WO2019163684A1 - Agent anticancéreux - Google Patents

Agent anticancéreux Download PDF

Info

Publication number
WO2019163684A1
WO2019163684A1 PCT/JP2019/005695 JP2019005695W WO2019163684A1 WO 2019163684 A1 WO2019163684 A1 WO 2019163684A1 JP 2019005695 W JP2019005695 W JP 2019005695W WO 2019163684 A1 WO2019163684 A1 WO 2019163684A1
Authority
WO
WIPO (PCT)
Prior art keywords
cancer
cells
adipsin
anticancer agent
cell
Prior art date
Application number
PCT/JP2019/005695
Other languages
English (en)
Japanese (ja)
Inventor
洋平 下野
秀彰 後藤
博信 南
Original Assignee
国立大学法人神戸大学
学校法人藤田学園
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 国立大学法人神戸大学, 学校法人藤田学園 filed Critical 国立大学法人神戸大学
Priority to JP2019548758A priority Critical patent/JP6664685B2/ja
Publication of WO2019163684A1 publication Critical patent/WO2019163684A1/fr

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A61P35/04—Antineoplastic agents specific for metastasis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/02—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/34—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving hydrolase
    • C12Q1/37—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving hydrolase involving peptidase or proteinase
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/15—Medicinal preparations ; Physical properties thereof, e.g. dissolubility
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing

