WO2019150200A2 - Transformation de plante par crispr sans adn - Google Patents

Transformation de plante par crispr sans adn Download PDF

Info

Publication number
WO2019150200A2
WO2019150200A2 PCT/IB2019/000132 IB2019000132W WO2019150200A2 WO 2019150200 A2 WO2019150200 A2 WO 2019150200A2 IB 2019000132 W IB2019000132 W IB 2019000132W WO 2019150200 A2 WO2019150200 A2 WO 2019150200A2
Authority
WO
WIPO (PCT)
Prior art keywords
peg
cas9
lipofectamine
plant cell
crispr
Prior art date
Application number
PCT/IB2019/000132
Other languages
English (en)
Other versions
WO2019150200A3 (fr
Inventor
Aiden Y. PARK
Slki PARK
Ji Young YOON
Sunmee Choi
Sunghwa Choe
Jongjin Park
Original Assignee
G+Flas Life Sciences
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by G+Flas Life Sciences filed Critical G+Flas Life Sciences
Publication of WO2019150200A2 publication Critical patent/WO2019150200A2/fr
Publication of WO2019150200A3 publication Critical patent/WO2019150200A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
    • C12N15/8213—Targeted insertion of genes into the plant genome by homologous recombination
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
    • C12N15/8206—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by physical or chemical, i.e. non-biological, means, e.g. electroporation, PEG mediated
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
    • C12N15/8206—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by physical or chemical, i.e. non-biological, means, e.g. electroporation, PEG mediated
    • C12N15/8207—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by physical or chemical, i.e. non-biological, means, e.g. electroporation, PEG mediated by mechanical means, e.g. microinjection, particle bombardment, silicon whiskers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22—Ribonucleases RNAses, DNAses

