WO2018115389A1 - Procédés de modification génétique ciblée dans des cellules végétales - Google Patents

Procédés de modification génétique ciblée dans des cellules végétales Download PDF

Info

Publication number
WO2018115389A1
WO2018115389A1 PCT/EP2017/084291 EP2017084291W WO2018115389A1 WO 2018115389 A1 WO2018115389 A1 WO 2018115389A1 EP 2017084291 W EP2017084291 W EP 2017084291W WO 2018115389 A1 WO2018115389 A1 WO 2018115389A1
Authority
WO
WIPO (PCT)
Prior art keywords
nickase
plant cell
dna
site
plant
Prior art date
Application number
PCT/EP2017/084291
Other languages
English (en)
Inventor
Paul Bundock
Original Assignee
Keygene N.V.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Keygene N.V. filed Critical Keygene N.V.
Publication of WO2018115389A1 publication Critical patent/WO2018115389A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
    • C12N15/8213—Targeted insertion of genes into the plant genome by homologous recombination
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2521/00—Reaction characterised by the enzymatic activity
    • C12Q2521/30—Phosphoric diester hydrolysing, i.e. nuclease
    • C12Q2521/307—Single strand endonuclease

Definitions

  • the process of deliberately creating alterations in the genetic material of living cells generally has the goal of modifying one or more genetically encoded biological properties of that cell, or of the organism of which the cell forms part or into which it can regenerate. These changes can take the form of deletion of parts of the genetic material, addition of exogenous genetic material, or changes in the existing nucleotide sequence of the genetic material.
  • ZFNs zinc finger nucleases
  • TALENs transcription activator-like effector nucleases
  • TALENs are similar to ZFNs and comprise a nonspecific Fokl nuclease domain fused to a customizable DNA-binding domain.
  • This DNA-binding domain is composed of highly conserved repeats derived from transcription activator-like effectors (TALEs), which are proteins secreted by Xanthomonas bacteria to alter transcription of genes in host plant cells.
  • TALEs transcription activator-like effectors
  • A, T, G, C 4 DNA nucleotides
  • CRISPRs Clustered Regularly Interspaced Short Palindromic Repeats
  • CRISPRs are loci containing multiple short direct repeats and are found in 40% of the sequenced bacteria and 90% of sequenced archaea.
  • the CRISPR repeats form a system of acquired bacterial immunity against genetic pathogens such as bacteriophages and plasmids.
  • pathogens such as bacteriophages and plasmids.
  • CRISPR associated proteins Cas
  • the CRISPR loci are then transcribed and processed to form so called crRNA's which include approximately 30 nucleotides of sequence identical to the pathogen genome.
  • crRNA molecules form the basis for the recognition of the pathogen upon a subsequent infection and lead to silencing of the pathogen genetic elements through either a RNAi-like process or direct digestion of the pathogen genome.
  • the CRISPR-Cas systems of bacterial and archaeal adaptive immunity show extreme diversity of protein composition and genomic loci architecture.
  • the CRISPR-Cas system has more than 50 gene families and there is no strictly universal gene indicating fast evolution and extreme diversity of loci architecture.
  • the Cas9 protein is an example of a Cas protein of the type II CRISPR/Cas system and forms an endonuclease, when combined with the crRNA and a second RNA termed the trans-activating crRNA (tracrRNA), which targets the invading pathogen DNA for degradation by the introduction of DNA double strand breaks (DSBs) at the position in the pathogen genome defined by the crRNA.
  • tracrRNA trans-activating crRNA
  • sgRNA single chain chimeric guide RNA
  • CRISPR/Cas9 Clustered Regularly Interspaced Short Palindromic Repeats from Prevotella and Francisella 1 or CRISPR/Cpf1.
  • Cpfl genes are associated with the CRISPR locus and coding for an endonuclease that use a crRNA to target DNA.
  • Cpf 1 is a smaller and simpler endonuclease than Cas9, which may overcome some of the CRISPR/Cas9 system limitations.
  • Cpf1 is a single RNA-guided endonuclease lacking tracrRNA, and it utilizes a T-rich protospacer-adjacent motif.
  • Cpf 1 cleaves DNA via a staggered DNA double-stranded break (Zetsche et al (2015) Cell 163 (3): 759-771 ).
  • the CRISPR/Cas system can be used for genome editing in a wide range of different cell types, using a guide RNA designed to target the Cas protein to a specific target sequence in the genome, thereby introducing a DSB in the genomic target sequence.
  • targeted alteration in plant material is still not always successful or efficient. Indeed, available methodology is often optimized for animal, in particular human, cell material and is not always successful or efficient when applied specifically to plant cells. Thus, there is a need for new methods of providing plant cells wherein a targeted alteration has been introduced with a system and protocol specifically designed for such plant cells. Such methods of targeted alteration of DNA in a plant cell may, preferably, be successfully applied on various plant cells and with a suitable efficiency in comparison to methods known in the art.
  • Figure 1 Sequence of the tomato CENH3 exon 5.
  • the upper sequence shows tomato CENH3 exon 5 (SEQ ID NO: 12) (bold) with the relevant amino acids indicated.
  • the sgRNA target sequence is underlined.
  • the lower line indicates the SNPs to be introduced by the oligonucleotide, identical nucleotides are shown as a dot.
  • the G to A mutation removes the sgRNA PAM sequence but is silent and does not alter the amino acid (E)
  • the A to C mutation introduces the L to F amino acid change
  • the third mutation of T to G introduces a Mfe ⁇ site that can be used for genotyping.
  • Codon-optimized refers to one or more replacement(s) of codon of a nucleic acid from a first organism (for example a bacterium) with codon more frequently used in a second, different, organism (for example a plant), to adapt and optimize (gene) expression in the second organism.
  • nucleic acid construct refers to a man-made nucleic acid molecule resulting from the use of recombinant DNA technology and which is used to deliver exogenous DNA into a host cell, often with the purpose of expression in the host cell of a DNA region comprised on the construct.
  • the vector backbone of a construct may for example be a plasmid into which a (chimeric) gene is integrated or, if a suitable transcription regulatory sequence is already present (for example a (inducible) promoter), only a desired nucleic acid sequence (e.g. a coding sequence) is integrated downstream of the transcription regulatory sequence.
  • Vectors may comprise further genetic elements to facilitate their use in molecular cloning, such as e.g. selectable markers, multiple cloning sites and the like. "Exemplary”: this terms means "serving as an example, instance, or illustration,” and should not be construed as excluding other configurations disclosed herein.
  • “Expression” this refers to the process wherein a DNA region, which is operably linked to appropriate regulatory regions, particularly a promoter, is transcribed into an RNA, which in turn is being translated into a protein or peptide.
  • “Nickase” any endonuclease system which cleaves only a single strand of a DNA duplex (a "nick”). Within the context of the current invention the nickase is a site-specific nickase, by binding to and recognizing a particular recognition sequence with a DNA molecule.
  • “Guide sequence” is to be understood herein as the section of the sgRNA or crRNA which is for targeting the sgRNA or crRNA to the target sequence in the duplex DNA.
  • Plant this includes plant cells, plant protoplasts, plant cell tissue cultures from which plants can be regenerated, plant calli, plant clumps, and plant cells that are intact in plants or parts of plants such as embryos, pollen, ovules, seeds, leaves, flowers, branches, fruit, kernels, ears, cobs, husks, stalks, roots, root tips, anthers, grains and the like.
  • Non-limiting examples of plants include crop plants and cultivated plants, such as barley, cabbage, canola, cassava, cauliflower, chicory, cotton, cucumber, eggplant, grape, hot pepper, lettuce, maize, melon, oilseed rape, potato, pumpkin, rice, rye, sorghum, squash, sugar cane, sugar beet, sunflower, sweet pepper, tomato (e.g. Solanum lycopersicum), water melon, wheat, and zucchini.
  • crop plants and cultivated plants such as barley, cabbage, canola, cassava, cauliflower, chicory, cotton, cucumber, eggplant, grape, hot pepper, lettuce, maize, melon, oilseed rape, potato, pumpkin, rice, rye, sorghum, squash, sugar cane, sugar beet, sunflower, sweet pepper, tomato (e.g. Solanum lycopersicum), water melon, wheat, and zucchini.
  • Sequence or “Nucleic acid sequence”: This refers to the order of nucleotides of, or within a nucleic acid. In other words, any order of nucleotides in a nucleic acid may be referred to as a sequence of nucleic acid sequence.
  • a target sequence is to denote an order of nucleotides within a nucleic acid that is to be targeted, i.e. wherein an alteration is to be introduced.
  • a first nucleic acid sequence may be comprised within or overlap with a further nucleic acid sequence.
  • the targets sequence is an order of nucleotides comprised by a first strand of a DNA duplex.
  • the target sequence comprises a PAM (Protospacer adjacent motif) sequence.
  • any method, use or composition described herein can be implemented with respect to any other method, use or composition described herein.