Definitions

  • the present invention relates to an anticancer agent, and relates to a preventive agent and / or therapeutic agent for cancer. More specifically, the present invention relates to a preventive and / or therapeutic agent for cancer by suppressing cancer stem cells and / or suppressing cancer cell proliferation by a novel mechanism. Furthermore, the present invention relates to a novel screening method for a prophylactic and / or therapeutic agent for cancer.
  • Cancer-stromal interactions are thought to be deeply involved in cancer cell growth, invasion, and metastasis.
  • vascular endothelial cells, fibroblasts, immune cells, etc. are used as the stroma that constitutes cancer tissue, and research is also underway on their interaction with cancer cells (Kawada et al., Drug Drug Delivery System, 18- 4, (2003), Ishii et al., Microscope, Vol.43, 104-8 (2008)).
  • the cancer-stromal interaction differs depending on the cancer-causing organ, and there are many unexplained matters.
  • Normal mammary gland tissue has a characteristic structure in which epithelial tissues that perform the main functions are surrounded by fat cells. Even in breast cancer, the tumor is surrounded by a stroma containing fat cells. Experimentally, it has been shown that the presence of mammary adipose tissue is essential for the development of normal mammary tissue and breast cancer.
  • Adipsin is mainly involved in eliciting an immune response against bacterial infection as an enzyme involved in the complement binding reaction.
  • C3a produced through the action of adipsin accompanying complement binding is also involved in immune cell triggering, vascular endothelial and epithelial cell proliferation, and platelet activation.
  • Non-patent document 1 Frontiers in Immunology, 26 May 2015, doi: 10.3389 / fimmu.2015.00257).
  • C3aR C3a receptor
  • Patent Document 1 US Pat. No. 8,940,299
  • Patent Document 1 although there are references to C3a and C5a which are complement components and descriptions of these receptor antagonists, there is no description of adipsin including description of adipsin in the complement cascade reaction.
  • cancer stem cells are cancer cells with a particularly high tumorigenicity present in tumor tissue, and they have the ability to replicate themselves and a few exist. It has been shown that it has the ability to form tumors similar to the original tumor tissue. Almost all organs and tissues in the body have been identified with the presence of tissue stem cells having self-renewal and multipotency, and they play an important role in the formation and maintenance of tissues. On the other hand, cancer stem cells were identified for the first time in acute myeloid leukemia in 1997, and it has been reported that cancer stem cells were also found in solid cancers including breast cancer.
  • cancer stem cells are the source of breast cancer formation, progression, recurrence, and metastasis, and therefore, development of treatments targeting them is desired.
  • an effective treatment method for cancer stem cells has not been reported.
  • cancer stem cell research is being carried out by applying normal tissue stem cell enrichment and separation methods.
  • leukemia research the search for therapeutic methods targeting leukemia stem cells and the treatment of mouse models are considered. Is underway.
  • solid cancers the establishment of separation and concentration methods is still insufficient, and cancer stem cell research is still a future research area.
  • An object of the present invention is to provide an anticancer agent having an action based on a novel mechanism. It is another object of the present invention to provide a novel anticancer agent having cancer stem cell suppression and / or cancer cell proliferation suppression action. Furthermore, it aims at providing the screening method of a novel anticancer agent.
  • adipose-derived stem cell which is a kind of stroma rather than adipose tissue in a breast cancer surgical specimen: (Hereinafter also referred to as “ADSC”) could be isolated and cultured.
  • ADSC adipose-derived stem cell
  • this invention consists of the following. 1. An anticancer agent comprising a substance having an anti-adipsin action as an active ingredient. 2. 2. The anticancer agent according to item 1 above, wherein the anticancer agent has a cancer metastasis prevention, recurrence prevention and / or therapeutic effect. 3. 3. The anticancer agent according to item 1 or 2, wherein the anticancer agent has a cancer stem cell-inhibiting effect and / or a cancer cell proliferation-inhibiting effect. 4). Cancer stem cell enhancement and / or cancer cells by interaction with one or more types of cells selected from adipocytes, adipose tissue stem cells, and cells derived from adipose tissue stem cells 4.
  • the anticancer agent according to item 3 above which is a cancer associated with proliferation. 5. 4. The anticancer agent according to 3 above, wherein the cancer is a cancer associated with enhancement of cancer stem cell nature and / or cancer cell proliferation by interaction with adipsin. 6). Cancer is breast cancer, colon cancer, uterine cancer, stomach cancer, pancreatic cancer, liver cancer, lung cancer, kidney cancer, bile duct cancer, esophageal cancer, pharyngeal cancer, biliary tract cancer, bladder cancer, 6. The anticancer agent according to any one of 1 to 5 above, which is one or more selected from hematological cancer, lymphoma, ovarian cancer, prostate cancer, thyroid cancer, and bone and soft tissue tumor. 7).
  • a system in which cancer cells are cultured in the presence of adipsin is a system in which adipsin is added to the culture medium to culture cancer cells, or adipocytes, adipose tissue stem cells, cells induced to differentiate from adipose tissue stem cells, and adipsin 8.
  • the screening method for an anticancer agent according to item 7 above which is a system in which cancer cells are co-cultured with any one or more types of cells selected from strongly expressed cells. 9.
  • Agent screening method 10.