Definitions

  • CRISPR/Cas9 systems are used for precise genome editing of animal and plant cells, because of their accuracy, programmability, and relative ease-of-use.
  • Three ways to deliver the CRISPR/Cas systems into live cells include plasmid DNA, RNA, and ribonucleoprotein (RNP).
  • RNP ribonucleoprotein
  • RNP -based methods take advantages of being immediately ready to react with target DNA without being translated when introduced into host cells.
  • no unwanted DNA footprints are left in the host genome.
  • plant cells whose cell walls were enzymatically removed can be transfected with functional RNP and whole plants can be regenerated from an engineered protoplast, there exists a need to increase the number of
  • Some methods disclosed herein comprise one or more of the following elements up to and including the following: a) providing a pre-assembled ribonucleotide protein complex mixture comprising a guide nucleic acid sequence and a programmable endonuclease, wherein the guide nucleic acid sequence and the programmable endonuclease are complexed to a transfection enhancement agent; b) providing at least one plant cell; and c) physically introducing the pre-assembled ribonucleoprotein complex intracellularly into the at least one plant.
  • physically introducing the pre-assembled ribonucleoprotein complex intracellulary into the at least one plant cell comprises injecting the ribonucleoprotein complex mixture directly into an embryo sac. In some cases, physically introducing the pre-assembled ribonucleoprotein complex intracellularly into the at least one plant cell comprises injecting the ribonucleoprotein complex mixture directly into a pollen nucleus. In some embodiments, the method further comprises injecting the ribonucleoprotein complex mixture directly into an embryo sac and a pollen nucleus.
  • Some methods of engineering a trait of interest in a plant cell comprise isolating the at least one plant cell comprising the trait of interest.
  • the lipofectamine, the guide RNA, and the programmable endonuclease are incubated in a buffer for at least 10 min prior to the addition of PEG.
  • the method further comprises adding PEG and incubating for at least 10 min.
  • Some methods disclosed herein comprise one or more of the following elements up to and including the following: a) providing a ribonucleotide protein complex mixture comprising a guide nucleic acid sequence and a programmable endonuclease, wherein the ribonucleotide protein is complexed with a transfection enhancement agent; b) injecting the ribonucleoprotein complex mixture directly into an embryo sac and a pollen nuclei; c) screening for at least one plant cell comprising the trait of interest; and d) isolating the at least one plant cell comprising the trait of interest.
  • the guide nucleic acid sequence is selected from the group consisting of a single-guide RNA (sgRNA), a CRISPR RNA, and a trans-activating RNA (tracrRNA).
  • sgRNA single-guide RNA
  • CRISPR RNA CRISPR RNA
  • tracrRNA trans-activating RNA
  • a transfection enhancement agent comprises at least one constituent selected from a lipid and a hydrophilic polymer.
  • the lipid is lipofectamine.
  • the lipofectamine is lipofectamine 2000.
  • the lipofectamine is lipofectamine 3000.
  • the hydrophilic polymer is 2,000 dalton to 5,000 dalton.
  • the hydrophilic polymer is polyethylene glycol (PEG).
  • a PEG comprising an about 40% PEG solution is consistent with the methods, compositions, and kits disclosed herein. The about 40% PEG solution comprises at least one constituent in some embodiments of this disclosure.
  • the at least one constituent of the about 40% PEG solution comprises at least one constituent selected from a sugar, a salt, and PEG4000.
  • a sugar comprising about 0.8 M mannitol is consistent with the methods, compositions, and kits disclosed herein.
  • a salt comprises about 1 M CaCl 2.
  • kits for engineering a trait of interest in a plant cell comprise at least one composition, in some cases.
  • a kit for delivering a ribonucleoprotein complex into a plant cell comprising a first composition and a second composition is consistent with embodiments disclosed herein.
  • the first composition of a kit or method disclosed herein is lipofectamine.
  • the second composition of a kit or method disclosed herein is polyethylene glycol.
  • transfection enhancement agent in methods, compositions, and kits for engineering a trait of interest in a plant cell can improve transfection efficiency and/or efficiency of genome editing a trait of interest.
  • the transfection enhancement agent increases transfection of the ribonucleoprotein complex by at least 1.1 to 100 fold.
  • the transfection enhancement agent increases the efficiency of genome editing the trait of interest by at least 1.1 to 100 fold, in some cases.
  • transfection enhancement agent in methods, compositions, and kits described herein can aid in delivery of a ribonucloprotein complex into a cell.
  • the transfection enhancement agent increases the delivery of the ribonucleoprotein complex at least 2 fold.
  • the programmable endonuclease is selected from Cas9, Cpfl, c2cl, C2c2, Casl3, c2c3, Casl, CaslB, Cas2, Cas3, Cas4, Cas5, Cas5e (CasD), Cas6, Cas6e, Cas6f, Cas7, Cas8, Cas8a, Cas8al, Cas8a2, Cas8b, Cas8c, Csnl, Csxl2, Cas9, CaslO, CaslOd, Casl2a, Casl2b, Casl2c, Casl2d, Casl2e, Casl3a, Casl3b, Casl3c, Casl3d, CasF, CasG, CasH, Csyl, C
  • the programmable endonuclease comprises a region exhibiting at least 70% identity over at least 70% of its residues to a Cas9 domain or a Cpfl domain.
  • the Cas9 is selected from the group consisting of SpCas9 SaCas9, StCas9, NmCas9, FnCas9, and CjCas9.
  • the region is a Cpfl domain.
  • the pre-assembled ribonucleoprotein further comprises an exonuclease, in some
  • the injecting comprises injecting using a needle operably attached to a syringe pump.
  • Protoplasts can be processed using various methods in conjunction with the methods disclosed herein.
  • at least one protoplast is centrifuged.
  • centrifugation of the protoplast is carried out without a sucrose gradient.
  • the method further comprising centrifuging and removing the supernatant.
  • the method further comprises sequentially adding PIM solution without sucrose.
  • the method further comprises centrifuging and removing the supernatant.
  • the method further comprises adding PIM solution and transferring to a plate.
  • the method further comprises adding PIM with 2.4% low melting gel.
  • Programmable nucleases disclosed herein are derived either directly or modified from a number of possible sources.
  • Programmable nucleases consistent with the present disclosure are eubacterial, archaeal, or thermostable in origin.
  • the programmable endonuclease is derived from a species selected from the group consisting of Streptococcus pyogenes (S.
  • Streptococcus thermophilus Streptococcus sp., Staphylococcus aureus, Nocardiopsis rougevillei, Streptomyces pristinae spiralis, Streptomyces viridochromo genes, Streptomyces viridochromogenes, Streptosporangium roseum, Streptosporangium roseum,
  • Arthrospira platensis Arthrospira sp., Lyngbya sp., Microcoleus chthonoplastes, Oscillatoria sp., Petrotoga mobilis, Thermosipho africanus, Acaryochloris marina, Leptotrichia shahii, Prevotella, and Francisella novicida.
  • the plant cell is selected from the group consisting of a gametophyte, a reproductive cell, a vegetative cell, and a meristematic cell in some embodiments of the methods, compositions, and kits described herein.
  • the at least one plant cell is selected from the group consisting of a monocot and a dicot.
  • a monocot useful in the methods, compositions and kits described herein is selected from the group consisting of maize, rice, sorghum, rye, barley, wheat, millet, oats, sugarcane, turfgrass, and switchgrass.
  • the monocot is rice.
  • a dicot useful in the methods, compositions, and kits described herein is selected from the group consisting of soybean, canola, alfalfa, sunflower, cotton, tobacco, peanut, potato, tobacco, Arabidopsis , lettuce and safflower.
  • the dicot is lettuce.
  • the plant cell does not always include a cell wall.
  • the plant cell comprises at least one protoplast.
  • FIG. 1 illustrates sequences of cloning sites for sgRNA of SpCas9 and crRNA of FnCpfl. Shown at top are two Bsal enzyme sites were in the middle of T7 promoter and sgRNA scaffold for sgRNA of SpCas9. Shown at bottom are two Bsal enzyme sites were in the end of T7 promoter and crRNA scaffold for crRNA of FnCpfl.
  • FIG. 2 illustrates lettuce protoplasts. Shown at the top left and bottom left are, respectively, protoplasts after GFP-SpyCas9 protein transfection without lipofectamine 3000 and plus reagent. Shown at the top right and bottom right are, respectively, protoplasts after GFP-SpyCas9 protein transfection with lipofectamine 3000 and plus reagent.
  • FIG. 4 illustrates a figure from the website geochembio.com/biology/organisms/maize of maize flower and embryo showing fertilization via pollination and formation of a maize embryo.
  • FIG. 5 illustrates a modified figure from Leroux et al. (2014) Am J Bot 101 : 1259 - 1274, showing the developing the embryo of maize, wherein a CRIPSR/Cas9+ sgRNA RNP complex of the present disclosure, targeting any of a number of genes of interest, is injected into the pollen nucleic.
  • the CRIPSR/Cas9+ sgRNA RNP complex of the present disclosure is illustrated as a needle labeled“CRISPR PLUS.”
  • FIG. 6 illustrates a modified figure from Bortiri and Hake (2007) J Exp Bot 58(5): 909 - 916 showing injection of CRIPSR/Cas9 sgRNA RNP complexes of the present disclosure, targeting a gene of interest, into the pollen nuclei.
  • the CRIPSR/Cas9+ sgRNA RNP complexes of the present disclosure are illustrated as needles labeled“CRISPR PLUS.”
  • FIG. 7 illustrates a modified figure from Nannas and Dawe (2015) GENETICS 199(3): 655 - 669 showing injection of CRIPSR/Cas9 sgRNA RNP complexes of the present disclosure.
  • the CRIPSR/Cas9+ sgRNA RNP complex of the present disclosure is illustrated as a needle labeled “CRISPR PLUS”
  • FIG. 8 illustrates a bar graph showing the transfection efficiency of CRISPR/Cas9 pre- assembled ribonucleoprotein complexes in lettuce protoplasts.
  • FIG. 9 illustrates the morphology of lettuce protoplasts after transfection with traceable GFP -labeled CRISPR/Cas9 (Fig. 9a, Fig. 9b, Fig. 9e, Fig. 9f).
  • GFP-SpyCas9 RNPs were transfected into lettuce protoplasts with PEG4000 (Fig. 9c, Fig. 9d, Fig. 9g, Fig. 9h)
  • GFP-SpyCas9 RNPs were conventionally transfected into lettuce protoplasts with PEG 4000.
  • Microscopic images are shown under bright field (Fig. 9a, Fig. 9b, Fig. 9c, Fig. 9d) and confocal laser scanning (Fig.
  • FIG. 10 illustrates a bar graph showing the transfection efficiency of CRISPR/Cas9 pre- assembled ribonucleoprotein in rice protoplasts.
  • FIG. 11 illustrates gene editing efficiency in rice protoplasts.
  • Each Cas9 variant and guide RNAs against the same loci of rice Dwarf5 were transfected to protoplasts of 1 -week-old rice protoplasts using a transfection enhancement agent (PEG) or a lipid mediated transfection method (lipofectamine). Cells were harvested 48 hour after transfection for genomic DNA extraction.
  • PEG transfection enhancement agent
  • lipofectamine lipofectamine
  • Cells were harvested 48 hour after transfection for genomic DNA extraction.
  • alternative PCR primer pair was used for clearer single whose sizes, which were subjected to an in vitro cleavage assay with a Cas9/sgRNA endonuclease.
  • the sgRNA sequence was TCAACCACCCTGTGAATTT.
  • Primer pairs for PCR are Fl, GGATTGGATTGGTATTGTCGT; Rl, TCACTTTTGATGAACTATGT.
  • Type II clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR associated protein 9 (Cas9) can serve as a robust RNA-guided gene editing system.
  • Streptococcus pyogenes Cas9 (SpCas9) has 1,368 amino acids, and is comprised of two endonuclease domains, the HNH and RuvC-like domains, and a DNA binding domain, Class 2 Type II.
  • SpCas9 plays a role in adaptive immunity against infecting foreign genetic elements to prokaryotes.
  • the HNH domain cleaves the DNA strand complementary to the guide RNA (gRNA) sequence, while the RuvC-like domain cuts the other non-complementary DNA strand by a gRNA/Cas9 complex.
  • the complex of Cas9 apoprotein and guide RNA results in double-stranded breaks (DSBs) upstream of the nearby NGG protospacer-adjacent motif (PAM).
  • CRISPR/Casl2 is a class 2, type V CRISPR systems. CRISPR arrays are matured without an additional tracrRNA.
  • CRISPR/Casl2a i.e., CRISPR/Cpfl
  • CRISPR/Casl2 system which contains CRISPR from Prevotella and Francisella.
  • CRISPR-based genome editing tools promise a bright future in biotechnology in that it accelerates human disease therapeutics, agricultural trait development, and microbiological strain enhancement.
  • the type II CRISPR/Cas9 system effectively trigger homologous recombination (HR) or non-homologous end joining (NHEJ), resulting in insertions or deletions (indels) of nucleotides into or from a nucleic acid molecule, which can cause frameshift mutations in the coding region of a gene in prokaryotic/eukaryotic systems.
  • HR homologous recombination
  • NHEJ non-homologous end joining
  • CRISPR/Cas systems are able to cause staggered cuts in a double-stranded DNA molecule.
  • a class 2, type V CRISPR/Casl2 system is capable of causing cuts at different locations on each strand of a double-stranded DNA molecule.
  • staggered cutting of a double-stranded DNA molecule can improve efficiency of strategies for insertion of nucleotide sequences or repair of DNA sequences cut by CRISPR/Cas 12 systems.
  • CRISPR/Cas-based genome editing systems can be targeted to specific nucleic acid sequences.
  • a guide RNA of a CRISPR/Cas is designed to associate with a nucleic acid molecule such that the Cas endonuclease can recognize a protospacer adjacent motif (PAM) sequence in the nucleic acid molecule and cleave (or nick) the nucleic acid molecule.
  • Guide RNAs in CRISPR/Cas9 genome editing systems are targeted to NGG nucleotide PAM sequences.
  • Guide RNAs in CRISPR/Cas 12 genome editing systems are targeted to TTTN nucleotide PAM
  • CRISPR/Cas-based genome editing technology minimize the genome alternation much less than autonomous transposable element events, which occur in all living organisms in nature.
  • CRISPR techniques hold great promise for plant genome engineering because of its simplicity. Edited plants can be generated by DNA-based CRISPR technology because of its simplicity.
  • DNA-based CRISPR use of DNA-based CRISPR technology in plants results in the transfer of foreign DNA to next generations by employing fine-tuned removal breeding program and requires tracing the movement of the incorporated foreign DNA in the whole genome and offspring.
  • DNA-based CRISPR appear simple, DNA-based CRISPR needs further steps for removal of foreign DNA.
  • protoplast genome engineering and subsequent regeneration of a whole plant is hardly possible in certain plants, such as maize.
  • Agrobacterium-mediated transformation of somatic tissue and subsequent regeneration of a whole plant is limited only in hybrid embryos of some inbred lines. Even successful transformation and subsequent regeneration of plants accompany unwanted somaclonal genetic variations. Genetic transformation of one variety and subsequent transfer of traits to elite lines takes a long time and is not always successful.
  • innovation in maize genome engineering is required to introduce traits into desirable elite germplasm timely manner.
  • post-translation modification after production in plants may be similar to animals.
  • DNA-free CRISPR technology for producing a new crop trait, which do not give rise to foreign DNA contamination.
  • the term“about” when used in the context of a scalar value refers to + or - 10% of the scalar value.
  • the term“about” when used in the context of a range of values refers to a range that includes values from 10% lower than the lowest value of the range to values 10% higher than the highest value of the range.
  • the term“at least one of’ followed by a list such as“A, B, C, or D” refers to a list comprising each member of the list, individually, or any combination of two or more members of the list, up to and including all members of the list and, optionally, including other elements not listed in the list.
  • the present disclosure provides methods for DNA-free genome engineering.
  • the methods disclosed herein are consistent with a number of genome editing constructs, for example,
  • CRISPR/Cas systems such as the constructs disclosed elsewhere herein or otherwise.
  • endonucleases, transfection enhancement reagents, cellular reagents, and solutions disclosed herein are all useful in methods for DNA-free genome engineering, as described herein.
  • DNA-free genome engineering is carried out, in some embodiments, by complexing a guide RNA and endonuclease with a“transfection enhancement agent.”
  • a transfection enhancement agent can be and single agent or a combination of agents, which improves the efficiency of genome engineering.
  • the efficiency of transfection, and thereby, genome engineering may be enhanced by at least 1.1 fold, at least at least 1.1 to 1.5 fold, at least 1.5 to 2 fold, at least 2 to 2.5 fold, at least 2.5 to 3 fold, at least 3 to 3.5 fold, at least 3.5 to 4 fold, at least 4 to 4.5 fold, at least 4.5 to 5 fold, at least 5 to 10 fold, at least 10 to 20 fold, at least 20 to 30 fold, at least 30 to 40 fold, at least 40 to 50 fold, at least 50 to 60 fold, at least 60 to 70 fold, at least 70 to 80 fold, at least 80 to 90 fold, at least 90 to 100 fold, at least 1.1 to 100 fold, or at least 10 to 100 fold.
  • transfection enhancement agent is lipofectamine.
  • the transfection enhancement agent is a hydrophilic polymer, such as PEG.
  • transfection enhancement agents can be lipofectamine and hydrophilic polymers.
  • Lipofectamine- 3000 and PEG are mixed with guide RNA and any endonuclease disclosed herein.
  • CRISPR PLETS refers to translational fusion of a DNA modifying enzyme (DME), DNA binding protein (DBP), or terminal deoxyribonucleotidyl transferase (TdT) at a location either upstream or downstream of the genome editing enzyme (e.g., Cas9 or Casl2).
  • CRISPR PLUS refers to translation fusion of a genome editing enzyme (e.g., Cas9 or Casl2) to an exonuclease.
  • a genome editing enzyme e.g., Cas9 or Casl2
  • exonucleases consistent with the present disclosure are a RecE domain, a RecJ domain, a RecBCD domain, a Mungbean nuclease domain, an Exol domain, an Exol domain, an Exolll domain, an ExoVII domain.
  • Other exonucleases are also consistent with the compositions and methods disclosed herein regarding CRISPR PLUS reagents.
  • RecBD is also consistent with exonucleases contemplated herein.
  • the exonuclease is an exonucleases contemplated herein.
  • the exonuclease is an exonucleases contemplated herein.
  • the exonuclease is an exonucleases contemplated here
  • exorib onucl ease T TREX2, TREX1, recBCD, exodeoxyribonuclease I, exodeoxyribonuclease III, mungbean exonuclease, recE, recJ, T5, lambda exonuclease, exonuclease VII small unit, exonuclease VII large unit, exol, exolll, exoVII and L exo.
  • Said fusions can be connected via a linker protein or any of a number of other linkers.
  • a reagent that increases the efficiency of transfection can be used in place of lipofectamine- 3000.
  • a reagent that can be used in combination with CRISPR PLUS and/or PEG to efficiently transfect guide RNA and an endonuclease comprises cationic lipids, neutral lipids, or a combination thereof.
  • the lipids form positively charged liposomes, capable of formulating negatively charged nucleic acids or interacts with the negatively charged cell surface.
