CN110105451B - IL-4R alpha antibodies and uses thereof - Google Patents

IL-4R alpha antibodies and uses thereof Download PDF

Info

Publication number
CN110105451B
CN110105451B CN201810100470.3A CN201810100470A CN110105451B CN 110105451 B CN110105451 B CN 110105451B CN 201810100470 A CN201810100470 A CN 201810100470A CN 110105451 B CN110105451 B CN 110105451B
Authority
CN
China
Prior art keywords
gly
ala
thr
leu
ser
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201810100470.3A
Other languages
Chinese (zh)
Other versions
CN110105451A (en
Inventor
许铮
李响
宋瑞
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Beijing Cain Technology Co ltd
Original Assignee
Beijing Cain Technology Co ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Beijing Cain Technology Co ltd filed Critical Beijing Cain Technology Co ltd
Priority to CN202110070349.2A priority Critical patent/CN113150146B/en
Priority to CN201810100470.3A priority patent/CN110105451B/en
Publication of CN110105451A publication Critical patent/CN110105451A/en
Application granted granted Critical
Publication of CN110105451B publication Critical patent/CN110105451B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2866—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against receptors for cytokines, lymphokines, interferons
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
    • C07K2317/565—Complementarity determining region [CDR]
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/76—Antagonist effect on antigen, e.g. neutralization or inhibition of binding
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/90—Immunoglobulins specific features characterized by (pharmaco)kinetic aspects or by stability of the immunoglobulin
    • C07K2317/92—Affinity (KD), association rate (Ka), dissociation rate (Kd) or EC50 value
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/90—Immunoglobulins specific features characterized by (pharmaco)kinetic aspects or by stability of the immunoglobulin
    • C07K2317/94—Stability, e.g. half-life, pH, temperature or enzyme-resistance

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Immunology (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)

Abstract

IL-4R alpha antibody and uses thereof. The invention belongs to the technical field of antibodies, and provides an antibody specifically bound with a human interleukin-4 receptor (hIL-4R) or an antigen binding fragment thereof, a pharmaceutical composition containing the antibody or the antigen binding fragment, and application of the antibody or the antigen binding fragment. In addition, the invention also provides a nucleic acid molecule for encoding the antibody, a vector and a host cell containing the nucleic acid molecule, and a method for preparing the antibody.

Description

IL-4R alpha antibodies and uses thereof
Technical Field
The invention belongs to the technical field of antibodies, and relates to a humanized IL-4R antibody and application of the antibody in treating diseases related to IL-4/IL-4R alpha signal transduction.
Background
Allergic diseases (e.g. allergic rhinitis) can be well treated by antihistamines and specific immune drugs, however non-specific immunosuppression remains the dominant treatment modality for some of the more serious allergic diseases that lack specific therapies such as atopic dermatitis and asthma.
About more than 2.35 billion asthmatics worldwide, of which about 10-20% cannot be effectively controlled by existing drugs (asthma exacerbation) and the treatment costs for this fraction account for 80% of all asthma treatment expenditures. Atopic dermatitis affects 10-20% of children and 3-10% of adults, of which about 20% of patients are moderate-to-severe atopic dermatitis and there is no effective therapeutic drug at present.
Oral/intravenous injection of broad-spectrum immunosuppressants such as steroids, cyclosporin A, methotrexate, thiooxazole purine and mycophenolate mofetil can effectively relieve the symptoms of diseases. The activity of these immunosuppressive agents derives mainly from downstream regulatory factors (such as transcription factors) that target inflammation: such as steroid binding to glucocorticoid receptor and thereby inhibiting the expression of key transcription factors that drive inflammation (e.g., NF-kB); cyclosporin a is a calcineurin inhibitor that prevents IL-2 expression required for T cell activation and proliferation by transcription factor activated nuclear T factor (NFAT).
Systemic administration of broad-spectrum immunosuppressants, due to their pleiotropic effects, often leads to a range of side effects, such as fluid retention, glucose intolerance, hypertension, muscle weakness, osteoporosis, hypothalamic-pituitary-adrenal axis inhibition and increased risk of infection. Although topical application (e.g., inhalants, topical drops, dermal sprays, ointments, etc.) can reduce the side effects of systemic administration, it is difficult to effectively treat severe allergic diseases. The non-steroidal PDE4 inhibitor, Eucrisa, as approved in the gregorian year in month 12, is only effective in patients with mild to moderate atopic dermatitis.
In view of the high incidence of allergic diseases, particularly atopic dermatitis and asthma, and the limitations (safety and efficacy) of broad-spectrum immunosuppressant therapy, there is an unmet clinical need, particularly for some severe patients, for more safe and effective specific therapeutic drugs.
Type 2 inflammatory pathway describes an inflammatory pathway in which Th2 cells play a key role. Th2 cells play a key role in the type 2 inflammatory pathway by secreting the type 2 cytokines IL-4, IL-5 and IL-13. IL-4 promotes the differentiation and proliferation of Th2 cells, and Th2 cells further produce IL-4, IL-5 and IL-13. IL-5 can promote eosinophil differentiation in bone marrow, IL-4, IL-5 and IL-13 can promote eosinophil metastasis to specific tissues, IL-4 and IL-13 can also convert serotypes of B cells to generate IgE, and IL-13 also has important roles in mucus secretion, goblet cell proliferation, smooth muscle contraction, collagen production and the like.
The typical signs of activation of type 2 inflammatory pathways are elevation of IgE, eosinophils and TARC, severe allergic disease if the type 2 immune response is over-activated, and different disease manifestations in different tissues, which can be classified as atopic dermatitis, chronic rhinosinusitis nasal polypus, asthma, etc. depending on the site of occurrence.