  • Cancer cells are breast cancer cells, colon cancer cells, uterine cancer cells, stomach cancer cells, pancreatic cancer cells, liver cancer cells, lung cancer cells, kidney cancer cells, bile duct cancer cells, esophageal cancer cells, and pharynx Any one selected from cancer cells, biliary tract cancer cells, bladder cancer cells, blood cancer cells, lymphoma cells, ovarian cancer cells, prostate cancer cells, thyroid cancer cells, bone soft tissue tumor cells,
  • the screening method for an anticancer agent according to any one of 7 to 9.
  • a screening method for an anti-cancer agent which comprises selecting a substance that inhibits the action of adipsin by allowing adipsin and a candidate substance to interact.
  • the method for preventing and / or treating cancer according to item C which is a cancer associated with proliferation.
  • Cancer is breast cancer, colon cancer, uterine cancer, stomach cancer, pancreatic cancer, liver cancer, lung cancer, kidney cancer, bile duct cancer, esophageal cancer, pharyngeal cancer, biliary tract cancer, bladder cancer,
  • the method for preventing cancer according to any one of items A to E above and / or one or more selected from hematological cancer, lymphoma, ovarian cancer, prostate cancer, thyroid cancer, and bone and soft tissue tumor Or treatment method.
  • the anticancer agent comprising the substance having anti-adipsin action of the present invention as an active ingredient has an effect of suppressing cancer stem cell properties and suppressing the growth of cancer cells.
  • various methods for suppressing cancer stem cell properties have been studied, it cannot be said that sufficient effects have been obtained, and the anticancer agent of the present invention is very useful.
  • action by suppressing adipsin is a novel mechanism, a novel anticancer agent can be screened paying attention to the mechanism concerned. Thereby, the more superior anticancer agent which can suppress cancer stem cell nature can be obtained.
  • FIG. 1A shows colony formation by co-culture of KUB06-PDX cells and various ADSCs
  • FIG. 1B is a diagram showing the number of colonies with a colony diameter exceeding 100 ⁇ m.
  • FIG. 2A is a diagram showing that various adipokines are secreted in the culture supernatant of ADSC (KUF06), and FIG.
  • each ADSC (KUF01, KUF02, KUF03, KUF06, KUF07, KUF11, KUF15, KUF16).
  • (KUF17) is a figure which shows the measurement result of the adipsin expression level.
  • (Reference Example 4) It is a flowchart which shows a complement reaction.
  • (Reference Example 5) It is a figure which shows the measurement result of the amount of C3a in the culture supernatant secreted from PDX tumor (KUB06-PDX cell) or each ADSC, and the cancer cell proliferation effect
  • FIG. 4A shows the amount of C3a in the culture supernatant of PDX tumor (KUB06-PDX cells) or each ADSC (KUF01, KUF02, KUF03, KUF06, KUF07, KUF11, KUF15, KUF16, KUF17).
  • FIG. 4B shows the effect on colony formation when SB290157, which is a C3a receptor inhibitor, is acted on in coculture of PDX tumors (KUB06-PDX cells) and ADSCs (KUF06, KUF16, KUF17). It is. (Reference Example 5) It is a figure which shows the expression inhibitory effect of a breast cancer stem cell related gene by suppression of adipsin expression. Fig.
  • FIG. 5A shows a decrease in the expression of various genes (CD44, CXCR4, SUG, SNAIL and ZEB1) characteristic of cancer stem cells in PDX tumors (KUB06-PDX cells) by co-culture with ADSC (KUF06siAdipsin) in which adipsin expression was suppressed It is a figure which shows doing.
  • FIG. 5B is a diagram showing that the ratio of CD44 high-expressing cells in PDX tumors (KUB06-PDX cells) decreased from 33.4% to 22.8% by co-culture with KUF06siAdipsin.
  • Example 1 It is a figure which shows the influence which acts on colony formation of PDX tumor (KUB06-PDX cell) by coculture with ADSC (KUF06shAdipsin) which suppressed the expression of adipsin.
  • Example 2 It is a figure which shows the effect which acts on the breast cancer tumor growth in in vivo when PDX tumor (KUB06-PDX cell) and KUF06shAdipsin are co-transplanted.
  • FIG. 7A shows the results of the increase in tumors when KUB06-PDX cells were transplanted alone and when PDX tumors (KUB06-PDX cells) and ADSC were co-transplanted.
  • FIG. 1 It is a figure which shows the influence which acts on colony formation of PDX tumor (KUB06-PDX cell) by coculture with ADSC (KUF06shAdipsin) which suppressed the expression of adipsin.
  • Example 2 It is a figure which shows the effect which acts on the breast
  • FIG. 7B is a diagram showing an inhibitory effect on breast cancer tumor growth when co-transplanted with a PDX tumor (KUB06-PDX cell) and KUF06shAdipsin.
  • KUB06-PDX cell KUF06shAdipsin.
  • FIG. 8A shows colony formation by co-culture of human colon adenocarcinoma-derived HCT116 cells and ADSC
  • FIG. 8B shows the number of colonies counted with a colony diameter exceeding 100 ⁇ m.
  • FIG. 9A shows colony formation by co-culture of human endometrial adenocarcinoma-derived Ishikawa cells and ADSC
  • FIG. 9B shows the number of colonies counted with a colony diameter exceeding 100 ⁇ m.
  • the present invention relates to an anticancer agent having a novel mechanism of action focusing on the relationship between tumors and adipocytes and / or adipose tissue stem cells and focusing on the action of adipsin secreted from adipocytes and / or adipose tissue stem cells. Furthermore, this invention relates to the novel screening method of the anticancer agent which paid its attention to the novel mechanism of action.
  • breast cancer cells and normal mammary adipose tissue are separated from a surgical specimen, and adipose tissue-derived stem cells (ADSC) are separated and cultured from the mammary adipose tissue for secretion.
  • ADSC adipose tissue-derived stem cells
  • Tumor formation and progression involves a variety of cells, including cells in the stroma, the microenvironment, including tumor-associated fibroblasts, infiltrating inflammatory cells, vascular endothelial cells, lymphocytes, and nerve cells .
  • Adipose tissue-derived cells which are one type of stromal cells, are not well known as components of the tumor microenvironment despite being important cells in some tissues such as the breast.