  • lipofectamine e.g., Lipofectamine 2000 or Lipofectamine 3000.
  • lipofectamine increases the transfection efficiency in in vitro cell culture by lipofection of RNA or plasmid DNA.
  • hydrophilic polymers examples include Ficoll, polyvinyl alcohol, styrene-maleic anhydride alternating copolymerization, divinyl ether - maleic anhydride alternating copolymerization, polyvinyl pyrrolidone, polyvinyl methyl ether, polyvinyl methyloxazoline, polyethyl oxazoline, polyhydroxy propyl-oxazole lean, polyhydroxypropyl methacrylamide, polymethacryl amide, polydimethylacrylamide, polyhydroxy propyl methacrylate, polyhydroxyethyl acrylate, hydroxymethyl cellulose, hydroxyethyl cellulose, poly asphalt amide or the synthetic polyamino acid.
  • PEG agents consistent with the methods of the present disclosure include any length of molecular weight of PEG.
  • PEG, or another hydrophilic polymer consistent with the present disclosure can have a molecular weight of anywhere between 300 g/mol and 10,000,000 g/mol.
  • PEG or another hydrophilic polymer consistent with the present disclosure, can have a molecular weight of from 300 g/mol to 500 g/mol, 500 g/mol to 1,000 g/mol, 1,000 g/mol to 1,500 g/mol, 1,500 g/mol to 2,000 g/mol, 2,000 g/mol to 2,500 g/mol, 2,500 g/mol to 3,000 g/mol, 3,000 g/mol to 3,500 g/mol, 3,500 g/mol to 4,000 g/mol, 4,000 g/mol to 4,500 g/mol, 4,500 g/mol to 5,000 g/mol, 5,000 g/mol to 5,500 g/mol, 5,500 g/mol to 6,000 g/mol, 6,000 g/mol to 6,500 g/mol, 6,500 g/mol to 7,000 g/mol, 7,000 g/mol to 7,500 g/mol, 7,500 g/mol to 8,000 g/mol, 8,000 g/mol to 8,500
  • the hydrophilic polymer can be included in the ribonucleoprotein complex mixture at various concentrations.
  • a representative hydrophilic polymer included in a ribonucleoprotein complex mixture is polyethylene glycol (PEG).
  • the concentration of the hydrophilic polymer may be 1 mg/ml to 100 mg/ml.
  • the concentration of the hydrophilic polymer may be 1 mg/ml to 10 mg/ml, 10 mg/ml to 70 mg/ml, 20 mg/ml to 60 mg/ml, or 30 mg/ml to 50 mg/ml. In one
  • the hydrophilic polymer comprises 220 m ⁇ in the ribonucleoprotein-plant cell mixture, equivalent to a concentration of 40 mg/ml.
  • the polyethylene glycol (PEG) solution can be a 40% PEG solution.
  • the PEG solution can be at least 1 % PEG, at least 2 % PEG, at least 3 % PEG, at least 4 % PEG, at least 5 % PEG, at least 6 % PEG, at least 7 % PEG, at least 8 % PEG, at least 9 % PEG, at least 10 % PEG, at least 11 % PEG, at least 12 % PEG, at least 13 % PEG, at least 14 % PEG, at least 15 %
  • PEG at least 16 % PEG, at least 17 % PEG, at least 18 % PEG, at least 19 % PEG, at least 20 %
  • PEG at least 21 % PEG, at least 22 % PEG, at least 23 % PEG, at least 24 % PEG, at least 25 %
  • PEG at least 26 % PEG, at least 27 % PEG, at least 28 % PEG, at least 29 % PEG, at least 30 %
  • PEG at least 31 % PEG, at least 32 % PEG, at least 33 % PEG, at least 34 % PEG, at least 35 %
  • PEG at least 36 % PEG, at least 37 % PEG, at least 38 % PEG, at least 39 % PEG, at least 40 %
  • PEG at least 41 % PEG, at least 42 % PEG, at least 43 % PEG, at least 44 % PEG, at least 45 %
  • PEG at least 46 % PEG, at least 47 % PEG, at least 48 % PEG, at least 49 % PEG, at least 50 %
  • PEG at least 51 % PEG, at least 52 % PEG, at least 53 % PEG, at least 54 % PEG, at least 55 %
  • PEG at least 56 % PEG, at least 57 % PEG, at least 58 % PEG, at least 59 % PEG, at least 60 %
  • PEG at least 61 % PEG, at least 62 % PEG, at least 63 % PEG, at least 64 % PEG, at least 65 %
  • PEG at least 66 % PEG, at least 67 % PEG, at least 68 % PEG, at least 69 % PEG, at least 70 %
  • PEG at least 71 % PEG, at least 72 % PEG, at least 73 % PEG, at least 74 % PEG, at least 75 %
  • PEG at least 76 % PEG, at least 77 % PEG, at least 78 % PEG, at least 79 % PEG, at least 80 %
  • PEG at least 81 % PEG, at least 82 % PEG, at least 83 % PEG, at least 84 % PEG, at least 85 %
  • PEG at least 86 % PEG, at least 87 % PEG, at least 88 % PEG, at least 89 % PEG, at least 90 %
  • PEG at least 91 % PEG, at least 92 % PEG, at least 93 % PEG, at least 94 % PEG, at least 95 %
  • PEG at least 96 % PEG, at least 97 % PEG, at least 98 % PEG, at least 99 % PEG, 100 % PEG, 1 to 10 % PEG, 10 to 20 % PEG, 20 to 30 % PEG, 30 to 40 % PEG, 40 to 50 % PEG, 50 to 60 % PEG, 60 to 70 % PEG, 70 to 80 % PEG, 80 to 90 % PEG, or 90 to 100 % PEG.
  • the PEG solution can further comprise 0.8 M mannitol, 1 M CaCl2, and PEG 4000.
  • a range of mannitol concentration and CaCl2 concentrations are consistent with the present disclosure.
  • the mannitol concentration can vary from 0.1 mM to 1 mM, from 1 mM to 10 mM, from 10 mM to 20 mM, from 20 mM to 30 mM, from 30 mM to 40 mM, from 40 mM to 50 mM, from 50 mM to 60 mM, from 60 mM to 70 mM, from 70 mM to 80 mM, from 80 mM to 90 mM, from 90 mM to 0.1 M, from 0.1 M to 1 M, from 1 M to 10 M, from 10 M to 20 M, from 20 M to 30 M, from 30 M to 40 M, from 40 M to 50 M, from 50 M to 60 M, from 60 M to 70 M, from 70 M to 80 M, from 80 mM
  • the CaCl2 concentration can vary can vary from 0.1 mM to 1 mM, from 1 mM to 10 mM, from 10 mM to 20 mM, from 20 mM to 30 mM, from 30 mM to 40 mM, from 40 mM to 50 mM, from 50 mM to 60 mM, from 60 mM to 70 mM, from 70 mM to 80 mM, from 80 mM to 90 mM, from 90 mM to 0.1 M, from 0.1 M to 1 M, from 1 M to 10 M, from 10 M to 20 M, from 20 M to 30 M, from 30 M to 40 M, from 40 M to 50 M, from 50 M to 60 M, from 60 M to 70 M, from 70 M to 80 M, from 80 M to 90 M, from 90 M to 100 M, from 100 M to 500 M, from 500 M to 1000 M.
  • the mixing of transfection enhancement agents, CRISPR PLUS reagents, and plant cells may be carried out by centrifugation.
  • centrifugation is carried out at a temperature of 3°C to 5°C or 0°C to 40°C.
  • Various centrifugation times are consistent with the present disclosure, such as 0.5 min to 30 min, 1 min to 15 min, or within 1 min.
  • a variety of centrifugation speeds are also consistent with the present disclosure, including 10 x g to 2000 x g, 20 x g to 1500 x g, 30 x g to 1000 x g, 50 x g to 500 x g, or 70 x g to 300 x g.
  • the centrifugation speed is set at 100 x g.
  • CRISPR PLUS, lipofectamine, PEG, or any combination thereof in transfection or injection into the embryo sac of guide RNA and RNA-guided endonucleases can improve transfection as compared to transfection or injection into the embryo sac without use of any of CRISPR PLUS, lipofectamine, or PEG.
  • CRISPR PLUS reagents for example, use of CRISPR PLUS reagents,
  • lipofectamine, PEG, or any combination thereof can improve the efficiency of genome editing by at least 1.1 fold, at least at least 1.1 to 1.5 fold, at least 1.5 to 2 fold, at least 2 to 2.5 fold, at least 2.5 to 3 fold, at least 3 to 3.5 fold, at least 3.5 to 4 fold, at least 4 to 4.5 fold, at least 4.5 to 5 fold, at least 5 to 10 fold, at least 10 to 20 fold, at least 20 to 30 fold, at least 30 to 40 fold, at least 40 to 50 fold, at least 50 to 60 fold, at least 60 to 70 fold, at least 70 to 80 fold, at least 80 to 90 fold, at least 90 to 100 fold, at least 1.1 to 100 fold, or at least 10 to 100 fold.
  • CRISPR PLUS reagents, lipofectamine, PEG, or any combination thereof can improve transfection efficiency by at least 1.1 fold, at least at least 1.1 to 1.5 fold, at least 1.5 to 2 fold, at least 2 to 2.5 fold, at least 2.5 to 3 fold, at least 3 to 3.5 fold, at least 3.5 to 4 fold, at least 4 to 4.5 fold, at least 4.5 to 5 fold, at least 5 to 10 fold, at least 10 to 20 fold, at least 20 to 30 fold, at least 30 to 40 fold, at least 40 to 50 fold, at least 50 to 60 fold, at least 60 to 70 fold, at least 70 to 80 fold, at least 80 to 90 fold, at least 90 to 100 fold, at least 1.1 to 100 fold, or at least 10 to 100 fold.
  • the transfection enhancement agents e.g., lipofectamine, PEG
  • the transfection enhancement agents drive the fold increase in genome editing efficiency and transfection efficiency described above.
  • CRISPR/Cas ribonucleoproteins are injected directly into the embryo sac right before pollination. Once in the embryo sac the RNP fuses into the egg cell to initiate genome engineering. RNPs also target the pollen nuclei. Fertilized embryos go through normal
  • embryogenesis and seeds with the engineered trait of interest are screened out.
  • RNPs are injected using injectors, such as the gene gun (Bio-Rad), or those disclosed in Bonetta (2005) Nat Meth 2: 875-883, the website techdent.fr/mesotherapy.php or a syringe pump fitted with a 32G needle, such as the syringe pump disclosed at the website syringepump.com/NE-lOOO. php.
  • injectors such as the gene gun (Bio-Rad), or those disclosed in Bonetta (2005) Nat Meth 2: 875-883, the website techdent.fr/mesotherapy.php or a syringe pump fitted with a 32G needle, such as the syringe pump disclosed at the website syringepump.com/NE-lOOO. php.
  • the CRISPR/Cas ribonucleoprotein complex also referred to as“RNP complex mixture”, “RNP mixture”,“ribonucleoprotein complex mixture”, or“ribonucleoprotein mixture,” is carried out by injection directly into the embryo sac right before pollination.
  • RNPs in the embryo sac fuse into the egg cell and genome engineering commences.
  • Pollen nuclei are introduced and fuse to the eff cell.
  • Pollen nuclei may also be a target of genome engineering by RNPs.
  • pollen nucleic are conventionally pollinated or injected directly with the RNPs disclosed herein.
  • the fertilized embryo proceeds through normal embryogenesis and seeds with engineered genomes are screened out.
  • Ribonucleoprotein complexes comprise various components or combinations thereof disclosed herein.
  • a ribonucleoprotein complex comprises RNA and protein.
  • the RNA may be sgRNA (single guide RNA), crRNA (CRISPR RNA), and/or the tracr RNA (trans activating RNA).
  • sgRNA single guide RNA
  • CRISPR RNA crRNA
  • tracr RNA trans activating RNA
  • Various lengths of sgRNA are consistent with the present disclosure.
  • the sgRNA may be from 10 to 40 nucleotides, 15 to 30 nucleotides, or 18 to 25 nucleotides in length.
  • the RNA targets a complementary target sequence, such as a region of a gene in a plant cell.
  • an sgRNA sequence of TCACGACCAGAGATAAGTAC may be used to target the LsFtl3-l of a lettuce cell.
  • the sgRNA sequence of AACCACCAGCGACACCA may be used to target the ALS gene of the rice plant cell.
  • the protein is a programmable endonuclease disclosed herein. An otherwise known programmable endonuclease is also consistent with the protein described herein.
  • the amount of sgRNA per lxlO 5 plant cells can be 0.1 pg to 20 pg or 0.5 pg to 30 pg.
  • a ratio of 1 pg, 2 pg, 3 pg, 4 pg, 5 pg, 6 pg, or 7 pg sgRNA to lxlO 5 plant cells can be used.
  • 25 pg sgRNA to 2xl0 5 plant cells can be used.
  • the lipofectamine can be mixed with plant cells in various ratios. Specifically,
  • lipofectamine can be mixed with 1 x 10 5 plant cells at volumes of 0.1 pl to 30 pl, and 0.5 pl to 20 pl or 1 pl to 10 pl. Specifically, 1 pl, 2 pl, 3 pl, 4 pl, 5 pl, 6 pl, 7 pl, 8 pl, 9 pl or 10 pl of lipofectamine can be mixed with l x lO 5 plant cells. In one embodiment of the present invention, 2xl0 5 plant cells can be mixed with 2 pl of lipofectamine.
  • CRISPR PLUS reagents can be mixed with plant cells in various ratios.
  • CRISPR PLUS reagents can be mixed with l x lO 5 plant cells in volumes of 0.1 pl to 30 pl, and 0.5 pl to 20 pl or 1 pl to 10 pl.
  • 1 pl, 2 pl, 3 pl, 4 pl, 5 pl, 6 pl, 7 pl, 8 pl, 9 pl or 10 pl of CRISPR PLUS reagents can be mixed with 1 x 10 5 plant cells.
  • 2xl0 5 plant cells can be mixed with 2 m ⁇ of CRISPR PLUS reagents was used.
  • Methods disclosed herein are compatible with a number of endonucleases, such as those disclosed herein.
  • the present disclosure provides a number of endonucleases, compatible with the techniques disclosed herein of DNA-free delivery (e.g., CRISPR PLUS with lipofectamine) of genome editing technologies.
  • Any one of the following site-specific endonuclease and a guide RNA can be complexed to form a ribonucleoprotein (RNP) and further complex to lipofectamine and/or a hydrophilic polymer (e.g., PEG) to be delivered to a cell for the purposes of genome engineering.
  • RNP ribonucleoprotein
  • PEG hydrophilic polymer
  • endonucleases disclosed herein are useful for methods of DNA-free genome engineering and in compositions used for DNA-free genome engineering, such as those disclosed herein. Methods for the modification of nucleic acids in plants, plant cells, or
  • compositions derived from plant cells can comprise the use of endonucleases described herein.
  • An exemplary genome editing technology of the disclosure comprises a nuclease such as a site-specific endonuclease or a domain thereof.
  • a nuclease such as a site-specific endonuclease or a domain thereof.
  • Non-limiting exemplary site-specific endonuclease or a domain thereof.
  • CRISPR-associated (Cas) polypeptides or Cas nucleases including Class 1 Cas polypeptides, Class 2 Cas polypeptides, type I Cas polypeptides, type II Cas polypeptides, type III Cas polypeptides, type IV Cas polypeptides, type V Cas polypeptides, and type VI CRISPR-associated (Cas) polypeptides; zinc finger nucleases (ZFN); transcription activator-like effector nucleases (TALEN); meganucleases; RNA-binding proteins (RBP); CRISPR-associated RNA binding proteins; recombinases; flippases; transposases; Argonaute (Ago) proteins (e.g., prokaryotic Argonaute (pAgo), archaeal Argonaute (aAgo), and eukaryotic Argonaute (eAgo)); derivatives thereof; variants thereof; and fragments thereof
  • Some endonucleases of the disclosure comprise one or more domains of a site-specific endonuclease.
  • domains suitable for use with the disclosure include guide nucleic acid recognition or binding domain; nuclease domains such as DNase domain, RNase domain, RuvC domain, and HNH domain; DNA binding domain; RNA binding domain; helicase domains; protein-protein interaction domains; and dimerization domains.
  • a guide nucleic acid recognition or binding domain interacts with a guide nucleic acid.
  • a nuclease domain comprises catalytic activity for nucleic acid cleavage.
  • a nuclease domain is a mutated nuclease domain that lacks or has reduced catalytic activity.
  • a site-specific endonuclease can be a chimera of various site-specific endonuclease proteins, for example, comprising domains from different Cas proteins.
  • a site-specific endonuclease consistent with the disclosure is a wild-type form of the protein, such as a form encoded in an unaltered genome.
  • some site-specific endonucleases are a modified versions of the wildtype form, for example, comprising an amino acid change such as a deletion, insertion, substitution, variant, mutation, fusion, chimera, or any combination thereof, relative to a wild-type version of the protein.
  • a modified site-specific endonuclease of the disclosure may comprise a polypeptide having at least about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to a wild type exemplary site-specific endonuclease.
  • a modified site-specific endonuclease of the disclosure may comprise an amino acid sequence having at least about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to a nuclease domain, for example, a RuvC domain or an HNH domain, of a wild-type site-specific endonuclease.
  • Some site-specific endonucleases of the disclosure comprise a Cas polypeptide or a recognizable domain thereof.
  • Programmable endonucleases useful in the methods for DNA-free genome engineering described herein include Cas polypeptides.
  • guide nucleic acid sequences described herein are useful for recognizing target sequence(s) of a nucleic acid molecule and Cas polypeptides associated with guide nucleic acid sequences are useful for manipulating the nucleic acid molecule (i.e., cleaving the nucleic acid molecule strand).
  • Non-limiting exemplary Cas polypeptides suitable for use with the present disclosure include Cas9, Cas l2a (Cpfl), c2cl, C2c2, Casl3, c2c3, Casl, CaslB, Cas2, Cas3, Cas4, Cas5, Cas5e (CasD), Cas6, Cas6e, Cas6f, Cas7,
  • the programmable endonuclease comprises a region exhibiting at least 70% identity over at least 70% of its residues to a Cas9 domain. In some embodiments, the programmable endonuclease comprises a region exhibiting at least 70% identity over at least 70% of its residues to a Casl2 domain, such as a Cpfl domain. In some embodiments, the programmable endonucleases comprise a region exhibiting at least 30 %, at least 31 %, at least 32 %, at least 33 %, at least 34 %, at least 35 %, at least 36 %, at least 37 %, at least 38 %, at least 39
  • the programmable endonucleases comprise a region exhibiting at least 30 %, at least 31 %, at least 32 %, at least 33 %, at least 34 %, at least 35 %, at least 36 %, at least 37 %, at least 38 %, at least 39 %, at least 40
  • CRISPR/Cas9 from Streptococcus pyogenes is relatively large-sized protein with 1,368 amino acids, and is characterized to have two endonuclease domains, HNH and RuvC, and a recognition lobe (REC) domain (Nishimasu et al. 2014).
  • HNH domain cleaves the DNA strand complementary to the guide RNA sequence
  • RuvC-like domain cuts the other non complementary DNA strand through Watson-Crick base pairing by a gRNA/Cas9 complex (Jinek et al., 2012).
  • DLBs double stranded breaks
  • NHEJ non- homologous end joining
  • Error-prone mutations lead to frameshift mutations when placed in the coding region of eukaryotic genes (Cho et al., 2013; DiCarlo et al., 2013; Belhaj et al., 2013).
  • Cas9 has derived a series of functional alterations by introducing substitution mutations.
  • the deactivated Cas9 (D10A and H840A) possessing only sequence-specific binding function can as a functional transcription factor when fused in frame with either an activator or a repressor domain.
  • Cas9 polypeptides are examples of site-specific endonucleases, as are derivatives thereof; variants thereof; and fragments thereof recognizable by a person of skill in the art as retaining some or all of the common activity or having sufficient sequence identity as a protein listed above or elsewhere herein.
  • Cas9 is classified as a class II, Type II CRISPR/Cas effector protein.
  • An exemplary Cas9 polypeptide is Cas9 from Streptococcus pyogenes , referred to herein as SpCas9, which is composed of 1,368 amino acids.
  • Cas9 is characterized to have two endonuclease domains, HNH and RuvC, and a recognition lobe (REC) domain.
  • the HNH domain cleaves the DNA strand complementary to the guide RNA sequence.
  • the RuvC-like domain cuts the other non-endonucleases
  • a Cas9 protein comprises mutations. For example, substitution of aspartic acid (D) at the lO* 11 amino acid in the RuvC domain to alanine (A) removes the RuvC-dependent nuclease function leaving only HNH-dependent endonuclease function.
  • D aspartic acid
  • A alanine
  • the D10A variant of Cas9 known as a nickase, can be used to generate a single strand nick at the target site.
  • An additional substitution mutation a change from histidine (H) to alanine (A) at the 840 th amino acid in HNH domain of Cas9 H840A, produces a deactivated Cas9 protein lacking all nuclease activity.
  • the deactivated Cas9 comprising mutations D10A and H840A, retains sequence-specific binding function and can serve as a functional transcription factor, for example, when fused in frame with either an activator or a repressor domain.
  • a Cas9 enzyme is used in the chimeric polypeptides of the present disclosure.
  • the Cas9 may be a Streptococcus pyogenes Cas9, referred to herein as “SpyCas9” or“SpCas9”.
  • SpyCas9 Streptococcus pyogenes Cas9
  • SpCas9 Streptococcus pyogenes Cas9
  • variants or homologs of a Cas9 protein or a number of Cas9 proteins from other species are also consistent with the present disclosure.