  • Embodiments discussed in the context of methods, use and/or compositions of the invention may be employed with respect to any other method, use or composition described herein.
  • an embodiment pertaining to one method, use or composition may be applied to other methods, uses and compositions of the invention as well.
  • the present invention is directed to a method for targeted alteration of duplex DNA in a plant cell using a site-specific nickase and a single-stranded oligonucleotide.
  • the method of the invention provides for improved efficacy in modifying a locus of interest in, for example, chromosomal DNA present in a plant cell.
  • method for targeted alteration of duplex DNA in a plant cell may also find use as a method for the provision of a plant cell having a targeted alteration or modification in a duplex DNA molecule in that plant cell and/or as a method for the provision of a plant, and a descendent thereof, or a plant part, comprising a targeted alteration or modification in a duplex DNA molecule in that plant or plant part, wherein the alteration or modification is relative to a plant cell not treated with the method according to the invention.
  • a method for targeted alteration of duplex DNA in a plant cell wherein the first DNA strand of the duplex DNA comprises a target sequence and the second DNA strand of the duplex DNA comprises a second nucleic acid sequence complement to the target sequence, the method comprising
  • oligonucleotide that comprises the target sequence except for at least one mismatch with respect to the target sequence.
  • a duplex DNA in a plant cell is exposed to a site-specific nickase and a single-stranded oligonucleotide with the purpose of targeted alteration of the duplex DNA.
  • an alteration i.e. a change or modification
  • the targeted alteration is a specific and selective alteration of one or more nucleotides at (a) specific site(s) in the duplex DNA.
  • the duplex DNA in the plant cell comprises a first DNA strand a second DNA strand.
  • the second DNA strand is the complement of the first DNA strand and pairs to it to form the duplex.
  • a complement of a first DNA strand sequence ATTT in the 5' to 3' direction
  • TAAA in the 3' to 5' direction.
  • the DNA of the duplex DNA may be any type of DNA, endogenous or exogenous to the plant, for example genomic DNA, chromosomal DNA, artificial chromosomes, plasmid DNA, or episomal DNA.
  • the duplex may be nuclear or organellar DNA.
  • the DNA duplex is chromosomal DNA, preferably endogenous to the plant cell.
  • the first DNA strand of the DNA duplex comprises a target sequence and the second strand comprises a second nucleic acid sequence that is complement to the target sequence.
  • target sequence is to denote an order of nucleotides that is to be targeted, i.e. wherein an alteration is to be introduced.
  • the first strand comprises a nucleic acid sequence that is to be targeted with the method of the invention, i.e. wherein an alteration is to be introduced.
  • the target sequence is not limited to a particular part or section of the DNA.
  • the target sequence may, for example, be part of an intron or an exon, may be part of a coding or non-coding sequence, and/or may be part of a regulatory element or not.
  • the target sequence thus refers to an order of nucleotides that is comprised in the first strand.
  • a plant cell comprising the duplex DNA to be targeted is provided.
  • the skilled person will understand how to provide a plant cell within the context of the current invention, for example by providing the living plant cell in a suitable medium and at a suitable temperature. It will be understood by the skilled person that the number of cells is not limited in any way, however in general a population of plant cells will be provided.
  • a non-limiting number of cell may, for example, be 10 000 - 2 000 000 plant cells per milliliter of aqueous medium used in the method. Although preferably the plant cells are from the same species, in some embodiments more than one species of plant cell may be used in the same experiment.
  • step (b) the duplex DNA is exposed to
  • oligonucleotide that comprises the target sequence except for at least one mismatch with respect to the target sequence.
  • the duplex DNA that is present in the plant cell, is presented with a site-specific nickase and a single-stranded oligonucleotide that comprises the target sequence except for at least one mismatch with respect to the target sequence.
  • "Exposed” is intended to mean presenting to the plant cell the site- specific nickase, or polynucleotide encoding the same, and the single-stranded oligonucleotide in such a manner that it gains access to the interior of the plant cell, in such a manner that the site-specific nickase and the single-stranded oligonucleotide can interact with the duplex DNA comprising the first strand comprising the target sequence.
  • the site-specific nickase is a nickase, i.e. an endonuclease system which cleaves only a single strand of a DNA duplex (creating a "nick"). Endonucleases cleave the phosphodiester bond within a polynucleotide chain.
  • the nickase is a site-specific nickase, by binding to and recognizing a particular recognition sequence with a DNA molecule.
  • a site-specific nickase recognize a specific sequence (site) on a double-stranded DNA, here a duplex DNA, and cleave only one of the DNA strands in a strictly determined manner.
  • the current invention may in principal use any type of site-specific nickase, although, as will be detailed herein, particular nickases, including CRISPR nickases (also referred to as “CRISPR/Cas nickases”, or “CRISPR/Cas system nickase", including CRISPR/Cas9 nickases and CRISPR/Cpf1 nickases) and TALE nickase are preferred.
  • CRISPR nickases also referred to as "CRISPR/Cas nickases”
  • CRISPR/Cas system nickase including CRISPR/Cas9 nickases and CRISPR/Cpf1 nickases
  • TALE nickase are preferred.
  • a cleavage will be introduced in one of the strands of the DNA duplex in the plant cell and at a specific sequence site.
  • the nick is introduced in the target sequence comprised in the first strand or in the complement thereof (i.e. the second nucleic acid sequence) in the second strand.
  • single-stranded refers to a linear stretch of nucleotides, with a 5'end and a 3'end, that exist in absence of a complementary stretch annealed to it (and, if the complement would be present, therewith forming a double strand).
  • the single-stranded oligonucleotide may comprise both RNA and DNA nucleotides, preferably the single-stranded oligonucleotide does not comprise RNA nucleotides.
  • the single-stranded oligonucleotide consists of DNA nucleotides.
  • one or more of the nucleotides of the single-stranded oligonucleotide comprise chemical modifications.
  • the single-stranded oligonucleotide comprises the target sequence except for at least one mismatch with respect to the target sequence.
  • the single-stranded oligonucleotide comprises the information with respect to the alteration that is to be introduced in the target sequence that is comprised in the first strand of the DNA duplex.
  • the single-stranded oligonucleotide may, in certain embodiment also comprise additional stretches on nucleotides adjacent to the target sequence with the one or more mismatches.
  • the oligonucleotide substantially consists of the target sequence with the one or more mismatches relative to the target sequence comprised in the first strand of the DNA duplex.
  • the single-stranded oligonucleotide comprises at least one mismatch with respect to the PAM sequence preferably present in the target sequence.
  • the single-stranded oligonucleotide comprises at least one mismatch with respect to the PAM sequence preferably present in the target sequence, and in addition at least one mismatch outside said PAM sequence.
  • said at least one mismatch outside said PAM sequence is a mismatch resulting in a codon alteration, which preferably results in an amino acid change, or early stop, in the encoded protein.
  • the single-stranded oligonucleotide can introduce single, or multiple, nucleotide deletions, insertions or substitutions in the target sequence.
  • the single- stranded oligonucleotide is designed to comprise the target sequence that is comprised on the first strand of the DNA duplex, except for one or more predefined mismatches relative to said target sequence.
  • the single-stranded oligonucleotide is designed in such a manner that it comprises a sequence that may be capable of binding to the complement of the target sequence, i.e. to the second nucleic acid sequence in the second strand, for example under the experimental conditions applied in the method of the invention.
  • mismatch nucleotide i.e. a nucleotide that does not correspond to the nucleotide as found in the target sequence on the first strand of the DNA duplex
  • the mismatch nucleotide may, after the introduction of a nick in the duplex DNA with the site-specific nickase, induce changes in the region of the duplex DNA comprising the target sequence.
  • the duplex DNA is specifically and selectively altered at one or more predefined nucleotides positions in the duplex DNA.
  • the site-specific nickase causes a nick in the strand of the duplex DNA that comprises the target sequence. It was found by the inventors in a series of experiments, and as shown in the Examples, that when in the method of the invention a site-specific nickase is selected that is directed to introducing a nick in the strand that comprises the target sequence, there is a high efficacy of introducing the alteration in the duplex DNA.