  • tumor is not particularly limited as long as it is an excessive neoplastic cell group that occurs in humans and animals and has independence, and is used in a concept including a malignant tumor and a benign tumor.
  • cancer is not limited to epithelial malignant tumors among malignant tumors, but is used in a concept including non-epithelial malignant tumors, ie, sarcomas.
  • adipsin is not particularly limited, but particularly refers to adipsin that affects cancer stem cell enhancement, cancer cell proliferation, and the like.
  • adipsin include adipsin derived from one or more types of cells selected from adipocytes, adipose tissue stem cells, and cells induced to differentiate from adipose tissue stem cells.
  • Adipsin has been identified as a substance involved in an innate immune response (complement binding reaction) to bacterial infection and the like, and is known to be deeply involved in innate immunity, for example, made of adipocytes and spread throughout the body via blood.
  • the anticancer agent comprising a substance having an anti-adipsin action of the present invention as an active ingredient relates to a cancer preventive agent and / or therapeutic agent, and has, for example, cancer metastasis prevention, recurrence prevention and / or therapeutic effect.
  • the anticancer agent of the present invention is also characterized by having cancer stem cell-inhibiting activity and / or cancer cell proliferation-inhibiting activity.
  • cancer stem cell refers to a cell having the characteristics of a stem cell among cancer cells.
  • cancer stem cell means that tumor cells and cancer stem cells have a particularly high tumorigenicity, have the ability to self-replicate, and form a tumor similar to the original tumor tissue with only a small number. It refers to any property such as Many cancers are treated with surgery and chemotherapy and radiation therapy, but it is extremely difficult to completely eliminate tumor cells.
  • the cancer stem cell hypothesis has been proposed as a cause of cancer occurrence, recurrence, and metastasis. According to the cancer stem cell hypothesis, there are stem cells in tumor tissue as well as normal tissues, and they have the ability to replicate themselves, and the ability to form a tumor similar to the original tumor tissue with only a few. It has been shown to have relapse / metastasis.
  • the cancer applicable to the anticancer agent of the present invention containing a substance having an anti-adipsin action as an active ingredient is one selected from adipocytes, adipose tissue stem cells, and cells induced to differentiate from adipose tissue stem cells.
  • adipocytes etc. a cancer that is affected by enhancement of cancer stem cell nature and / or cancer cell proliferation by interaction with multiple types of cells (hereinafter also referred to as “adipocytes etc.”).
  • the interaction may be a direct interaction or an indirect interaction.
  • Direct interaction means having direct interaction with adipocytes located in the vicinity of cancer cells and cancer stem cells, and indirect interaction means cancer cells and cancer. It means that adipsin or the like secreted from fat cells or the like not located in the vicinity of stem cells interacts with cancer cells or cancer stem cells via, for example, blood vessels or other stroma.
  • the type of cancer applicable to the anticancer agent of the present invention containing an anti-adipsin-active substance as an active ingredient is not particularly limited as long as it is a cancer associated with adipsin secreted from the stroma.
  • Preferred examples include breast cancer, colon cancer, uterine cancer, stomach cancer, pancreatic cancer, liver cancer, lung cancer and renal cancer, and most preferred examples include breast cancer, colon cancer and uterine cancer.
  • the anticancer agent of the present invention may be a high molecular compound or a low molecular compound as long as it has an anti-adipsin action.
  • the polymer compound include proteins and nucleic acid substances, and specifically include antibodies, antibody fragments, peptides, siRNA or shRNA.
  • the low molecular compound are not particularly limited.
  • the substance containing a low molecular compound and a high molecular compound may be sufficient. For example, siRNA or shRNA that inhibits adipsin expression, or an antibody against adipsin.
  • adipsin is a protein containing the amino acid sequence shown in GenBank accession number, NP_001304264.1, and the mRNA sequence contains the base sequence shown in GenBank accession number, NM_001317335.1.
  • siRNAs and shRNAs are known to target specific mRNAs and prevent their translation by a mechanism called RNA interference.
  • the anticancer agent comprising a substance having an anti-adipsin action of the present invention as an active ingredient can be used as a prophylactic and / or therapeutic agent for cancer, and prevention of metastasis, recurrence and / or treatment of cancer. Has an effect. Therefore, it goes without saying that the anticancer agent of the present invention can be administered after diagnosis of cancer. For example, after treatment or treatment with other anticancer agents, treatment and cancer It can also be applied to further treatments aimed at preventing recurrence.
  • the anticancer agent of this invention can be made into the form of a pharmaceutical composition individually or in combination with another active ingredient.
  • the anticancer agent or pharmaceutical composition of the present invention can contain a pharmacologically acceptable carrier depending on the administration form.
  • pharmacologically acceptable carrier used for the anticancer agent include excipients, disintegrants or disintegration aids, binders, lubricants, coating agents, dyes, diluents, bases, and the like. Examples include solubilizers or solubilizers, isotonic agents, pH adjusters, stabilizers, propellants, and pressure-sensitive adhesives.
  • the dose of the anticancer agent of the present invention varies depending on the patient's body weight, age, severity of disease, etc., and is not particularly limited.
  • the dose range is 0.0001 to 1 mg / kg body weight. It can be administered once to several times a day, every 2 days, every 3 days, every week, every 2 weeks, a month, or a plurality of months.