IL-4 and IL-13 are potent modulators of type 2 immune responses and exhibit corresponding functions depending on the binding receptor. IL-4 and IL-13 have only 25% amino acid homology, but their receptor complexes (type I and type II receptors) share a common component, IL-4R α, which exerts different effects depending on the cells expressing the distribution. IL-4 can act through both type I and type II receptors, whereas IL-13 can only act through type II receptors. IL-4 binds IL-4R α with high affinity and is independent of the γ -chain or IL-13R α 1, whereas IL-4R α increases the affinity of IL-13 for binding to 13R α 1.
The immediate manifestation of severe allergic disease is the presence of high concentrations of IgE and eosinophils, and thus the antibody target that targets the type 2 inflammatory pathway in the early phase is IgE, but later studies found that targeting IgE is not universal for the treatment of severe allergic disease. With the further understanding of the type 2 inflammatory pathway, the key drivers of the type 2 inflammatory pathway, IL-4 and IL-13, become the hot research targets of a new generation of antibody drugs for treating severe allergic diseases.
The biological activity of IL-4 is mediated by specific cell surface IL-4 receptors. Human IL-4 receptor alpha (hIL-4R alpha) antibodies are described in both U.S. Pat. Nos. 5717072 and 7186809. While some methods of using hIL-4R antibodies are described in U.S. Pat. Nos. 5714146, 5985280, and 6716587. WO2005047331 relates to an IL-4 Ra recombinant protein Altrakincept developed by Immunex, which competitively binds IL-4 by nebulization, inhibiting the binding of IL-4 to cell surface IL-4 Ra in vivo; an IL-4 antibody, Pascolizumab, developed by GSK, is disclosed in US6358509 to prevent IL-4 from binding to IL-4R α. Although these two IL-4 inhibitors showed good therapeutic effects in early studies (preclinical, phase I clinical), they did not show therapeutic effects in large-scale late-stage clinical studies, and development thereof has been stopped. US8679487 discloses that Amgen also developed an IL-4 receptor alpha antibody AMG-317, a fully human IL-4R alpha antibody, which inhibits the activity of IL-4 and IL-13, but was not developed in phase II clinical encounter with asthma.
Examples of anti-IL-13 antibody molecules include: CAT-354 as disclosed in US07/0128192 or WO 2005007699; TNX-650 disclosed in WO2005062967 and WO2005062972 and NTC00441818 disclosed in Clinical rails Gov.Identifier; QAX-576(NTC532233) published by Clinical rails Gov. identifier; US20060140948 or WO2006055638, Amgen in the name of Abgenix, US 6468528; WO2005091856 by Centocor, Inc; and anti-IL-13 antibodies as disclosed in WO2007080174 in the name of Glaxo and in WO2007045477 in the name of Novartis.
The IL-13 antibody, traokinumab, typically developed by AstraZeneca, is expected to obtain phase III clinical results for the treatment of severe asthma in the next half year 2017, and is expected to be the first IL-13 antibody to market worldwide. Meanwhile, AstraZeneca and Abbott together develop a companion diagnostic method based on the biomarkers periodin and DPP 4. In addition, Trlokinumab has also completed phase IIb clinical trials for the treatment of atopic dermatitis.
One of the IL-13 antibody drugs developed by Roche, Lebrikizumab, 2016 at the end of 2 months, Roche, disclosed 2 phase three clinical trial data with positive and negative results. In LavoltaI, Lebrikizumab was shown to significantly reduce the exacerbation rate of asthma, while in LavoltaII, similar results were not obtained. According to the information disclosed in 2017JP Morgan conference, Roche has stopped the development of asthma indications, while multiple phase II clinics in COPD, atopic dermatitis, idiopathic pulmonary fibrosis are in progress.
After a number of setbacks in the previous development of inhibitors of IL-4 or IL-13 monofunctional activity (no product currently on the market), it was thought that blocking both IL-4 and IL-13 would be a viable approach. Simultaneous blockade of IL-4 and IL-13 can be achieved in at least two ways: one is an IL-4R α antibody; the second is a bispecific antibody for IL-4 and IL-13.
An in-the-art drug targeting both IL-4 and IL-13 has been SAOFi's SAR156597, disclosed in WO2009052081, which is a dual variable domain Ig (DVD-Ig) bispecific antibody used in the treatment of systemic scleroderma and idiopathic pulmonary fibrosis, currently in phase II clinics.
WO2005023860 relates to an IL-4 mutant Pitrakinra developed by Aerovanice, can be combined with IL-4R alpha with high affinity, is a dual antagonist of IL-4 and IL-13, and can remarkably improve FEV1 (forced expiratory volume in one second) of asthma patients. PEG-modified pitrakira (aeroderm) was the first dual blocker to perform clinical trials for atopic dermatitis, and although some symptomatic improvement was shown, the disease endpoint improvement was not statistically significant.
In addition, Roche has also been based on Lebrikizumab engineering of targeted IL-4 and IL-13 bispecific antibodies through the "Knobs to Hores" technology platform, but currently has no clinical progress. The IL-4R α and IL-13R α fusion proteins produced by Regeneron by the Dual Trap technique had good results (reduced biomarkers) in early clinical studies, but were discontinued due to lack of funds.
