WO2019148405A1

WO2019148405A1 - IL-4Rα ANTIBODY AND USE THEREOF

Info

Publication number: WO2019148405A1
Application number: PCT/CN2018/074890
Authority: WO
Inventors: 许峥; 李响; 宋瑞
Original assignee: 北京凯因科技股份有限公司
Priority date: 2018-02-01
Filing date: 2018-02-01
Publication date: 2019-08-08
Also published as: ZA202004861B; RU2758092C1; KR20200116967A; KR102652133B1

Abstract

The present invention belongs to the technical field of antibodies. Provided are an antibody specifically binding to human interleukin-4 receptor (hIL-4R) or an antigen-binding fragment thereof, a pharmaceutical composition comprising the antibody or antigen-binding fragment, and a use thereof. Further, the present invention also provides a nucleic acid molecule encoding the antibody, a vector and host cell comprising the nucleic acid molecule, and a method for preparing the antibody.

Description

IL-4Rα antibody and use thereof

Technical field

The present invention is in the field of antibody technology and relates to a humanized IL-4R antibody and the use of the antibody in the treatment of diseases associated with IL-4/IL-4Rα signaling.

Background technique

Allergic diseases (such as allergic rhinitis) can be well treated with antihistamines and specific immunological drugs, but for some more serious allergic diseases such as atopic dermatitis and asthma, there is no specific treatment. Non-specific immunosuppression remains the primary treatment modality.

There are more than 235 million asthma patients worldwide, of which about 10-20% are not effectively controlled by existing drugs (asthma worsens) and the cost of treatment for this part of the population accounts for 80% of all asthma treatment expenditures. Atopic dermatitis affects 10-20% of children and 3-10% of adults, of which about 20% are moderate to severe atopic dermatitis, and there is currently no effective treatment.

Oral/intravenous broad-spectrum immunosuppressive agents such as steroids, cyclosporin A, methotrexate, azathioprine and mycophenolate mofetil can effectively alleviate the symptoms of the disease. The activity of these immunosuppressive agents is mainly derived from downstream regulators that target inflammation (such as transcription factors): such as steroid-binding glucocorticoid receptors and inhibition of key transcription factors that drive inflammation (such as NF-kB); cyclosporin A is a calcineurin inhibitor that blocks the expression of IL-2 required for T cell activation and proliferation by transcription factor activation of T cell nuclear factor (NFAT).

Systemic drug broad-spectrum immunosuppressive agents often cause a series of side effects such as fluid retention, glucose intolerance, hypertension, muscle weakness, osteoporosis, hypothalamic-pituitary-adrenal axis inhibition, and increased infection due to their pleiotropic effects. risk. Although topical medications (such as inhalants, topical drops, skin sprays, ointments, etc.) can reduce the side effects of systemic medications, it is difficult to effectively treat severe allergic diseases. Euclisa, a non-steroidal PDE4 inhibitor approved by Pfizer last December, is only effective in patients with mild to moderate atopic dermatitis.

Given the high incidence of allergic diseases, especially atopic dermatitis and asthma, and the limitations of broad-spectrum immunosuppressive therapy (safety and efficacy), especially for some severe patients, there is an unmet clinical need to address A safer and more effective specific treatment.

The type 2 inflammatory pathway describes an inflammatory pathway in which Th2 cells play a key role. Th2 cells play a key role in the type 2 inflammatory pathway by secreting the type 2 cytokines IL-4, IL-5 and IL-13. IL-4 promotes the differentiation of Th cells into Th2 cells and proliferates, and Th2 cells further produce IL-4, IL-5 and IL-13. IL-5 promotes eosinophil differentiation in bone marrow, IL-4, IL-5 and IL-13 promote the transfer of eosinophils to specific tissues, IL-4 and IL-13 also B cell serotypes Transformation leads to IgE, which also plays an important role in mucus secretion, goblet cell hyperplasia, smooth muscle contraction, and collagen production.

Typical markers of activation of type 2 inflammatory pathways are elevated IgE, eosinophils, and TARC. If type 2 immune responses are over-activated, severe allergic diseases can occur, with different disease manifestations in different tissues, depending on where they occur. Different can be divided into atopic dermatitis, chronic sinusitis, nasal polyps and asthma.

IL-4 and IL-13 are potent regulators of type 2 immune responses and exhibit corresponding functions depending on the binding receptor. Although IL-4 and IL-13 have only 25% amino acid homology, their receptor complexes (type I receptor and type II receptor) share a common component IL-4Rα, depending on the expression distribution. Different cells play different roles. IL-4 can function through type I receptors and type II receptors, while IL-13 can only function through type II receptors. IL-4 binds with high affinity to IL-4Rα and is independent of γ-chain or IL-13Rα1, while IL-4Rα increases the affinity of IL-13 for binding to 13Rα1.

The direct manifestation of severe allergic diseases is the presence of high concentrations of IgE and eosinophils, so the early target for targeting the type 2 inflammatory pathway is IgE, but later studies have found that targeting IgE for the treatment of severe allergic diseases Not universal. With further understanding of the type 2 inflammatory pathway, IL-4 and IL-13, the key drivers of the type 2 inflammatory pathway, have become a hot research target for a new generation of antibody drugs for severe allergic diseases.

The biological activity of IL-4 is mediated by specific cell surface IL-4 receptors. Human IL-4 receptor alpha (hIL-4R alpha) antibodies are described in U.S. Patents 5,707,072 and 7,186,809. Some methods of using hIL-4R antibodies are described in U.S. Patents 5,714,146, 5,985,280 and 6,716,587. WO2005047331 relates to an IL-4Rα recombinant protein Altrakincept developed by Immunex, which competitively binds to IL-4 by spraying, inhibits the binding of IL-4 to cell surface IL-4Rα in vivo; US 6358509 discloses a one developed by GSK. The IL-4 antibody Pascolizumab prevents IL-4 from binding to IL-4Rα. Although these two IL-4 inhibitors showed good efficacy in early studies (preclinical, phase I clinical), they did not show efficacy in large-scale late-stage clinical studies, and development has stopped. U.S. Patent No. 8,679,487 discloses that Amgen has also developed an IL-4 receptor alpha antibody, AMG-317, which is a fully human IL-4Rα antibody that inhibits IL-4 and IL-13 activity but treats asthma. Phase II clinical failures have stopped development.

Examples of anti-IL-13 antibody molecules include: CAT-354 as disclosed in US07/0128192 or WO2005007699; TNX-650 disclosed in WO2005062967 and WO2005062972, and NTC00441818 published by Clinical Trails Gov. Identifier; QAX- disclosed by Clinical Trails Gov. Identifier 576 (NTC 532 233); US20060140948 or WO2006055638, filed in the name of Abgenix, U.S. Patent No. 6,465,528 to Amgen; a Centocor, Inc. as Applicant's WO2005091856; and as disclosed in WO2007080174, filed in the name of Glaxo, and in the name of Novartis, WO2007045477 Anti-IL-13 antibody.

Typically, the IL-13 antibody Tralokinumab, developed by AstraZeneca, is expected to have Phase III clinical results for the treatment of severe asthma in the second half of 2017 and is expected to be the world's first marketed IL-13 antibody. At the same time, AstraZeneca and Abbott jointly developed a companion diagnostic method based on the biomarkers periostin and DPP4. In addition, Tralokinmub has also completed Phase IIb clinical trials for the treatment of specific dermatitis.

An IL-13 antibody drug, Lebrikizumab, developed by Roche. At the end of February 2016, Roche disclosed two Phase III clinical trial data, with one win and one loss. In LavoltaI, Lebrikizumab was shown to significantly reduce the rate of asthma exacerbation, whereas in Lavolta II, similar results were not obtained. According to information disclosed at the 2017 JP Morgan conference, Roche has stopped the development of asthma indications, and multiple Phase II clinical trials for COPD, atopic dermatitis, and idiopathic pulmonary fibrosis are underway.

After the development of the previous IL-4 or IL-13 monofunctional inhibitors encountered many setbacks (there is no product on the market yet), it is thought that blocking IL-4 and IL-13 at the same time may be a feasible approach. At the same time, blocking IL-4 and IL-13 can be achieved by at least two methods: one is IL-4Rα antibody; the other is bispecific antibody of IL-4 and IL-13.

A drug that targets both IL-4 and IL-13, Sanofi's SAR156597, published in WO2009052081, is a dual variable domain Ig (DVD-Ig) bispecific antibody for the treatment of systemic crust. Disease and idiopathic pulmonary fibrosis, currently in phase II clinical.

WO2005023860 relates to an IL-4 mutant Pitrakinra developed by Aerovance, which binds IL-4Rα with high affinity and is a dual antagonist of IL-4 and IL-13, which can significantly improve FEV1 (forced expiratory volume in one second) in asthma patients. . PEG-modified Pitrakinra (Aeroderm) was the first dual blocker to conduct a clinical trial of atopic dermatitis, although it showed a certain improvement in symptoms, but the improvement in disease endpoint was not statistically significant.