  • the present invention also extends to a method for preventing and / or treating cancer by using an anticancer agent or pharmaceutical composition comprising the substance having anti-adipsin activity of the present invention as an active ingredient.
  • the anticancer agent or pharmaceutical composition of the present invention can be administered locally or systemically.
  • the administration form is not particularly limited, for example, in the case of breast cancer treatment, it can be administered by injection or infusion to the affected area or the vicinity of the affected area.
  • Preparations for parenteral administration may include sterile aqueous or non-aqueous solutions, suspensions, emulsions, and the like.
  • non-aqueous diluents include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and organic ester compositions such as ethyl oleate.
  • Aqueous carriers may include any of water, alcoholic aqueous solutions, emulsions, suspensions, saline, buffered media and the like.
  • Parenteral carriers may include any of sodium chloride solution, Ringer's dextrose, dextrose, sodium chloride, Ringer's lactic acid, binding oil and the like.
  • Intravenous carriers may include, for example, fluid supplements, nutrients and electrolytes (eg, those based on Ringer's dextrose).
  • the anti-neoplastic agent of the present invention may further contain preservatives and other additives such as antimicrobial compounds, antioxidants, chelating agents and inert gases.
  • the present invention relates to screening for an anticancer agent having a preventive and / or therapeutic effect on cancer associated with adipocytes, adipose tissue stem cells, cells induced to differentiate from adipose tissue stem cells, or cells that strongly express adipsin. It extends to methods.
  • a candidate substance having a cancer stem cell-inhibiting action and / or a cancer cell growth-inhibiting action is obtained by adding a candidate substance to a system in which cancer cells are cultured in the presence of adipsin and culturing.
  • the method of sorting is mentioned.
  • Another embodiment of the screening method includes a method of selecting a substance that inhibits the action of adipsin by allowing adipsin to interact with a candidate substance.
  • culturing cancer cells in the presence of adipsin Of one or a plurality of cells selected from adipocytes, adipose tissue stem cells, cells induced to differentiate from adipose tissue stem cells, and cells that strongly express adipsin It is preferable to co-culture cancer cells in a culture system.
  • cancer stem cell inhibitory action and / or cancer cell proliferation inhibitory action can be used as an index.
  • the suppressive action on cancer stem cells and / or the suppressive action on cancer cell proliferation can be confirmed by a method known per se or any method developed in the future.
  • Examples include a method of measuring and confirming the number of colonies and / or the size of colonies of cancer cells, measurement of aldehyde dehydrogenase activity, analysis of the expression level of a cancer stem cell marker gene or protein, and the like. Particularly preferably, it can be confirmed by measuring the number of colonies of cancer cells and / or the size of colonies.
  • a method in which adipsin and a candidate substance are allowed to interact, a substance that inhibits the action of adipsin is selected, and an anticancer agent is screened.
  • a candidate substance added to a solution containing adipsin, or one or more selected from adipocytes, adipose tissue stem cells, cells induced to differentiate from adipose tissue stem cells, and cells that strongly express adipsin It is preferable to add a candidate substance to the cell culture system.
  • the interaction between adipsin and a candidate substance can be analyzed by ELISA (solid phase enzyme immunoassay) for the production of complement C3a or Ba factor.
  • adipsin such as adipocytes, adipose tissue stem cells, and adipsin secreted from one or more types of cells selected from cells induced to differentiate from adipose tissue stem cells.
  • Candidate substances to be used in screening methods for anticancer agents having preventive and / or therapeutic effects on cancer associated with enhancement and / or cancer cell proliferation may be high molecular compounds or low molecular weight compounds. It may be a compound.
  • the polymer compound are not particularly limited, and examples thereof include proteins and nucleic acid substances. Specific examples include antibodies, antibody fragments, peptides such as siRNA or shRNA that inhibits expression of adipsin.
  • the low molecular compound are not particularly limited.
  • the substance containing a low molecular compound and a high molecular compound may be sufficient.
  • Reference Example 1 Breast Cancer Cell Culture
  • Tumor tissue is collected from a breast cancer patient, and according to the method described in Imamura et al. (Oncol Rep 2015; 33: 1837-43), the subdivided tumor tissue is mixed with Matrigel and transplanted to the mammary gland tissue of immunodeficient mice.
  • Breast cancer xenograft patient-derived tumor xenograft: hereinafter referred to as “PDX tumor” was formed.
  • the obtained PDX tumor was infected with a lentivirus and introduced with the green fluorescent dye ZsGreen gene, and then a PDX tumor was formed again.
  • the PDX tumor was dissociated again and ZsGreen-expressing PDX cells were collected using a cell sorter (FACS Aria TM III cell sorter, BD). The cells were then passaged to another immunodeficient mouse to establish ZsGreen-expressing PDX cells (KUB06-ZsGreen, hereinafter also referred to as “KUB06-PDX cells”).
  • KUB06-ZsGreen hereinafter also referred to as “KUB06-PDX cells”.
  • the immunodeficient mice described in this Reference Example and the following Examples are commercially available 6-8 week old severe combined immunodeficient mice (NOD-SCID (NOD.CB17-Prkdcscid / J)) or hyperimmune deficient mice (NSG). (NOD.Cg-PrkdcscidIl2rgtm1Wjl / SzJ)) was used.
  • ADSC human adipose tissue-derived stem cells