  • the site-specific nickase preferably introduced a nick in the strand of the DNA duplex that comprises the same target sequence as is comprised in the single-stranded oligonucleotide (except for the one or more mismatched in the single-stranded oligonucleotide) that is employed in the method of the invention.
  • a site-specific nickase is used that introduces a nick in the first strand of the DNA duplex, the first strand being defined as the strand comprising the target sequence.
  • This target sequence is also comprised in the single-stranded oligonucleotide used, except for the one or more mismatches.
  • the nick is introduced in the target sequence, i.e. in the stretch of nucleotides in the first strand of the duplex DNA wherein an alteration is to be introduced, and not in the second nucleic acid sequence that is in the second strand.
  • the current invention may in principal use any type of site-specific nickase, although, particular nickases, including CRISPR nickases (also referred to as “CRISPR/Cas nickases”, or “CRISPR/Cas system nickase", including CRISPR/Cas9 nickases and CRISPR/Cpf1 nickases) and TALE nickase are preferred.
  • CRISPR nickases also referred to as “CRISPR/Cas nickases”
  • CRISPR/Cas system nickase including CRISPR/Cas9 nickases and CRISPR/Cpf1 nickases
  • TALE nickase TALE nickase
  • the site-specific nickase is a RNA-guided endonuclease, more specific a RNA-guided nickase.
  • RNA-guided nickases comprise a nuclease domain and at least one domain that interacts with a guide RNA.
  • An RNA-guided nickase is directed to a specific nucleic acid sequence by a guide RNA.
  • the guide RNA interacts with the RNA-guided nickase as well as with the specific nucleic acid sequence such that, once directed to the site comprising the specific nucleic acid sequence, the RNA-guided nickase is able to introduce a single-stranded break at the target site.
  • the RNA-guided nickase can be derived from clustered regularly interspersed short palindromic repeats (CRISPR)/CRISPR-associated (Cas) system, preferably a type II CRISPR/Cas system.
  • CRISPR clustered regularly interspersed short palindromic repeats
  • Cas CRISPR-associated
  • Such nickase is being referred herein as a CRISPR nickase.
  • step (b) further comprises exposing the duplex DNA to a guide RNA that comprises a guide sequence for targeting the site-specific nickase to the target sequence in the duplex DNA.
  • step (b) further comprises exposing the duplex DNA to a guide RNA that comprises a guide sequence for targeting the site-specific nickase to the target sequence in the duplex DNA.
  • the CRISPR/Cas system can be used for genome editing in a wide range of different cell types.
  • the most commonly used protein is the Cas9 protein derived from the bacteria Streptococcus pyogenes (SpCas9).
  • Other examples of CRISPR related proteins include but are not limited to Cas9, CSY4, dCas9, and dCas9-effector domain (activator and/or inhibitor domain) fusion proteins, and another example, such as Cpf1 and such as for example described in 2015 by Zetsche et al. (Cell 163, 759-771 ) and in WO2015/006747.
  • Cpf1 is a single RNA-Guided Endonuclease of a Class 2 CRISPR-Cas System (see e.g. Cell (2015) 163(3):759-771 .
  • Cpf1 is a single RNA-guided endonuclease lacking tracrRNA, and it utilizes a T-rich protospacer-adjacent motif.
  • Cpf1 cleaves DNA via a staggered DNA double-stranded break.
  • Cpf1 has shown to have efficient genome-editing activity in human cells.
  • Cpf1 may thus be used as an alternative Cas-protein as part of the CRISPR system.
  • a Cas protein such as a Cas9 protein comprises at least two nuclease domains.
  • a Cas9 protein can comprise a RuvC-like nuclease domain and an HNH-like nuclease domain.
  • the RuvC and HNH domains work together to cut single strands to make a double-stranded break in DNA. (Jinek et al., Science, 337: 816-821 ). Therefore, such Cas protein, that would normally introduce a DSB, must be modified to contain only one functional nuclease domain (for example, either a RuvC-like or an HNH-like nuclease domain).
  • the Cas-derived protein can be modified such that one of the nuclease domains is mutated such that it is no longer functional (i.e., the nuclease activity is absent), therewith creating a CRISPR nickase.
  • Such CRISPR nickase is thus able to introduce a nick into a double-stranded nucleic acid, but not cleave the double-stranded DNA.
  • CRISPR nickases are known to the skilled person, and examples thereof are provided herein elsewhere.
  • each nuclease domain of a CRISPR endonuclease can be modified, for example inactivated, using well-known methods, such as site-directed mutagenesis, PCR-mediated mutagenesis, and total gene synthesis, as well as other methods known in the art.
  • CRISPR-Cas endonuclease Cpf1 was first believed to contain only a RuvC endonuclease domain, but very recently, structural and functional studies show that Cpf1 acts as a monomer and contains a second putative novel nuclease (NUC) domain (see Gao et al. Cell Research (2016) 26:901-913, Yamano et al. Cell (2016) 165(4): 949-962).
  • the duplex DNA is exposed to the CRISPR nickase together with a guide RNA.
  • the guide RNA directs the CRISPR nickase to the target sequence in the DNA duplex (i.e. to the target sequence as is comprised on the first DNA strand), thereby allowing the CRISPR nickase to create a single-stranded break (or nick) at the target site.
  • the CRISPR nickase causes a nick in the strand that comprises the target sequence.
  • the CRISPR nickase has a RuvC domain that is inactivated and wherein the guide sequence is complement to the strand comprising the target sequence (i.e. the first strand).
  • one of the two nuclease domains of a CRISPR endonuclease, RuvC is inactivated in such a manner that this domain has no nuclease activity anymore.
  • the skilled person is well aware of techniques available in the art such as site-directed mutagenesis, PCR-mediated mutagenesis, and total gene synthesis that allow for the provision of a CRISPR nickase wherein the RuvC domain is inactivated.
  • the other domain i.e. the HNH domain
  • this CRISPR nickase comprises only one active nuclease domain, the HNH, domain.
  • the HNH domain can introduce a nick in the same strand as to which the guide RNA hybridizes.
  • the HNH domain of the CRISPR nickase will introduce a nick in the strand comprising the target sequence (here the first strand of the DNA duplex).
  • the guide RNA hybridizes to the strand comprising the target sequence.
  • the guide RNA comprises a guide sequence that is complement to at least part of the target sequence, and thus hybridized to at least part of the target sequence.
  • the CRISPR nickase is Cas9 D10A (for example as described by Cong et al (Science (2013) ;339(6121 ):819-23).
  • this CRISPR nickase there is an aspartate to alanine (D10A) conversion in a RuvC-like domain, which inactivates the RuvC domain and converts the Cas9-derived protein into a nickase.
  • the CRISPR nickase has a HNH domain that is inactivated and wherein the guide sequence is complement to the strand not comprising the target sequence (i.e. the second strand).
  • one of the two nuclease domains of a CRISPR endonuclease, HNH is inactivated in such a manner that this domain has no nuclease activity anymore.
  • the skilled person is well aware of techniques available in the art such as site-directed mutagenesis, PCR-mediated mutagenesis, and total gene synthesis that allow for the provision of a CRISPR nickase wherein the HNH domain is inactivated.
  • the other domain i.e. the RuvC domain
  • this CRISPR nickase comprises only one active nuclease domain, the RuvC domain.
  • the RuvC domain can introduce a nick in the strand complement to the strand to which the guide RNA hybridizes.
  • the RuvC domain of the CRISPR nickase will introduce a nick in the strand comprising the target sequence (here the first strand of the DNA duplex).
  • the guide RNA hybridizes to the strand not comprising the target sequence (i.e. the second strand).
  • the guide RNA comprises a guide sequence that comprises at least part of the target sequence, and thus hybridized to complement (i.e. present in the second strand) of the last part of the target sequence.
  • the CRISPR nickase is Cas9 H840A or H839A.
  • this CRISPR nickase there is a histidine to alanine (H839A or H840A) conversion in a HNH-like domain, which inactivates the HNH-domain and converts the Cas9-derived protein into a nickase.
  • H839A or H840A histidine to alanine
  • the CRISPR nickase has a NUC domain that is inactivated and wherein the guide sequence is complement to the strand not comprising the target sequence (i.e. the second strand).
  • the NUC domain is inactivated in such a manner that this domain has no nuclease activity anymore.
  • the NUC domain is, as discussed above, for example found in the recently described Cpf1 endonuclease.
  • the skilled person is well aware of techniques available in the art such as site- directed mutagenesis, PCR-mediated mutagenesis, and total gene synthesis that allow for the provision of a CRISPR nickase wherein the NUC domain is inactivated.
  • the other domain i.e. the RuvC domain
  • this CRISPR nickase comprises only one active nuclease domain, the RuvC domain.
  • the RuvC domain can introduce a nick in the strand complement to the strand to which the guide RNA hybridizes.
  • the RuvC domain of the CRISPR nickase will introduce a nick in the strand comprising the target sequence (here the first strand of the DNA duplex).
  • the guide RNA hybridizes to the strand not comprising the target sequence (i.e. the second strand).