WO2010053751 relates to an IL-4R alpha antibody developed by Regeneron corporation, which can block IL-4 and IL-13 simultaneously so as to regulate type 2 immunity. The antibody of this patent application relates to 6 complementarity determining regions whose sequences are:
HCDR1 is: Gly-Phe-Thr-Phe-X5-X6-Tyr-X8, wherein X5 is Asp or Arg (preferably Arg), X6-ASP or Ser (Asp), X8-Ala or Gly (Ala)
HCDR2 is X1-Ser-X3-X4-X5-X6-X7-X8, wherein X1 ═ Ile or Leu (preferably Ile), X3 ═ Gly, Tyr or Arg, X4 ═ Ser, Asp or Thr, X5 ═ Gly or Ser (preferably Gly), X6 ═ Gly, Ser or Val, X7 ═ Ser or Asn (preferably Asn), and X8 ═ Thr, Lys or Ile
HCDR3 is
Ala-Lys-X3-X4-X5-X6-X7-X8-X9-X10-X11-X12-X13-X14-X15-X16-X17-X18Wherein X3 ═ Asp, Glu or Trp, X4 ═ Gly or Arg, X5 ═ Leu, Thr or Arg, X6 ═ Gly, Arg or Ser, X7 ═ Ile or Gly, X8 ═ Thr, Phe or Tyr, X9 ═ Ile, Asp or Phe, X10 ═ Arg, Tyr or Asp, X11 ═ Pro, Tyr or deletion, X12 ═ Arg or deletion, X13 ═ Tyr or deletion, X14 ═ Tyr or deletion, X15 ═ Gly or deletion, X16 ═ Leu or deletion, X17 ═ Asp or deletion, and X18 ═ Val or deletion
LCDR1 is Gln-X2-X3-X4-X5-X6-X7-X8-X9-X10-X11Wherein X2 is Asp, Ser or Val, X3 is Ile or Leu, X4 is Ser, Leu or Asn, X5 is Asn, Tyr or Ile, X6 is Trp, Ser or Tyr, X7 is Ile or deleted, X8 is Gly or deleted, X9 is Tyr or deleted, X10 is Asn or deleted, X11 is Tyr or deleted
LCDR2 is X1-X2-Ser, wherein X1 ═ Leu, Ala or Val, X2 ═ Ala or Gly
LCDR3 is X1-Gln-X3-X4-X5-X6-Pro-X8-Thr, wherein X1 ═ Gln or Met, X3 ═ Ala or Tyr, X4 ═ Leu or Asn, X5 ═ Gln or Ser, X6 ═ Thr, Phe or His, and X8 ═ Tyr, Ile or Trp.
As protein drugs, the amino acid sequence of the primary structure of the protein is the basis of the spatial structure of the protein, and the spatial structure directly determines the function of the protein, and small changes in the amino acid sequence may cause a huge change in the spatial structure, and further cause a change in the function. The variable region of the antibody includes 6 Complementarity Determining Regions (CDRs), namely HCDR1, HCDR2, HCDR3 for the heavy chain and LCDR1, LCDR2, LCDR3 for the light chain. Among them, HCDR3 is the most highly variable in structure and sequence and is the most critical region for antibody binding diversity and specificity. The complementarity determining region of an antibody is a critical region for maintaining the activity of the antibody, and in many cases, even if one of the complementarity determining regions is changed to an amino acid with similar properties, the binding of the whole antibody to an antigen is seriously affected, and the biological activity is further affected. It is difficult to predict what changes will be made to the activity of an antibody by any alteration of the CDR regions.
The applicant of the present invention has surprisingly found that the binding capacity of the antibody to antigen can be increased (more than 50% increase in EC50) when R at position 108 in HCDR3 of dupilumab is changed to a or E, while the binding activity is decreased by more than 50% when R at position 108 is changed to another representative amino acid such as Y, L or Q. Similarly, when R is changed to A or E, especially when R is changed to A or E at position 106, the binding activity (EC50) is reduced by 5-10 times. Accordingly, the present invention provides a novel IL-4 Ra antibody with binding activity significantly superior to that of dolitumumab, which modulates type 2 immunity by binding to IL-4 Ra, while blocking IL-4 and IL-13.
Based on the public Information of WHO drugs (WHO Drug Information, Vol.26, No.4,2012), the amino acid sequence of the lepiruzumab is as follows:
the heavy chain amino acid sequence is as follows:
EVQLVESGGGLEQPGGSLRLSCAGSGFTFRDYAMTWVRQAPGKGLEWVSSISGSGGNTYYADSVKGRFTISRDNSKNTLYLQMNSLRAEDTAVYYCAKDRLSITIRPRYYGLDVWGQGTTVTVSSASTKGPSVFPLAPCSRSTSESTAALGCLVKDYFPEPVTVSWNSGALTSGVHTFPAVLQSSGLYSLSSVVTVPSSSLGTKTYTCNVDHKPSNTKVDKRVESKYGPPCPPCPAPEFLGGPSVFLFPPKPKDTLMISRTPEVTCVVVDVSQEDPEVQFNWYVDGVEVHNAKTKPREEQFNSTYRVVSVLTVLHQDWLNGKEYKCKVSNKGLPSSIEKTISKAKGQPREPQVYTLPPSQEEMTKNQVSLTCLVKGFYPSDIAVEWESNGQPENNYKTTPPVLDSDGSFFLYSRLTVDKSRWQEGNVFSCSVMHEALHNHYTQKSLSLSLG
the light chain amino acid sequence is as follows:
DIVMTQSPLSLPVTPGEPASISCRSSQSLLYSIGYNYLDWYLQKSGQSPQLLIYLGSNRASGVPDRFSGSGSGTDFTLKISRVEAEDVGFYYCMQALQTPYTFGQGTKLEIKRTVAAPSVFIFPPSDEQLKSGTASVVCLLNNFYPREAKVQWKVDNALQSGNSQESVTEQDSKDSTYSLSSTLTLSKADYEKHKVYACEVTHQGLSSPVTKSFNRGEC
summary of The Invention
It is an object of the present invention to provide antibodies or antigen-binding fragments thereof that specifically bind to human IL-4R α and that have improved affinity for IL-4R compared to currently available dupilumab antibodies. The dolugumab variant comprises the following amino acid substitutions relative to dolugumab: the 24 th amino acid Arg of the LVR is mutated into Ala, or the 28 th amino acid Ser is mutated into Arg, or the 32 th amino acid Ser is mutated into Arg or Lys; arg 100 of HVR is mutated to Ala, or Arg 106 is mutated to Ala or Glu, or Arg 108 is mutated to Ala, Glu, Gln, Tyr or Leu. Specifically, the application relates to an antibody which is a dolitumumab variant, wherein Arg at position 108 of a heavy chain variable region (HVR) of dolitumumab is mutated into Ala or Glu.