  • the collected adipose tissue was cut and cultured with shaking in 199 medium (Thermo-Fisher) containing 1 mg / ml collagenase I (Worthington Biochemical) and 1% DNaseI (Sigma) at 37 ° C. for 1 hour. Cells are harvested by centrifugation and resuspended and cultured in Dulbecco's Modified Eagle Medium (DMEM / F12, Gibco) containing 10% fetal bovine serum (FBS), 100 U / mL penicillin and 100 ⁇ g / mL streptomycin (Gibco) did.
  • DMEM / F12 Dulbecco's Modified Eagle Medium
  • FBS fetal bovine serum
  • streptomycin Gibco
  • Reference Example 3 Enhancement of Breast Cancer Cell Growth by Co-culture with ADSC
  • Each ADSC (KUF01, KUF02, KUF03, KUF06, KUF07, KUF11, KUF15, KUF16, KUF17) was prepared from the normal breast gland adipose tissue of 9 breast cancer patients with different patient backgrounds by the method of Reference Example 2 (1). did. KUB06-PDX cells and ADSC derived from each patient were co-cultured at 37 ° C. for 7 to 14 days by the method of Reference Example 2 (2). As a control ( ⁇ ), KUB06-PDX cells were cultured in a system in which ADSC was not added.
  • Example 1 Confirmation of suppression of expression of breast cancer stem cell-related genes by suppressing adipsin expression
  • Changes in gene expression characteristic of cancer stem cells in Qing were confirmed.
  • SiRNA (Hs_CFD_1747, Hs_CFD_1750, Sigma) against adipsin consisting of the nucleotide sequences shown in SEQ ID NOs: 5 and 6 was transfected into ADSC (KUF06) to suppress adipsin expression.
  • siNC was similarly transfected into ADSC (KUF06).
  • ADSC (KUF06) transfected with each siRNA is hereinafter also referred to as “KUF06siAdipsin” or “KUF06siNC”.
  • -Adipsin siRNA # 1 Hs_CFD_1747): CUGCUACAGCUGUCGGAGATT (SEQ ID NO: 5)
  • Adipsin siRNA # 2 Hs_CFD_1750: CCUCCAAGCGCCUGUACGATT (SEQ ID NO: 6)
  • GAPDH Forward AGAAGGCTGGGGCTCATTTG (SEQ ID NO: 7) Reverse: AGGGGCCATCCACAGTCTTC (SEQ ID NO: 8) CD44 Forward: AAAGGAGCAGCACTTCAGGA (SEQ ID NO: 9) Reverse: TGTGTCTTGGTCTCTGGTAGC (SEQ ID NO: 10) -CXCR4 Forward: AATCTTCCTGCCCACCATCTA (SEQ ID NO: 11) Reverse: AGCCTGTACTTGTCCGTCAT (SEQ ID NO: 12) -SLUG Forward: CCTTTTTCTTGCCCTCACTGC (SEQ ID NO: 13) Reverse: GGCTTCGGAGTGAAGAAATGC (SEQ ID NO: 14) -SNAIL Forward: CGAGCTGCAGGACTCTAAT (SEQ ID NO: 15) Reverse: CCACTGTCCTCATCTGACA (SEQ ID NO: 16) -ZEB1 Forward: GCACCTGAAGAGGACCAGAG (SEQ ID NO:
  • Example 2 Analysis of colonies in co-cultured KUB06-PDX cells
  • Lentivirus expressing shRNA against adipsin TRCN0000057208, Sigma
  • ADSC ADSC
  • a lentivirus expressing shNC was used as a control.
  • -Adipsin shRNA TRCN0000057208: CCGGCGCGACTCCATCTCTACAAATCTCG-AGATTTGTAGAGATGGAGTCGCGTTTTTG (SEQ ID NO: 23)
  • Example 3 Effect on breast cancer tumor growth by suppressing adipsin expression
  • PDX tumor KUB06-PDX cells
  • KUF06shAdipsin KUF06shAdipsin
  • ADSC mesenteric adipose tissue in the vicinity of the resection stump of a surgical specimen of a colorectal cancer patient was collected in the same manner as in Reference Example 2, and ADSC was separated and cultured therefrom.
  • ADSC was prepared based on the method shown in Zhao et al. (Exp Ther Med 2013; 6: 937-42) and Zuk et al. (Tissue Eng 2001; 7: 211-28).
  • the collected adipose tissue was cut and cultured with shaking at 37 ° C. for 1 hour in 199 medium (Thermo-Fisher) containing 1 mg / ml collagenase I (Worthington Biochemical) and 1% DNase I (Sigma).
  • DMEM Dulbecco's modified Eagle's medium
  • FBS fetal bovine serum
  • penicillin 100 ⁇ U / mL penicillin and 100 ⁇ g / mL streptomycin (Gibco) did.
  • DMEM / F12 Dulbecco's modified Eagle medium
  • DMEM / F12 Gibco
  • penicillin 100 U / mL penicillin and 100 ⁇ g / mL streptomycin
  • HCT116 cells 1 ⁇ 10 4 cells / well
  • ADSC 1 ⁇ 10 3 cells / well
  • the medium was changed every 2 days.
  • As a control ( ⁇ ) only HCT116 cells (1 ⁇ 10 4 cells / well) not mixed with ADSC were similarly cultured using a three-dimensional culture plate.
  • Human ADSC was established and cultured from abdominal mesenteric adipose tissue in the same manner as in Reference Example 7.
  • Dulbecco's modified Eagle medium DMEM / F12, Gibco
  • DMEM / F12 Dulbecco's modified Eagle medium
  • penicillin 100 U / mL penicillin and 100 ⁇ g / mL streptomycin
  • Ishikawa cells 1 ⁇ 10 4 cells / well
  • ADSC 5 ⁇ 10 3 cells / well
  • the medium was changed every 2 days.
  • Ishikawa cells (1 ⁇ 10 4 cells / well) not mixed with ADSC were similarly cultured using a three-dimensional culture plate.
  • Cancer stem cells are present in tumor tissue, and they have been shown to have the ability to replicate themselves and to form tumors similar to the original tumor tissue with only a few, It is thought to be the cause of cancer recurrence and metastasis.
  • Establishing treatments targeting cancer stem cells is expected to lead to cancer treatment with a low risk of recurrence and metastasis, but the existence ratio is low and it is very difficult to analyze the properties of cancer stem cells It is.
  • leukemia stem cell research research is progressing to the search for therapeutic methods targeting cancer stem cells and treatment in mouse models, but in solid cancers, methods for isolation and enrichment have not yet been established. It was insufficient.
  • the anticancer agent comprising the substance having anti-adipsin action of the present invention as an active ingredient has an effect of suppressing cancer stem cell properties and suppressing the growth of cancer cells.
  • the anticancer agent of the present invention is very useful.
  • action by suppressing adipsin is a novel mechanism, the novel anticancer agent which paid its attention to the action mechanism can be screened. Thereby, the more superior anticancer agent which can suppress cancer stem cell nature can be obtained.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Physics & Mathematics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biochemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Biophysics (AREA)
  • General Physics & Mathematics (AREA)
  • Hematology (AREA)
  • Food Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Pathology (AREA)
  • Biomedical Technology (AREA)
  • Urology & Nephrology (AREA)
  • Oncology (AREA)
  • Cell Biology (AREA)
  • Epidemiology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