  • the guide RNA comprises a guide sequence that comprises at least part of the target sequence, and thus hybridized to complement (i.e. present in the second strand) of the last part of the target sequence.
  • the CRISPR nickase according to this embodiment is Cpf1 R1226A (see Gao et al. Cell Research (2016) 26:901-913, Yamano et al. Cell (2016) 165(4): 949-962).
  • this CRISPR nickase there is an arginine to alanine (R1226A) conversion in the NUC-domain, which inactivates the NUC-domain and converts the Cpf1- derived protein into a nickase.
  • the guide RNA is not in particular limited to a certain size (length, nucleotides), according to a preferred embodiment, the guide sequence is 5 - 100, preferably 10 -50, even more preferably 15 - 25 nucleotides in length.
  • the site-specific nickase is a TALE nickase.
  • the TALE nickase causes a nick in the strand that comprises the target sequence.
  • TALE nucleases are an efficient genome-editing tool and have been described extensively in the art (see also the Background of the invention).
  • TALE nickase are TALE nucleases that have been modified in such manner that it does not introduce double strand breaks, but only introduce a nick in one of the strands.
  • TALE nickases are described in the art (see for example Wu et al. Biochem Biophys Res Commun. (2014)2014 Mar 28;446(1 ):261-266 and Luo et al. Scientific Reports 6 (2016), Article number: 20657 and WO 2015/164748).
  • TALE nickases can induce a site-specific DNA single-strand break, without inducing double-strand break and non-homologous end joining mediated gene mutation, and lower cell apoptosis rate than TALENs.
  • One such TALE nickase involves a D450 mutation of the Fokl catalytic domain creating a TALE nickase with strand-specific nicking activity (see Luo et al. supra).
  • the TALE nickase comprises an inactivated monomer (i.e. lacking nuclease activity) comprising a DNA-binding domain that binds to the strand not comprising the target sequence (i.e. the second strand), i.e. hybridizes to a nucleic acid sequence in the second strand.
  • the TALE nickase comprises an inactivated monomer comprising a DNA-binding domain that binds to at least part of the sequence complement to the target sequence.
  • any type of plant cell may be used in the method as long as the plant cells allows the exposure of the DNA duplex to the site-specific nuclease, the single-stranded oligonucleotide and, in some embodiments, the guide RNA.
  • the plant cell is a plant protoplast.
  • the skilled person is aware of methods and protocols for preparing and propagation plant protoplasts, see for example Plant Tissue Culture (ISBN: 978-0-12-415920-4, Roberta H. Smith).
  • the plant protoplasts for use in the method of the current invention can be provided using common procedures (e.g. using macerase and/or cellulases and pectinases) used for the generation of plant cell protoplasts.
  • Plant cell protoplasts systems have for example been described for tomato, tobacco and many more (Brassica napus, Daucus carota, Lactuca sativa, Zea mays, Nicotiana benthamiana, Petunia hybrida, Solanum tuberosum, Oryza sativa).
  • the present invention is generally applicable to any protoplast system, including those, but not limited to, the systems described in any one of the following references: Barsby ef al. 1986, Plant Cell Reports 5(2): 101-103; Fischer et al. 1992, Plant Cell Rep. 1 1 (12): 632- 636; Hu ef al. 1999, Plant Cell, Tissue and Organ Culture 59: 189-196; Niedz ef al.
  • the duplex DNA is exposed to the site-specific nickase by introducing into the plant cell a nucleic acid construct for expression of the site-specific nickase in the plant cell.
  • the methods of the invention do not depend on a particular method for introducing the site-specific nickase in the plant cell.
  • the site-specific nickase is provided to the plant cells as a polypeptide, the polypeptide being taken up into the plant cell interior.
  • the site-specific nickase is provided by introducing into the plant cell a nucleic acid construct, i.e. a polynucleotide, for expression of the site-specific nickase in the plant cell.
  • a nucleic acid construct i.e. a polynucleotide
  • Such nucleic acid construct may be any suitable construct known in the art and which is used to deliver exogenous DNA into a host cell with the purpose of expression in the host cell of a DNA region (here the site-specific nickase) comprised on the construct.
  • Introduction of the site-specific nickase or the nucleic acid construct encoding the same may be accomplished by any method known which permits the successful introduction of the protein or the nucleic acid construct into the plant cells, and which, in case of a nucleic acid construct, results in the expression of the introduced nucleic acid. Methods included but are not limited to such methods as transfection, microinjection, electroporation, nucleofection and lipofection.
  • the guide RNA may also be introduced in the plant cell by any suitable method.
  • guide RNA may be provided to the plant cell directly, or, in a preferred embodiment, by introducing into the plant cell a nucleic acid construct for expression of the guide RNA in the plant cell.
  • nucleic acid construct may be any suitable construct known in the art and which is used to deliver exogenous DNA into a host cell with the purpose of expression in the host cell of a DNA region (here the guide RNA) comprised on the construct.
  • Introduction of the guide RNA or the nucleic acid construct encoding the same may be accomplished by any method known which permits the successful introduction of the guide RNA or the nucleic acid construct into the plant cells, and which, in case of a nucleic acid construct, results in the expression of the introduced guide RNA. Methods included but are not limited to such methods as transfection, microinjection, electroporation, nucleofection and lipofection.
  • the site-specific nickase and the guide RNA are introduced in the plant cell using the same nucleic acid construct, in other words the nucleic acid construct is for expression of both the site-specific nickase and the guide RNA in the plant cell.
  • the nucleic acid sequence encoding the site-specific nickase and the nucleic acid sequence encoding the guide RNA are under control of different promoters.
  • the guide RNA may, preferably, be under control of, i.e. operably linked to, a pol III promoter (such as U6 and H 1 ) preferably for expression in plant; RNA pol III promoters, such as U6 and H1 , are commonly used to express these small RNAs (see e.g. Ma et al. Molecular Therapy Nucleic Acids (2014) 3, e161 ).
  • a pol III promoter such as U6 and H 1
  • RNA pol III promoters such as U6 and H1
  • the site-specific nickase may, preferably, be under control of a constitutive promotes, preferably for expression in plant, such the 35 S promoter (e.g. the 35 S promoted from cauliflower mosaic virus (CaMV); Odell et al. Nature 313:810-812; 1985).
  • Suitable constitutive promoters include but are not limited to the cassava vein mosaic virus (CsVMV) promoter, and the sugarcane bacilliform badnavirus (ScBV) promoter (see e.g. Samac et al. Transgenic Res. 2004 Aug; 13(4):349-61 .)
  • Other constitutive promoters include, for example, the core promoter of the Rsyn7 promoter and other constitutive promoters disclosed in WO 99/43 838 and US 6072050; ubiquitin (Christensen et al., Plant Mol. Biol. 12:619-632, 1989 and Christensen et al., Plant Mol. Biol. 18:675- 689, 1992); pEMU (Last et al., Theor. Appl. Genet. 81 :581-588, 1991 ); AA6 promoter (WO2007/069894); and the like.
  • the nucleic acid constructs may also include transcription termination regions. Where transcription terminations regions are used, any termination region may be used in the preparation of the nucleic acid constructs.
  • the nucleic acid construct is for transient expression.
  • the expression in the plant material is temporary as a consequence of the non-permanent presence of the nucleic acid construct.
  • Expression may be transient, for instance when the construct is not integrated into the host genome.
  • site-specific nickase, single-stranded oligonucleotides and nucleic acid constructs are transiently provided to a plant cell, followed by a decline in the amount of one or more of the components.
  • the plant cell, progeny of the plant cell, and plants which comprise the plant cell wherein the duplex DNA has been altered comprise a diminished amount of one or more of the components used in the method of the invention, or no longer contain one or more of the components.
  • the nucleic acid construct may be optimized for increased expression in the transformed plant.
  • nucleic acid sequence encoding the site-specific nickase is codon optimized for expression in the plant cell.
  • nucleic acid sequence encoding the site-specific nickase is codon optimized for expression in tomato, more preferably Solanum lycopersicum .
  • nucleic acid construct encoding the site-directed nickase can be synthesized using plant- preferred codons for improved expression. See, for example, Campbell and Gowri, (Plant Physiol. 92: 1- 1 1 , 1990) for a discussion of host-preferred codon usage. Methods are available in the art for synthesizing plant-preferred genes (see, for example, Murray et al., Nucleic Acids Res. (1989) 17:477- 498, or Lanza et al. (2014) BMC Systems Biology 8:33-43).
  • Introduction in the plant cell of the site-specific nickase, the guide RNA, the single-stranded oligonucleotide, and/or, where applicable the guide RNA, or nucleic acid construct encoding the same may be accomplished by any method known which permits the successful introduction thereof into the plant cell, and which, in case of a nucleic acid construct, results in the expression of the introduced site- specific nickase and/or guide RNA. Methods included but are not limited to such methods as transfection, microinjection, electroporation, nucleofection and lipofection.