In addition, Roche has also used the Lebrikizumab-modified targeting of IL-4 and IL-13 bispecific antibodies through the "Knobs into Holes" technology platform, but no clinical progress has been made. Regeneron's IL-4Rα and IL-13Rα fusion proteins prepared by Dual Trap technology have achieved good results in early clinical studies (reducing biomarkers) but stopped due to lack of funds.

WO2010053751 relates to an IL-4Rα antibody developed by Regeneron, which blocks both IL-4 and IL-13 to modulate type 2 immunity. The antibody in this patent application involves six complementarity determining regions, the sequences of which are:

HCDR1 is: Gly-Phe-Thr-Phe-X5-X6-Tyr-X8, wherein X5 is Asp or Arg (preferably Arg), X6 is ASP or Ser (Asp), X8 is Ala or Gly (Ala)

HCDR2 is X1-Ser-X3-X4-X5-X6-X7-X8, wherein X1=Ile or Leu (preferably Ile), X3=Gly, Tyr or Arg, X4=Ser, Asp or Thr, X5=Gly or Ser (preferably Gly), X6=Gly, Ser or Val, X7=Ser or Asn (preferably Asn), and X8=Thr, Lys or Ile

HCDR3 is Ala-Lys-X ³ -X ⁴ -X ⁵ -X ⁶ -X ⁷ -X ⁸ -X ⁹ -X ¹⁰ -X ¹¹ -X ¹² -X ¹³ -X ¹⁴ -X ¹⁵ -X ¹⁶ -X ¹⁷ -X ¹⁸ , wherein X3 = Asp, Glu or Trp, X4 = Gly or Arg, X5 = Leu, Thr or Arg, X6 = Gly, Arg or Ser, X7 = Ile or Gly, X8 = Thr, Phe or Tyr, X9 =Ile, Asp or Phe, X10=Arg, Tyr or Asp, X11=Pro, Tyr or deletion, X12=Arg or deletion, X13=Tyr or deletion, X14=Tyr or deletion, X15=Gly or deletion, X16=Leu Or missing, X17=Asp or missing, and X18=Val or missing

LCDR1 is Gln-X ² -X ³ -X ⁴ -X ⁵ -X ⁶ -X ⁷ -X ⁸ -X ⁹ -X ¹⁰ -X ¹¹ , where X2=Asp, Ser or Val, X3=Ile or Leu, X4 =Ser, Leu or Asn, X5=Asn, Tyr or Ile, X6=Trp, Ser or Tyr, X7=Ile or deletion, X8=Gly or deletion, X9=Tyr or deletion, X10=Asn or deletion, X11=Tyr Or missing

LCDR2 is X ¹ -X ² -Ser, where X1=Leu, Ala or Val, X2=Ala or Gly

LCDR3 is X ¹ -Gln-X ³ -X ⁴ -X ⁵ -X ⁶ -Pro-X ⁸ -Thr, where X1=Gln or Met, X3=Ala or Tyr, X4=Leu or Asn, X5=Gln or Ser , X6 = Thr, Phe or His, X8 = Tyr, Ile or Trp.

As a protein drug, the amino acid sequence of the protein's primary structure is the basis of the protein's spatial structure, and the spatial structure directly determines its function. Small changes in the amino acid sequence may lead to large changes in the spatial structure, which in turn leads to functional changes. The variable region of an antibody comprises six complementarity determining regions (CDRs), namely the HCDR1, HCDR2, HCDR3 and light chain LCDR1, LCDR2, LCDR3 of the heavy chain. Among them, HCDR3 is the most highly variable in structure and sequence, and is also the key region that best reflects the diversity and specificity of antibody binding. The complementarity determining region of an antibody is a key region for maintaining antibody activity. In many cases, even if one of them is changed to a similar amino acid, the binding of the entire antibody to the antigen is seriously affected, thereby affecting its biological activity. It is even more difficult to predict what changes in the activity of any antibody will be brought about by the modification of any CDR region.

Applicants of the present invention have surprisingly found that when the 108th R in the HCDR3 of the dupilumab antibody is increased to A or E, the binding ability of the antibody to the antigen can be increased (the EC50 is increased by more than 50%), and When the R at position 108 is changed to another representative amino acid such as Y, L or Q, the binding activity is reduced by more than 50%. Similarly, when R is changed to A or E, especially when 106-position R is changed to A or E, the binding activity (EC50) is reduced by 5-10 times. Thus, the present invention provides a novel IL-4Rα antibody having a binding activity significantly superior to that of piruzumab, which modulates type 2 by blocking IL-4 and IL-13 by binding to IL-4Rα. Immunity.

Summary of invention

One of the objects of the present invention is to provide an antibody or antigen-binding fragment thereof which specifically binds to human IL-4Rα, which is associated with IL compared to the currently available dupilumab antibody. The affinity of -4R has been further improved. The Dubrizumab variant contains the following amino acid substitutions relative to the Dubrizumab: the 24th amino acid Arg mutation of LVR is Ala, or the 28th amino acid Ser is mutated to Arg, or the 32nd amino acid Ser is mutated to Arg or Lys; the 100th Arg mutation of HVR is Ala, or the 106th Arg is mutated to Ala or Glu, or the 108th Arg is mutated to Ala, Glu, Gln, Tyr or Leu.

In particular, one aspect of the invention relates to an antibody or antigen-binding fragment thereof which specifically binds to human interleukin-4 receptor alpha (hIL-4R alpha), comprising a heavy chain variable region (HVR) and a light chain A variable region (LVR), wherein the heavy chain variable region comprises: CDR1 (HCDR1) having the amino acid sequence Gly-Phe-Thr-Phe-Arg-Asp-Tyr-Ala; and the amino acid sequence is Ile-Ser-Gly-Ser- CDR2 (HCDR2) of Gly-Gly-Asn-Thr; and, the amino acid sequence is

CDR3 (HCDR3) of Ala-Lys-Asp-Xaa1-Leu-Ser-Ile-Thr-Ile-Xaa2-Pro-Xaa3-Tyr-Tyr-Gly-Leu-Asp-Val, wherein Xaa1 is Arg or Ala, Xaa2 is Arg, Ala or Glu, Xaa3 is Arg, Ala or Glu;

The light chain variable region comprises: the amino acid sequence is

CDR1 (LCDR1) of Gln-Xaa4-Leu-Leu-Tyr-Xaa5-Ile-Gly-Tyr-Asn-Tyr,

Where Xaa4 is Ser or Arg, Xaa5 is Ser, Arg or Lys; the amino acid sequence is

Leu-Gly-Ser's CDR2 (LCDR2); and, the amino acid sequence is

CDR3 (LCDR3) of Met-Gln-Ala-Leu-Gln-Thr-Pro-Tyr-Thr.

In a preferred embodiment, the HCDR3 and LCDR1 are the following amino acid sequence (a) HCDR3:

Ala-Lys-Asp-Xaa1-Leu-Ser-Ile-Thr-Ile-Xaa2-Pro-Xaa3-Tyr-Tyr-Gly-Leu-Asp-Val, wherein Xaa1 is Arg, Xaa2 is Arg, and Xaa3 is Ala or Glu ; and, LCDR1: Gln-Xaa4-Leu-Leu-Tyr-Xaa5-Ile-Gly-Tyr-Asn-Iyr, wherein Xaa4 is Ser, Xaa5 is Ser; (b) HCDR3:

Ala-Lys-Asp-Xaa1-Leu-Ser-Ile-Thr-Ile-Xaa2-Pro-Xaa3-Tyr-Tyr-Gly-Leu-Asp-Val, wherein Xaa1 is Arg, Xaa2 is Ala or Glu, and Xaa3 is Arg ; and, LCDR1: Gln-Xaa4-Leu-Leu-Tyr-Xaa5-Ile-Gly-Tyr-Asn-Tyr, wherein Xaa4 is Ser, Xaa5 is Ser; (c) HCDR3:

Ala-Lys-Asp-Xaa1-Leu-Ser-Ile-Thr-Ile-Xaa2-Pro-Xaa3-Tyr-Tyr-Gly-Leu-Asp-Val, wherein Xaa1 is Ala, Xaa2 is Arg, and Xaa3 is Arg; , LCDR1: Gln-Xaa4-Leu-Leu-Tyr-Xaa5-Ile-Gly-Tyr-Asn-Tyr, wherein Xaa4 is Ser, Xaa5 is Ser; (d) HCDR3:

Ala-Lys-Asp-Xaa1-Leu-Ser-Ile-Thr-Ile-Xaa2-Pro-Xaa3-Tyr-Tyr-Gly-Leu-Asp-Val, wherein Xaa1 is Arg, Xaa2 is Arg, and Xaa3 is Arg; , LCDR1: Gln-Xaa4-Leu-Leu-Tyr-Xaa5-Ile-Gly-Tyr-Asn-Tyr, wherein Xaa4 is Arg, Xaa5 is Ser; (e) HCDR3:

Ala-Lys-Asp-Xaa1-Leu-Ser-Ile-Thr-Ile-Xaa2-Pro-Xaa3-Tyr-Tyr-Gly-Leu-As p-Val, wherein Xaa1 is Arg, Xaa2 is Arg, and Xaa3 is Arg; And, LCDR1: Gln-Xaa4-Leu-Leu-Tyr-Xaa5-Ile-Gly-Tyr-Asn-Tyr, wherein Xaa4 is Ser and Xaa5 is Arg or Lys.