Specifically, one aspect of the present invention relates to an antibody or antigen-binding fragment thereof that specifically binds to human interleukin-4 receptor alpha (hIL-4 ra), comprising a heavy chain variable region (HVR) and a light chain variable region (LVR), wherein the heavy chain variable region comprises: CDR1 with the amino acid sequence of Gly-Phe-Thr-Phe-Arg-Asp-Tyr-Ala (HCDR 1); CDR2 having the amino acid sequence Ile-Ser-Gly-Ser-Gly-Gly-Asn-Thr (HCDR 2); and, a CDR3(HCDR3) having an amino acid sequence of Ala-Lys-Asp-Xaa1-Leu-Ser-Ile-Thr-Ile-Xaa2-Pro-Xaa3-Tyr-Tyr-Gly-Leu-Asp-Val, wherein Xaa1 is Arg or Ala, Xaa2 is Arg, Ala or Glu, Xaa3 is Arg, Ala or Glu;
the light chain variable region comprises: the amino acid sequence is CDR1(LCDR1) of Gln-Xaa4-Leu-Leu-Tyr-Xaa5-Ile-Gly-Tyr-Asn-Tyr, wherein Xaa4 is Ser or Arg, and Xaa5 is Ser, Arg or Lys; CDR2 with the amino acid sequence of Leu-Gly-Ser (LCDR 2); and, CDR3 having the amino acid sequence Met-Gln-Ala-Leu-Gln-Thr-Pro-Tyr-Thr (LCDR 3).
In a preferred embodiment, the HCDR3 and LCDR1 are the amino acid sequences of (a) HCDR 3: Ala-Lys-Asp-Xaa1-Leu-Ser-Ile-Thr-Ile-Xaa2-Pro-Xaa 3-Tyr-Gly-Leu-Asp-Val, wherein Xaa1 is Arg, Xaa2 is Arg, and Xaa3 is Ala or Glu; and, LCDR 1: Gln-Xaa4-Leu-Leu-Tyr-Xaa5-Ile-Gly-Tyr-Asn-Tyr, wherein Xaa4 is Ser, and Xaa5 is Ser; (b) HCDR 3: Ala-Lys-Asp-Xaa1-Leu-Ser-Ile-Thr-Ile-Xaa2-Pro-Xaa 3-Tyr-Gly-Leu-Asp-Val, wherein Xaa1 is Arg, Xaa2 is Ala or Glu, and Xaa3 is Arg; and, LCDR 1: Gln-Xaa4-Leu-Leu-Tyr-Xaa5-Ile-Gly-Tyr-Asn-Tyr, wherein Xaa4 is Ser, and Xaa5 is Ser; (c) HCDR 3: Ala-Lys-Asp-Xaa1-Leu-Ser-Ile-Thr-Ile-Xaa2-Pro-Xaa 3-Tyr-Gly-Leu-Asp-Val, wherein Xaa1 is Ala, Xaa2 is Arg, and Xaa3 is Arg; and, LCDR 1: Gln-Xaa4-Leu-Leu-Tyr-Xaa5-Ile-Gly-Tyr-Asn-Tyr, wherein Xaa4 is Ser, and Xaa5 is Ser; (d) HCDR 3: Ala-Lys-Asp-Xaa1-Leu-Ser-Ile-Thr-Ile-Xaa2-Pro-Xaa 3-Tyr-Gly-Leu-Asp-Val, wherein Xaa1 is Arg, Xaa2 is Arg, and Xaa3 is Arg; and, LCDR 1: Gln-Xaa4-Leu-Leu-Tyr-Xaa5-Ile-Gly-Tyr-Asn-Tyr, wherein Xaa4 is Arg and Xaa5 is Ser; (e) HCDR 3: Ala-Lys-Asp-Xaa1-Leu-Ser-Ile-Thr-Ile-Xaa2-Pro-Xaa 3-Tyr-Gly-Leu-Asp-Val, wherein Xaa1 is Arg, Xaa2 is Arg, and Xaa3 is Arg; and, LCDR 1: Gln-Xaa4-Leu-Leu-Tyr-Xaa5-Ile-Gly-Tyr-Asn-Tyr, wherein Xaa4 is Ser, and Xaa5 is Arg or Lys.