  • Polyethylene glycol (PEG) is a polyether compound with many applications from industrial manufacturing to medicine. PEG is also known as polyethylene oxide (PEO) or polyoxyethylene (POE).
  • PEG The structure of PEG is commonly expressed as H-(0- CH2-CH2)n-OH.
  • the PEG used in the method according to the invention is an oligomer and/or polymers, or mixtures thereof with a molecular mass below 20,000 g/mol.
  • PEG-mediated gene transformation has been known since 1985.
  • the first method for plant protoplast transformation utilized PEG (Krens et al. (1982) Nature 296: 72-74; Potyrykus et al. (1985) Plant Mol. Biol. Rep. 3:1 17-128; Negrutiu et al. (1987) Plant Mol.Biol. 8: 363-373).
  • the technique is applicable to protoplasts from many different plants (Rasmussen et al. (1993) Plant Sci.
  • PEG is thought to stimulate transformation by precipitating the DNA, in the presence of divalent cations, onto the surface of the plant protoplasts from where it then becomes internalized (Maas & Werr (1989) Plant Cell Rep. 8: 148-151 ).
  • the prior art has not contemplated the use of PEG transformation in the method of the invention to introduce into the plant cell the site-specific nickase, the single-stranded oligonucleotide, and, where applicable, the guide RNA, or nucleic acid construct encoding the same.
  • a method according to the invention wherein the method comprises a step of synchronizing the cell cycle of the plant cell, preferably before and/or during performing step (b), preferably wherein synchronizing is performed by contacting the plant cell with a synchronizing agent.
  • the method comprises a step of synchronizing the cell cycle of the plant cell.
  • synchronization is performed before and/or during performing step (b).
  • step (b) most of the plant cells will be in the same phase of the cell cycle when the duplex DNA is exposed to, for example, the site-specific nuclease and the single-stranded oligonucleotide as defined herein. This may be advantageous and increase the rate of introduction of the alteration in the duplex DNA. Also in case the plant cells are synchronized during step (b), this may increase overall introduction of the alteration in the duplex DNA.
  • Synchronizing the plant cell may be accomplished by any suitable means.
  • synchronization of the cell cycle may be achieved by nutrient deprivation such as phosphate starvation, nitrate starvation, ion starvation, serum starvation, sucrose starvation, auxin starvation.
  • Synchronization can also be achieved by adding a synchronizing agent to the plant cell.
  • Synchronizing agents such as aphidocolin, hydroxyurea, thymidine, colchicine, cobtorin, dinitroaniline, benefin, butralin, dinitramine, ethalfluralin, oryzalin, pendimethalin, trifluralin, amiprophos-methyl, butamiphos dithiopyr, thiazopyr propyzamide, tebutam DCPA (chlorthal-dimethyl), mimosine, anisomycin, alpha amanitin, lovastatin, jasmonic acid, abscisic acid, menadione, cryptogeine, hydrogenperoxide, sodiumpermanganate, indomethacin, epoxomycin, lactacystein, icrf 193, olomoucine, roscovitine, bohemine, staurosporine, K252a, okadaic acid, endothal, caffeine, MG 132, cycline dependent kin
  • synchronizing the cell cycle synchronizes the plant cell in the S-phase, the M-phase, the G1 and/or G2 phase of the cell cycle.
  • the at least one mismatch in the single-stranded oligonucleotide is positioned at most 3, preferably at most 2, more preferably at most 1 nucleotide from the 3' end of the single-stranded oligonucleotide, most preferably the at least one mismatch is at the 3' end of the single-stranded oligonucleotide.
  • the mismatch should be present within the oligonucleotide, in other words "somewhere in the middle" of the oligonucleotide, it has been found that the method of the invention can advantageously be performed when the mismatch is not located somewhere in the middle of the oligonucleotide but at specific locations.
  • the mismatch is located at most three, two, or preferably at most one nucleotide from the 3' end of the oligonucleotide.
  • the at least one mismatch is at the 3' end of the single-stranded oligonucleotide, i.e. 0 nucleotides from the 3'end.
  • the single-stranded non- circular oligonucleotide has two ends, the 3' end and the 5' end (also referred to as "three prime end” and “five prime end”).
  • the 5' end of a single-stranded oligonucleotide designates that specific nucleotide of which the C-5 carbon atom forms the terminal carbon atom of the sugar- phosphate backbone.
  • the C-5 carbon atom may or may not be linked to a phosphate group by a phosphodiester bond, but this phosphate group in turn does not form any linkage with another nucleotide.
  • the 3' end designates that specific nucleotide of which the C-3 carbon atom is not linked to any other nucleotides, whether by means of a phosphate diester bond or otherwise.
  • the term “mismatch positioned 2 nucleotides from the 3'end” indicates that the mismatch is two nucleotides from the nucleotide at the 3' terminus of the oligonucleotide.
  • the term “mismatch positioned 1 nucleotide from the 3'end” indicates that the mismatch is one nucleotide from the nucleotide at the 3' terminus of the oligonucleotide.
  • the term “mismatch positioned 0 nucleotides from the 3'end” indicates that the mismatch is the nucleotide at the 3' terminus of the oligonucleotide.
  • the single-stranded oligonucleotide may comprise more than one mismatch relative to the target sequence.
  • the single-stranded oligonucleotide can accommodate more than one mismatch either adjacent or on removed locations in the single-stranded oligonucleotide.
  • the oligonucleotide may comprise two, three, four or more mismatch nucleotides, which may be adjacent or remote (i.e. non-adjacent) to each other.
  • the single-stranded oligonucleotide according to the invention may further comprise parts that do not comprise the target sequence, in other words adjacent nucleotides that would not hybridize with the second DNA strand, i.e. the complement of the target sequence, for example as these parts of the single- stranded oligonucleotide are not complementary to any sequence in the second DNA strand.
  • the single-stranded oligonucleotide is a chemically protected oligonucleotide, preferably comprises at least one, two, three of four chemically protected nucleotide(s).
  • Such chemically protected oligonucleotide may be better resistant to nucleases and may in addition provide for higher binding affinity.
  • modifications to provide a chemically protected oligonucleotide is not in particular limited.
  • suitable modification include the introduction of a reverse base (idC) at the 3' end of the oligonucleotide to create a 3' blocked end on the repair oligonucleotide; introduction of one or more 2 ⁇ - methyl nucleotides or bases which increase hybridization energy (see WO2007/073149) at the 5' and/or 3' of the repair oligonucleotide; conjugated (5' or 3') intercalating dyes such as acridine, psoralen, and ethidium bromide; introduction of a 5' terminus cap such as a T/A clamp, a cholesterol moiety, SIMA (HEX), and riboC; backbone modifications such as phosphothioate, methyl phosphonates, MOE (methoxyethyl), di PS and peptide nucleic acid (PNA); or ribose modifications such as 2
  • PS phosphorothioates
  • LNA's locked nucleic acids
  • the at least one mismatch is not a chemically protected nucleotide.
  • a chemically protected nucleotide is at least one nucleotide from the at least one mismatch.
  • a mismatch in the single-stranded oligonucleotide is not a chemically protected nucleotide and the nucleotide adjacent to (either side) the mismatch is also not a chemically protected (or modified) nucleotide.
  • the single-stranded oligonucleotide is between 10 and 1000 nucleotides in length, preferably between 10 and 500 nucleotides in length, even more preferably between 15 and 250 nucleotides in length.
  • the single-stranded oligonucleotide comprises the sequence except for at least one mismatch with respect to the target sequence.
  • the single-stranded oligonucleotide has, for example a length of 150 nucleotides
  • the target sequence in the first strand of the DNA duplex is also at most 150 nucleotides (or less, as the single-stranded oligonucleotide may also comprise, adjacent to the target sequence, additional nucleotides, as explained above).
  • the single-stranded oligonucleotide has the same length as the target sequence, for example 50 nucleotides, 100 nucleotides, 250 nucleotides or more.
  • the method of the invention may be performed using any type of plant cells.
  • the plant cell is from a plant selected from the group consisting of barley, cabbage, canola, cassava, cauliflower, chicory, cotton, cucumber, eggplant, grape, hot pepper, lettuce, maize, melon, oilseed rape, potato, pumpkin, rice, rye, sorghum, squash, sugar cane, sugar beet, sunflower, sweet pepper, tomato, water melon, wheat, and zucchini.
  • the plant cell is from Solanum lycopersicum .
  • two or more single-stranded oligonucleotides are used.
  • the two or more single-stranded oligonucleotides may comprise the same target sequence of may comprise partially overlapping target sequences, or may comprise distinct target sequences.
  • two or more guide RNA's are used.
  • the two or more guide RNA's may direct the site-specific nickase to the same site in the DNA duplex, or to a different site (for example in order to introduce more than one nick, either in the same strand or in any other strand).