In a preferred embodiment, the amino acid sequence of the HVR is SEQ ID NO: 1. In a preferred embodiment, the amino acid sequence of the LVR is SEQ ID NO: 2. In a preferred embodiment, the amino acid sequence of the LVR is selected from the group consisting of SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, and SEQ ID NO:9. In a preferred embodiment, the amino acid sequence of the HVR is selected from the group consisting of SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15 and SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21. And SEQ ID NO: 23 and SEQ ID NO: 25.

In a preferred embodiment, the HVR and LVR are selected from the group consisting of SEQ ID NO: 1 and SEQ ID NO: 3, SEQ ID NO: 1 and SEQ ID NO: 5, SEQ ID NO: 1 and SEQ ID NO: 7, SEQ ID NO: 1 and SEQ ID NO: 9, SEQ ID NO: 11 and SEQ ID NO: 2, SEQ ID NO: 13 and SEQ ID NO: 2, SEQ ID NO: 15 and SEQ ID NO: 2, SEQ ID NO: 17 and SEQ ID NO: 2, SEQ ID NO: 19 and SEQ ID NO: 2, SEQ ID NO: 21 and SEQ ID NO: 2, SEQ ID NO: 23 and SEQ ID NO: 2, or SEQ ID NO: 25 and SEQ ID NO: 2.

In a most preferred embodiment, the HVR and LVR are selected from the group consisting of SEQ ID NO: 17 and SEQ ID NO: 2, or SEQ ID NO: 19 and SEQ ID NO: 2.

In another aspect, the present invention is also a pharmaceutical composition comprising an antibody or antigen-binding fragment thereof of the present invention and a pharmaceutically acceptable carrier. Also, the present invention relates to an isolated nucleic acid molecule encoding the antibody or antigen-binding fragment thereof of the present invention; an expression vector comprising the nucleic acid molecule of the present invention, and an expression vector comprising the same according to the present invention. Host cells, preferably eukaryotic cells.

In another aspect, the present invention relates to a method of producing an antibody or antigen-binding fragment thereof which specifically binds to human IL-4R, the method comprising expressing under conditions conducive for expression of the antibody or antigen-binding fragment thereof of the present invention The nucleic acid molecule of the present invention, and the expressed antibody or antigen-binding fragment thereof is recovered.

In another aspect, the invention relates to the use of an antibody or antigen-binding fragment thereof for the preparation of a medicament for the prevention or treatment of a disease or condition associated with IL-4/IL-4Rα signaling in humans. In a preferred embodiment, the disease or condition is selected from the group consisting of: asthma, atopic dermatitis, arthritis, herpes, chronic primary urticaria, scleroderma, hypertrophic scar, Whipole disease, benign prostatic hyperplasia, COPD, Atopic dermatitis, idiopathic pulmonary fibrosis, allergic reaction, Kawasaki disease, sickle cell disease, Churg-Strauss syndrome, Graves' disease, pre-eclampsia, Sjogren's syndrome, autoimmune lymph Tissue hyperplasia syndrome, autoimmune hemolytic anemia, Barrett's esophagus, autoimmune uveitis, tuberculosis or kidney disease.

In another aspect, the invention relates to a method of preventing or treating a disease or condition associated with IL-4/IL-4Rα signaling in a human comprising administering the antibody of any one of claims 1-8 to a subject. Or an antigen binding fragment thereof. In a preferred embodiment, the disease or condition is selected from the group consisting of: asthma, atopic dermatitis, arthritis, herpes, chronic primary urticaria, scleroderma, hypertrophic scar, Whipole disease, benign prostatic hyperplasia, COPD, Atopic dermatitis, idiopathic pulmonary fibrosis, allergic reaction, Kawasaki disease, sickle cell disease, Churg-Strauss syndrome, Graves' disease, pre-eclampsia, Sjogren's syndrome, autoimmune lymph Tissue hyperplasia syndrome, autoimmune hemolytic anemia, Barrett's esophagus, autoimmune uveitis, tuberculosis or kidney disease. In a preferred embodiment, the disease or condition is atopic dermatitis or asthma. In a preferred embodiment, the antibody or antigen-binding fragment thereof is used in combination with other drugs for the treatment of autoimmune diseases. In a preferred embodiment, the antibody or antigen-binding fragment thereof is used in combination with a hormonal drug, an immunosuppressant or an antihistamine.

In another aspect, the present invention relates to an article or kit comprising a container and a package insert, wherein the container contains the antibody or antigen-binding fragment thereof of the present invention, or the pharmaceutical composition of the present invention, The package insert contains the instruction manual for the drug. In a preferred embodiment, the article or kit further comprises one or more containers containing one or more other agents or conditions for preventing or treating a disease or condition associated with IL-4/IL-4Rα signaling in the human body. drug. In a preferred embodiment, the other drug is a hormonal drug, an immunosuppressant or an antihistamine.

DRAWINGS

Figure 1 is an SDS-PAGE diagram of the dupilumab variant D1-D9: Lane 1 is the molecular weight marker, lane 2 is D1, lane 3 is D2, lane 4 is D3, lane 5 is D4, lane 6 is D5, lane 7 is D6, lane 8 is D7, lane 9 is D8, and lane 10 is D9.

Figure 2 is a SEC detection map of the Dubrizumab variant D8.

Figure 3 shows the biological effect of in vitro neutralization of IL-4 by Dubrizumab and Dubrizumab variants D5, D7, D8 and D9. Dubrizumab only inhibits 92% of cell growth, whereas D8 and D9 have better inhibition, and the inhibition rate is 98%, which is obviously better than that of pirumab.

Figures 4A-4H show the results of the stability comparison of different storage conditions, such as high temperature, intense light irradiation, repeated freeze-thaw, and strong acid conditions of pirubizumab and pedizumab variants. Fig. 4A is a graph showing the SEC results of three samples at 50 °C, and Fig. 4B is a graph showing the results of ELISA of three samples at 50 °C. Figure 4C is a SEC result plot of three samples under repeated freeze-thaw conditions, and Figure 4D is a ELISA result plot of three samples under repeated freeze-thaw conditions. Figure 4E is a graph of SEC results for three samples under strong acid conditions, and Figure 4F is a graph of ELISA results for three samples under strong acid conditions. Figure 4G is a SEC result plot of three samples at 4500lx and Figure 4H is an ELISA result plot of three samples at 4500lx.

Detailed description of the invention

1. Definition:

"IL-4R", CD124, is a type I membrane-transparent glycoprotein composed of 825 amino acids (25 signal peptide domains, 207 extracellular domains, 24 membrane-penetrating portions, and 569 intracellular domains). The extracellular domain has one CKR-SF domain and one type III fibrin domain, and there are six N-binding sugar chain adhesion sites. Distributed in T cells, B cells, NK cells, monocytes/macrophages, neutrophils, hematopoietic precursor cells, mast cells, endothelial cells, fibroblasts, keratinocytes, etc., IL-4R and IL-13R The alpha chain is equivalent, and binding to IL-4 can cause several intracellular proteins to be phosphorylated by tyrosine.

"Disease associated with IL-4/IL-4Rα signaling" means a disease in which biological function mediated by IL-4/IL-4Rα signaling is involved. Examples of diseases associated with IL-4/IL-4Rα signaling include, for example, inflammatory diseases or conditions such as asthma, atopic dermatitis, chronic obstructive pulmonary disease (COPD), inflammatory bowel disease, multiple sclerosis, joints Inflammation, allergic rhinitis, eosinophilic esophagitis and psoriasis.

In some embodiments, the disease associated with IL-4/IL-4Rα signaling is airway inflammation. In some embodiments, the disease associated with IL-4/IL-4Rα signaling is cutaneous inflammation or atopic dermatitis.

"Allergic reactions," "allergic diseases," or "allergic conditions" are considered inflammatory diseases caused by the interaction of genetic and environmental factors. Molecular and cellular immune mechanisms involved in the development of allergic diseases include changes in the expression of T cell immunoglobulin mucin regions caused by attenuated natural immune stimuli. Changes in the balance of

helper T cells

1, 2 and regulatory T cell balance Change and many other factors. Among allergic diseases, atopic dermatitis, asthma, and allergic rhinitis are the most common inflammatory conditions in patients with allergies; these patients often suffer from multiple clinical symptoms. The pathogenesis of allergy is associated with an abnormal immune response against exogenous antigens (Mueller et al. (2002) Structure, binding, and antagonists in the IL-4/IL-13 receptor syste m, Biochim Biophys Acta 1592: 237-250) . Overproduction of antigen-specific IgE is an essential factor in triggering allergic inflammation. Abnormal type 2 T helper cell (Th2) polarization contributes to an increased IgE response. Activated T cells produce interleukin-4 (IL-4) and interleukin-13 (IL-13), the major Th2 cytokines that initiate and maintain immune and inflammatory responses in allergic reactions.