In a preferred embodiment, the amino acid sequence of the HVR is SEQ ID NO: 1. in a preferred embodiment, the amino acid sequence of said LVR is SEQ ID NO: 2. in a preferred embodiment, the amino acid sequence of said LVR is selected from the group consisting of SEQ ID NO: 3. SEQ ID NO: 5. SEQ ID NO: 7 and SEQ ID NO: 9. in a preferred embodiment, the amino acid sequence of the HVR is selected from SEQ ID NO: 11. SEQ ID NO: 13. SEQ ID NO: 15 and SEQ ID NO: 17. SEQ ID NO: 19. SEQ ID NO: 21 and SEQ ID NO: 23 and SEQ ID NO: 25.
in a preferred embodiment, the HVRs and LVRs are selected from the following combinations of amino acid sequences: SEQ ID NO: 1 and SEQ ID NO: 3, SEQ ID NO: 1 and SEQ ID NO: 5, SEQ ID NO: 1 and SEQ ID NO: 7, SEQ ID NO: 1 and SEQ ID NO: 9, SEQ ID NO: 11 and SEQ ID NO: 2, SEQ ID NO: 13 and SEQ ID NO: 2, SEQ ID NO: 15 and SEQ ID NO: 2, SEQ ID NO: 17 and SEQ ID NO: 2, SEQ ID NO: 19 and SEQ ID NO: 2, SEQ ID NO: 21 and SEQ ID NO: 2, SEQ ID NO: 23 and SEQ ID NO: 2, or, SEQ ID NO: 25 and SEQ ID NO: 2.
in a most preferred embodiment, the HVRs and LVRs are selected from the following combinations of amino acid sequences: SEQ ID NO: 17 and SEQ ID NO: 2, or, SEQ ID NO: 19 and SEQ ID NO: 2.
in another aspect, the invention also relates to a pharmaceutical composition comprising an antibody or antigen-binding fragment thereof of the invention and a pharmaceutically acceptable carrier. Also, the invention relates to an isolated nucleic acid molecule encoding the antibody or antigen binding fragment thereof of the invention; an expression vector comprising the nucleic acid molecule of the invention, and a host cell, preferably a eukaryotic cell, comprising the expression vector of the invention.
In another aspect, the invention relates to a method of making an antibody or antigen-binding fragment thereof that specifically binds to human IL-4R, the method comprising expressing a nucleic acid molecule of the invention under conditions conducive to expression of the antibody or antigen-binding fragment thereof, and recovering the expressed antibody or antigen-binding fragment thereof.
In another aspect, the invention relates to the use of an antibody or antigen-binding fragment thereof in the manufacture of a medicament for the prevention or treatment of a disease or disorder associated with IL-4/IL-4 Ra signaling in a human. In a preferred embodiment, the disease or condition is selected from: asthma, atopic dermatitis, arthritis, herpes, chronic primary urticaria, scleroderma, hypertrophic scarring, Whipole's disease, benign prostatic hyperplasia, COPD, atopic dermatitis, idiopathic pulmonary fibrosis, allergic reactions, Kawasaki disease, sickle cell disease, Churg-Strauss syndrome, Graves' disease, pre-eclampsia, Sjogren's syndrome, autoimmune lymphoproliferative syndrome, autoimmune hemolytic anemia, Barrett's esophagus, autoimmune uveitis, tuberculosis, or nephropathy.
In another aspect, the invention relates to a method of preventing or treating a disease or disorder associated with IL-4/IL-4 ra signaling in a human comprising administering to a subject the antibody or antigen-binding fragment thereof of any one of claims 1-8. In a preferred embodiment, the disease or condition is selected from: asthma, atopic dermatitis, arthritis, herpes, chronic primary urticaria, scleroderma, hypertrophic scarring, Whipole's disease, benign prostatic hyperplasia, COPD, atopic dermatitis, idiopathic pulmonary fibrosis, allergic reactions, Kawasaki disease, sickle cell disease, Churg-Strauss syndrome, Graves' disease, pre-eclampsia, Sjogren's syndrome, autoimmune lymphoproliferative syndrome, autoimmune hemolytic anemia, Barrett's esophagus, autoimmune uveitis, tuberculosis, or nephropathy. In a preferred embodiment, the disease or disorder is allergic dermatitis or asthma. In a preferred embodiment, the antibody or antigen-binding fragment thereof is used in combination with other agents for treating autoimmune diseases. In a preferred embodiment, the antibody or antigen-binding fragment thereof is used in combination with a hormonal agent, an immunosuppressive agent or an antihistaminic agent.
In another aspect, the invention relates to an article of manufacture or kit comprising a container comprising an antibody or antigen-binding fragment thereof of the invention, or a pharmaceutical composition of the invention, and a package insert carrying instructions for use of the medicament. In a preferred embodiment, the article of manufacture or kit further comprises one or more containers comprising one or more additional agents for preventing or treating a disease or condition associated with IL-4/IL-4 Ra signaling in a human. In a preferred embodiment, the other drug is a hormonal drug, an immunosuppressant or an antihistamine.
Drawings
FIG. 1 is a SDS-PAGE pattern of dupilumab variant D1-D9: lane 1 is a molecular weight marker (marker), lane 2 is D1, lane 3 is D2, lane 4 is D3, lane 5 is D4, lane 6 is D5, lane 7 is D6, lane 8 is D7, lane 9 is D8, and lane 10 is D9.
Fig. 2 is a SEC detection plot of dolitumumab variant D8.
FIG. 3 is a biological effect diagram of in vitro neutralization of IL-4 by dolugumab and dolugumab variants D5, D7, D8 and D9, dolugumab can only inhibit cell growth by 92%, D8 and D9 have better inhibition effect, and the inhibition rate reaches 98%, which is obviously superior to dolugumab.