  • the site-specific nickase, the guide RNA, and/or the single-stranded oligonucleotide is transiently expressed in the plant cell, as already discussed herein elsewhere.
  • an alteration in introduced in the duplex DNA in a plant cells may comprise the insertion, deletion or modification of at least one base pair.
  • the targeted alteration may comprise the deletion of at least one base pair and the insertion of at least one base pair.
  • 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10 or more base pairs may be altered with the method of the invention.
  • More than one modification may be introduced in a single experiment, and/or the experiment may be repeated to introduce subsequent alteration in the duplex DNA in the plant cell.
  • the method further comprises the step of regenerating a plant or descendent thereof comprising the targeted alteration.
  • the CRISPR/Cas9 protein induces DSBs with predominantly blunt ends or occasionally a 5' 1 bp overhang.
  • NHEJ non-homologous end joining
  • DNA-based expression cassettes such as plasmids or a T-DNA. These were introduced into plant protoplasts or integrated into the plant genome and then cells or regenerated plants containing INDEL mutations at the target sequences were identified.
  • INDELs can be very useful in elucidating gene function and allows researchers to develop plant varieties containing null alleles that have improved agricultural performance.
  • plant performance can be often better achieved through the modification of plant proteins, e.g. the alteration of specific amino acids in the protein that leads to an enhanced phenotype.
  • Amino acids can be altered by introducing specific single nucleotide polymorphism, SNPs, into the coding sequence of the target gene using the process of homology directed repair (HDR).
  • HDR homology directed repair
  • a DSB at, or close to, the sequence to be modified must be produced that is then repaired using an exogenous homologous repair template that carries the specific SNPs to be introduced into the genome, for example, a single-stranded oligonucleotide comprising a mismatch relative to the target to be altered.
  • the HDR mechanism uses endogenous proteins involved in homologous DNA repair to copy the sequence information present on the repair template (including the SNPs) into the genome, resulting in a cell with the desired changes at the target sequence.
  • HDR occurs in plant cells, such as tomato protoplasts, when they are transfected with a vector that expresses a nickase, such as the Cas9 D10A nickase, including a guide RNA, and with a single stranded oligonucleotide that comprises a sequence identical to the target sequence on a strand of the duplex DNA to be targeted, except for at least one mismatch with respect to said target sequence (i.e., the single-stranded oligonucleotide is complementary to the un-nicked strand of the duplex DNA targeted).
  • a vector that expresses a nickase such as the Cas9 D10A nickase, including a guide RNA
  • a single stranded oligonucleotide that comprises a sequence identical to the target sequence on a strand of the duplex DNA to be targeted, except for at least one mismatch with respect to said target sequence (i.e., the single-stranded oli
  • the sequence of the S. pyogenes Cas9 ORF (Accession number NC_002737) was used to design a variant that had altered codon usage for optimal expression in tomato, Solanum lycopersicum and also a D10A mutation that inactivates one of the Cas9 nuclease domains and converts the protein into a nickase.
  • the resulting DNA ORF has a sequence SEQ ID NO:1 and the resulting protein has an amino acid sequence SEQ ID NO:2.
  • the ORF was then synthesized (www.geneart.com) flanked by both Xhol (5') and Sacl (3') sites and cloned into a plasmid.
  • the Cas9 ORF fragment was then isolated from this plasmid after digestion with Xhol and Sacl.
  • the constitutive cauliflower mosaic virus 35S promoter present on the vector pKG7381 was used to express the Cas9 ORF in tomato protoplasts.
  • Plasmid pKG7381 carries a 6xHIS tagged version of green fluorescent protein (GFP) flanked by Xhol and Sacl sites.
  • GFP green fluorescent protein
  • the GFP ORF in pKG7381 was replaced by the Cas9 ORF using the Xhol and Sacl sites, resulting in the construct pKG9299 that carries the Cas9 D10A ORF with a nuclear localization sequence (NLS) and 6xHIS tag translationally fused at its N terminus.
  • NLS nuclear localization sequence
  • 6xHIS tag translationally fused at its N terminus For guide RNA testing we also used a version of KG9299 that lacked the D10A mutation (KG9227) that was generated from KG9299 using a mutagenesis kit.
  • the seguences of the oligonucleotides used in this study are Sense oligo SEQ ID NO:8
  • Protoplasts were resuspended in CPW9M (Frearson et al, 1973, Dev Biol. 33: 130- 137) medium and 3 mL CPW18S (Frearson et al, 1973, Dev Biol. 33: 130-137) was added at the bottom of each tube using a long-neck glass Pasteur pipette. Live protoplasts were harvested by centrifugation for 10 minutes at 800 rpm as the cell fraction at the interface between the sucrose and CPW9M medium. Protoplasts were counted and resuspended in MaMg (Negrutiu et al., 1987, Plant Mol. Biol. 8: 363-373) medium at a final density of 10 6 per mL.
  • the protoplasts were harvested by centrifugation for 5 minutes at 800 rpm and resuspended in 9M culture medium at a density of 0.5 x 10 6 per ml and transferred to a 4cm diameter petri dish and an equal volume of 2% alginate solution (20g/l Alginate-Na (Sigma-Aldrich #A0682), 0.14g/l CaCI2.2H20, 90g/l mannitol) was added. Then 1 ml aliquots (125000 transfected protoplasts) were spread over Ca-Agar plates (72.5g/l mannitol, 7.35g/l CaCl2.2H20, 8g/l agar, pH5.8) and allowed to polymerize for 1 hour.
  • 2% alginate solution (20g/l Alginate-Na (Sigma-Aldrich #A0682), 0.14g/l CaCI2.2H20, 90g/l mannitol) was added. Then 1 ml aliquots (125000
  • the embedded protoplasts were grown in a 4cm tissue culture dish containing 4ml of K8p (Kao and Michayluk, 1975, Planta 126 (2): 105-1 10) culture medium.
  • K8p Kao and Michayluk, 1975, Planta 126 (2): 105-1 10
  • the disc of transfected protoplasts was removed from the dish after 48 hours, the alginate was dissolved, and the protoplasts were isolated by centrifugation.
  • the protoplasts were incubated in the K8p medium for 21 days at 28°C in the dark. After this period the discs of transfected protoplasts were transferred to solid GM medium (Tan et al., 1987, Theor. Appl. Genet.
  • Tomato protoplasts that had been transfected were cultivated for 48 hours, the alginate dissolved, and collected by centrifugation. Total genomic DNA was then isolated from each transfected sample of cells using the DNeasy Plant Mini Kit (Qiagen). This was then used in a PCR reaction to amplify the tomato CENH3 target site using the following primers 5'- CAAATAGGTTATGGATTTATCCTTGC -3' (SEQ ID NO: 10) and 5'- TAATGCACACGATCCAAATAGC -3' (SEQ ID NO: 1 1 ). These were then used to generate a library which was then sequenced on the MiSeq sequencer with each sample identified using a unique 5 nt tag.
  • DSB DNA double strand break
  • the number of protoplasts with indels at the target site can be directly related to the targeting efficiency of each guide RNA.
  • the protoplasts were harvested and their pooled genomic DNA was used for the amplification of a PCR product carrying the CENH3 target sites. This PCR product was then used to generate a sequencing library that was then sequenced on the MiSeq platform. The reads were then processed and analyzed for the presence of indel mutations at the expected target site.
  • the 100 nucleotide oligonucleotides are identical to one of the DNA strands of the target sequence except for three SNPs (mismatches) which we would like to introduce into the CENH3 locus ( Figure 1 ).
  • the first SNP alters the Cas9 D10A PAM sequence so that it is no longer recognized by the protein and therefore once altered will prevent the Cas9 D10A from creating additional nicks at the target site that may result in undesired INDEL mutations.
  • This SNP is silent and does not alter the CENH3 codon (glycine).
  • the second SNP on the oligonucleotide alters a single codon in CENH3, changing a lysine to a phenylalanine.
  • the final SNP changes a single nucleotide in the CENH3 intron, resulting in the creation of a Mfel site. While this has no effect on the CENH3 protein, the creation of a novel restriction site simplifies the downstream genotyping of cells and calli that have undergone the HDR genome editing process.
  • control samples were treated similar with the exception that the transfection lacked KG9499 (guide RNA1 ) or both KG9299 (35S::Cas9 D10A) and KG9499 (guide RNA1 ).
  • KG9299 (35S::Cas9 D10A) plus KG9499 (guide RNA1 ) plus oligonucleotide 2 (antisense) produced sequence reads where 1 % of these contained the expected SNPs.
  • the experiment was then repeated using the optimal gene editing reagents and the transfected protoplasts were maintained on growth medium to produce calli. Once these calli were of a sufficient size then they were individually genotyped. Each callus was sampled by the removal of a small amount of callus material that was then used as a template in a direct PCR reaction using the CENH3 exon 5 specific primers. The PCR product from each callus was then digested with Mfel which will be digested if the callus was derived from a protoplast in which genome editing had taken place. We found that the number of positive calli identified correlated well with the genome editing efficiency that we had estimated based on the MiSeq sequencing results.