IL-4 and IL-13 signaling are mediated through two different receptor complexes with a shared subunit IL-4 receptor alpha (IL-4Ralpha), which contributes to overlapping organisms between the two cytokines Answer. IL-4Rα forms two distinct heterodimeric receptor complexes that mediate the biological functions of IL-4 and IL-13 in a tissue and response-specific manner. Dubrizumab is an antagonist monoclonal antibody directed against human IL-4Rα that inhibits the biological activity induced by IL-4 and IL-13. Dubrizumab blocks IL-4 signaling by preventing its binding to the receptor subunit, and inhibition of IL-13 signaling is likely to be mediated through interference with dimeric receptor interactions.

Dubrizumab, a fully human monoclonal antibody against the shared IL-4R alpha subunit, was developed by Regeneron Pharmaceuticals, Inc. and is currently in the treatment of moderate to severe asthma and treatment of moderate to severe atopic dermatitis. In the test.

As used herein, an "antibody" is an immunoglobulin molecule consisting of four peptide chains, two heavy chains (H) and two light chains (L) interconnected by disulfide bonds, each heavy chain comprising a heavy chain variable region ( HVR or VH) and heavy chain constant region, the heavy chain constant region comprises three domains of CH1, CH2 and CH3, each light chain comprising a light chain variable region (LVR or VL) and a light chain constant region, a light chain constant region Containing a domain (CL1), the VH and VL regions can be further divided into hypervariable regions called complementarity determining regions (CDRs), which are interspersed with more conserved regions called framework regions (FR), each VH and VL consists of three CDRs and four FRs, arranged from the amino terminus to the carboxy terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4. Herein, the heavy chain constant region may be selected from IgG1, IgG2, IgG3 or IgG4, preferably IgG4, and the light chain constant region is selected from

Or λ.

The term "variable region" is used herein to describe a region of a portion of an antibody that differs between antibody sequences and that relates to the binding and specificity of a particular antibody to its particular antigen. However, variability is usually not evenly distributed throughout the variable region of the antibody. It typically focuses on three segments called the complementarity determining regions (CDRs) or hypervariable regions in the light and heavy chain variable regions. The relatively conservative portion of the variable region is referred to as the framework region (FR). The variable regions of the native heavy and light chains each comprise four FRs, most of which adopt a beta-sheet conformation, joined by three CDRs that form a circular junction and in some cases form part of a beta-sheet structure. The CDRs in each chain are held together in close proximity by the FR and together with the CDRs of the other chain contribute to the formation of the antigen binding site of the antibody. The constant region is not directly involved in the binding of the antibody to the antigen, but exhibits multiple effector functions, such as the involvement of antibodies in antibody-dependent cellular cytotoxicity.

The terms "complementarity determining region", "hypervariable region" and "CDR" refer to one or more of the hypervariable regions or complementarity determining regions (CDRs) present in the variable regions of an antibody light or heavy chain (see, Kabat, EA et al, Sequences of Proteins of Immunological Interest, National Institutes of Health, Bethesda, Md., (1987)). These terms include the hypervariable regions defined by Kabat et al. ("Sequences of Proteins of Immunological Interest," Kabat E., et al., USD ept. of Health and Human Services, 1983) or hypervariable loops in the three-dimensional structure of antibodies (Chothia and Lesk, J Mol. Biol. 196901). -917 (1987)). The CDRs in each chain remain in close proximity through the framework regions and, together with the CDRs from other chains, promote the formation of antigen binding sites.

The terms "framework region" and "FR" refer to one or more of the framework regions of the variable regions of the antibody light and heavy chains (see, Kabat, EA et al, Sequences of Proteins of Immunological Interest, National Institutes of Health, Bethesda, Md., (1987)). . These terms include those amino acid sequences in the light and heavy chains of the antibody that are located between the amino terminus and the first CDR, those between the CDRs, and those between the third CDR and the start of the constant region.

CDR and FR residues can be defined according to standard sequences (Kabat et al, Sequences of Proteins of Immunological Interes, National Institutes of Health, Bethesda Md. (1987)) and structural definitions (Chothia and Lesk, J. Mot. Biol. 196:901-217 (1987)). determine.

As indicated herein, reference is made to the numbering scheme of Kabat, EA, et al., Sequences of Proteins of Immunological Interest (National Institutes of Health, Bethesda, Md. (1987) and (1991). Kabat utilizes methods for assigning residue numbers to each amino acid in the listed sequences, And this method of assigning residue numbers has become a standard in the art. When it is explicitly stated that the Kabat numbering is used, the specification follows the Kabat numbering scheme. When the Kabat numbering is not indicated, the sequential amino acid sequence numbering (ie, the amino acid use in the sequence is used) Sequential integers (1, 2, 3, etc.) are numbered from left to right in the direction from the amino terminus to the carboxy terminus.

The "affinity" of an antibody to an antigen or epitope is a term well understood in the art and refers to the extent or strength of binding of an antibody to an epitope. Affinity can be measured and/or expressed in a variety of ways known in the art including, but not limited to, an equilibrium dissociation constant (KD or Kd, which can be defined as the ratio of the dissociation rate of the antibody to the rate of binding, ie, _Koff / K _on ), apparent equilibrium dissociation constant (KD' or Kd') and IC50 (the amount required to achieve 50% inhibition in competition assays); the relative affinity of the humanized antibody can also be correlated with the mouse or Combined with antibody to determine. For the purposes of the present invention, affinity is the average affinity of a particular population of antibodies that bind an antigen or epitope. The affinity of the antibody can be measured using an enzyme-linked immunosorbent assay (ELISA) or a fluorescence activated cell sorting (FACS) assay. In the examples herein, the affinity of the antibody of the present invention to IL-4R was determined by an ELISA method, as described in the examples. .

2. Method for preparing antibody of the present invention

Antibodies of the invention can be produced by any available method, such as recombinant expression techniques. Nucleic acids encoding light and heavy chain variable regions operably linked to a constant region can be inserted into an expression vector. The light and heavy chains can be cloned in the same or different expression vectors. A DNA segment encoding an immunoglobulin chain can be operably linked to a control sequence of an expression vector that ensures expression of the immunoglobulin polypeptide. Expression control sequences include, but are not limited to, promoters (eg, naturally-binding or heterologous promoters), signal sequences, enhancer elements, and transcription termination sequences. In one embodiment, the expression control sequence is a prokaryotic promoter system in a vector capable of transforming or transfecting a eukaryotic host cell. Once the vector is introduced into the appropriate host, the host is maintained under conditions suitable for high level expression of the nucleotide sequence and collection and purification of the antibody.

The expression vector can be replicable in any host organism, as an episome or as an integral part of the host chromosomal DNA. In one embodiment, the expression vector contains a selectable marker (eg, ampicillin resistance, hygromycin resistance, tetracycline resistance, or neomycin resistance) to allow detection of those cells that are transformed by the intended DNA sequence.

Expression vectors can be used to express antibodies of the invention from any host cell, including prokaryotic host cells (e.g., E. coli), yeast host cells, mammalian host cells, plant host cells, and insect host cells.

In one embodiment, an antibody of the invention is produced using E. coli. Other prokaryotic hosts suitable for this application include bacilli, such as Bacillus and other Enterobacteriaceae, such as Salmonella, S. genus, and various Pseudomonas species. In these prokaryotic hosts, expression vectors can also be prepared, which expression vectors typically contain expression control sequences (e.g., origins of replication) that are compatible with the host cell. In addition, any number of various known promoters will be present, such as a lactose promoter system, a tryptophan (trp) promoter system, a beta-lactamase promoter system, or a promoter system from lambda phage. Promoters typically control expression, optionally together with an operator sequence, and have a ribosome binding site sequence, etc., for initiation and completion of transcription and translation.

Other microorganisms such as yeast can also be used to express the antibodies of the invention. For example, the genus Saccharomyces can be used as a yeast host with a suitable promoter containing expression control sequences (e.g., promoters), origins of replication, termination sequences, and other sequences as desired. Promoters for yeast expression techniques include 3-phosphoglycerate kinase and other glycolytic enzyme promoters. Inducible yeast promoters include, but are not limited to, promoters derived from alcohol dehydrogenase, isocytochrome C, and enzymes responsible for maltose and galactose utilization.