Fig. 4A-4H show stability comparisons of doluzumab and doluzumab variants under different storage conditions, e.g., high temperature, intense light irradiation, repeated freeze-thaw, strong acid conditions. FIG. 4A is a graph showing SEC results of three samples at 50 ℃ and FIG. 4B is a graph showing ELISA results of three samples at 50 ℃. Fig. 4C is a graph of SEC results for three samples under repeated freeze-thaw conditions, and fig. 4D is a graph of ELISA results for three samples under repeated freeze-thaw conditions. FIG. 4E is a graph of SEC results for three samples at 4500lx and FIG. 4F is a graph of ELISA results for three samples at 4500 lx. FIG. 4G is a graph of SEC results of three samples under a strong acid condition, and FIG. 4H is a graph of ELISA results of three samples under a strong acid condition.
Detailed Description
1. Defining:
"IL-4R", CD124, is a type I transmembrane glycoprotein consisting of 825 amino acids (25 signal peptide domains, 207 extracellular domains, 24 membrane permeants, 569 intracellular domains). The extracellular domain has 1 CKR-SF domain and 1 type III fibrin domain, and has 6N-binding type sugar chain adhesion sites. The alpha chains of IL-4R and IL-13R are equivalent, and the combination of IL-4 can cause tyrosine phosphorylation of a plurality of intracellular proteins.
"diseases associated with IL-4/IL-4R α signaling" means diseases in which biological functions mediated by IL-4/IL-4R α signaling are involved. Examples of diseases associated with IL-4/IL-4R α signaling include, for example, inflammatory diseases or disorders such as asthma, atopic dermatitis, Chronic Obstructive Pulmonary Disease (COPD), inflammatory bowel disease, multiple sclerosis, arthritis, allergic rhinitis, eosinophilic esophagitis, and psoriasis.
In some embodiments, the disease associated with IL-4/IL-4R α signaling is airway inflammation. In some embodiments, the disease associated with IL-4/IL-4 Ra signaling is skin inflammation or atopic dermatitis.
An "allergic reaction", "allergic disease" or "allergic condition" is considered an inflammatory disease caused by the interaction of genetic and environmental factors. The molecular and cellular immune mechanisms involved in the development of allergic diseases include altered expression of T cell immunoglobulin mucin domain molecules due to reduced natural immune stimulation, altered T helper cell type 1, 2 balance, and altered regulatory T cell balance. Among allergic diseases, atopic dermatitis, asthma and allergic rhinitis are the most common inflammatory conditions in patients with allergies; these patients often suffer from the onset of multiple clinical symptoms. The pathogenesis of allergy is associated with abnormal immune responses to exogenous antigens (Mueller et al (2002) Structure, binding, and antagnostists in the IL-4/IL-13receptor system, Biochim Biophys Acta 1592: 237-. Overproduction of antigen-specific IgE is an essential factor in triggering allergic inflammation. Aberrant type 2T helper cell (Th2) polarization contributes to an increased IgE response. Interleukin-4 (IL-4) and interleukin-13 (IL-13) produced by activated T cells are the major Th2 cytokines that initiate and sustain immune and inflammatory responses in allergy.
IL-4 and IL-13 signaling is mediated by two distinct receptor complexes with a shared subunit IL-4 receptor alpha (IL-4R alpha), which may contribute to overlapping biological responses between these two cytokines. IL-4R α forms two distinct heterodimeric receptor complexes that mediate the biological functions of IL-4 and IL-13 in a tissue-and response-specific manner. Dopiruzumab is an antagonistic monoclonal antibody against human IL-4R α, which inhibits the biological activity induced by IL-4 and IL-13. Dolitumumab blocks IL-4 signaling by preventing its binding to receptor subunits, while inhibition of IL-13 signaling is likely mediated by interfering with dimeric receptor interactions.
Dolitumumab, a fully human monoclonal antibody to the shared IL-4 ralpha subunit, was developed by Regeneron Pharmaceuticals, inc, and is currently in clinical trials for the treatment of moderate to severe asthma and for the treatment of moderate to severe atopic dermatitis.
An "antibody" as described herein is an immunoglobulin molecule consisting of four peptide chains, two heavy chains (H) and two light chains (L) interconnected by disulfide bonds, each heavy chain comprising a heavy chain variable region (HVR or VH) comprising three domains CH1, CH2 and CH3 and a heavy chain constant region comprising a light chain variable region (LVR or VL) and a light chain constant region comprising one domain (CL1), the VH and VL regions being further divided into hypervariable regions known as Complementarity Determining Regions (CDRs) interspersed with more conserved regions known as Framework Regions (FRs), each VH and VL consisting of three CDRs and four FRs, arranged in the following order from amino terminus to carboxy terminus: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR 4. Herein, the heavy chain constant region may be selected from IgG1, IgG2, IgG3 or IgG4, preferably IgG4, and the light chain constant region is selected from κ or λ.
The term "variable region" is used herein to describe regions where certain portions of an antibody differ between antibody sequences and relate to the binding and specificity of a particular antibody for its particular antigen. However, variability is typically not evenly distributed throughout the variable region of an antibody. It is typically concentrated in three segments called Complementarity Determining Regions (CDRs) or hypervariable regions in the light and heavy chain variable regions. The relatively conserved portions of the variable regions are called Framework Regions (FR). The variable regions of native heavy and light chains each comprise four FRs, which mostly adopt a β -sheet conformation, connected by three CDRs which form loops connecting, and in some cases forming part of, the β -sheet structure. The CDRs in each chain are held together in close proximity by the FRs and, together with the CDRs of the other chain, contribute to the formation of the antigen binding site of the antibody. The constant regions are not directly involved in binding of the antibody to the antigen, but exhibit various effector functions, such as participation of the antibody in antibody-dependent cellular cytotoxicity.