  • a Cas protein such as a Casl2 (e.g., Cpfl) or a Casl4, or any of a number of other RNA guided endonuclease can be used in the chimeric polypeptides of the present disclosure and is consistent with the methods disclosed herein.
  • a Cas protein such as a Casl2 (e.g., Cpfl) or a Casl4, or any of a number of other RNA guided endonuclease can be used in the chimeric polypeptides of the present disclosure and is consistent with the methods disclosed herein.
  • Casl2 polypeptides are examples of site-specific endonucleases, as are derivatives thereof, variants thereof, and fragments thereof recognizable by a person of skill in the art as retaining some or all of the common activity or having sufficient sequence identity as a protein listed above or elsewhere herein.
  • Casl2 polypeptides are classified as class II, Type V CRISPR/Cas effector proteins.
  • Casl2 which includes Casl2a (Cpfl), Casl2b, and Cas l2c, is classified as a class II, Type V CRISPR/Cas system containing having about 1,300 amino acids, and is a smaller and simpler endonuclease than Cas9.
  • Cpfl was identified later than Cas9 by metagenomic data analysis, and composed of two major domains such as REC and RuvC domains.
  • Cpfl does not have a HNH endonuclease domain, which is the other essential domain of Cas9 (Fagerlund et ak, 2015; Zetsche et ak, 2015).
  • CRISPR/Casl2 cleaves a double stranded DNA (dsDNA) immediate downstream from T-rich (5'-TTTN-3') PAM (Zetsche et ak, 2015). CRISPR/Casl2 generates 4-5 nt-long 5- overhang in 20 nt away from T-rich PAM, and the sticky ends enhance the efficiency of DNA replacement during HR distinct from Cas9 (Fagerlund et ak, 2015; Zetsche et ak, 2015).
  • Casl2 is an example of a site-specific endonuclease, as are derivatives thereof, variants thereof, and fragments thereof that are recognizable by a person of skill in the art as retaining some or all of the common activity or having sufficient sequence identity as a protein listed above or elsewhere herein.
  • Casl2a (Cpfl) is classified as a class II, Type V CRISPR/Cas effector protein having about 1,300 amino acids. Cpfl is smaller than Cas9.
  • Cpfl comprises two major domains such as REC and RuvC domains.
  • Cpfl lacks the HNH endonuclease domain.
  • Cpfl cleaves a double stranded DNA (dsDNA) immediately downstream from T-rich (5 -TTTN-3')
  • Cpfl generates a 4-5 nt-long 5’ -overhang 20 nucleotides away from T-rich PAM. In some cases, the sticky ends produced by Cpfl enhance the efficiency of DNA replacement during HR.
  • Exemplary site-specific endonucleases are optionally derived or obtained from the organism Streptococcus pyogenes (S. pyogenes).
  • Streptococcus thermophilus Streptococcus sp., Staphylococcus aureus, Nocardiopsis rougevillei, Streptomyces pristinae spiralis, Streptomyces viridochromo genes, Streptomyces viridochromogenes, Streptosporangium roseum, Streptosporangium roseum, Alicyclobacillus acidocaldarius, Bacillus pseudomycoides, Bacillus selenitireducens, Exiguobacterium sibiricum, Lactobacillus delbrueckii, Lactobacillus salivarius, Microscilla marina, Burkholderiales bacterium, Polar
  • Polar omonas sp. Crocosphaera watsonii, Cyanothece sp., Microcystis aeruginosa, Pseudomonas aeruginosa, Synechococcus sp., Acetohalobium arabaticum, Ammonifex degensii,
  • Caldicommeosiruptor becscii Candidatus Desulforudis, Clostridium botulinum, Clostridium difficile, Finegoldia magna, Natranaerobius thermophilus, Pelotomaculum thermopropionicum,
  • Acidithiobacillus caldus Acidithiobacillus ferrooxidans, Allochromatium vinosum, Marinobacter sp., Nitrosococcus halophilus, Nitrosococcus watsoni, Pseudoalter omonas haloplanktis,
  • Ktedonobacter racemifer Methanohalobium evestigatum, Anabaena variabilis, Nodularia spumigena, Nostoc sp., Arthrospira maxima, Arthrospira platensis, Arthrospira sp., Lyngbya sp., Microcoleus chthonoplastes, Oscillatoria sp., Petrotoga mobilis, Thermosipho afiricanus,
  • the disclosure provides a guide nucleic acid for use in a CRISPR/Cas system.
  • a guide nucleic acid such as a guide RNA binds to a Cas protein and targets the Cas protein to a specific location within a target nucleic acid.
  • a guide nucleic acid comprises a nucleic acid-targeting segment and a Cas protein binding segment.
  • a guide nucleic acid comprises a single nucleic acid molecule, referred to as a single guide nucleic acid (sgRNA).
  • a guide nucleic acid comprises two separate nucleic acid molecules, referred to as a double guide nucleic acid. Plants
  • the methods of the present disclosure may be used to engineer a trait of interest in a wide range of plant cells, comprising at least one protoplast or at least one phytoplasm.
  • a protoplast or phytoplasm refers to a cell without the cell wall.
  • a representative example of a protoplast is a plant cell without a cell wall.
  • a plant that may be engineered using the RNP complex mixtures disclosed herein e.g., PLUS reagent, lipofectamine, PEG, guide RNA, and a
  • programmable endonuclease may be a monocot or a dicot.
  • monocots that may be engineered with the methods disclosed herein include maize, rice, sorghum, rye, barley, wheat, millet, oats, sugarcane, turfgrass, or switchgrass.
  • dicots that may be engineered with the methods disclosed herein include soybean, canola, alfalfa, sunflower, cotton, tobacco, peanut, potato, tobacco, Arabidopsis, Arabidopsis thaliana , lettuce, or safflower.
  • target plant cell is from lettuce.
  • target plant cell is rice.
  • target plant cell is maize.
  • the present disclosure also provides methods and compositions consistent with editing the genome of a plant cell, wherein the plant cell is a gametophyte, a reproductive cell, a vegetative cell, or a meristematic cell
  • Genes to test include genes responsible for a trait of interest.
  • the gene may confer a health benefit.
  • the Rl-nj allele may be targeted in maize.
  • Other genes are also consistent with the compositions and methods disclosed herein, for example, a gene involved in growth regulation, a gene involved in hormone synthesis, detection, or signaling, a fruit fly regulation gene, an inflorescence gene that regulates branching, or a gene involved in carbohydrate quality.
  • granule-bound starch synthase 1 (WAXY) and amylose extender 3 (AE3) are genes involved in carbohydrate quality.
  • plant material includes lettuce material as follows. Plant material includes, for example, i.) 20-30 seeds, Chungchima, one variety of lettuce, Lactuca sativa, ii.) MS salt with vitamins (M0222, Duchefa,
  • RV Haarlem, Netherlands iii.) Blades (N.10, FEATHER SAFETY RAZOR, Osaka, Japan), iv.) Forceps (Cat.3-SA, Jonostick by Regine Switzerland Standard, China), v.) Cell strainer (Cat.93 l00, SPL, Korea), and vi.) 1000 m ⁇ wide bore tip (T-205-WB-C-R-S, Axygen, NY).
  • PEG Transfection A number of transfection agents are consistent with the disclosure herein.
  • a hydrophilic polymer can be used as a transfection agent.
  • a preferred hydrophilic polymer is PEG, although other hydrophilic polymers are also consistent with the methods disclosed herein.
  • Representative examples of materials useful for PEG transfection include enzyme solution, PEG solution, W5 solution, MMG solution, a growth chamber 24 degree
  • a representative enzyme solution used in the PEG transfection includes mannitol (M0803, Duchefa, RV Haarlem,
  • KC1 P5405, Sigma-Aldrich, ETSA
  • MES M1503, Duchefa, RV Haarlem
  • a representative PEG solution includes PEG 4000 (81240, Sigma-Aldrich, Germany), CaCl2 (C3881, Sigma-Aldrich, Japan), and mannitol (M0803, Duchefa, RV Haarlem, Netherlands).
  • a representative W5 solution includes NaCl (7548-4405, Daejung chemicals and metals, Korea), KC1 (P5405, Sigma-Aldrich, USA), CaCl2 (C3881, Sigma-Aldrich, Japan), and MES (Ml 503, Duchefa, RV Haarlem, Netherlands).
  • a representative MMG solution includes mannitol (M0803, Duchefa, RV Haarlem, Netherlands), MgCl2 (M0533, Duchefa, RV Haarlem, Netherlands), and MES (Ml 503, Duchefa, RV Haarlem, Netherlands).
  • CRISPR/Cas9 protein purification include, i.) LB agar (204010, BD, USA), ii.) LB liquid (LB-05, LPS SOLUTION, Korea), iii.) kanamycin (MB-K4390, MBcell, USA), iv.) BL21 RosettaTM2 (DE3) pLysS (Novagen, Madison, WI) cells (Agilent, Santa Clara, CA) and BL21 cell
  • Representative materials for in vitro sgRNA transcription include i.) a 60 mer forward oligonucleotide (Macrogen, Korea), ii.) an 80 mer reverse
  • oligonucleotide (Macrogen, Korea), iii.) Q5 DNA polymerase (M0491, NEB, Ipswich, MA, USA), iv.) T4 DNA polymerase (M4211, Promega, Madison, WI, USA), v.) T7 RNA polymerase
  • MEGAclean-up MEGAclean-up kit, AM1908, Ambion, Invitrogen, Vilnius, Lithuania
  • HiScribeTM T7 High Yield RNA Synthesis Kit NEB, Ipswich, MA
  • a thermocycler SimiAmp Thermal Cycler, ThermoFisher scientific, Waltham, MA, USA.
  • Representative materials for the in vitro cleavage assay include a double stranded DNA template, sgRNA, SpyCas9 protein (G+FLAS life sciences, Korea), agarose (Cat.32033, iNtRON biotechnology, Korea), RedSafe (Cat.2l 141, iNtRON biotechnology, Korea), a 6X Loading dye (B7024S, NEB, Ipswich, Massachusetts, USA), incubator for 37°C (HB-201SL, HanBaek Scientific Co., Korea), and a gel electrophoresis system (MINI HD9, UVItec Cambridge, LA Abcoude, Netherlands).
  • Plant Regeneration Representative materials for plant regeneration include, B5 salt (G0209, Duchefa, RV Haarlem, Netherlands), MS salt (M0221, Duchefa, RV Haarlem,
  • sucrose S0809, Duchefa, RV Haarlem, Netherlands
  • 2.4-D D0911, Duchefa, RV Haarlem, Netherlands
  • BAP B0904, Duchefa, RV Haarlem, Netherlands
  • MES MES
  • SpCas9 purification methods can be carried out as follows. Plasmid vectors, pET28a-A pyogenes Cas9 (SpCas9) and pET28a- Francisella novicida Cpfl (FnCpfl), were transformed into the E. coli strain BL21 DE3. The expressible fusion protein vector contains an N-terminal His 6-tag and the SpCas9 sequence spanning residues 1-1368. The procedure can be useful for the expression and purification of SpCas9, SpCas9 variants from other bacterial species, SpCas9-fused moieties proteins, FnCpfl, FnCpfl variants from other bacterial species, and FnCpfl -fused moieties proteins.
  • pET28a-SpCas9-BPNLS or pET28a-FnCpfl-BPNLS can be transformed into BL21 competent cells.
  • methods of transformation include transforming pET28a-SpCas9-BPNLS or pET28a-FnCpfl-BPNLS chemically into competent BL21 RosettaTM2 (DE3) pLysS (Novagen, Madison, WI) cells (Agilent, Santa Clara, CA). 10 ng of plasmid DNA is added to 50 pl of freshly thawed competent cells and incubated on ice for 30 min.
  • cells with plasmid DNA can be incubated on ice for an amount of time, such as 1 min to 5 min, 5 min to 10 min, 10 min to 15 min, 15 min to 20 min, 20 min to 25 min, 25 min to 30 min, 30 min to 35 min, 35 min to 40 min, 40 min to 45 min, 45 min to 50 min, 50 min to 70 min, 70 min to 90 min, 90 min to 160 min, 160 min to 230 min, or 230 min to 300 min.
  • Cells are heat-shock cells by incubation at 42 °C for 1 min, and 600 m ⁇ of SOC medium is added to the cells.
  • heat shock can be carried out for 1 min to 5 min, 5 min to 10 min, 10 min to 15 min, 15 min to 20 min, 20 min to 25 min, 25 min to 30 min, 30 min to 35 min, 35 min to 40 min, 40 min to 45 min, 45 min to 50 min, 50 min to 70 min, 70 min to 90 min, 90 min to 160 min, 160 min to 230 min, or 230 min to 300 min.
  • the culture is incubated at 37 °C for 1 h in a shaking incubator.
  • the culture is incubated from 1 hour to 1.1 hours, 1.1 hours to 1.2 hours, 1.2 hours to 1.3 hours, 1.3 hours to 1.4 hours, 1.4 hours to 1.5 hours, 1.5 hours to 2 hours, 2 hours to 2.5 hours, 2.5 hours to 3 hours, 3 hours to 3.5 hours, 3.5 hours to 4 hours, 4 hours to 4.5 hours, or 4.5 hours to 5 hours.
  • 50 m ⁇ of culture is plated out on LB agar containing 50 pg/ml of kanamycin.
  • Kanamycin amounts can range from 1 pg/ml to 500 pg/ml, 10 pg/ml to 100 pg/ml, 25 pg/ml to 75 pg/ml, 1 pg/ml to 5 pg/ml, 5 pg/ml to 10 pg/ml to, 10 pg/ml to 15 pg/ml, 15 pg/ml to 20 pg/ml, 20 pg/ml to 25 pg/ml, 25 pg/ml to 30 pg/ml, 30 pg/ml to 35 pg/ml, 35 pg/ml to 40 pg/ml, 40 pg/ml to 45 pg/ml, 45 pg/ml to 50 pg/ml, 50 pg/ml to 60 pg/ml, 60 pg/ml to 70 pg/ml, 70 pg/m
  • cell culture is carried out as follows. Three 25-ml seed cultures are grown with a serial dilution (original, l,000x, 100,000* dilutions) in baffled flasks over-night. One colony from the agar plate is selected to inoculate 25 ml LB medium containing 50 pg/ml kanamycin (Original).
  • Kanamycin amounts can range from 1 pg/ml to 500 pg/ml, 10 pg/ml to 100 pg/ml, 25 pg/ml to 75 pg/ml, 1 pg/ml to 5 pg/ml, 5 pg/ml to 10 pg/ml, 10 pg/ml to 15 pg/ml, 15 pg/ml to 20 pg/ml, 20 pg/ml to 25 pg/ml, 25 pg/ml to 30 pg/ml, 30 pg/ml to 35 pg/ml, 35 pg/ml to 40 pg/ml, 40 pg/ml to 45 pg/ml, 45 pg/ml to 50 pg/ml, 50 pg/ml to 60 pg/ml, 60 pg/ml to 70 pg/ml, 70 pg/ml
  • the preculture is incubated at 30°C or 37°C in a shaking incubator (250 rpm) for overnight.
  • SpCas9 or FnCpfl protein induction is performed as follows. 10 ml of the preculture is used to inoculate 500 ml prewarmed LB medium supplemented with 50 pg/ml kanamycin in a 2 1 baffled flask. The cells are expressed 2 x 500 ml total culture volume at once. Cultures are incubated at 37°C in a shaking incubator (200 rpm) while monitoring the cell growth every hour by measuring optical density at 600 nm (OD600). At an OD of 0.6 ⁇ 0.7, the
  • cell resuspension cell lysis On Day 4, cell resuspension cell lysis, debris removal, preparation of binding and elution buffers, alternative His protein purification by HisTrap-HP affinity column, desalting His-purified SpCas9 or FnCpfl protein, and concentration is performed.
  • cells were harvested by centrifugation at 4,000 rpm for 30 min in a swing-bucket rotor in 500 ml bottles.
  • the supernatant is discarded and resuspended the cell pellets using 25 ml ice-chilled lysis buffer (20 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 5 mM Imidazole, 1 mM l,4-dithiothreitol (DTT), and 1 mM phenylmethylsulfonyl fluoride (PMSF) per cell pellet from 1 1 culture.
  • ice-chilled lysis buffer 20 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 5 mM Imidazole, 1 mM l,4-dithiothreitol (DTT), and 1 mM phenylmethylsulfonyl fluoride (PMSF) per cell pellet from 1 1 culture.
  • the Tris-HCl concentration may vary from 1 mM to 5 mM, 5 mM to 10 mM, 10 mM to 15 mM, 15 mM to 20 mM, 20 mM to 25 mM, 25 mM to 30 mM, 30 mM to 35 mM, 35 mM to 40 mM, 40 mM to 45 mM, 45 mM to 50 mM, 50 mM to 60 mM, 60 mM to 70 mM, 70 mM to 80 mM, 80 mM to 90 mM, 90 mM to 100 mM, 100 mM to 150 mM, 150 mM to 200 mM, 200 mM to 250 mM, 250 mM to 300 mM, 300 mM to 350 mM, 350 mM to 400 mM, 400 mM to 450 mM, or 450 mM to 500 mM per cell pellet from 1 1 culture.
  • the NaCl concentration may vary from 1 mM to 10 mM, 10 mM to 100 mM, 0.1 M to 0.25 M, 0.25 M to 0.4 M, 0.4 M to 0.55 M, 0.55 M to 0.7 M, 0.7 M to 0.85 M, 0.85 M to 1 M, 1 M to 1.2 M, 1.2 M to 1.4 M, 1.4 M to 1.6 M, 1.6 M to 1.8 M, 1.8 M to 2 M, 2 M to 2.2 M, 2.2 M to 2.4 M, 2.4 M to 2.6 M, 2.6 M to 2.8 M, 2.8 M to 3 M, 3 M to 3.5 M, 3.5 M to 4 M, 4 M to 4.5 M, 4.5 M to 5 M, 5 M to 5.5 M, 5.5 M to 6 M, 6 M to 6.5 M, 6.5 M to 7 M, 7 M to 7.5 M, 7.5 M to 8 M, 8 M to 8.5 M, 8.5 M to 9 M, 9 M to 9.5 M, or 9.5 M to 10 M per cell pellet from 1
  • Imidazole concentrations may vary from 10 mM to 20 pM, 20 pM to 30 pM, 30 pM to 40 pM, 40 pM to 50 pM, 50 pM to 60 pM, 60 pM to 70 pM, 70 pM to 80 pM, 80 pM to 90 pM, 90 pM to 100 pM, 100 pM to 200 pM, 200 pM to 300 pM, 300 pM to 400 pM, 400 pM to 500 pM, 500 pM to 1 mM, 1 mM to 5 mM, 5 mM to 10 mM, 10 mM to 20 mM, 20 mM to 30 mM, 30 mM to 40 mM, 40 mM to 50 mM, 50 mM to 100 mM, 100 mM to 150 mM, 150 mM to 200 mM, 200 mM to 250 mM, 250 mM to
  • l,4-dithiothreitol (DTT) concentrations may vary from 10 pM to 20 pM, 20 pM to 30 pM, 30 pM to 40 pM, 40 pM to 50 pM, 50 pM to 60 pM, 60 pM to 70 pM, 70 pM to 80 pM, 80 pM to 90 pM, 90 pM to 100 pM, 100 pM to 200 pM, 200 pM to 300 pM, 300 pM to 400 pM, 400 pM to 500 pM, 500 pM to 1 mM, 1 mM to 5 mM, 5 mM to 10 mM, 10 mM to 20 mM, 20 mM to 30 mM, 30 mM to 40 mM, 40 mM to 50 mM, 50 mM to 100 mM, 100 mM to 150 mM, 150 mM to 200 mM, 200
  • Phenylmethylsulfonyl fluoride (PMSF) concentrations may vary from 10 pM to 20 pM, 20 pM to 30 pM, 30 pM to 40 pM, 40 pM to 50 pM, 50 pM to 60 pM, 60 pM to 70 pM, 70 pM to 80 pM, 80 pM to 90 pM, 90 pM to 100 pM, 100 pM to 200 pM, 200 pM to 300 pM, 300 pM to 400 pM, 400 pM to 500 pM, 500 pM to 1 mM, 1 mM to 5 mM, 5 mM to 10 mM, 10 mM to 20 mM, 20 mM to 30 mM, 30 mM to 40 mM, 40 mM to 50 mM, 50 mM to 100 mM, 100 mM to 150 mM, 150 mM to 200 mM, 200
  • the re-suspended cell pellets are lysed using a probe sonicator.
  • Cell suspension is passed through the homogenizer three to four times at 40% amplitude for 1 min to ensure complete lysis.
  • the lysate is cooled on ice between passes.
  • the lysate is clarified by centrifugation in 50 ml Nalgene Oak Ridge tubes at 15,000 rpm (-30,000 x g) for 60 min at 4 °C. The supernatant is collected and, after centrifugation, the lysate is filtered with two connected syringe filters, 1 pm and 0.45 pm. The filtrate is collected.
  • Preparation of the binding and elution buffers can be carried out as follows. 1 1 of the binding buffer is prepared with 20 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 5 mM Imidazole, and 1 mM DTT.
  • 1 1 of the elution buffer is prepared with 20 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 500 mM Imidazole, and lmM DTT. Amount of Tris-HCl, NaCl, imidazole, and DTT may all be varied, as described in the present disclosure.
  • chromatographic steps can be performed at 4°C. 20 ml of the cleared lysate is loaded on the superloop at a time. The column with bound protein is attached to an FPLC system equilibrated in binding buffer (20 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 5 mM Imidazole). Amount of Tris-HCl, NaCl, and imidazole may all be varied, as described in the present disclosure. The column is washed with 50 ml wash buffer at 5 ml/ min until the absorbance nearly reaches the baseline again.
  • Elution is performed with 50 ml elution buffer (20 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 500 mM Imidazole). Amount of Tris-HCl, NaCl, and imidazole may all be varied, as described in the present disclosure.
  • the flow rate is set to 5 ml/min and the pressure limit to 0.3 MPa for further steps using the Histrap-HP column. Two 5 ml fractions are collected.
  • Alternative His Protein purification by HisTrap-HP affinity column can be carried out as follows.
  • a 50 ml syringe is connected to a Histrap-HP column.
  • the Histrap-HP column was washed with 10 column volumes with distilled water.
  • a new 50 ml syringe is used, which connects to the Histrap-HP column.
  • the Histrap-HP column is equilibrated with 10 column volumes of binding buffer.
  • a syringe piston is pressed to adjust the flow rate as well as FPLC flow speed (5 ml/min).
  • a new 50 ml syringe is again used, which connects to Histrap-HP column. 10 ml of the filtrate is loaded into the 50 ml syringe.
  • a syringe piston is pressed to adjust the flow rate as well as FPLC flow speed (5 ml/min). The flow-through is harvested to observe His-protein loss.
  • a new 50 ml syringe is again used, which connects to Histrap-HP column. Wash the column with 10 column volumes of binding buffer.
  • a new 50 ml syringe is again used, which connects to Histrap-HP column. 5 column volumes of elution buffer are added. Fractionation is performed with every 5 ml elute.
  • a new 50 ml syringe is again used, which connects to Histrap-HP column. The column is washed with 10 column volumes of binding buffer.
  • Desalting His-purified SpCas9 or FnCpfl protein is carried out as follows.
  • the 10 mL fractions are desalted with 10 ml of storage buffer (20 mM HEPES, 150 mM KC1, 1 mM DTT, pH7.5, 10 % (v/v) glycerol, 1 mM DTT) using a 53 ml HiPrep desalt column.
  • Fresh DTT is immediately added prior to use.