Abstract

La présente invention concerne des procédés de modification génétique ciblée dans des cellules végétales, ainsi que les cellules végétales et les plantes ainsi obtenues. Dans le procédé, l'utilisation de la combinaison d'une nickase et d'un oligonucléotide simple brin selon l'invention permet la modification ciblée d'un ADN bicaténaire à une efficacité accrue.
PCT/EP2017/084291 2016-12-22 2017-12-22 Procédés de modification génétique ciblée dans des cellules végétales WO2018115389A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
NL2018047 2016-12-22
NL2018047 2016-12-22

Publications (1)

Publication Number Publication Date
WO2018115389A1 true WO2018115389A1 (fr) 2018-06-28

Family

ID=58402105

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2017/084291 WO2018115389A1 (fr) 2016-12-22 2017-12-22 Procédés de modification génétique ciblée dans des cellules végétales

Country Status (1)

Country Link
WO (1) WO2018115389A1 (fr)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2020011985A1 (fr) 2018-07-12 2020-01-16 Keygene N.V. Système crispr/nucléase de type v pour édition de génome dans des cellules végétales
WO2020089448A1 (fr) 2018-11-01 2020-05-07 Keygene N.V. Arn guide double pour édition de génome crispr/cas dans des cellules végétales
CN112888444A (zh) * 2018-08-14 2021-06-01 因思科瑞普特公司 经由批量细胞培养在自动化模块和仪器中对经核酸酶编辑的序列的改进的检测
WO2023285478A1 (fr) * 2021-07-14 2023-01-19 Scienza Biotechnologies 4 B.V. Procédé pour la génération de protoplastes à génome modifié à partir de tissus végétaux à propagation clonale

Citations (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999043838A1 (fr) 1998-02-24 1999-09-02 Pioneer Hi-Bred International, Inc. Promoteurs de synthese
WO2007069894A2 (fr) 2005-12-16 2007-06-21 Keygene N.V. Promoteurs de plante constitutifs
WO2007073149A1 (fr) 2005-12-22 2007-06-28 Keygene N.V. Variantes de nucleotides ameliorant les echanges de nucleotides cibles
EP2516652A1 (fr) 2009-12-21 2012-10-31 Keygene N.V. Techniques améliorées de transfection de protoplastes
EP2646549A1 (fr) 2010-12-02 2013-10-09 Keygene N.V. Altération ciblée d'adn
WO2015006747A2 (fr) 2013-07-11 2015-01-15 Moderna Therapeutics, Inc. Compositions comprenant des polynucléotides synthétiques codant pour des protéines liées à crispr et des arnsg synthétiques et méthodes d'utilisation
WO2015048707A2 (fr) * 2013-09-30 2015-04-02 Regents Of The University Of Minnesota Résistance aux geminivirus conférée à des plantes au moyen de systèmes crispr/cas
WO2015139008A1 (fr) * 2014-03-14 2015-09-17 Cibus Us Llc Procédés et compositions permettant d'améliorer l'efficacité de modifications génétiques ciblées en utilisant la réparation de gène médiée par des oligonucléotides
WO2015164748A1 (fr) 2014-04-24 2015-10-29 Sangamo Biosciences, Inc. Protéines effectrices de type activateur de transcription (tale) obtenues par génie génétique
WO2016105185A1 (fr) * 2014-12-22 2016-06-30 Keygene N.V. Populations de cals végétaux
WO2017138986A1 (fr) * 2016-02-09 2017-08-17 Cibus Us Llc Procédés et compositions permettant d'améliorer l'efficacité de modifications génétiques ciblées en utilisant la réparation de gène médiée par des oligonucléotides
WO2017184786A1 (fr) * 2016-04-19 2017-10-26 The Broad Institute Inc. Complexes cpf1 à activité d'indel réduite
WO2017207589A1 (fr) * 2016-06-01 2017-12-07 Kws Saat Se Séquences d'acides nucléiques hybrides destinées à l'ingénierie génomique
WO2017222370A1 (fr) * 2016-06-20 2017-12-28 Keygene N.V. Procédé de modification ciblée de l'adn dans des cellules végétales

Patent Citations (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6072050A (en) 1996-06-11 2000-06-06 Pioneer Hi-Bred International, Inc. Synthetic promoters
WO1999043838A1 (fr) 1998-02-24 1999-09-02 Pioneer Hi-Bred International, Inc. Promoteurs de synthese
WO2007069894A2 (fr) 2005-12-16 2007-06-21 Keygene N.V. Promoteurs de plante constitutifs
WO2007073149A1 (fr) 2005-12-22 2007-06-28 Keygene N.V. Variantes de nucleotides ameliorant les echanges de nucleotides cibles
EP2516652A1 (fr) 2009-12-21 2012-10-31 Keygene N.V. Techniques améliorées de transfection de protoplastes
EP2646549A1 (fr) 2010-12-02 2013-10-09 Keygene N.V. Altération ciblée d'adn
WO2015006747A2 (fr) 2013-07-11 2015-01-15 Moderna Therapeutics, Inc. Compositions comprenant des polynucléotides synthétiques codant pour des protéines liées à crispr et des arnsg synthétiques et méthodes d'utilisation
WO2015048707A2 (fr) * 2013-09-30 2015-04-02 Regents Of The University Of Minnesota Résistance aux geminivirus conférée à des plantes au moyen de systèmes crispr/cas
WO2015139008A1 (fr) * 2014-03-14 2015-09-17 Cibus Us Llc Procédés et compositions permettant d'améliorer l'efficacité de modifications génétiques ciblées en utilisant la réparation de gène médiée par des oligonucléotides
WO2015164748A1 (fr) 2014-04-24 2015-10-29 Sangamo Biosciences, Inc. Protéines effectrices de type activateur de transcription (tale) obtenues par génie génétique
WO2016105185A1 (fr) * 2014-12-22 2016-06-30 Keygene N.V. Populations de cals végétaux
WO2017138986A1 (fr) * 2016-02-09 2017-08-17 Cibus Us Llc Procédés et compositions permettant d'améliorer l'efficacité de modifications génétiques ciblées en utilisant la réparation de gène médiée par des oligonucléotides
WO2017184786A1 (fr) * 2016-04-19 2017-10-26 The Broad Institute Inc. Complexes cpf1 à activité d'indel réduite
WO2017207589A1 (fr) * 2016-06-01 2017-12-07 Kws Saat Se Séquences d'acides nucléiques hybrides destinées à l'ingénierie génomique
WO2017222370A1 (fr) * 2016-06-20 2017-12-28 Keygene N.V. Procédé de modification ciblée de l'adn dans des cellules végétales

Non-Patent Citations (63)