In another embodiment, a mammalian tissue cell culture can be used to express and produce an antibody of the invention. Any mammalian tissue cell can be used in such methods, and many suitable host cell lines capable of secreting heterologous proteins (eg, intact immunoglobulins) have been developed in the art, including mammalian BHK or CHO cell lines, various Cos. Cell lines, HeLa cell lines, preferably myeloma cell lines or transformed B cells or hybridomas. In one embodiment, the cells are non-human. Expression vectors for mammalian cells can include expression control sequences, such as origins of replication, promoters and enhancers, as well as necessary processing signal sites, such as ribosome binding sites, RNA splice sites, polyadenylation sites, and transcription. Terminate the subsequence. In one embodiment, the expression control sequence is a promoter derived from an immunoglobulin gene, SV40, adenovirus, bovine papilloma virus, cytomegalovirus, and the like.

A vector containing a polynucleotide sequence of interest (e.g., heavy and light chain coding sequences and expression control sequences) can be transferred to a host cell by a known method, which varies depending on the type of cell host. For example, calcium chloride transfection is commonly used in prokaryotic cells, while calcium phosphate treatment, electroporation, lipofection, biotrajective or viral transfection can be used in other cellular hosts. Other methods for transforming mammalian cells include the use of polybrene, protoplast fusion, liposomes, electroporation, and microinjection. To produce transgenic animals, the transgene can be microinjected into the fertilized egg or can be introduced into the embryonic stem cell genome, and the nuclei of such cells are transferred into the enucleated oocyte.

When a nucleic acid molecule encoding a heavy chain and a light chain is cloned into a separate expression vector, the vector can be co-transfected to obtain expression and assemble the intact immunoglobulin. Once expressed, intact antibodies, dimers thereof, individual light and heavy chains, or other immunoglobulin forms of antibodies can be purified according to standard methods in the art, including ammonium sulfate precipitation, affinity column, column chromatography, HPLC purification. , gel electrophoresis, etc. At least about 90 to 95% homogenous, substantially pure immunoglobulin can be prepared for pharmaceutical use. In another embodiment, substantially pure humanized antibodies of at least about 98 to 99% or greater homogeneity can be produced for use in pharmaceutical formulation and methods.

Accordingly, the invention provides methods of expressing an antibody of the invention comprising: (a) transforming a host cell with a nucleic acid molecule encoding an antibody described herein, and (b) culturing the transformed host cell under conditions permitting expression of the antibody. Known techniques for including a selectable marker on a vector can be used such that the labeled host cell expressing the antibody can be readily selected.

An "antigen-binding fragment" of an antibody, or "antigen-binding portion", referred to as an antibody, refers to one or more fragments of the antibody that retain the ability to specifically bind to an antigen, such as hIL-4R. It has been demonstrated that the antigen binding function of antibodies can be achieved by certain fragments of full length antibodies. Examples of "antigen-binding fragments" of antibodies include, but are not limited to: (i) Fab fragments, ie, monovalent fragments consisting of VL, VH, CL1 and CH1 domains; (ii) F(ab')2 fragments, ie by hinges a divalent fragment consisting of two F(ab') fragments joined by a disulfide bond; (iii) an Fd fragment consisting of a VH and CH1 domain; (iv) consisting of a one-armed VL and VH domain of the antibody Fv fragment; (v) a dAb fragment consisting of a VH domain; and (vi) a CDR. Furthermore, although the two domains VL and VH of the Fv fragment are encoded by different genes, they can be joined together by a synthetic linker into a single linked strand, where the VL and VH regions are paired. A monovalent molecule (called a single chain Fv, scFv) is formed. Such single chain antibodies are also encompassed within the scope of "antigen-binding fragments" of antibodies.

The antibody of the present invention can be produced by a method comprising culturing a host cell containing a DNA sequence encoding the antibody and expressing the antibody under conditions permitting expression of the antibody, and then recovering the produced antibody from the culture. .

The medium used to culture the cells may be any conventional medium for culturing the host cells, such as a minimal medium or a compatible medium containing a suitable additive. A suitable medium can be obtained by commercially available or a suitable medium can be prepared according to the published method. The polypeptide produced by the cell can then be recovered from the culture medium by conventional methods, including isolating the host cell from the culture medium by centrifugation or filtration, and precipitating the supernatant or the protein component in the filtrate with a salt such as ammonium sulfate, according to The type of the peptide of interest is selected by various chromatographic methods such as exchange chromatography, gel filtration chromatography, affinity chromatography, and the like.

3. Treatment methods and medicaments

The present invention provides a pharmaceutical composition comprising the anti-IL-4Rα antibody of the present invention or an antigen-binding fragment thereof. The pharmaceutical compositions of this invention will be administered with appropriate carriers, excipients, and other formulations. These formulations are included in the formulation to improve delivery and tolerability and the like. A large number of suitable formulations can be found in the pharmacopoeia well known to all pharmaceutical chemists: Remington's Pharmaceutical Sciences, Mack Publishing Company, Easton, PA.

The dose to be administered is adjusted depending on the age and size of the subject, the target disease, the symptoms, the route of administration, and the like. When the antibody of the present invention is used to treat various IL-4R-related disorders and diseases in an adult, the antibody of the present invention can be administered intravenously, usually in a single dose of from about 0.01 to about 20 mg/kg per kilogram of body weight. More preferably, it is from about 0.1 to about 15, from about 1 to about 10, or from about 3 to about 10 mg/kg of body weight. The frequency and duration of treatment can be adjusted depending on the severity of the condition.

Various drug delivery systems are known for administering the pharmaceutical compositions of the invention, such as encapsulation in liposomes, microparticles, microcapsules, recombinant cells capable of expressing a variant virus, receptor-mediated endocytosis Role (see, eg, Wu et al. (1987), J. Biol. Chem. 262: 4429-4432). Methods of administering a drug include, but are not limited to, intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, dura, and oral. The pharmaceutical compositions can be administered by any convenient route, such as by perfusion or intravenous bolus injection, epithelial and mucosal layers (e.g., oral mucosa, rectal and intestinal mucosa), and can be administered with other bioactive agents. The mode of administration can be systemic or topical.

The pharmaceutical composition can also be delivered by sacs, especially by liposome sac (see Langer (1990) Science 249: 1527-1533; Treat et al. (1989) in Liposomes in the Therapy of Infectious Disease and Cancer, Lopez Berestein And Fidler (ed.), Liss, New York, pp. 353-365; Lopez-Berestein, ibid., pp. 317-327).

In some cases, the pharmaceutical composition can be delivered in a controlled release system. In one embodiment, a pump can be used (see Langer, supra; Sefton (1987) CRC Crit. Ref. Biomed. Eng. 14:201). In another embodiment, polymeric materials can be employed (see Medical Applications of Controlled Release, Langer and Wise, ed., CRC Pres., Boca Raton, Florida (1974). For a discussion of other controlled release systems see Langer ( 1990) Science 249: 1527-1533.

Formulations for injection may include dosage forms for intravenous, subcutaneous, intradermal and intramuscular injection, drip, and the like. These injectable preparations can be prepared by the disclosed methods. For example, an injection preparation can be prepared by dissolving, suspending or emulsifying an antibody or a salt thereof in a sterile aqueous medium or an oil medium conventionally used for injection. Aqueous media for injection are, for example, physiological saline, isotonic solutions containing glucose and other adjuvants, and the like. They can be combined with suitable solubilizing agents such as alcohols (such as ethanol), polyols (such as propylene glycol, polyethylene glycol), nonionic surfactants [such as polysorbate 80, HCO-50 (polyoxygenated hydrogenated castor oil) Ethylene (50 mol) adduct) or the like is used in combination. The oil medium used is, for example, sesame oil, soybean oil, and the like. They can be used in combination with solubilizing agents such as benzyl benzoate, benzyl alcohol and the like. The injection prepared in this manner is preferably packaged in a suitable ampoule.

Monotherapy and Combination Therapy Antibodies and antibody fragments of the invention are useful for treating diseases and disorders that can be ameliorated, inhibited, or ameliorated by reducing IL-4 activity. These diseases include those characterized by aberrant expression or overexpression of IL-4 or a host's abnormal response to IL-4 production. IL-4-related diseases treated with the antibodies or antibody fragments of the invention include, for example, arthritis (including septic arthritis), herpes, chronic primary urticaria, scleroderma, hypertrophic scars, Whipple's disease, benign Prostatic hyperplasia, lung disease such as asthma (mild, moderate and severe), inflammatory diseases such as inflammatory bowel disease, allergic reaction, Kawasaki disease, sickle cell disease, Churg-Strauss syndrome, Graves's Disease, pre-eclampsia, Sjogren's syndrome, autoimmune lymphoproliferative syndrome, autoimmune hemolytic anemia, Barrett's esophagus, autoimmune uveitis, tuberculosis (sickness), atopic dermatitis, ulcerative colon Inflammation, fibrosis, and kidney disease (see U.S. Patent 7,186,809).