  • HEPES concentration may be varied from 1 mM to 10 pM HEPES, 10 pM to 20 pM HEPES, 20 pM to 30 pM HEPES, 30 pM to 40 pM HEPES, 40 pM to 50 pM HEPES, 50 pM to 100 pM HEPES, 100 pM to 200 pM HEPES, 200 pM to 300 pM HEPES, 300 mM to 400 mM HEPES, 400 mM to 500 mM HEPES, 500 mM to 1 mM HEPES, 1 mM to 10 mM HEPES, 10 mM to 20 mM HEPES, 20 mM to 30 mM HEPES, 30 mM to 40 mM HEPES, 40 mM to 50 mM HEPES, 50 mM to 60 mM HEPES, 60 mM to 70 mM HEPES, 70 mM to 80 mM
  • HEPES 80 mM to 90 mM HEPES, 90 mM to 100 mM HEPES, 100 mM to 150 mM HEPES, 150 mM to 200 mM HEPES, 200 mM to 250 mM HEPES, 250 mM to 300 mM HEPES, 300 mM to 350 mM HEPES, 350 mM to 400 mM HEPES, 400 mM to 450 mM HEPES, 450 mM to 500 mM HEPES, 500 mM to 600 mM HEPES, 600 mM to 700 mM HEPES, 700 mM to 800 mM HEPES, 800 mM to 900 mM HEPES, 900 mM to 1 M HEPES, 1 M to 10 M HEPES, or 10 M to 100 M HEPES.
  • KC1 concentration may be varied from 1 mM to 10 mM KC1, 10 mM to 20 mM KC1, 20 mM to 30 mM KC1, 30 mM to 40 mM KC1, 40 mM to 50 mM KC1, 50 mM to 100 mM KC1, 100 mM to 200 mM KC1, 200 mM to 300 mM KC1, 300 mM to 400 mM KC1, 400 mM to 500 mM KC1, 500 mM to 1 mM KC1, 1 mM to 10 mM KC1, 10 mM to 20 mM KC1, 20 mM to 30 mM KC1, 30 mM to 40 mM KC1, 40 mM to 50 mM KC1, 50 mM to 60 mM KC1, 60 mM to 70 mM KC1, 70 mM to 80 mM KC1, 80 mM to 90 mM KC1, 90 mM to 100
  • DTT concentrations may vary from 10 mM to 20 mM 20 mM to 30 mM 30 mM to 40 mM 40 mM to 50 mM 50 mM to 60 mM 60 mM to 70 mM 70 mM to 80 mM 80 mM to 90 mM 90 mM to 100 mM 100 mM to 200 mM 200 mM to 300 mM 300 mM to 400 mM 400 mM to 500 mM 500 mM to 1 mM, 1 mM to 5 mM, 5 mM to 10 mM, 10 mM to 20 mM, 20 mM to 30 mM, 30 mM to 40 mM, 40 mM to 50 mM, 50 mM to 100 mM, 100 mM to 150 mM, 150 mM to 200 mM, 200 mM to 250 mM, 250 mM to 300 mM, 300 mM to 350 mM,
  • Concentration is carried out as follows. Eluted SpCas9 or FnCpfl protein is concentrated using a 30 kDa Amicon centrifugal concentrator to a concentration required for further
  • SpCas9 or FnCpfl protein can be concentrated up to 3 to 7 mg/ ml without precipitation.
  • the concentration is determined based on the assumption that 1 mg/ ml has an absorbance at 280 nm of 0.76 (based on a calculated extinction coefficient of 120,450/M ⁇ ah).
  • in vitro transcription of sgRNA is carried out as follows. [0096] Procedures that can be carried out on Day 1, include dimerization of single stranded sgDNA, preparation of the transcription template for Cas9 sgRNA, alternative preparation of a transcription template for SpCas9 sgRNA, preparation of the transcription template for FnCpfl crRNA, and/or alternative preparation of a transcription template for FnCpfl crRNA. Dimerization of single stranded sgDNA is carried out as follows.
  • SpCas9 can be programmed with chimeric sgRNAs, which combine the essential parts of the crRNA and tracrRNA molecules in a single oligonucleotide chain.
  • the resulting sgRNA contains a 20-mer target specific sequence with the T7 polymerase binding site to its upstream and the Cas9 protein binding region to its downstream. Designing gene specific targeting sequences are done using a web tool CHOPCHOP
  • sgRNAs are designed to target within a coding region without any mismatches, and the sequences preferably bear GG at the 5’ -end. The sequences are followed by NGG as their PAM motifs.
  • the crRNA guide is composed of a 5'- terminal 20-nt spacer sequence, followed by an invariant 76-nt guide RNA scaffold at the 3' end
  • Preparation of a transcription template for Cas9 sgRNA is carried out as follows.
  • the target specific sgRNA sequences are synthesized with l7-mer T7 promoter region to their 5 '-end and 23- mer gRNA scaffold annealing region to their 3’ -end with the total length of the oligonucleotide being a 60-mer.
  • an 80-mer gRNA scaffold sequence is also synthesized separately. Then the 60-mer and 80-mer
  • oligonucleotides are annealed together using a thermocycler, and a complete dsDNA is synthesized using T4 DNA polymerases and the annealed dimerized oligonucleotides as the template.
  • a transcription template for SpCas9 sgRNA is carried out as follows. A plasmid carrying T7 promoter and guide RNA scaffold is constructed. Only a target 20 bp double stranded oligonucleotide is cloned into the middle of two Bsal sites
  • a jTAGGTGAGACCGCAGGTCTCGjGTTTT placed between the T7 promoter and guide RNA scaffold by two Bsal type IIS restriction enzyme from golden gate cloning method (FIG. 1A).
  • a forward single oligonucleotide embodies a 5'-TAGG-3' overhang in front of the target 20 nt, while a reverse single oligonucleotide gets initiated with 5 '-C AAA-3' in front of the reverse target 20 nt.
  • Both one picomole of forward and reverse single oligonucleotides were mixed in 45 m ⁇ distilled water, which was transferred into a 0.2 ml PCR tub, and annealed at 95°C for 5 min and 55 °C for 10 min by a thermocycler. Annealed oligonucleotides are placed on ice. As a result, the dimerized oligonucleotides are employed to clone into a linear plasmid with two flanking sequences, 5'- CCTA-3' and 5'-GTTT-3'. The completed construct is used to synthesize sgRNAs as templates.
  • Preparation of a transcription template for FnCpfl crRNA is carried out as follows. A plasmid carrying a T7 promoter and a guide RNA scaffold was constructed. A target 20 bp double stranded oligonucleotide was cloned into the end of guide RNA scaffold by two Bsal type IIS restriction enzyme using the golden gate cloning method (FIG. IB). A forward single
  • oligonucleotide embodied the 5'-AGAT-3' overhang in front of the target 20 nt, while a reverse single oligonucleotide is initiated with 5'-AAAA-3' in front of the reverse target 20 nt.
  • Both one picomole of forward and reverse single oligonucleotides are mixed in 45 m ⁇ distilled water, which is transferred into 0.2 ml PCR tube, and annealed at 95 °C for 5 min and 55 °C for 10 min by a thermocycler. Annealed double stranded oligonucleotides (dsODN) are placed on ice.
  • the dimerized oligonucleotides were employed to clone into a linear plasmid with two flanking sequences, 5'-ATCT-3' and 5'-TTTT-3'.
  • the completed construct is used to synthesize sgRNAs as templates.
  • the transcription template for FnCpfl crRNA is prepared as follows. Two 63 nt single stranded oligonucleotides are synthesized, which compose of 5 nt overhang in front of T7 promoter, 19 nt T7 promoter, and 20 nt target spacer sequence. Both 10 m ⁇ of 200 nmol of forward and reverse single oligonucleotides are mixed, and the 20 m ⁇ mixture is transferred into a 0.2 ml PCR tube, and annealed at 95 °C for 5 min and 55 °C for 10 min by a thermocycler, then place annealed dsODN on ice
  • Procedures that can be carried out Day 2 include amplification of dsDNA templates for sgRNAs by PCR amplification and sgRNA transcription by T7 RNA polymerase.
  • Amplification of dsDNA templates for sgRNAs by PCR amplification is carried out as follows. Transcription templates for sgRNA synthesis can be PCR amplified from plasmid or synthetic oligonucleotide templates with appropriate PCR primers (A forward primer is 5'- AATTCTAATACGACTCACTATAGG-3', which has additional five AATTC nt in front of T7 promoter sequence and a reverse primer is from end of sgRNA scaffold 5'- GCACCGACTCGGTGCCACTT-3').
  • the high amount of dsDNA template can be obtained simply by PCR performance.
  • Q5® polymerase in some cases, is used to amplify transcription templates.
  • PCR products may be subjected to DNA electrophoresis to estimate concentration and to confirm amplicon. Size is determined prior to its use as a template in the T7 RNA transcription synthesis. PCR mixture may be used directly if diluted at least 10X in the transcription reaction. However, better yields will be obtained with purified PCR products. PCR products can be purified according to the protocol for commercial clean-up kit instruction. Table 1. PCR cycle program and conditions
  • sgRNA transcription by T7 RNA polymerase is carried out as follows. 1.4 mM (1 pg of a 120 bp PCR product or annealed dsODN) can be used in a 20 pl in vitro transcription reaction. Employing 1 pg templates is critically required to harvest 100 pg sgRNAs with above 1 pg/pl high concentration. Wearing gloves during sample handling and using nuclease-free tubes and reagents will help avoid RNase contamination. Reactions are typically 20 pl but can be scaled up as needed. Reactions should be assembled in nuclease-free microfuge tubes or PCR strip tubes.
  • MEGAshortscript T7 Transcription Kit or HiScribeTM T7 High Yield RNA Synthesis Kit components are thawed, mixed, and pulse-spun in a microfuge to collect solutions to the bottoms of tubes. Samples are kept on ice. The reaction is assembled at room temperature in the following order shown in Table 3.
  • the transcription components are mixed thoroughly and pulse-spun in a microfuge. Incubation is carried out at 37°C for 4 hours or longer (O/N available) for maximum yield.
  • Reactions can be incubated for up to 16 hours.
  • the amount of sgRNA may be synthesized sufficiently in 4 hours.
  • Incubation can be carried out in a thermocycler to prevent evaporation of the sample.
  • DNase treatment is performed to remove DNA template.
  • 20 pl nuclease-free water is added to each 20 m ⁇ reaction, followed by 2 m ⁇ of DNase I (RNase-free). The reaction is mixed and incubated for 15 minutes at 37°C.
  • Procedures that can be carried out on Day 3 include methods for sgRNA clean-up.
  • sgRNA can be cleaned up as follows. After 15 min, transcript products are cleaned-up using a MEGAclean-up kit. The products are transferred into a new 1.5 ml tube. 100 m ⁇ of elution solution is added and mixed. 350 m ⁇ of binding solution is added. Samples are
  • Samples are mixed by pipetting, and 250 m ⁇ of 100% ethanol is added. The manual of the MEGAclean-up kit is followed; the mixed samples are transferred into spin-down column/2 ml tube. Samples are centrifuged at 12,000 rpm for one min. The flow-through is discarded. 500 m ⁇ of washing solution is added. Samples are centrifuged at 12,000 rpm for one min and the flow-through is discarded. Once again, 500 m ⁇ of washing solution is added and is centrifuged at 12,000 rpm for one min (totally washing twice). The flow-through is discarded. The spin-column/2 ml tubes are centrifuged at 12000 rpm for one min.
  • the spin-column is transferred into a new 1.5 ml tube. 50 m ⁇ of water is added into the spin-column/ 1.5 ml tube each. The spin-column/ 1.5 ml tubes are placed on the heat-block at 70 °Cfor 10 min. After 10 min, the spin-column/ 1.5 ml tubes are centrifuged at 12,000 rpm for one min. 50 m ⁇ of water is added into the spin-column/ 1.5 mL tube each. The flow through is measured for the concentration of sgRNA.
  • sgRNA clean-up can be carried out as follows. After 15 min, transcript products are also cleaned-up through ethanol precipitation. The ethanol precipitation is not only available to concentrate sgRNAs but also applying to small size RNA less than 100 nt. FnCpfl crRNA size was 66 nt smaller than 100 nt, which was a minimum size for using
  • RNA concentration can be determined by measuring the ultraviolet light absorbance at 260 nm.
  • plant regeneration is carried out as follows.
  • Seeds i.e., rice seeds, maize seeds, or lettuce seeds
  • 2% sodium hypochlorite e.g., diluted Clorox® bleach
  • Seeds can be sterilized with 1% to 1.5%, 1.5% to 2%, 2% to 2.5%, 2.5% to 3%, 3% to 3.5%, 3.5% to 4%, 4% to 4.5%, 4.5% to 5%, 5% to 10%, 10% to 15%, 15% to 20%, or 20% to 40% sodium hypochlorite.
  • Seeds can be sterilized for 5 min to 10 min, 10 min to 20 min, 20 min to 30 min, 30 min to 1 hour, 1 hour to 2 hours, 2 hours to 6 hours, 6 hours to 12 hours, or longer than 12 hours. Bleached seeds are washed 5 times with sterile dH 2 0).
  • Sterile seeds are planted 1/2 MS media. Long-day conditions (l4-h light/lO-h dark photoperiod) can be used to grow plants.
  • a 50 E m -2 s _1 to 100 E m -2 s _1 , 100 E m -2 s _1 to 150 E m -2 s _1 , 150 E m -2 s _1 to 200 E m -2 s _1 , or 200 E m -2 s _1 to 250 E m -2 s _1 LED light can be useful for growing plants.
  • Plants are grown at a temperature from l8°Cto 25°C, 23°C to 25°C, 25°C to 27°C, 27°C to 30°C, 30°C to 35°C, or 35°Cto 45°C,.
  • Lettuce leaves are harvested 1 day to 2 days, 2 days to 3 days, 3 days to 4 days, 4 days to 5 days, 5 days to 6 days, 6 days to 7 days, 7 days to 8 days, 8 days to 9 days or 9 days to 10 days after germination.
  • the leaves are harvested after 1 day to 2 days, 2 days to 3 days, 3 days to 4 days, 4 days to 5 days, 5 days to 6 days, 6 days to 7 days, 7 days to 8 days, 8 days to 9 days or 9 days to 10 days, after germination.
  • the leaves are harvested after 1 day to 2 days, 2 days to 3 days, 3 days to 4 days, 4 days to 5 days, 5 days to 6 days, 6 days to 7 days, 7 days to 8 days, 8 days to 9 days or 9 days to 10 days, after germination.
  • Mannitol concentrations may be varied from 0.1 mM to 1 M, 100 mM to 100 M, 0.1 mM to 1 mM, 1 mM to 50 mM, 50 mM to 100 mM, 0.1 M to 0.5 M, 0.5 M to 1 M, 1 M to 10 M, lO M to 50 M, 50 M to 100 M, 100 M to 200 M, 200 M to 300 M, 300 M to 400 M, 400 M to 500 M, 500 M to 600 M, 600 M to 700 M, 700 M to 800 M, 800 M to 900 M, or 900 M to 1000 M.
  • MES concentrations may be varied form 0.1 mM to 1 M, 100 mM to 100 M, 0.1 mM to 1 mM, 1 mM to 50 mM, 50 mM to 100 mM, 0.1 M to 0.5 M, 0.5 M to l M, l M to lO M, 10 M to 50 M, 50 M to 100 M, 100 M to 200 M, 200 M to 300 M, 300 M to 400 M, 400 M to 500 M, 500 M to 600 M, 600 M to 700 M, 700 M to 800 M, 800 M to 900 M, or 900 M to 1000 M.
  • Cellulase R-10 (Yakurt) concentrations may be varied from 0.01% to 15%, 1% to 10%, 0.01% to 0.1%, 0.1% to 0.5%, 0.5% to 1%, 1% to 1.5%, 1.5% to 2%, 2% to 2.5%, 2.5% to 3%, 3% to 3.5%, 3.5% to 4%, 4% to 4.5%, 4.5% to 5%, 5% to 10%, or 10% to 15%.
  • Macerozyme R-10 (Yakurt) concentrations may be varied from 0.01% to 15%, 1% to 10%, 0.01% to 0.1%, 0.1% to 0.5%, 0.5% to 1%, 1% to 1.5%, 1.5% to 2%, 2% to 2.5%, 2.5% to 3%, 3% to 3.5%, 3.5% to 4%, 4% to 4.5%, 4.5% to 5%, 5% to 10%, 10% to 15%.
  • the solution is incubated at 55 °C for 10 min and CaCl 2 and BSA are added to a concentration of 10 mM CaCl 2 and 0.1% BSA.
  • CaCl 2 concentrations may be varied from 0.1 mM to 1 M, 1 mM to 500 mM, 1 mM to 20 mM, 0.1 mM to 1 mM, 1 mM to 10 mM, 10 mM to 100 mM, 100 mM to 1 mM,
  • BSA concentrations may be varied from 0.001% to 10%, 0.1% to 10%, 1% to 5%, 0.001% to 0.01%, 0.01% to 0.1%, 0.1% to 0.5%, 0.5% to 1%, 1% to 1.5%, 1.5% to 2%, 2% to 2.5%, 2.5% to 3%, 3% to 3.5%, 3.5% to 4%, 4% to 4.5%, 4.5% to 5%, or 5% to 10%.
  • the enzyme solution is filtered through a 0.45 mih syringe filter. Leaves are sliced with a razor as followed. Ten to fifteen leaves are detached from plants without damage of plants. One, two, three, four, five six, seven, eight, nine, ten, or more than ten leaves are piled on a droplet of sterile water.
  • the piled leaves are sliced and can be sliced together. Sliced leaves are placed in the enzyme solution. A 20 ml enzyme solution is poured into a 90 mm plate. 15 sliced leaves are transferred into the 20 mL enzyme solution. Sliced leaves are covered with foil and placed in a 90 mm plate on a gyratory shaker at 50 revolutions/min. Plates are incubated for 4-5 hours. The enzyme solution with protoplasts is poured into a round tube. The same volume of W5 (154 mM NaCl, 125 mM CaCl 2 , 5 mM KC1, and 2 mM MES (pH 5.7)) is added in the 20 mL enzyme solution.
  • W5 154 mM NaCl, 125 mM CaCl 2 , 5 mM KC1, and 2 mM MES (pH 5.7)
  • NaCl concentrations may be varied 50 mM to 100 mM, 100 mM to 200 mM, 200 mM to 300 mM, 300 mM to 400 mM, 400 mM to 500 mM, 500 mM to 1 mM, 1 mM to 100 mM, 100 mM to 200 mM, 200 mM to 300 mM,
  • CaCl 2 concentrations may be varied from 50 mM to 100 mM, 100 mM to 200 mM, 200 mM to 300 mM, 300 mM to 400 mM, 400 mM to 500 mM, 500 mM to 1 mM, 1 mM to 100 mM, 100 mM to 200 mM, 200 mM to 300 mM, 300 mM to 400 mM, 400 mM to 500 mM, 500 mM to 600 mM, 600 mM to 700 mM, 700 mM to 800 mM, 800 mM to 900 mM, 900 mM to 1 M, 1 M to 50 M, 50 M to 100 M, 100 M to 150 M, or 150 M to 500 M.
  • KC1 concentrations may vary from 1 mM to 50 mM, 50 mM to 100 mM, 100 mM to 200 mM, 200 mM to 300 mM, 300 mM to 400 mM, 400 mM to 500 mM, 500 mM to 1 mM, 1 mM to 10 mM, 10 mM to 20 mM, 20 mM to 30 mM, 30 mM to 40 mM, 40 mM to 50 mM, 50 mM to 100 mM, 100 mM to 150 mM, 150 mM to 200 mM, 200 mM to 250 mM, 250 mM to 300 mM, 300 mM to 500 mM, 500 mM to 1 M, or 1 mM to 50 M.
  • MES concentrations may be varied from 1 mM to 50 mM, 50 mM to 100 mM, 100 mM to 200 mM, 200 mM to 300 mM, 300 mM to 400 mM, 400 mM to 500 mM, 500 mM to 1 mM, 1 mM to 10 mM,
  • a range of pH values for each of the buffer components is consistent with the present disclosure.
  • 40 ml of the enzyme solution containing protoplasts is flowed through a 100 pm cell strainer into a 50 ml round tube. The cell strainer is removed and the round tube is centrifuged at 100 x g (80 x g in Hand centrifuge, model COMBI- 514R) for 5 min. The supernatant is removed with a 20 mL long pipette.
  • MMG solution is added into a protoplast pellet and the supernatant is removed completely. 1 mL of MMG solution is added and the protoplasts are counted with a hemocytometer. The cell number is adjusted to from 1 x l0 4 /ml to 1 x l0 5 /ml, 1 x l0 6 /ml to 2 x l0 6 /ml, 2 x l0 6 /ml to 100 x l0 6 /ml, or 100 x l0 6 /ml to 1 x l0 7 /ml by adding MMG solution.
  • RNP is transferred into protoplasts as follows. 5 pg of gRNA, 10 pg Cas9 protein (or mRNA), 2 pl plus reagent, and 2 pl lipofectamine 3000 are added. Next, 2 pl of 10X EB 3.1 buffer is added into a 1.5 mL tube. dH 2 0 is added to a final volume of 20 pl in a 1.5 ml tube.
  • the RNP complex mixture is incubated for 10 min.
  • a 200 m ⁇ protoplast solution is aliquoted with a 1,000 m ⁇ wide bore tip.
  • the RNP mixture is added into the 200 m ⁇ protoplast solution and mixed gently.
  • the same volume (220 m ⁇ ) of 40% PEG solution is added into the RNP- protoplast solution.
  • the RNP -protoplast is incubated in the PEG solution for 10 min.
  • the RNP- protoplast mixture is incubated for 10 min at a temperature from l8°C to 25°C, 23°C to 25°C, 25°C to 27°C, 27°C to 30°C, 30°C to 35°C, or 35°Cto 45°C.
  • 800 pl of W5 solution is added and inverted four to five times.
  • the samples are centrifuged at 100 g for 1 min in a large top table centrifuge, and the supernatant is discarded.
  • 400 m ⁇ W5 solution and 400 m ⁇ Plant Induction Medium (PIM) without sucrose is added into a protoplast pellet.
  • Centrifugation is carried out at 100 g for 1 min in a large top table centrifuge and the supernatant is discarded. 500 m ⁇ PIM (with sucrose) is added into a protoplast pellet and the pellet is re-suspended.
  • Protoplasts are mixed with low-melting point gel PIM.
  • 2.4% low- melting gel PIM is useful for mixing with protoplasts.
  • Protoplasts are transferred in 500 m ⁇ PIM (with sucrose) into a 6 well plate (3.5 cm diameter) with a 1,000 m ⁇ wide bore tip. 500 m ⁇ PIM (with sucrose) containing 2.4 % low melting gel is added.
  • the mixture, PIM, and low melting gel are plated using the Bergmann’s cell plating technique. For long-term culture the PIM solution is changed every week.
  • GFP -labeled endonucleases e.g., Cas9-GFP or Cpfl-GFP
  • fluorescence microscopy e.g., fluorescence microscopy.
  • Some steps may employ fresh plant material every time primary cells are used to transfect. Thus, plants may need to be consistently maintained.
  • fresh chemicals are used for PEG and MES to ensure optimal activity.
  • Third, reducing wash steps will help prevent osmotic stress to cells. Cells can be damaged whenever buffers are changed, because each step may use different salt buffers.
  • sterile conditions are maintained during plant regeneration. DNA-free genome editing does not use antibiotic reagents to select edited plants, and thus sterile conditions are used including clean bench, forceps, cell strainer, tips, agar-media, and RNPs (which can be contaminated with bacteria).