* Cited by examiner, † Cited by third party
Title
"Flow Cytometry with plant cells", 2007, WILEY-VCH VERLAG, pages: 327 ff
BARSBY ET AL., PLANT CELL REPORTS, vol. 5, no. 2, 1986, pages 101 - 103
BOCH, NATURE BIOTECHNOLOGY, vol. 29, 2011, pages 135 - 136
BOGDANOVE; VOYTAS, SCIENCE, vol. 333, 2011, pages 1843 - 1846
BROOKS ET AL., PLANT PHYS., vol. 166, 2014, pages 1292 - 1297
CAMPBELL; GOWRI, PLANT PHYSIOL., vol. 92, 1990, pages 1 - 11
CELL, vol. 163, no. 3, 2015, pages 759 - 771
CHRISTENSEN ET AL., PLANT MOL. BIOL., vol. 12, 1989, pages 619 - 632
CHRISTENSEN ET AL., PLANT MOL. BIOL., vol. 18, 1992, pages 675 - 689
CHRISTIAN, GENETICS, vol. 186, 2010, pages 757 - 761
CONG ET AL., SCIENCE, 2013, pages 819 - 823
CONG ET AL., SCIENCE, vol. 339, no. 6121, 2013, pages 819 - 23
CORMAC ET AL., NUCLEIC ACIDS RES, vol. 39, 2011, pages e82
CURTIN, THE PLANT GENOME, vol. 5, 2012, pages 42 - 50
FENG ET AL., CELL RES., vol. 23, 2013, pages 1229 - 1231
FISCHER ET AL., PLANT CELL REP., vol. 11, no. 12, 1992, pages 632 - 636
FREARSON ET AL., DEV BIOL., vol. 33, 1973, pages 130 - 137
FRIEDRICH FAUSER ET AL: "Both CRISPR/Cas-based nucleases and nickases can be used efficiently for genome engineering in Arabidopsis thaliana", THE PLANT JOURNAL, vol. 79, no. 2, 17 June 2014 (2014-06-17), GB, pages 348 - 359, XP055351728, ISSN: 0960-7412, DOI: 10.1111/tpj.12554 *
FRIEDRICH FAUSER ET AL: "Supplemetary data: Both CRISPR/Cas-based nucleases and nickases can be used efficiently for genome engineering in Arabidopsis thaliana", THE PLANT JOURNAL, vol. 79, no. 2, 16 May 2014 (2014-05-16), GB, pages 348 - 359, XP055366109, ISSN: 0960-7412, DOI: 10.1111/tpj.12554 *
GAO ET AL., CELL RESEARCH, vol. 26, 2016, pages 901 - 913
HAEUSSLER ET AL., J GENET GENOMICS, vol. 43, no. 5, 2016, pages 239 - 50
HU ET AL., PLANT CELL, TISSUE AND ORGAN CULTURE, vol. 59, 1999, pages 189 - 196
JINEK ET AL., SCIENCE, vol. 337, 2012, pages 816 - 820
JINEK ET AL., SCIENCE, vol. 337, pages 816 - 821
JOUNG ET AL., NAT REV MOL CELL BIOL., vol. 14, no. 1, 2013, pages 49 - 55
JUNWON LEE ET AL: "Designed nucleases for targeted genome editing", PLANT BIOTECHNOLOGY JOURNAL, vol. 14, no. 2, 15 September 2015 (2015-09-15), GB, pages 448 - 462, XP055365830, ISSN: 1467-7644, DOI: 10.1111/pbi.12465 *
KAO; MICHAYLUK, PLANTA, vol. 126, no. 2, 1975, pages 105 - 110
KRENS ET AL., NATURE, vol. 296, 1982, pages 72 - 74
LANZA ET AL., BMC SYSTEMS BIOLOGY, vol. 8, 2014, pages 33 - 43
LAST ET AL., THEOR. APPL. GENET., vol. 81, 1991, pages 581 - 588
LEE ET AL., PLANT BIOTECHNOLOGY JOURNAL, vol. 14, no. 2, 2016, pages 448 - 462
LI ET AL., NAT. BIOTECH., vol. 31, 2013, pages 688 - 691
LOWDER ET AL., PLANT PHYS., vol. 169, 2015, pages 971 - 985
LUO ET AL., SCIENTIFIC REPORTS, vol. 6, 2016
MA ET AL., MOLECULAR THERAPY NUCLEIC ACIDS, vol. 3, 2014, pages e161
MAAS; WERR, PLANT CELL REP., vol. 8, 1989, pages 148 - 151
MALI ET AL., SCIENCE, vol. 339, 2013, pages 823 - 826
MASAFUMI MIKAMI ET AL: "Precision Targeted Mutagenesis via Cas9 Paired Nickases in Rice", PLANT AND CELL PHYSIOLOGY, vol. 57, no. 5, 2 March 2016 (2016-03-02), UK, pages 1058 - 1068, XP055365817, ISSN: 0032-0781, DOI: 10.1093/pcp/pcw049 *
MURRAY ET AL., NUCLEIC ACIDS RES., vol. 17, 1989, pages 477 - 498
NEGRUTIU ET AL., PLANT MOL. BIOL., vol. 8, 1987, pages 363 - 373
NEGRUTIU ET AL., PLANT MOL.BIOL., vol. 8, 1987, pages 363 - 373
NEKRASOV ET AL., NAT. BIOTECH., vol. 31, 2013, pages 691 - 693
NIEDZ ET AL., LANT SCIENCE, vol. 39, 1985, pages 199 - 204
ODELL ET AL., NATURE, vol. 313, 1985, pages 810 - 812
POTYRYKUS ET AL., PLANT MOL. BIOL. REP., vol. 3, 1985, pages 117 - 128
PRIOLI; SONDAHL, NATURE BIOTECHNOLOGY, vol. 7, 1989, pages 589 - 594
PU GAO ET AL: "Type V CRISPR-Cas Cpf1 endonuclease employs a unique mechanism for crRNA-mediated target DNA recognition", CELL RESEARCH - XIBAO YANJIU, vol. 26, no. 8, 22 July 2016 (2016-07-22), GB, CN, pages 901 - 913, XP055366082, ISSN: 1001-0602, DOI: 10.1038/cr.2016.88 *
RASMUSSEN ET AL., PLANT SCI., vol. 89, 1993, pages 199 - 207
ROBERTA H. SMITH, PLANT TISSUE CULTURE
S. ROEST; GILISSEN, ACTA BOT. NEERL., vol. 38, no. 1, 1989, pages 1 - 23
SAMAC ET AL., TRANSGENIC RES., vol. 13, no. 4, August 2004 (2004-08-01), pages 349 - 61
SCHIML SIMON ET AL: "CRISPR/Cas-Mediated Site-Specific Mutagenesis in Arabidopsis thaliana Using Cas9 Nucleases and Paired Nickases.", METHODS IN MOLECULAR BIOLOGY (CLIFTON, N.J.) 2016, vol. 1469, 2016, pages 111 - 122, XP009503887, ISSN: 1940-6029 *
SHAN ET AL., NAT. BIOTECH., vol. 31, 2013, pages 686 - 688
SHEPARD; TOTTEN, PLANT PHYSIOL., vol. 55, 1975, pages 689 - 694
SHEPARD; TOTTEN, PLANT PHYSIOL., vol. 60, 1977, pages 313 - 316
SIMON SCHIML ET AL: "Repair of adjacent single-strand breaks is often accompanied by the formation of tandem sequence duplications in plant genomes", PROCEEDINGS NATIONAL ACADEMY OF SCIENCES PNAS, vol. 113, no. 26, 15 June 2016 (2016-06-15), US, pages 7266 - 7271, XP055365806, ISSN: 0027-8424, DOI: 10.1073/pnas.1603823113 *
SIMON SCHIML ET AL: "Revolutionizing plant biology: multiple ways of genome engineering by CRISPR/Cas", PLANT METHODS, vol. 12, no. 1, 28 January 2016 (2016-01-28), GB, XP055365824, ISSN: 1746-4811, DOI: 10.1186/s13007-016-0103-0 *
SIMON SCHIML ET AL: "The CRISPR/Cas system can be used as nuclease for in planta gene targeting and as paired nickases for directed mutagenesis in Arabidopsis resulting in heritable progeny", THE PLANT JOURNAL, vol. 80, no. 6, 11 November 2014 (2014-11-11), GB, pages 1139 - 1150, XP055290201, ISSN: 0960-7412, DOI: 10.1111/tpj.12704 *
TAN ET AL., THEOR. APPL. GENET., vol. 75, 1987, pages 105 - 108
WU ET AL., BIOCHEM BIOPHYS RES COMMUN, vol. 446, no. 1, 28 March 2014 (2014-03-28), pages 261 - 266
YAMANO ET AL., CELL, vol. 165, no. 4, 2016, pages 949 - 962
ZETSCHE ET AL., CELL, vol. 163, 2015, pages 759 - 771
ZETSCHE ET AL., CELL, vol. 163, no. 3, 2015, pages 759 - 771

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2020011985A1 (fr) 2018-07-12 2020-01-16 Keygene N.V. Système crispr/nucléase de type v pour édition de génome dans des cellules végétales
CN112888444A (zh) * 2018-08-14 2021-06-01 因思科瑞普特公司 经由批量细胞培养在自动化模块和仪器中对经核酸酶编辑的序列的改进的检测
WO2020089448A1 (fr) 2018-11-01 2020-05-07 Keygene N.V. Arn guide double pour édition de génome crispr/cas dans des cellules végétales
WO2023285478A1 (fr) * 2021-07-14 2023-01-19 Scienza Biotechnologies 4 B.V. Procédé pour la génération de protoplastes à génome modifié à partir de tissus végétaux à propagation clonale

Similar Documents

Publication Publication Date Title
EP3472325B1 (fr) Procédé de modification ciblée de l'adn dans des cellules végétales
US20200080110A1 (en) Method for targeted alteration of duplex dna
JP2020505937A (ja) 植物細胞における標的遺伝子変化の方法
WO2018115389A1 (fr) Procédés de modification génétique ciblée dans des cellules végétales
US20240002868A1 (en) Insect resistant inir6 transgenic maize plants lacking a selectable marker and junction
US20220364105A1 (en) Inir12 transgenic maize
US11369073B2 (en) INIR12 transgenic maize
US11326177B2 (en) INIR12 transgenic maize
US11359210B2 (en) INIR12 transgenic maize
US20220030822A1 (en) Inht26 transgenic soybean
CA3188408A1 (fr) Mais transgenique inir12
US20220010321A1 (en) Dual guide rna for crispr/cas genome editing in plants cells
US20200270626A1 (en) Balanced indels
WO2023130031A2 (fr) Maïs transgénique inot1824
CN116529370A (zh) 具有特征性原间隔子相邻基序或特征性指导rna识别位点的可切除植物转基因基因座
CN116367714A (zh) 具有经修饰的转基因基因座的转基因作物植物的基因组编辑

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 17835475

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 17835475

Country of ref document: EP

Kind code of ref document: A1