The terms "complementarity determining regions", "hypervariable regions" and "CDRs" refer to one or more of the hypervariable regions or Complementarity Determining Regions (CDRs) present in the variable regions of an antibody light or heavy chain (see Kabat, e.a. et al, sequences of proteins of immunologicalcalemtest, national institutes of health, Bethesda, Md., (1987)). These terms include the hypervariable regions defined by Kabat et al ("sequence of proteins of immunologicalcalemtest," Kabat E., et al, USDept. of health and HumanServices, 1983) or the hypervariable loops in the three-dimensional structure of antibodies (Chothia and Lesk, J mol. biol.196901-917 (1987)). The CDRs in each chain are held in close proximity by the framework regions and, together with the CDRs from the other chains, facilitate the formation of an antigen binding site.
The terms "framework regions" and "FR" refer to one or more of the framework regions within the variable regions of antibody light and heavy chains (see Kabat, e.a. et al, sequences of proteins of immunologicalcalest, national institutes of health, Bethesda, Md., (1987)). These terms include those amino acid sequences in the antibody light and heavy chains that are located between the amino terminus and the first CDR, those that are intermediate between the CDRs and those that are between the third CDR and the start of the constant region.
CDR and FR residues can be determined according to standard sequence definitions (Kabat et al, sequences of proteins of immunologicals Interes, national institutes of health, BethesdaMd. (1987)) and structural definitions (Chothia and Lesk, J.Mot.biol.196: 901-217 (1987)).
When referred to herein, reference is made to the numbering scheme of Kabat, e.a., et al, sequences of proteins of immunologicalcalest (national institutes of health, Bethesda, Md. (1987) and (1991).
The "affinity" of an antibody for an antigen or epitope is a term well understood in the art and refers to the degree or strength of binding of an antibody to an epitope. Affinity can be measured and/or expressed in a variety of ways known in the art, including but not limited to the equilibrium dissociation constant (KD or KD, which can be defined as the dissociation rate and the association rate of an antibodyRatio of rates, i.e. Koff/Kon) Apparent equilibrium dissociation constant (KD 'or KD'), and IC50 (the amount required to achieve 50% inhibition in a competition assay); the relative affinity of the humanized antibody can also be determined by comparison with, for example, a related murine or chimeric antibody. For the purposes of the present invention, affinity is the average affinity of a particular population of antibodies that bind an antigen or epitope. The affinity of the antibody can be measured using enzyme-linked immunosorbent assay (ELISA) or Fluorescence Activated Cell Sorting (FACS) assay, and the affinity of the antibody of the present invention to IL-4R is determined by ELISA in the examples herein, as described in the examples.
2. Method for producing antibody of the present invention
The antibodies of the invention can be produced by any useful method, such as recombinant expression techniques. Nucleic acids encoding the light and heavy chain variable regions operably linked to the constant regions can be inserted into an expression vector. The light and heavy chains may be cloned in the same or different expression vectors. The DNA segment encoding the immunoglobulin chain may be operably linked to the control sequences of an expression vector that ensure expression of the immunoglobulin polypeptide. Expression control sequences include, but are not limited to, promoters (e.g., naturally associated or heterologous promoters), signal sequences, enhancer elements, and transcription termination sequences. In one embodiment, the expression control sequence is a prokaryotic promoter system in a vector capable of transforming or transfecting a eukaryotic host cell. Once the vector is introduced into an appropriate host, the host is maintained under conditions suitable for high level expression of the nucleotide sequence and collection and purification of the antibody.
The expression vector may be replicable in any host organism, either as an episome or as an integral part of the host chromosomal DNA. In one embodiment, the expression vector contains a selectable marker (e.g., ampicillin resistance, hygromycin resistance, tetracycline resistance, or neomycin resistance) to allow for detection of those cells transformed with the desired DNA sequence.
Expression vectors can be used to express the antibodies of the invention from any host cell, including prokaryotic host cells (e.g., E.coli), yeast host cells, mammalian host cells, plant host cells, and insect host cells.
In one embodiment, the antibodies of the invention are produced using E.coli. Other prokaryotic hosts suitable for such applications include bacilli, such as bacilli and other enterobacteriaceae, such as salmonella, saxiella and various pseudomonas species. In these prokaryotic hosts, expression vectors can also be prepared, which typically contain expression control sequences (e.g., origins of replication) that are compatible with the host cell. In addition, there will be any number of a variety of well-known promoters, such as the lactose promoter system, the tryptophan (trp) promoter system, the beta-lactamase promoter system, or a promoter system from bacteriophage lambda. Promoters generally control expression, optionally together with operator sequences, and have ribosome binding site sequences and the like for initiating and completing transcription and translation.
Other microorganisms, such as yeast, may also be used to express the antibodies of the invention. For example, Saccharomyces can be used as a yeast host, with a suitable promoter containing expression control sequences (e.g., a promoter), an origin of replication, termination sequences, and other sequences as desired. Promoters useful in yeast expression techniques include 3-phosphoglycerate kinase and other glycolytic enzyme promoters. Inducible yeast promoters include, but are not limited to, promoters from alcohol dehydrogenase, isocytochrome C, and enzymes responsible for maltose and galactose utilization.