L'invention concerne un agent anticancéreux qui présente une nouvelle action basée sur un nouveau mécanisme. L'invention concerne également un nouvel agent anticancéreux qui agit pour inhiber les propriétés des cellules souches cancéreuses et/ou la prolifération des cellules cancéreuses. L'invention concerne également un procédé de criblage d'un nouvel agent anticancéreux. L'agent anticancéreux comprend, en tant que principe actif, une substance à action anti-adipsine. L'agent anticancéreux selon la présente invention, qui comprend en tant que principe actif une substance à action anti-adipsine, agit pour inhiber les propriétés des cellules souches cancéreuses et la prolifération des cellules cancéreuses. L'action antitumorale basée sur l'inhibition de l'adipsine constitue un nouveau mécanisme. Par conséquent, un nouvel agent anticancéreux peut être criblé en se focalisant sur ce mécanisme d'action. Ainsi, un agent anticancéreux plus efficace, capable d'inhiber les propriétés des cellules souches cancéreuses, peut être obtenu.
PCT/JP2019/005695 2018-02-20 2019-02-15 Agent anticancéreux WO2019163684A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
JP2019548758A JP6664685B2 (ja) 2018-02-20 2019-02-15 抗がん剤

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
JP2018-027603 2018-02-20
JP2018027603 2018-02-20

