chamber.

(3) 200 ul of serum-free HUVECs cell suspension was added to the Transwell upper chamber.

(4) Incubate in a 37 ° C, 5% CO ₂ saturated humidity incubator.

(5) After 48 hours, the Transwell chamber was taken out, transferred to a 24-well cell culture plate previously supplemented with 4% paraformaldehyde, and fixed at room temperature for 30 minutes.

(6) Remove the Transwell chamber, gently wipe the non-migrating cells in the upper layer of the chamber with a cotton swab, and transfer to a 24-well cell culture plate pre-added with 0.1% crystal violet to ensure that the chamber filter is immersed in crystal violet and stained at room temperature for 30 minutes.

(7) Remove the Transwell chamber, gently rinse the chamber with PBS, observe under the microscope, randomly take 6 fields of field count, and record the results.

3.4 MTT assay for cell proliferation:

HUVEC cells collected after co-culture were inoculated into a 96-well plate with a single cell suspension (2 × 10 ⁵ /mL) prepared in a culture medium, and each group was inoculated with 6 wells, and each well was inoculated with 2 × 10 ⁴ cells. Incubate at 37 ° C, 5% CO _{2 for} 48 h, add 20 μl of MTT reagent per well, incubate for 4 hours at 37 ° C, add isopropanol, measure with a microplate reader, the detection wavelength is 550 nm, and the reference wavelength is 655 nm. The experimental results are expressed as relative cell viability, and the lower the relative cell viability, the higher the radiosensitivity.

Relative survival rate (%) = [experimental well A value / unirradiated control well A value] × 100%.

3.5 Experimental results:

After co-culture of HUVEC cells with U251 cells inhibiting KRTAP20-1 expression, the proliferation of HUVEC cells (Fig. 5) and invasion (Fig. 6) decreased, suggesting that KRTAP20-1 can promote the proliferation of vascular endothelial cells induced by glioma cells. It has a promoting effect on angiogenesis of glioma.

The above examples demonstrate that KRTAP20-1 plays an important role in tumor cell growth and angiogenesis, and that reduction or removal of KRTAP20-1 expression in tumor cells inhibits tumor cell growth and angiogenesis.

Claims (15)

1. The application of the human KRTAP20-1 gene in the preparation or screening of tumor therapeutic drugs; the tumor is selected from the group consisting of glioma, lung cancer, colon cancer, liver cancer, gastric cancer, esophageal cancer, pancreatic cancer, breast cancer, cervical cancer, prostate cancer or Melanoma.
2. The use according to claim 1, characterized in that the isolated human KRTAP20-1 gene is used for preparing or screening a tumor therapeutic drug, which comprises two aspects: first, the human KRTAP20-1 gene is used as a drug or preparation for tumor cells. The target is used to prepare a tumor therapeutic drug; secondly, the human KRTAP20-1 gene is used as a drug or a preparation for targeting tumor cells to screen for a tumor therapeutic drug.
3. A small hairpin RNA that inhibits expression of the KRTAP20-1 gene, characterized in that the design target of the small hairpin RNA is selected from any one of SEQ ID NO. 1, SEQ ID NO. 4, and SEQ ID NO.
4. The small hairpin RNA for inhibiting expression of a KRTAP20-1 gene according to claim 3, wherein the small hairpin RNA is selected from any one of a complementary double-stranded RNA consisting of a sense strand and an antisense strand having the following sequence: shRNA44 : sense strand: SEQ ID NO. 2, antisense strand: SEQ ID NO. 3; shRNA137: sense strand: SEQ ID NO. 5, antisense strand: SEQ ID NO. 6; shRNA243: sense strand: SEQ ID NO. 8, antisense strand: SEQ ID NO.
5. An interference plasmid for the human KRTAP20-1 gene, characterized by comprising a small hairpin RNA encoding the KRTAP20-1 gene-inhibiting expression according to any one of claims 3-4.
6. An interference plasmid for the human KRTAP20-1 gene according to claim 5, which is selected from the group consisting of: pGPU6/GFP/Neo-KRTAP20-1-Homo-44, pGPU6/GFP/Neo-KRTAP20-1-Homo-137, pGPU6 /GFP/Neo-KRTAP20-1-Homo-243.
7. A pharmaceutical composition for treating a tumor, characterized in that the active ingredient of the pharmaceutical composition contains an isolated nucleic acid molecule which reduces expression of a KRTAP20-1 gene in a tumor cell, an antibody encoding a protein of KRTAP20-1 or inhibits KRTAP20- A small molecule compound encoding a protein activity; the tumor is selected from the group consisting of glioma, lung cancer, colon cancer, liver cancer, gastric cancer, esophageal cancer, pancreatic cancer, breast cancer, cervical cancer, prostate cancer or melanoma.
8. The pharmaceutical composition according to claim 7, characterized in that the isolated nucleic acid molecule which reduces KRTAP20-1 gene expression in tumor cells is selected from the antisense oligonucleotide of KRTAP20-1 gene or inhibits KRTAP20-1 expression. Small interfering RNA or small hairpin RNA.
9. The pharmaceutical composition according to claim 8, wherein the isolated nucleic acid molecule which reduces expression of a KRTAP20-1 gene in a tumor cell is selected from the KRTAP20-1 gene of any one of claims 3-4. Expressed small hairpin RNA.
10. The pharmaceutical composition according to claim 7, wherein the tumor is selected from any one of glioma, lung cancer, colon cancer, liver cancer, gastric cancer, breast cancer, pancreatic cancer, prostate cancer or melanoma.
11. Application of human KRTAP20-1 gene in the preparation of tumor diagnostic reagents.
12. The human KRTAP20-1 gene is used as a tumor diagnostic indicator in preparing a tumor diagnostic reagent; the tumor is selected from the group consisting of glioma, lung cancer, colon cancer, liver cancer, gastric cancer, esophageal cancer, pancreatic cancer, breast cancer, cervical cancer, prostate Cancer or melanoma.
13. The use of an agent for detecting a human KRTAP20-1 gene expression amount for preparing a tumor diagnostic reagent; the tumor is selected from the group consisting of glioma, lung cancer, colon cancer, liver cancer, gastric cancer, esophageal cancer, pancreatic cancer, breast cancer, cervical cancer, Prostate cancer or melanoma.
14. The use according to claim 13, characterized in that the primer, probe or gene chip for detecting the expression level of the human KRTAP20-1 gene is used for preparing a tumor diagnostic reagent.
15. A tumor diagnostic reagent characterized by detecting a primer, probe or gene chip of human KRTAP20-1 gene expression amount; the tumor is selected from the group consisting of glioma, lung cancer, colon cancer, liver cancer, gastric cancer, esophageal cancer, pancreatic cancer , breast cancer, cervical cancer, prostate cancer or melanoma.

Images