The invention encompasses combination therapies wherein an anti-IL-4Rα antibody or antibody fragment is administered in combination with one or more therapeutic agents (or second therapeutic agents). Co-administration and combination therapy are not limited to simultaneous administration, but also include treatment regimens that administer at least one anti-IL-4Rα antibody or antibody fragment in a course of treatment involving administration of at least one other therapeutic agent to the patient. The second therapeutic agent may be another IL-4 antagonist, such as another antibody/antibody fragment, or a soluble cytokine receptor, an IgE antagonist, an anti-asthma that can be administered by inhalation or other suitable means. Drugs (corticosteroids, non-steroidal agents, beta agonists, leukotrienes, antagonists, xanthine, fluticasone, salmeterol, salbutamol). In a specific embodiment, an anti-IL-4R antibody or antibody fragment of the invention can be administered with an IL-1 antagonist, such as a rilonacept or an IL-13 antagonist. The second agent may include one or more leukotriene receptor antagonists to treat conditions such as allergic inflammatory diseases such as asthma and allergies. Examples of leukotriene receptor antagonists include, but are not limited to, montelukast, pranlustat, and zafirlukast. The second agent can include a cytokine inhibitor such as one or more TNF (etanercept, ENBRELTM), IL-9, IL-5 or IL-17 antagonist.

The invention also encompasses the use of any of the anti-IL-4Rα antibodies or antigen-binding fragments described herein in the manufacture of a medicament for treating a disease or condition, wherein the disease or condition is by eliminating, inhibiting or reducing human interleukin-4 (hIL) -4) The activity is improved, improved or inhibited. Examples of such diseases or symptoms include, for example, arthritis, herpes, chronic primary urticaria, scleroderma, hypertrophic scar, Whipple's disease, benign prostatic hyperplasia, lung disease, asthma, inflammatory disease, allergic reaction , Kawasaki disease, sickle cell disease, Churg-Strauss syndrome, Graves' disease, pre-eclampsia, Sjogren's syndrome, autoimmune lymphoproliferative syndrome, autoimmune hemolytic anemia, Barrett Esophagus, autoimmune uveitis, tuberculosis (sickness), kidney disease, atopic dermatitis, and asthma.

In one aspect of the invention, there is provided a pharmaceutical composition comprising an antibody or antigen-binding fragment thereof of the invention that binds to human IL-4R, and a pharmaceutically acceptable carrier.

Herein, the drug, the pharmaceutical composition, and the pharmaceutical preparation (agent) may be used interchangeably if there is no contradiction or special explanation. As used herein, a pharmaceutically acceptable excipient refers to a non-toxic filler, stabilizer, diluent, carrier, solvent or other formulation excipient. For example, diluents, excipients such as microcrystalline cellulose, mannitol, etc.; fillers such as starch, sucrose, etc.; binders such as starch, cellulose derivatives, alginates, gelatin and/or polyethylene Pyrrolidone; a disintegrating agent such as calcium carbonate and/or sodium hydrogencarbonate; an absorption enhancer such as a quaternary ammonium compound; a surfactant such as cetyl alcohol; a carrier, a solvent such as water, physiological saline, kaolin, soap clay, etc.; Lubricants such as talc, calcium/magnesium stearate, polyethylene glycol, and the like. Further, the pharmaceutical composition of the present invention is preferably an injection.

In some embodiments of the invention, the antibody or antigen-binding fragment thereof in the pharmaceutical composition of the invention is present at a concentration of from 1 mg/ml to 1000 mg/ml, preferably at a concentration of from 10 mg/ml to 1000 mg/ml, more preferably It is present at a concentration of from 50 mg/ml to 500 mg/ml, more preferably at a concentration of from 100 mg/ml to 300 mg/ml.

The pharmaceutical composition of the present invention preferably has a pH of from 3.0 to 9.0. Among them, a buffer system, a preservative, a surface tension agent, a chelating agent, a stabilizer, and a surfactant may be further included. In one embodiment of the invention, the pharmaceutical composition of the invention is an aqueous formulation. This preparation is usually in solution or suspension. In a particular embodiment of the invention, the pharmaceutical composition is a stable aqueous solution. In another embodiment of the invention, the pharmaceutical composition is a lyophilized formulation which is dissolved by the physician or patient prior to use in a solvent and/or diluent.

Example 1: Construction of expression vector for Dubrizumab variant

HindIII cleavage site ( AAGCCT ), KoZAK sequence ( GCCGCCACC ), ATG, signal peptide gene ATGGAGAGAGACACACTCCTGCTATGGGTACTGCTGCTCTGGGTTCCAGGTTCCACTGGT and Dulbuzumab heavy chain coding gene (SEQ ID NO: 35, including heavy chain variable region coding gene SEQ ID NO :27 and the constant region IgG4 encoding gene), the termination code TAATAATAA and the EcoRI encoding gene GAATCC were sequentially fused in tandem, and the gene fragment was obtained by chemical synthesis. The above fragment was inserted into the eukaryotic expression plasmid pCDNA 3.1 (+) by EcoRI and HindIII sites and verified by sequencing, and the expression plasmid PCDNA3.1(+)-DH for the antibody degree of the Pruzumab heavy chain was obtained.

HindIII cleavage site ( AAGCCT ), KoZAK sequence ( GCCGCCACC ), ATG, signal peptide gene ATGGAGAGAGACACACTCCTGCTATGGGTACTGCTGCTCTGGGTTCCAGGTTCCACTGGT and Dulbuzumab light chain coding gene (SEQ ID NO: 38, including light chain variable region coding gene SEQ ID NO : 28 and constant region

The coding gene, the termination code TAATAATAA and the EcoRI coding gene GAATCC are sequentially fused in tandem, and the gene fragment is obtained by chemical synthesis. The above fragment was inserted into the eukaryotic expression plasmid pCDNA 3.1 (+) by EcoRI and HindIII sites and verified by sequencing, and the expression plasmid PCDNA3.1(+)-DL for the antibody degree of the pruzumab light chain was obtained.

According to the same method as above, a series of expression plasmids of the variants of pirimumab were prepared, respectively: pCDNA 3.1 (+)-D1L, pCDNA 3.1 (+)-D2L, pCDNA 3.1 (+)-D3L, pCDNA 3.1 ( +)-D4L, pCDNA 3.1(+)-D5H, pCDNA3.1(+)-D6H, pCDNA 3.1(+)-D7H, pCDNA 3.1(+)-D8H, pCDNA3.1(+)-D9H, pCDNA 3.1( +)-D10H, pCDNA 3.1(+)-D11H, pCDNA 3.1(+)-D12H, pCDNA 3.1(+)-DH and pCDNA 3.1(+)-DL.

Variant D1 is the mutation of the 24th amino acid Arg of LVR of Dubrizumab to Ala, the gene sequence of LVR encoding D1 is SEQ ID NO: 4; and the mutant D2 is the 28th of LVR of Dubrizumab The amino acid Ser is mutated to Arg, the gene sequence of the LVR encoding D2 is SEQ ID NO: 6; and the mutant D3 or D4 is the mutation of the 32nd amino acid Ser of the LVR of the Dubrizumab to Arg or Lys, encoding D3 and D4, respectively. The gene sequences of the LVR are SEQ ID NOS: 8 and 10, respectively; the mutant D5 is the mutation of the 100th Arg of the HVR of the Dubrizumab to Ala, and the gene sequence of the HVR encoding D5 is SEQ ID NO: 12; The body D6 or D7 is mutated to Ala or Glu at position 106 of HVR of Dubrizumab, and the gene sequences of HVR encoding D6 or D7 are SEQ ID NOS: 14 and 16 respectively; mutants D8-D12 are respectively The 108th Arg of HVR of the pirizumab is mutated to Ala, Glu, Gln, Tyr or Leu, and the gene sequence of the HVR encoding D8-D12 is SEQ ID NO: 18, 20, 22, 24 or 26, respectively. The heavy chain constant region of each mutant is IgG4, and the light chain constant region is

.

Example 2: Expression and purification of Dubrizumab and its variants

The construct used in Example 1 DNA embodiment, the antibody expressed by the eukaryotic cell expressing ^{FreeStyle TM 293-F Cells (Invitrogen} Corporation, R790-07). According FreeStyle ^TM 293 ExpressionSystem Operating Manual day cell density was adjusted to 1x10 ⁶ cells / ml before transfection plasmid. On the day of plasmid transfection, the plasmids were combined according to the following table, mixed with the transfection reagent, and added to the cell culture medium. After continuous incubation for 5-7 days at 37 ° C, 8% CO ₂ , the cell culture supernatant was collected for antibody purification.

The expression supernatant was filtered through a 0.22 μM filter, and the expressed antibody was captured from the expression supernatant using a Mabpurix affinity chromatography column (purchased from Sepax, Inc., 65008), and equilibrated with an equilibration buffer (120 mM Tris + 100 mM NaCl, pH 7.5). After chromatography, the column was passed through an affinity column and eluted with an elution buffer (0.15 M glacial acetic acid, pH 2.8). The purified antibody was subjected to SDS PAGE and SEC detection, and the purity was 95% or more.