  • the present disclosure provides exemplary methods of protoplast preparation, RNP transfection and washing.
  • centrifugation is carried out without a sucrose gradient, reducing the centrifugation process to a single step and resulting in harvesting a higher number of protoplasts.
  • RNP transfection methods disclosed herein includes coating the RNP with Plus reagent and
  • Methods for plant regeneration disclosed herein and compositions useful in methods for plant regeneration disclosed herein allow advantages in DNA-free genome engineering. For example, by use of the compositions disclosed herein or otherwise and with the practice of the methods disclosed above, one accomplishes transfection enhancement. Moreover, the methods for plant regeneration disclosed herein and compositions for use in plant regeneration disclosed herein allow for generation of a plant homozygous for an allele of interest in a single generation.
  • kits comprising the compositions disclosed herein.
  • kits disclosed herein include a ribonucleoprotein complex including the CRISPR PLUS reagents (e.g., Cas9, exonucleases, and sgRNAs), cationic lipoids (e.g., lipofectamine), and/or hydrophilic polymers (e.g., PEG).
  • CRISPR PLUS reagents e.g., Cas9, exonucleases, and sgRNAs
  • cationic lipoids e.g., lipofectamine
  • hydrophilic polymers e.g., PEG
  • kits that includes a plurality of compositions disclosed herein comprises at least a first composition and a second composition.
  • a representative kit disclosed herein includes a first composition comprising lipofectamine and a second composition comprising polyethylene glycol (PEG).
  • PEG polyethylene glycol
  • At least one composition of a kit for use in methods for DNA-free genome engineering described herein can be loaded into a syringe or a needle.
  • kits consistent with methods for DNA-free genome engineering include a first composition described herein and a second composition described herein loaded into a syringe.
  • Kits consistent with methods for DNA-free genome engineering include a first composition described herein and a second composition described herein loaded into a needle.
  • Kits comprising at least one composition disclosed herein can be used for delivering a ribonucleoprotein complex into a plant cell.
  • kits disclosed herein can be used in a method of delivering a ribonucleoprotein complex into a plant cell in accordance with methods disclosed herein.
  • FIG. 1 shows at top the sequence of a cloning site of SpCas9.
  • the sequence is annotated to show the Bsal enzyme cut sites, which are in the middle of the T7 promoter. Also shown above the sequence is the cut site for Hindlll.
  • Below the sequence at top are a series of annotations including, from left to right, Ml 3 fwd, T7 promoter, gRNA scaffold, Ml 3 rev, lac operator, and lac promoter. Shown at the bottom is a sequence of a cloning site in FnCpfl.
  • the sequence is annotated above to show the Bsal enzyme cut sites, of which, the first cut site is towards the end of the gRNA scaffold of Cpfl .
  • Also shown above the sequence are the cut sites for EcoRI and Hindlll.
  • Below the sequence at bottom are a series of annotations including, from left to right, Ml 3 fwd, T7 promoter, and gRNA scaffold of Cpfl.
  • FIG. 2 illustrates lettuce protoplasts. Shown at the top left is a bright field image of protoplasts after GFP-SpyCas9 protein transfection without lipofectamine 3000 and plus reagent. Shown at the bottom left is a fluorescence image of protoplasts after GFP-SpyCas9 protein transfection without lipofectamine 3000 and plus reagent. Shown at the top right is a bright field image of protoplasts after GFP-SpyCas9 protein transfection with lipofectamine 3000 and plus reagent. Shown at the bottom right is a fluorescence image of protoplasts after GFP-SpyCas9 protein transfection with lipofectamine 3000 and plus reagent.
  • FIG. 3 illustrates lettuce protoplast propagation in time-course. Shown at the top left and top right are five-day-old protoplasts. The protoplasts doubled by five days following RNP tranfection. Shown at the middle left and middle right are seven-day-old protoplasts, which showed colonies. Shown at bottom left are calli formed from protoplasts shown at middle left. Shown at bottom right are calli formed from protoplasts shown at middle right. Shown within each figure is a scale bar indicating the size of 100 pm. [00126] FIG. 4 shows a schematic from from the website
  • FIG. 5 illustrates a modified figure from Leroux et al. (2014) Am J Bot 101 : 1259 - 1274, showing the developing the embryo of maize, wherein a CRIPSR/Cas9+ sgRNA RNP complex of the present disclosure, targeting any of a number of genes of interest, is injected into the pollen nucleus.
  • the CRIPSR/Cas9+ sgRNA RNP complex of the present disclosure is illustrated as a needle labeled“CRISPR PLUS.”
  • CRISPR PLUS a needle labeled“CRISPR PLUS.”
  • FIG. 1 A legend at the bottom right shows from left to right, aleurone, ESR, BETL, se, CZ, BIZ, and subaleuorne, corresponding to the shading in the differentiation segment of the schematic.
  • FIG. 6 illustrates a modified figure from Bortiri and Hake (2007) J Exp Bot 58(5): 909 - 916 showing injection of CRIPSR/Cas9 sgRNA RNP complexes of the present disclosure, targeting a gene of interest, into the pollen nuclei.
  • the CRIPSR/Cas9+ sgRNA RNP complexes of the present disclosure are illustrated as needles labeled“CRISPR PLUS.”
  • the figure indicates that what is injected is CRISPR/Cas9+sgRNA RNP complex targeting any of a number of genes of interest and that the injection is in the pollen nuclei.
  • FIG. 7 illustrates a modified figure from Nannas and Dawe (2015) GENETICS 199(3): 655 - 669 showing injection of CRIPSR/Cas9 sgRNA RNP complexes of the present disclosure.
  • the CRIPSR/Cas9+ sgRNA RNP complex of the present disclosure is illustrated as a needle labeled“CRISPR PLUS.” Shown in the schematic is the pollen tube and sperm depicted as circles.
  • the dotted arrow shows the path of the sperm to the egg cell and polar nuclei.
  • An arrow indicates an inner barrier, which indicates the central cell, and an outer barrier, which indicates the embryo sac.
  • FIG. 1 illustrates a modified figure from Nannas and Dawe (2015) GENETICS 199(3): 655 - 669 showing injection of CRIPSR/Cas9 sgRNA RNP complexes of the present disclosure.
  • the CRIPSR/Cas9+ sgRNA RNP complex of the present disclosure is illustrated as a needle
  • Ribonucleoprotein complexes disclosed herein are also referred to as“riboprotein” complexes. Shown on the x-axis are the different groups tested, which from left to right are Cas9_GFP, Cas9_GFP+lipofectamine 3000, Cas9_GFP+PEG 4000, and Cas9_GFP+PEG 4000+lipofectamine 3000. The y-axis shows % transfection efficiency ranging from 0 to 60 in increments of 10.
  • FIG. 9 shows bright field images of lettuce protoplasts on the top row and confocal laser scanning images on the bottom row.
  • the left four images show transfection without PEG 4000, designated as“- PEG 4000” and the right four images show transfection with PEG 4000, designated as“+ PEG 4000”.
  • Each column shows from left to right, the following groups:
  • Cas9_GFP Cas9_GFP + lipofectamine 3000, Cas9_GFP, and Cas9_GFP + lipofectamine 3000.
  • FIG. 10 shows a bar graph titled“The transfection efficiency of CRISPR/Cas9 preassembled riboprotein in rice protoplasts. Shown on the x-axis are the different groups tested, which from left to right are Cas9-GFP, Cas9-GFP + Lipofectamine 3000, Cas9-GFP + PEG 4000, and Cas9-GFP + PEG 4000 + lipofectamine 3000. The y-axis shows transfection efficiency (%), ranging from 0 to 70 in increments of 10.
  • FIG. 11 shows a gel and a table titled“The genome editing efficiency of
  • Column 2 is lipofectamine-, GFP-SpCas9-, SpCas9+, gRNAOsdwrf5_l+, and gRNAOsdwrf5_2-.
  • Column 3 is lipofectamine-, GFP-SpCas9+, SpCas9-, gRNAOsdwrf5_l+, and gRNAOsdwrf5_2+.
  • Column 4 is lipofectamine+, GFP-SpCas9+, SpCas9-, gRNAOsdwrf5_l+, and gRNAOsdwrf5_2+.
  • Column 5 is lipofectamine+, GFP-SpCas9-, SpCas9+, gRNAOsdwrf5_l-, and gRNAOsdwrf5_2+. Shown immediately above the gel are conditions of an in vitro cleavage assay with Cas9 and target sgRNA, Osdwarf5_2.
  • Column 1 is SpCas9-, gRNAOsdwrf5_2-, and dsDNA+.
  • Column 2 is SpCas9+, gRNAOsdwrf5_2+, and dsDNA+.
  • Column 3 is SpCas9+, gRNAOsdwrf5_2+, and dsDNA+.
  • Column 4 is SpCas9+, gRNAOsdwrf5_2+, and dsDNA+.
  • Column 5 is SpCas9+, gRNAOsdwrf5_2+, and dsDNA+.
  • the gel from left to right shows“+RGEN” and illustrates a DNA ladder in the left most lane. Each lane from left to right is consistent with the conditions of transfection into rice protoplasts, as described above.
  • Editing efficiency (%) is shown below each lane and are, from Lane 3 to Lane 6: 1, 1, 10, and 72.
  • ETncut (700 bp) DNA bands are indicated at the right.
  • Cut DNA bands (450 bp) are indicated at the right.
  • Cut DNA bands (250 bp) are indicated at the right. Shown in the table at the bottom of the figure is the component in the in vitro cleavage assay in the left column and the amount in the right column.
  • Shown in the right column are, from top to bottom, 750 ng, 750 ng, 1 pg, and lhr 30 min.
  • each of these numbered embodiments is contemplated as depending from or relating to every previous or subsequent numbered embodiment, independent of their order as listed.
  • Some methods enumerated herein include up to and all of the following elements a, b, and c. The methods may further include additional elements. 1.
  • a method of engineering a trait of interest in a plant cell comprising: a) providing a pre-assembled ribonucleoprotein complex comprising a guide nucleic acid sequence and a programmable endonuclease, wherein the guide nucleic acid sequence and the programmable endonuclease are complexed to a transfection enhancement agent; b) providing at least one plant cell; and c) physically introducing the pre-assembled ribonucleoprotein complex intracellularly into the at least one plant cell.
  • the method comprises screening for at least one plant cell comprising the trait of interest.
  • the method comprises isolating the at least one plant cell comprising the trait of interest. 4.
  • the guide nucleic acid sequence is selected from the group consisting of a single-guide RNA (sgRNA), a CRISPR RNA, and a trans- activating RNA (tracrRNA).
  • sgRNA single-guide RNA
  • CRISPR RNA CRISPR RNA
  • tracrRNA trans- activating RNA
  • the physically introducing the pre-assembled ribonucleoprotein complex intracellularly into the at least one plant cell comprises injecting the ribonucleoprotein complex mixture directly into an embryo sac.
  • the plant cell is selected from the group consisting of a gametophyte, a reproductive cell, a vegetative cell, and a meristematic cell.
  • the transfection enhancement agent comprises at least one constituent selected from a lipid and a hydrophilic polymer.
  • the method of embodiment 7, wherein the lipid is lipofectamine. 9. The method of embodiment 8, wherein the lipofectamine is lipofectamine 2000. 10. The method of embodiment 8, wherein the lipofectamine is lipofectamine 3000. 11. The method of embodiment 7, wherein the hydrophilic polymer is 2,000 dalton to 5,000 dalton. 12. The method of embodiment 7, wherein the hydrophilic polymer is PEG. 13. The method of embodiment 12, wherein the PEG comprises an about 40% PEG solution. 14. The method of embodiment 13, wherein the about 40% PEG solution comprises at least one constituent selected from a sugar, a salt, and PEG. 4000. 15. The method of embodiment 14, wherein the mannitol comprises about 0.8 M mannitol. 16.
  • the method of embodiment 14, wherein the salt comprises about 1 M CaCl2. 17.
  • the method of embodiment 1, wherein the at least one plant cell comprises at least one protoplast. 18.
  • the pre-assembled ribonucleoprotein further comprises an exonuclease.
  • the physically introducing the pre- assembled ribonucleoprotein complex intracellularly into the at least one plant cell comprises injecting the ribonucleoprotein complex mixture directly into a pollen nucleus.
  • programmable endonuclease is a protein recognizable by a person of skill in the art as retaining some or all of the common activity or having sufficient sequence identity as a protein listed above. 23. The method of embodiment 1, wherein the programmable endonuclease comprises a region exhibiting at least 70% identity over at least 70% of its residues to a domain selected from the group consisting of a Cas9 domain and a Cpf 1 domain. 24. The method of embodiment 1, wherein he programmable endonuclease comprises a region exhibiting at least 70% identity over at least 70% of its residues to a Cpfl domain. 25.
  • the method of embodiment 23, wherein the Cas9 is selected from the group consisting of SpCas9, SaCas9, StCas9, NmCas9, FnCas9, and CjCas9. 26.
  • the method embodiment 1, wherein the injecting comprises injecting using a needle operably attached to a syringe pump.
  • 28. The method of embodiment 17, wherein the at least one protoplast is centrifuged.
  • the method of embodiment 28, wherein the centrifugation is carried out without a sucrose gradient.
  • 30. The method of embodiment 29, the method further comprising centrifuging and removing the supernatant. 31.
  • 35. The method of embodiment 1, wherein the transfection enhancement agent increases transfection of the ribonucleoprotein complex by at least 1.1 to 100 fold.
  • 36. The method of embodiment 1, wherein the transfection enhancement agent increases the efficiency of genome editing the trait of interest by at least 1.1 to 100 fold.
  • 37. The method of embodiment 1, wherein the transfection enhancement agent increases delivery of the ribonucleoprotein complex at least 2 fold.
  • 38. The method of embodiment 1, wherein the programmable endonuclease is derived from
  • Streptococcus pyogenes S. pyogenes
  • Streptococcus thermophilus Streptococcus sp.
  • Streptosporangium roseum Alicyclobacillus acidocaldarius, Bacillus pseudomycoides, Bacillus selenitireducens, Exiguobacterium sibiricum, Lactobacillus delbrueckii, Lactobacillus salivarius, Microscilla marina, Burkholderiales bacterium, Polaromonas naphthalenivorans, Polaromonas sp., Crocosphaera watsonii, Cyanothece sp., Microcystis aeruginosa, Pseudomonas aeruginosa,
  • Oscillatoria sp. Petrotoga mobilis, Thermosipho africanus, Acaryochloris marina, Leptotrichia shahii, Prevotella, or Francisella novicida.
  • the at least one plant cell is selected from the group consisting of a monocot and a dicot.
  • the monocot is selected from the group consisting of maize, rice, sorghum, rye, barley, wheat, millet, oats, sugarcane, turfgrass, and switchgrass.
  • the method of embodiment 39, wherein the dicot is selected from the group consisting of soybean, canola, alfalfa, sunflower, cotton, tobacco, peanut, potato, tobacco, Arabidopsis, lettuce and safflower. 43.
  • the method of embodiment 39, wherein the dicot is lettuce.
  • Some methods enumerated herein include up to and including all of the following elements a, b, and c. The methods may further include additional elements. 44.
  • a method of engineering a plant homozygous for an allele of interest in a single generation comprising: a) providing a ribonucleotide protein complex mixture comprising a guide nucleic acid sequence and a programmable endonuclease, wherein the ribonucleotide protein is complexed with a transfection enhancement agent; b) injecting the ribonucleoprotein complex mixture directly into an embryo sac and a pollen nuclei; c) screening for one or more plant cells comprising the trait of interest; and d) isolating the one or more plant cells comprising the trait of interest.
  • the method comprises screening for one or more plant cells comprising the trait of interest. 46.
  • the method of embodiment 44 wherein the method comprises isolating the one or more plant cells comprising the trait of interest.
  • the physically introducing the pre-assembled ribonucleoprotein complex intracellularly into the at least one plant cell comprises injecting the ribonucleoprotein complex mixture directly into an embryo sac.
  • the plant cell is a gametophyte, a reproductive cell, a vegetative cell, or a meristematic cell.
  • the transfection enhancement agent comprises at least one constituent selected from a lipid and a hydrophilic polymer.
  • the lipid is lipofectamine. 51.
  • the method of embodiment 50 wherein the lipofectamine is lipofectamine 2000. 52. The method of embodiment 50, wherein the lipofectamine is lipofectamine 3000. 43. The method of embodiment 49, wherein the hydrophilic polymer is PEG. 54. The method of embodiment 53, wherein the PEG comprises an about 40% PEG solution. 55. The method of embodiment 54, wherein the about 40% PEG solution comprises at least one constituent selected from a sugar, a salt, and PEG. 4000. 56. The method of embodiment 55, wherein the sugar comprises about 0.8 M mannitol. 57. The method of embodiment 55, wherein the salt comprises about 1 M CaCl2. 58. The method of embodiment 44, wherein the at least one plant cell comprises at least one protoplast. 59. The method of embodiment 44 wherein the physically introducing the pre-assembled
  • ribonucleoprotein complex intracellularly into the at least one plant cell comprises injecting the ribonucleoprotein complex mixture directly into a pollen nucleus.
  • lipofectamine is incubated with the guide RNA and the programmable endonuclease in a buffer for at least 10 min addition of PEG.
  • the method comprises adding PEG and incubating for at least 10 min. 62.
  • programmable endonuclease is selected from Cas9, Cpfl, c2cl, C2c2, Casl3, c2c3, Casl, CaslB, Cas2, Cas3, Cas4, Cas5, Cas5e (CasD), Cas6, Cas6e, Cas6f, Cas7, Cas8, Cas8a, Cas8al, Cas8a2, Cas8b, Cas8c, Csnl, Csxl2, Cas9, CaslO, CaslOd, Casl2a, casl2b, casl2c, casl2d, casl2e, casl3a, casl3b, casl3c, casl3d, CaslO, CaslOd, CasF, CasG, CasH, Csyl, Csy2, Csy3, Csel, Csel (CasA), Cse2 (CasB
  • the programmable endonuclease comprises a region exhibiting at least 70% identity over at least 70% of its residues to a Cas9 domain or a Cpf 1 domain.
  • he programmable endonuclease comprises a region exhibiting at least 70% identity over at least 70% of its residues to a Cpfl domain.
  • the Cas9 is SpCas9, SaCas9, StCas9, NmCas9, FnCas9, or CjCas9.
  • the method of embodiment 64 wherein the region is a Casl2a (Cpfl), Casl2b, or Casl2c domain.
  • the injecting comprises injecting using a needle operably attached to a syringe pump.
  • the method of embodiment 58 wherein the at least one protoplast is centrifuged.
  • the method of embodiment 68 wherein the centrifugation is carried out without a sucrose gradient.
  • 70 The method of embodiment 69, the method comprising centrifuging and removing the supernatant.
  • the method comprises sequentially adding PIM solution without sucrose. 72.
  • the programmable endonuclease is derived from Streptococcus pyogenes (S. pyogenes), Streptococcus thermophilus, Streptococcus sp.,
  • Streptosporangium roseum Alicyclobacillus acidocaldarius, Bacillus pseudomycoides, Bacillus selenitireducens, Exiguobacterium sibiricum, Lactobacillus delbrueckii, Lactobacillus salivarius, Microscilla marina, Burkholderiales bacterium, Polaromonas naphthalenivorans, Polaromonas sp., Crocosphaera watsonii, Cyanothece sp., Microcystis aeruginosa, Pseudomonas aeruginosa,
  • the monocot comprises maize, rice, sorghum, rye, barley, wheat, millet, oats, sugarcane, turfgrass, or switchgrass.
  • the method of embodiment 79, wherein the monocot is rice. 82.
  • the dicot comprises soybean, canola, alfalfa, sunflower, cotton, tobacco, peanut, potato, tobacco, Arabidopsis, lettuce or safflower.
  • the dicot is lettuce.