Publications (1)

Publication Number Publication Date
WO2019163684A1 true WO2019163684A1 (fr) 2019-08-29

Family

ID=67688407

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/JP2019/005695 WO2019163684A1 (fr) 2018-02-20 2019-02-15 Agent anticancéreux

Country Status (2)

Country Link
JP (1) JP6664685B2 (fr)
WO (1) WO2019163684A1 (fr)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2007141004A1 (fr) * 2006-06-09 2007-12-13 Bayer Healthcare Ag Utilisation de l'adipsine (adn) comme cible thérapeutique ou diagnostique
WO2009105217A2 (fr) * 2008-02-19 2009-08-27 The Trustees Of The University Of Pennsylvania Inhibiteurs du complément en tant qu'agents thérapeutiques pour le traitement du cancer
US20170160291A1 (en) * 2014-05-26 2017-06-08 Eberhard Karls Universitaet Tuebingen Medizinische Fakultaet Method for the diagnosis of or risk for a disease mediated via the alternative pathway of the complement system

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2007141004A1 (fr) * 2006-06-09 2007-12-13 Bayer Healthcare Ag Utilisation de l'adipsine (adn) comme cible thérapeutique ou diagnostique
WO2009105217A2 (fr) * 2008-02-19 2009-08-27 The Trustees Of The University Of Pennsylvania Inhibiteurs du complément en tant qu'agents thérapeutiques pour le traitement du cancer
US20170160291A1 (en) * 2014-05-26 2017-06-08 Eberhard Karls Universitaet Tuebingen Medizinische Fakultaet Method for the diagnosis of or risk for a disease mediated via the alternative pathway of the complement system

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
GOTO, H. ET AL.: "Adipose-derived stem cells enhance human breast cancer growth and cancer stem cell -like properties through adipsin", ONCOGENE, vol. 38, no. 6, 7 February 2019 (2019-02-07), pages 767 - 779, XP036695894, ISSN: 1476-5594 *
PATTRICK, M. ET AL.: "Dual role of complement in adipose tissue", MOLECULAR IMMUNOLOGY, vol. 46, 2009, pages 755 - 760, XP025912802, ISSN: 0161-5890 *

Also Published As

Publication number Publication date
JP6664685B2 (ja) 2020-03-13
JPWO2019163684A1 (ja) 2020-02-27

Similar Documents

Publication Publication Date Title
Hossain et al. Mesenchymal stem cells isolated from human gliomas increase proliferation and maintain stemness of glioma stem cells through the IL-6/gp130/STAT3 pathway
Valkenburg et al. Targeting the tumour stroma to improve cancer therapy
Xu et al. Bone marrow-derived mesenchymal stromal cells are attracted by multiple myeloma cell-produced chemokine CCL25 and favor myeloma cell growth in vitro and in vivo
Long et al. Autocrine CCL5 signaling promotes invasion and migration of CD133+ ovarian cancer stem-like cells via NF-κB-mediated MMP-9 upregulation
Wang et al. Micro RNA‐155 deficiency enhances the recruitment and functions of myeloid‐derived suppressor cells in tumor microenvironment and promotes solid tumor growth
Bar et al. Cyclopamine-mediated hedgehog pathway inhibition depletes stem-like cancer cells in glioblastoma
Gargini et al. Cancer stem cell-like phenotype and survival are coordinately regulated by Akt/FoxO/Bim pathway
Wang et al. Endothelial cells enhance prostate cancer metastasis via IL-6→ androgen receptor→ TGF-β→ MMP-9 signals
Liu et al. Bone marrow mesenchymal stem cells interact with head and neck squamous cell carcinoma cells to promote cancer progression and drug resistance
Zhu et al. Stroma-derived fibrinogen-like protein 2 activates cancer-associated fibroblasts to promote tumor growth in lung cancer
Gao et al. Chemokine CCL15 mediates migration of human bone marrow-derived mesenchymal stem cells toward hepatocellular carcinoma
EP3204420A1 (fr) Procédés d'élimination de cellules souches cancéreuses par ciblage de cd47
AU2010279359A1 (en) Compositions containing JARID1B inhibitors and methods for treating cancer
Wu et al. Enhanced alleviation of aGVHD by TGF‐β1‐modified mesenchymal stem cells in mice through shifting MΦ into M2 phenotype and promoting the differentiation of Treg cells
Yin et al. Targeted delivery of CXCL9 and OX40L by mesenchymal stem cells elicits potent antitumor immunity
Liao et al. DSE regulates the malignant characters of hepatocellular carcinoma cells by modulating CCL5/CCR1 axis
Stefani et al. L ow‐dose irradiated mesenchymal stromal cells break tumor defensive properties in vivo
Kanayasu-Toyoda et al. Cell-surface MMP-9 protein is a novel functional marker to identify and separate proangiogenic cells from early endothelial progenitor cells derived from CD133+ cells
Mitsuhashi et al. Programmed death (PD)‐1/PD‐ligand 1 blockade mediates antiangiogenic effects by tumor‐derived CXCL10/11 as a potential predictive biomarker
Ting et al. Withaferin A targeting both cancer stem cells and metastatic cancer stem cells in the UP-LN1 carcinoma cell model
WO2019163684A1 (fr) Agent anticancéreux
WO2022049867A1 (fr) Régulateur de microenvironnement immunitaire tumoral et son utilisation préventive, thérapeutique ou de diagnostic
WO2011088402A2 (fr) Utilisation de neutrophiles entraînés pour traiter une maladie métastatique et micrométastatique chez des patients à risque
WO2011004379A1 (fr) Compositions et méthodes de traitement du cancer
Adelipour et al. Correlation of micro vessel density and c-Myc expression in breast tumor of mice following mesenchymal stem cell therapy

Legal Events

Date Code Title Description
ENP Entry into the national phase

Ref document number: 2019548758

Country of ref document: JP

Kind code of ref document: A

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 19757605

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 19757605

Country of ref document: EP

Kind code of ref document: A1