Example 3: Determination of antigen binding affinity

In vitro affinity assays were performed using the purified antibodies described in Example 2. The plate was coated with 2 μg/ml of IL-4R (R&D, 7700-4R-050), 100 μl/well, and the plate was sealed, placed at 4 ° C overnight, and washed three times with the washing solution the next day. Then, a 10% bovine serum albumin solution was prepared by using a washing solution, and added to the microplate in 200 μl/well, and the plate was washed 3 times with a washing solution at 37 ° C for 2 hours; a gradient diluted antibody solution was added at 100 μl/well, 37 ° C 2 Hour, wash plate 3 times with washing solution; dilute solution (2% bovine serum albumin solution using washing solution) 1/5000 diluted HRP-labeled secondary antibody (No. ab6858, product from Abcam), add to 100 μl/well In the plate, the plate was washed at 37 ° C for 1 hour; the plate was washed 5 times with the washing solution; the TMB coloring solution was added at 100 μl/well, and the reaction was allowed to stand at room temperature for 5 to 10 minutes, and the reaction was terminated with 50 μl/well of a stop solution. The absorbance was measured at a wavelength of 450 nm.

抗体名称Antibody name	IC ₅₀(nM) IC ₅₀ (nM)
D1R24A-LD1R24A-L	3.893.89
D2S28R-LD2S28R-L	4.984.98
D3S32R-LD3S32R-L	6.876.87
D4S32K-LD4S32K-L	4.194.19
D5R100A-HD5R100A-H	3.943.94
D6R106A-HD6R106A-H	5.385.38
D7R106E-HD7R106E-H	18.4818.48
D8R108A-HD8R108A-H	1.981.98
D9R108E-HD9R108E-H	3.203.20
D10R108Q-HD10R108Q-H	12.0112.01
D11R108Y-HD11R108Y-H	14.2314.23
D12R108L-HD12R108L-H	13.0513.05

Dubrizumab

3.31

The results show that, with respect to the degree of matching Lu monoclonal antibody, D8 and D9 having improved EC _50, respectively 3.200nM and 1.977nM, especially D8, with an EC50 of approximately 60% of horses Lu mAb.

Example 4: Biological effects of neutralizing IL-4 in vitro

The biological effect assay for neutralizing IL-4 in vitro was performed using the purified antibody described in Example 2. TF-1 cells were cultured for 24 h at 37 ° C under 5% carbon dioxide using RPMI 1640 basal medium (C22400500BT from GIBCO). TF-1 cells were collected the next morning, then washed 3 times with RPMI1640 medium, and resuspended in complete medium (RPMI1640 basal medium containing 10% fetal bovine serum) at a cell concentration of 4.0×10 ⁵ cells/ml. . Using a 96-well cell culture plate, a cell suspension, and a gradient-diluted antibody sample and IL-4 were added and mixed and mixed. Incubate for 2 days at 37 ° C under 5% carbon dioxide. According to CCK-8 (CK04, product source Dojindo company) instruction manual, add CCK-8 dilution solution, incubated at 37 ° C, 5% carbon dioxide for 2.5 h, microplate reader detection, with 630 nm as reference wavelength, 450 nm for determination The absorbance was measured at the wavelength, and the cell viability was measured.

The results in Figure 3 show that Dubrizumab inhibits 92% of cell growth, while D8 and D9 have better inhibitory effects with an inhibition rate of 98%, which is significantly better than Dubrizumab.

Example 5: Stability of Dubrizumab mutants

In order to further investigate the properties of the mutated antibody, the purity of the main peak after antibody storage was detected by SEC-HPLC method (SEC), and the relative activity of the antibody after storage was detected by ELISA. The stability and activity of the antibody and the original antibody pedizumab.

The purified antibody of the present invention and Dubrizumab were separately added to a buffer solution of 12.5 mM sodium acetate, pH: 6.15, to a final concentration of about 2.7 mg/ml. According to the experimental results of the pre-experiment, 1.5ml sample was added with 35.1μl 0.2M Tris-Base to reach pH 9.0, filtered and dispensed in 200μl/branch, each sub-packaged 7; 2.5ml sample plus 288μl 0.2M citric acid acidification To pH 3.0 or so, filter and dispense 200μl/branch, and pack 12 pieces each; finally, the remaining sample was filtered and sterilized, 200μl/piece, and each batch was 30 pieces. All samples were placed in clean, sterilized vials, covered with sterile rubber plugs, and sealed with aluminum lids.

SEC-HPLC detection: Separation of different molecular weight substances by gel filtration chromatography to quantitatively analyze the purity of the sample. The column is TSK G3000SWXL, mobile phase: 0.2 mol/L potassium phosphate buffer, 0.25 mol/L potassium chloride pH 6.2 ±0.1, flow rate 0.5 ml/min, wash time 30 min.

ELISA method (microplate reader detection): 2μg/ml IL-4R coated with the enzyme standard plate, the test sample 500ng/ml is the initial concentration 5 times diluted 8 concentration gradient, transferred to the enzyme plate and IL-4R combined, plus Goat anti-human Fab fragment secondary antibody (product of Jackson Immuno company), color development, reading plate, calculate the relative activity of the antibody of the present invention (relative activity means: the degree of the activity of the same plate in each test spot 1 time relative activity of the antibody of the invention).

Storage conditions include high temperature, strong light irradiation, repeated freezing and thawing, and strong acid. The specific operations, test points, and test items are as follows:

High temperature test: The sample was placed in a 50 ° C incubator for 20 days, and samples at 0, 5, 10, 15, and 20 were examined. The results are shown in Fig. 4A and Fig. 4B. The results of SEC-HPLC experiments showed that the stability of the test samples was consistent with the change trend of the pirimizumab. The purity of the sample at 0 o'clock was greater than that of the antibody of the present invention, and as the high temperature standing time was prolonged, less than 5% was reduced, and there was no significant difference in thermal stability. The ELISA results neglect the abnormal results (the second point of HC-108A in Fig. 4B), and the activity of the antibody of the present invention is always higher than that of the puruzumab, and the gap becomes larger as the high temperature standing time is prolonged, indicating the binding activity of the antibody of the present invention. The thermal stability is superior to that of piruzumab.

Repeated freezing and thawing: -80 ° C, room temperature repeated freezing and thawing 3 times, 5 times, detection of the change of the antibody of the present invention and Dubrizumab, the results see 4C and Figure 4D. From the results of SEC-HPLC, it was found that the purity of Dubrizumab did not change with the increase of the number of freeze-thaw cycles, and both of them were close to 100%. The purity of the antibody of the present invention was less than that of the puruzumab, and the purity of the main peak was only after repeated freeze-thaw cycles. Reduce to 5%. However, in terms of the effect on the activity after repeated freezing and thawing, the ELISA showed that the antibody of the present invention is superior to the pirizumab in reducing the activity caused by repeated freezing and thawing, and the antibody of the present invention has a high degree of freezing and thawing under the same conditions. Relative activity.

Strong acid effect: The pH of the sample was adjusted to 3.0 with citric acid, and placed at 25 ° C for 3 days, and the detection was observed at zero point, first day, and third day, respectively. From the SEC experimental results in Figure 4E, it can be seen that the purity of the three test samples decreased by about 10% from the zero point. After subtracting the abnormal point of the first day of HC-R108E in Figure 4E, the purity of all samples in the three days was hardly further reduced. The SEC peak map speculated that the strong acid treatment caused the sample to be destroyed from the 0 point, and some of the polymerization occurred and partially degraded. It can be seen from Fig. 4F that the binding activity of the antibody of the present invention after the strong acid treatment is significantly higher than that of the puruzumab under the same conditions, and it is presumed that since the test article is modified, the isoelectric point is lowered, thereby being more resistant to acid.

Light effect: The sample was placed in a drug stability test chamber at 25 ° C, 45001x light for 10 days, and samples were tested at 0, 5, and 10 days, respectively. The results are shown in Figures 4G and 4H. From the SEC results, it was found that the purity of the peak of the target of the antibody and the antibody of the present invention was extremely small. The ELISA results showed that the activity of the antibody of the present invention did not decrease with the extension of the illumination time, indicating that the light stability of the antibody of the present invention was slightly better than that of the antibody. Piruzumab.

Based on the above experimental results of high temperature, strong acid, light and repeated freezing and thawing, it can be seen that the influence of each factor on the stability of the antibody is not much different, but in terms of activity, the antibody of the present invention has better resistance than the Dubrizumab. Receptive, this is more advantageous in the later storage process.