  • a kit for delivering a ribonucleoprotein complex into a plant cell comprising a first composition and a second composition.
  • the first composition is lipofectamine and the second composition is polyethylene glycol.
  • This example describes methods for endonuclease purification, wherein the endonuclease is SpCas9.
  • Plasmid vectors, pET28a-& pyogenes Cas9 (SpCas9) and pET28a- Francisella novicida Cpfl (FnCpfl) were transformed into the E. coli strain BL21 DE3.
  • the expressible fusion protein vector contained an N-terminal His 6-tag and the SpCas9 sequence spanning residues 1-1368.
  • BL21 Competent Cells pET28a-SpCas9-BPNLS or pET28a-FnCpfl-BPNLS were transformed chemically into competent BL21 RosettaTM2 (DE3) pLysS (Novagen, Madison, WI) cells (Agilent, Santa Clara, CA). 10 ng of plasmid DNA was added to 50 pl of freshly thawed competent cells and incubated on ice for 30 min. Cells were heat shocked by incubation at 42 °C for 1 min, and 600 m ⁇ of SOC medium was added to the cells and incubate the culture at 37 °C for 1 h in a shaking incubator. 50 m ⁇ of culture was plated out on LB agar containing 50 pg/ml kanamycin. The plate was incubated overnight at 37 °C. Day 2
  • [00138] Cell Culture Three 25-ml seed cultures were grown with a serial dilution (original, I,OOO c , 100,000 dilutions) in baffled flasks overnight. One colony was picked from the agar plate to inoculate 25 ml LB medium containing 50 pg/ml kanamycin (Original). 25 pl was transferred into a new 25 ml LB medium containing 50 pg/ml kanamycin (1,000 dilution). 250 pl was transferred into a new 25 ml LB medium containing 50 pg ml/l kanamycin (100,000 dilution). The preculture was incubated at 30 °C or 37 °C in a shaking incubator (250 rpm) overnight.
  • Cell Resuspension Cells were harvested by centrifugation at 4,000 rpm for 30 min in a swing-bucket rotor in 500 ml bottles. The supernatant was decanted and the cell pellets were resuspended using 25 ml ice-chilled lysis buffer (20 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 5 mM Imidazole, 1 mM l,4-dithiothreitol (DTT), and 1 mM phenylmethylsulfonyl fluoride (PMSF) per cell pellet from a 1 1 culture. The resuspended cell pellets can either be used directly for further purification or flash frozen in liquid nitrogen and stored at -80 °C until SpCas9 or FnCpfl purification process.
  • Tris-HCl pH 8.0
  • Imidazole 1 mM l,4-dithiothreitol
  • PMSF phenylmethyl
  • Binding and Elution Buffers 1 1 of the binding buffer (20 mM Tris- HCl (pH 8.0), 0.5 M NaCl, 5 mM Imidazole, and 1 mM DTT) and 1 1 of the elution buffer (20 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 500 mM Imidazole, and lmM DTT) was prepared. Purification was carried out by Histrap-HP Affinity Column. All chromatographic steps are better performed at
  • His Protein Purification by HisTrap-HP affinity column was carried out as follows. A 50 ml syringe was connected to Histrap-HP column. The Histrap-HP column was washed with 10 column volumes of distilled water. A new 50 ml syringe was connected to Histrap- HP column. The Histrap-HP column was equilibrated with 10 column volumes of binding buffer. A syringe piston was pressed to adjust the flow rate as well as FPLC flow speed (5 ml/min). A new 50 ml syringe was connected to Histrap-HP column. 10 ml of the filtrate was loaded into the 50 ml syringe.
  • a syringe piston was pressed to adjust the flow rate as well as FPLC flow speed (5 ml/min). The flow-through was harvested to observe His-protein loss.
  • a new 50 ml syringe was connected to Histrap-HP column. The column was washed with 10 column volumes of binding buffer.
  • a new 50 ml syringe was connected to Histrap-HP column. 5 column volumes of elution buffer were added and every 5 ml eluate was fractionated.
  • a new 50 ml syringe was connected to Histrap-HP column. The column was washed with 10 column volumes of binding buffer.
  • SpCas9 can be programmed with chimeric sgRNAs, which combine the essential parts of the crRNA and tracrRNA molecules in a single oligonucleotide chain.
  • the resulting sgRNA contains a 20-mer target specific sequence with the T7 polymerase binding site to its upstream and the Cas9 protein binding region to its downstream.
  • Designing gene specific targeting sequences was done using a web tool CHOPCHOP (http://chopchop.cbu.uib.no).
  • sgRNAs were designed to target within a coding region without any mismatches, and the sequences were preferably bearing GG at the 5’ -end.
  • the crRNA guide was composed of a 5 '-terminal 20-nt spacer sequence, followed by an invariant 76-nt guide RNA scaffold at the 3' end (5 -XXXXXXXXXXXXXXXXXXX-
  • the 60-mer and 80-mer oligonucleotides were annealed together using a thermocycler and a complete dsDNA was synthesized using T4 DNA polymerases and the annealed dimerized oligonucleotides as the template.
  • a jTAGGTGAGACCGCAGGTCTCGjGTTTT placed between T7 promoter and guide RNA scaffold by two Bsal type IIS restriction enzyme using the golden gate cloning method (Fig. la).
  • a forward single oligonucleotide embodied a 5'-TAGG-3' overhang in front of the target 20 nt, while a reverse single oligonucleotide was initiated with 5 '-C AAA-3' in front of the reverse target 20 nt.
  • Both one picomole of forward and reverse single oligonucleotides were mixed in 45 m ⁇ distilled water, which was transferred into 0.2 ml PCR tube, and annealed at 95 °C for 5 min and 55 °C for 10 min by a thermocycler. Annealed oligonucleotides were placed on ice. As a result, the dimerized oligonucleotides were employed to clone into a linear plasmid with two flanking sequences, 5'- CCTA-3' and 5'-GTTT-3'. The completed construct was used to synthesize sgRNAs as templates.
  • Both one picomole of forward and reverse single oligonucleotides were mixed in 45 m ⁇ distilled water, which was transferred into 0.2 ml PCR tube, and annealed at 95 °C for 5 min and 55 °C for 10 min by a thermocycler, then place annealed double stranded oligonucleotides (dsODN) on ice.
  • dsODN double stranded oligonucleotides
  • the dimerized oligonucleotides were employed to clone into a linear plasmid with two flanking sequences, 5'- ATCT-3' and 5'-TTTT-3'.
  • the completed construct was used to synthesize sgRNAs as templates.
  • Transcription templates for sgRNA synthesis can be PCR amplified from plasmid or synthetic oligonucleotide templates with appropriate PCR primers (a forward primer is 5'- AATTCTAATACGACTCACTATAGG-3', which has an additional five AATTC nt in front of T7 promoter sequence and a reverse primer from the end of sgRNA scaffold is 5'- GCACCGACTCGGTGCCACTT-3').
  • the high amount of dsDNA template was obtained by PCR performance.
  • Q5® polymerase was used to amplify transcription templates.
  • PCR products can be subjected to DNA electrophoresis to estimate concentration and to confirm amplicon. The size prior to its use as a template in the T7 RNA transcription synthesis was determined.
  • the PCR mixture may be used directly if diluted at least 10X in the transcription reaction. However, better yields may be obtained with purified PCR products.
  • PCR products were purified according to the protocol for commercial clean-up kit
  • sgRNA transcription by T7 RNA polymerase Generally, 1.4 mM (1 pg of a 120 bp PCR product or annealed dsODN) can be used in a 20 m ⁇ in vitro transcription reaction.
  • Incubation can be run in a thermocycler to prevent evaporation of the sample.
  • DNase treatment was carried out to remove DNA template.
  • 20 pl nuclease-free water was added to each 20 m ⁇ reaction, followed by 2 m ⁇ of DNase I (RNase-free). Samples were mixed and incubated for 15 minutes at 37°C.
  • Centrifugation was carried out at 12,000 rpm for one min. The flow-through was discarded. Once again, 500 m ⁇ of washing solution was added. Centrifugation was carried out at 12,000 rpm for one min (totally washing twice). The flow-through was discarded.
  • the spin-column/2 ml tubes were centrifuged at 12000 rpm for one min. The spin-column only was transferred into a new 1.5 ml tube. 50 m ⁇ of water was added into the spin-column/ 1.5 ml tube each. The spin-column/ 1.5 ml tubes were placed on the heat-block at 70 °C for 10 min.
  • the spin-column/ 1.5 ml tubes were centrifuged at 12,000 rpm for one min. 50 m ⁇ of water was added into each of the spin- column/l.5 mL tube. The flow-through was measured the concentration of sgRNA.
  • transcript products were also cleaned- up through ethanol precipitation.
  • the ethanol precipitation is not only available to concentrate sgRNAs but also applying to small size RNA less than 100 nt.
  • FnCpfl crRNA size was 66 nt much smaller than 100 nt, which was the minimum size for use of the MEGAclean-up kit.
  • 1/10 volume 3M sodium acetate of PCR products was added to PCR products, and samples were inverted and mixed gently. Ice-chilled 100% ethanol was added to each sample tube. The sample tubes were incubated in -20 °C for 30 min.
  • RNA pellets were dissolved in 50 m ⁇ RNase-free water. RNA concentration can be determined by measuring the ultraviolet light absorbance at 260 nm.
  • Healthy plants were prepared by sterilizing seeds with 2% sodium hypochlorite (e.g., Clorox bleach) for 10 min. The bleached seeds were washed 5 times with sterile dH20 and the sterile seed were planted in 1/2 MS media. Lettuce leaves were harvested 5 days after germination. For rice seeds and for maize seeds, the leaves were harvested after 7 days.
  • sodium hypochlorite e.g., Clorox bleach
  • the solution was incubated at 55 °C for 10 min and 10 mM CaCl 2 and 0.1% BSA was added.
  • the enzyme solution was filtered through a 0.45 pm syringe filter.
  • Leaves were sliced with a sterilized knife or razor as follows. 10-15 leaves were detached from plants without damage of plants. Two or three leaves were piled on a droplet of sterile water and the piled leaves were sliced together. Sliced leaves were placed into the enzyme solution as follows. 20 mL of the enzyme solution was poured into a 90 mm plate and fifteen sliced leaves were transferred into the plate. The plates were covered with foil and placed on a gyratory shaker at 50 rev. /min. A stir bar may be used if a gyratory shaker is unavailable. The plate was incubated for four to five hours.
  • This example describes RNP transfer into protoplasts.
  • a ribonucleoprotein complex mixture composed of 5 pg of gRNA, 10 pg Cas9 protein (or mRNA), 2 pl plus reagent, 2 pl lipofectamine 3000, and 2 pl of 10X NEB 3.1 buffer was added into a 1.5 ml tube.
  • DH 2 0 was added up to a final volume of 20 pl in a 1.5 ml tube (FIG. 2C-D), as shown in Table 5.
  • the RNP complex mixture was incubated for 10 min and 200 pl of a 2 x 10 5 protoplasts/ml protoplast solution (i.e., as generated in Example 3) was aliquoted with a 1,000 pl wide bore tip.
  • the RNP mixture was added into the 200 pl protoplast solution and mixed gently. 220 pl of 40% PEG solution was added into the RNP-protoplast solution, as shown in Table 6. The RNP-protoplast mixture was incubated in the PEG solution for 10 min and the RNP-protoplast mixture was incubated for 10 min at room temperature. 800 pl of W5 solution was added and the sample was gently inverted 4-5 times. Samples were centrifuged at 100 x g for 1 min in a large table top centrifuge. The supernatant was discarded. 400 pl of W5 solution and 400 pl of Plant Induction Medium (PIM) without sucrose were added into the protoplast pellet.
  • PIM Plant Induction Medium
  • This example describes mixing protoplasts with PIM.
  • Protoplasts in 500 pl PIM (with sucrose) were transferred into a 6-well plate (3.5 cm diameter) with a 1,000 m ⁇ wide bore tip.
  • 500 m ⁇ PIM (with sucrose) was added containing 2.4% low melting gel.
  • the mixture, PIM, and low melting gel were plated using Bergmann’s cell plating techniques.
  • the sealed 6-well plate was placed in a dark room at 25 °C for 48 hours. For longer term culture, the PIM solution is changed every week.
  • GFP-labeled endonuclease was detected by fluorescence microscopy. The number of expressing cells was measured (see, FIGs. 8-10). Cells treated with lipofectamine and PEG showed a ribonucleoprotein transmission efficiency increase of more than 1.5 times as compared with control groups treated with PEG alone.
  • This example describes genome engineering monocots with RNP/PLUS Reagent- Mediated Delivery of CRISPR/Cas Reagents.
  • a guide RNA is designed against a target gene region of interest in a monocot.
  • the monocot is a maize, rice, sorghum, rye, barley, wheat, millet, oats, sugarcane, turfgrass, or switchgrass.
  • a ribonucleoprotein complex mixture is injected directly into an embryo sac and/or a pollen nucleus.
  • the ribonucleoprotein (RNP) complex mixture includes the gRNA against the target region of interest and a programmable endonuclease, such as Cas9 or a Casl2 endonuclease (i.e., Cpfl).
  • the gRNA and programmable endonuclease are coated in PLUS reagent, lipofectamine 3000, and 40% PEG to enhance transfection.
  • the monocot cultures are grown and the culture is screened for one or more plant cell having a trait of interest, which was developed by targeting the gene region of interest.
  • the plant cells comprising the trait of interest are isolated and used to grow a crop with the genetically engineered trait.
  • a guide RNA is designed against a target gene region of interest in a dicot.
  • the dicot is a soybean, canola, alfalfa, sunflower, cotton, tobacco, peanut, potato, tobacco, Arabidopsis , lettuce, or safflower.
  • a ribonucleoprotein (RNP) complex mixture is injected directly into an embryo sac and/or a pollen nucleus.
  • the ribonucleoprotein complex mixture includes the gRNA against the target region of interest and a programmable endonuclease, such as Cas9 or Cpf 1.
  • the gRNA and programmable endonuclease are coated in PLUS reagent, lipofectamine 3000, and 40% PEG to enhance transfection.
  • the dicot cultures are grown and the culture is screened for one or more plant cell having a trait of interest, which was developed by targeting the gene region of interest.
  • the plant cells comprising the trait of interest are isolated and used to grow a crop with the genetically engineered trait.
  • This example describes genome engineering Arabidopsis with RNP/PLUS reagent- mediated delivery of CRISPR/Cas reagents.
  • a guide RNA is designed against a target gene region of interest in Arabidopsis.
  • a ribonucleoprotein (RNP) complex mixture is injected directly into the embryo sac.
  • the ribonucleoprotein complex mixture includes the gRNA against the target region of interest and a programmable endonuclease, such as Cas9 or Cpf 1.
  • the gRNA and programmable endonuclease are coated in PLUS reagent, lipofectamine 3000, and 40% PEG to enhance transfection.
  • the cultures are grown and the culture is screened for one or more Arabidopsis cell having a trait of interest, which was developed by targeting the gene region of interest.
  • the Arabidopsis cells comprising the trait of interest are isolated and used to grow a crop with the genetically engineered trait.
  • This example describes knocking out a target gene region with RNP/PLUS reagent- mediated delivery of CRISPR/Cas reagents.
  • the gene region targeted for knock out confers a health benefit, such as increased accumulation of nutrients beneficial for growth in kernels.
  • a guide RNA is designed against a target gene region of interest in the plant.
  • a ribonucleoprotein (RNP) complex mixture is injected directly into the embryo sac and/or pollen nucleus.
  • the ribonucleoprotein complex mixture includes the gRNA against the target region of interest and a programmable endonuclease, such as Cas9 or Cpf 1.
  • the gRNA and programmable endonuclease are coated in PLUS reagent, lipofectamine 3000, and 40% PEG to enhance transfection.
  • the cultures are grown and the culture is screened for one or more cell knocked out in the target gene region.
  • the knockout cells are isolated and used to grow a crop with the health benefit.
  • This example illustrates genome engineering lettuce and rice with RNP/PLUS reagent-mediated delivery of CRISPR/Cas reagents.
  • Plant growth condition and protoplast transfection Plants were grown under a 150 E m -2 s _1 LED light under long-day conditions (l4-h light/lO-h dark photoperiod) at 25°C. Rice seeds were sterilized in 20% hypochlorite solution for 40 min and then placed on 1 ⁇ 2 MS media. One-week-old leaves were used in this study. Lettuce seeds were sterilized in a 20% hypochlorite solution for 1 min, washed three times in distilled water, and sown on 1 ⁇ 2 MS media with 3% sucrose.
  • the 1 -week-old leaves grown in 1/2 media were digested with enzymes (1.5% cellulose R10, 0.3% macerozyme R10, 0.5 M Mannitol, 8 mM CaCl2, 5 mM MES [pH 5.7], 0.1% BSA) for 4 h at 25 °C in darkness.
  • the mixture was filtered before protoplasts were collected by
  • a mixture of protoplasts was re-suspended in 200 pl of MMG solution and the solution was gently mixed with 10-20 pl of RNP complex and 210-220 pl of freshly prepared PEG (0.2 M mannitol, 40%W/V PEG-4000, 100 mM CaCl 2 ) solution. The samples were then incubated at 25 °C for 10 min. After a 10 min incubation at room temperature, transformation was stopped by adding 840-880 pl W5 solution. Protoplasts were then collected by centrifugation for 2 min at lOOg at room temperature and washed one more time with 0.5 ml of W5 buffer. 0.5 ml of PIM (without sucrose) solution was added by centrifugation for another 2 min at lOOg.
  • the density of protoplasts was adjusted to lxl0 5 /ml and they were cultured in modified PIM (B5 medium 1.58 g, sucrose 103 g, 2,4-D 0.2 mg, BAP 0.3 mg, MES 0.1 g, CaCl 2' 2H 2 0 375 mg, NaFe-EDTA 18.35 mg and Sodium succinate 270 mg) medium.
  • modified PIM B5 medium 1.58 g, sucrose 103 g, 2,4-D 0.2 mg, BAP 0.3 mg, MES 0.1 g, CaCl 2' 2H 2 0 375 mg, NaFe-EDTA 18.35 mg and Sodium succinate 270 mg
  • FIG. 8 illustrates a bar graph showing the transfection efficiency of CRISPR/Cas9 pre-assembled ribonucleoprotein complexes in lettuce protoplasts.
  • FIG. 9 illustrates the morphology of lettuce protoplasts after transfection with traceable GFP -labeled CRISPR/Cas9 (Fig. 9a, Fig. 9b, Fig. 9e, Fig. 9f).
  • GFP-SpyCas9 RNPs were transfected into lettuce protoplasts with PEG4000 (Fig. 9c, Fig. 9d, Fig. 9g, Fig. 9h)
  • GFP-SpyCas9 RNPs were conventionally transfected into lettuce protoplasts with PEG 4000.
  • Microscopic images are shown under bright field (Fig. 9a, Fig. 9b, Fig. 9c, Fig. 9d) and confocal laser scanning (Fig.
  • FIG. 10 illustrates a bar graph showing the transfection efficiency of CRISPR/Cas9 pre-assembled ribonucleoprotein in rice protoplasts.
  • FIG. 11 illustrates gene editing efficiency in rice protoplasts.
  • Each Cas9 variant and guide RNAs against the same loci of rice Dwarf5 were transfected to protoplasts of 1 -week-old rice protoplasts using a transfection enhancement agent (PEG) or a lipid mediated transfection method (lipofectamine). Cells were harvested 48 hour after transfection for genomic DNA extraction.
  • PEG transfection enhancement agent
  • lipofectamine lipofectamine
  • Cells were harvested 48 hour after transfection for genomic DNA extraction.
  • alternative PCR primer pair was used for clearer single whose sizes, which were subjected to an in vitro cleavage assay with a Cas9/sgRNA endonuclease.
  • the sgRNA sequence was TCAACCACCCTGTGAATTT.
  • Primer pairs for PCR are Fl, GGATTGGATTGGTATTGTCGT; Rl, TCACTTTTGATGAACTATGT.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Chemical & Material Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Cell Biology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Medicinal Chemistry (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Agricultural Chemicals And Associated Chemicals (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