Claims

An antibody or antigen-binding fragment thereof which specifically binds to human interleukin-4 receptor alpha (hIL-4Rα), comprising a heavy chain variable region (HVR) and a light chain variable region (LVR), wherein The heavy chain variable region contains:

The amino acid sequence is CDR1 (HCDR1) of Gly-Phe-Thr-Phe-Arg-Asp-Tyr-Ala;

The amino acid sequence is CDR2 (HCDR2) of Ile-Ser-Gly-Ser-Gly-Gly-Asn-Thr;

The amino acid sequence is

CDR3 (HCDR3) of Ala-Lys-Asp-Xaa1-Leu-Ser-Ile-Thr-Ile-Xaa2-Pro-Xaa3-Tyr-Tyr-Gly-Leu-Asp-Val, wherein Xaa1 is Arg or Ala, Xaa2 is Arg, Ala or Glu, Xaa3 is Arg, Ala or Glu;

The light chain variable region contains:

The amino acid sequence is CDR1 (LCDR1) of Gln-Xaa4-Leu-Leu-Tyr-Xaa5-Ile-Gly-Tyr-Asn-Tyr, wherein Xaa4 is Ser or Arg, and Xaa5 is Ser, Arg or Lys;

The amino acid sequence is CDR2 (LCDR2) of Leu-Gly-Ser; and,

The amino acid sequence is CDR3 (LCDR3) of Met-Gln-Ala-Leu-Gln-Thr-Pro-Tyr-Thr.
The antibody or antigen-binding fragment thereof according to claim 1, wherein the HCDR3 and LCDR1 are the following amino acid sequences

(a) HCDR3:

Ala-Lys-Asp-Xaa1-Leu-Ser-Ile-Thr-Ile-Xaa2-Pro-Xaa3-Tyr-Tyr-Gly-Leu-Asp-Val, wherein Xaa1 is Arg, Xaa2 is Arg, and Xaa3 is Ala or Glu ; and, LCDR1: Gln-Xaa4-Leu-Leu-Tyr-Xaa5-Ile-Gly-Tyr-Asn-Tyr, wherein Xaa4 is Ser, Xaa5 is Ser;

(b) HCDR3:

Ala-Lys-Asp-Xaa1-Leu-Ser-Ile-Thr-Ile-Xaa2-Pro-Xaa3-Tyr-Tyr-Gly-Leu-Asp-Val, wherein Xaa1 is Arg, Xaa2 is Ala or Glu, and Xaa3 is Arg ; and, LCDR1: Gln-Xaa4-Leu-Leu-Tyr-Xaa5-Ile-Gly-Tyr-Asn-Tyr, wherein Xaa4 is Ser, Xaa5 is Ser;

(c) HCDR3:

Ala-Lys-Asp-Xaa1-Leu-Ser-Ile-Thr-Ile-Xaa2-Pro-Xaa3-Tyr-Tyr-Gly-Leu-Asp-Val, wherein Xaa1 is Ala, Xaa2 is Arg, and Xaa3 is Arg; , LCDR1: Gln-Xaa4-Leu-Leu-Tyr-Xaa5-Ile-Gly-Tyr-Asn-Tyr, wherein Xaa4 is Ser, Xaa5 is Ser;

(d) LCDR3:

Ala-Lys-Asp-Xaa1-Leu-Ser-Ile-Thr-Ile-Xaa2-Pro-Xaa3-Tyr-Tyr-Gly-Leu-Asp-Val, wherein Xaa1 is Arg, Xaa2 is Arg, and Xaa3 is Arg; , LCDR1: Gln-Xaa4-Leu-Leu-Tyr-Xaa5-Ile-Gly-Tyr-Asn-Tyr, wherein Xaa4 is Arg, Xaa5 is Ser;

(e) LCDR3:

Ala-Lys-Asp-Xaa1-Leu-Ser-Ile-Thr-Ile-Xaa2-Pro-Xaa3-Tyr-Tyr-Gly-Leu-Asp-Val, wherein Xaa1 is Arg, Xaa2 is Arg, and Xaa3 is Arg; , LCDR1: Gln-Xaa4-Leu-Leu-Tyr-Xaa5-Ile-Gly-Tyr-Asn-Tyr, wherein Xaa4 is Ser and Xaa5 is Arg or Lys.
The antibody or antigen-binding fragment thereof according to claim 2, wherein the amino acid sequence of the HVR is SEQ ID NO: 1.
The antibody or antigen-binding fragment thereof according to any one of claims 1 to 3, wherein the amino acid sequence of the LVR is SEQ ID NO: 2.
The antibody or antigen-binding fragment thereof of any one of claims 1 to 3, wherein the amino acid sequence of the LVR is selected from the group consisting of SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7 and SEQ ID NO: 9. .
The antibody or antigen-binding fragment thereof of claim 4, wherein the amino acid sequence of the HVR is selected from the group consisting of SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19. SEQ ID NO: 21, SEQ ID NO: 23 and SEQ ID NO: 25.
The antibody or antigen-binding fragment thereof according to any one of claims 1 to 6, wherein the HVR and LVR are selected from the following amino acid sequence combinations:

SEQ ID NO: 1 and SEQ ID NO: 3,

SEQ ID NO: 1 and SEQ ID NO: 5,

SEQ ID NO: 1 and SEQ ID NO: 7,

SEQ ID NO: 1 and SEQ ID NO: 9,

SEQ ID NO: 11 and SEQ ID NO: 2,

SEQ ID NO: 13 and SEQ ID NO: 2,

SEQ ID NO: 15 and SEQ ID NO: 2,

SEQ ID NO: 17 and SEQ ID NO: 2,

SEQ ID NO: 19 and SEQ ID NO: 2,

SEQ ID NO: 21 and SEQ ID NO: 2,

SEQ ID NO: 23 and SEQ ID NO: 2, or

SEQ ID NO: 25 and SEQ ID NO: 2.
The antibody or antigen-binding fragment thereof of claim 7, wherein said HVR and LVR are selected from the group consisting of amino acid sequences as follows:

SEQ ID NO: 17 and SEQ ID NO: 2, or

SEQ ID NO: 19 and SEQ ID NO: 2.
A pharmaceutical composition comprising the antibody or antigen-binding fragment thereof of any one of claims 1-8 and a pharmaceutically acceptable carrier.
An isolated nucleic acid molecule encoding the antibody or antigen-binding fragment thereof of any of claims 1-8.
An expression vector comprising the nucleic acid molecule of claim 10.
A host cell comprising the expression vector of claim 11.
The host cell of claim 12 which is a eukaryotic cell.
A method of producing an antibody or antigen-binding fragment thereof that specifically binds to human IL-4R, the method comprising expressing claim 10 under conditions conducive for expression of the antibody or antigen-binding fragment thereof according to any one of claims 1-8 The nucleic acid molecule and recover the expressed antibody or antigen-binding fragment thereof.
Use of an antibody or antigen-binding fragment thereof according to any one of claims 1 to 8 for the preparation of a medicament for the prevention or treatment of a disease or condition associated with IL-4/IL-4Rα signaling in humans.
The use according to claim 15, wherein the disease or condition is selected from the group consisting of: asthma, atopic dermatitis, arthritis, herpes, chronic primary urticaria, scleroderma, hypertrophic scar, Whipole disease, benign prostatic hyperplasia, COPD, atopic dermatitis, idiopathic pulmonary fibrosis, allergic reaction, Kawasaki disease, sickle cell disease, Churg-Strauss syndrome, Graves' disease, pre-eclampsia, Sjogren's syndrome, autologous Immune lymphoproliferative syndrome, autoimmune hemolytic anemia, Barrett's esophagus, autoimmune uveitis, tuberculosis or kidney disease.
A method of preventing or treating a disease or condition associated with IL-4/IL-4Rα signaling in a human comprising administering the antibody or antigen-binding fragment thereof according to any one of claims 1-8.
The method of claim 17, wherein the disease or condition is selected from the group consisting of: asthma, atopic dermatitis, arthritis, herpes, chronic primary urticaria, scleroderma, hypertrophic scar, Whipole disease, benign prostatic hyperplasia, COPD, atopic dermatitis, idiopathic pulmonary fibrosis, allergic reaction, Kawasaki disease, sickle cell disease, Churg-Strauss syndrome, Graves' disease, pre-eclampsia, Sjogren's syndrome, autologous Immune lymphoproliferative syndrome, autoimmune hemolytic anemia, Barrett's esophagus, autoimmune uveitis, tuberculosis or kidney disease.
The method of claim 18, wherein the disease or condition is atopic dermatitis or asthma.
The method of any one of claims 17 to 19, wherein the antibody or antigen-binding fragment thereof is used in combination with other drugs for treating autoimmune diseases.
The method of any one of claims 17 to 19, wherein the antibody or antigen-binding fragment thereof is used in combination with a hormonal drug, an immunosuppressant or an antihistamine.
An article or kit comprising a container and a package insert, wherein the container contains the antibody of any one of claims 1-8, or an antigen-binding fragment thereof, or the pharmaceutical composition of claim 9, the package The insert contains the instruction manual for the drug.
The article or kit of claim 22, further comprising one or more containers containing one or more other agents that prevent or treat a disease or condition associated with IL-4/IL-4Rα signaling in the human body.
The article or kit of claim 23, wherein the other drug is a hormonal drug, an immunosuppressive agent or an antihistamine drug.