L'invention concerne : des compositions d'agents améliorant la transfection, comprenant des réactifs PLUS, de la lipofectamine et/ou des solutions de PEG pour l'administration médiée par ribonucléoprotéine d'endonucléases programmables à des plantes ; et leurs procédés d'utilisation, par exemple l'ingénierie génomique de plantes.
PCT/IB2019/000132 2018-01-30 2019-01-29 Transformation de plante par crispr sans adn WO2019150200A2 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201862624020P 2018-01-30 2018-01-30
US62/624,020 2018-01-30

Publications (2)

Publication Number Publication Date
WO2019150200A2 true WO2019150200A2 (fr) 2019-08-08
WO2019150200A3 WO2019150200A3 (fr) 2019-09-26

Family

ID=67478368

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IB2019/000132 WO2019150200A2 (fr) 2018-01-30 2019-01-29 Transformation de plante par crispr sans adn

Country Status (1)

Country Link
WO (1) WO2019150200A2 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111378684A (zh) * 2020-03-15 2020-07-07 华中农业大学 一种热诱导的基因编辑系统CRISPR-Cas12b在陆地棉中的应用

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20160030187A (ko) * 2013-06-17 2016-03-16 더 브로드 인스티튜트, 인코퍼레이티드 간의 표적화 및 치료를 위한 ＣＲＩＳＰＲ­Ｃａｓ 시스템, 벡터 및 조성물의 전달 및 용도

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111378684A (zh) * 2020-03-15 2020-07-07 华中农业大学 一种热诱导的基因编辑系统CRISPR-Cas12b在陆地棉中的应用
CN111378684B (zh) * 2020-03-15 2023-06-27 华中农业大学 一种热诱导的基因编辑系统CRISPR-Cas12b在陆地棉中的应用

Also Published As

Publication number Publication date
WO2019150200A3 (fr) 2019-09-26

Similar Documents

Publication Publication Date Title
KR20190020035A (ko) 식물 세포에서의 표적된 dna 변경 방법
CN114630910A (zh) 改善的同源依赖修复基因组编辑
US20220098605A1 (en) Genetic regulatory element
US11814632B2 (en) Modified excisable MON87701 soybean transgenic insect resistance locus
US20220364105A1 (en) Inir12 transgenic maize
CA3194195A1 (fr) Element de regulation genetique
WO2018115389A1 (fr) Procédés de modification génétique ciblée dans des cellules végétales
US11326177B2 (en) INIR12 transgenic maize
US11369073B2 (en) INIR12 transgenic maize
US11359210B2 (en) INIR12 transgenic maize
US20220030822A1 (en) Inht26 transgenic soybean
WO2022026848A1 (fr) Soja transgénique inir20
WO2018187347A1 (fr) Compositions et procédés de transfert de traits ou de composants cytoplasmiques ou nucléaires
WO2019150200A2 (fr) Transformation de plante par crispr sans adn

Legal Events

Date Code Title Description
NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 19746838

Country of ref document: EP

Kind code of ref document: A2