In another embodiment, mammalian tissue cell cultures can be used for expression and production of the antibodies of the invention. Any mammalian tissue cell can be used for such methods, and many suitable host cell lines capable of secreting heterologous proteins (e.g., intact immunoglobulins) have been developed in the art, including mammalian BHK or CHO cell lines, various Cos cell lines, HeLa cell lines, preferably myeloma cell lines or transformed B cells or hybridomas. In one embodiment, the cell is non-human. Mammalian cell expression vectors can include expression control sequences such as origins of replication, promoters, and enhancers, as well as necessary processing signal sites such as ribosome binding sites, RNA splice sites, polyadenylation sites, and transcription terminator sequences. In one embodiment, the expression control sequence is a promoter derived from an immunoglobulin gene, SV40, adenovirus, bovine papilloma virus, cytomegalovirus, and the like.
Vectors containing the polynucleotide sequences of interest (e.g., heavy and light chain coding sequences and expression control sequences) can be transferred to a host cell by well-known methods, which vary depending on the type of cellular host. For example, calcium chloride transfection is commonly used for prokaryotic cells, while calcium phosphate treatment, electroporation, lipofection, bioballistics or viral transfection may be used for other cellular hosts. Other methods for transforming mammalian cells include the use of polybrene (polybrene), protoplast fusion, liposomes, electroporation, and microinjection. To produce transgenic animals, the transgene may be microinjected into a fertilized egg, or may be introduced into the genome of an embryonic stem cell, and the nucleus of such cell transferred into an enucleated oocyte.
When the nucleic acid molecules encoding the heavy and light chains are cloned into separate expression vectors, the vectors may be co-transfected to obtain expression and assemble the intact immunoglobulin. Once expressed, the whole antibody, its dimer, individual light and heavy chains, or other immunoglobulin forms of the antibody may be purified according to standard methods in the art, including ammonium sulfate precipitation, affinity columns, column chromatography, HPLC purification, gel electrophoresis, and the like. Substantially pure immunoglobulins of at least about 90 to 95% homogeneity may be prepared for pharmaceutical use. In another embodiment, substantially pure humanized antibodies of at least about 98 to 99% or greater homogeneity can be produced for use in pharmaceutical formulations and methods.
Accordingly, the invention provides a method of expressing an antibody of the invention comprising: (a) transforming a host cell with a nucleic acid molecule encoding an antibody described herein, and (b) culturing the transformed host cell under conditions that allow expression of the antibody. Known techniques for including a selectable marker on a vector can be used so that host cells expressing the marker of the antibody can be readily selected.
An "antigen-binding fragment" of an antibody, or referred to as an "antigen-binding portion" of an antibody, refers to one or more fragments of an antibody that retain the ability to specifically bind to an antigen (e.g., hIL-4R). It has been demonstrated that the antigen binding function of an antibody can be performed by certain fragments of a full-length antibody. Examples of "antigen-binding fragments" of antibodies include, but are not limited to: (i) fab fragments, monovalent fragments consisting of the VL, VH, CL1 and CH1 domains; (ii) a F (ab ') 2 fragment, i.e., a bivalent fragment consisting of two F (ab') fragments linked by disulfide bonds of the hinge region; (iii) an Fd fragment consisting of the VH and CH1 domains; (iv) (ii) an Fv fragment consisting of the single-arm VL and VH domains of an antibody; (v) a dAb fragment consisting of a VH domain; and (vi) a CDR. Furthermore, although the two domains of the Fv fragment, VL and VH, are encoded by different genes, they can be joined together by recombinant means by a synthetic linker into separate linked chains in which the VL and VH regions pair to form monovalent molecules (known as single chain Fv, scFv). Such single chain antibodies are also encompassed within the scope of "antigen-binding fragments" of antibodies.
The antibody of the present invention can be produced by a method comprising culturing a host cell containing a DNA sequence encoding the antibody and capable of expressing the antibody under conditions permitting expression of the antibody, and recovering the produced antibody from the culture.
The medium used to culture the cells can be any conventional medium used to culture the host cells, such as minimal medium or a minimal medium containing suitable additives. Suitable media can be obtained commercially or prepared according to published procedures. The polypeptide produced by the cells can then be recovered from the culture medium by conventional methods including separation of the host cells from the culture medium by centrifugation or filtration, precipitation of the protein component in the supernatant or filtrate with a salt such as ammonium sulfate, and purification by various chromatographic methods such as, for example, exchange chromatography, gel filtration chromatography, affinity chromatography, etc., depending on the kind of the desired peptide.
3. Therapeutic methods and agents
The invention provides pharmaceutical compositions comprising an anti-IL-4 ra antibody or antigen-binding fragment thereof of the invention. The pharmaceutical compositions of the present invention will be administered with suitable carriers, excipients and other formulations. These formulations are included in formulations to improve delivery and tolerability, among other things. Pharmacopoeias well known to all pharmaceutical chemists: a number of suitable formulations can be found in Remington's Pharmaceutical Sciences, Mack Publishing Company, Easton, Pa.
The administration dose is adjusted depending on the age and body size of the subject, the target disease, symptoms, administration route, and the like. When the antibodies of the invention are used to treat various disorders and diseases associated with IL-4R in adults, intravenous administration of the antibodies of the invention may be used, typically as a single dose of about 0.01 to about 20mg/kg, more preferably about 0.1 to about 15, about 1 to about 10, or about 3 to about 10mg/kg body weight per kg body weight. Depending on the severity of the condition, the frequency and duration of treatment may be adjusted.
Various drug delivery systems are known for administration of the pharmaceutical compositions of the invention, such as encapsulation in liposomes, microparticles, microcapsules, recombinant cells capable of expressing variant viruses, receptor-mediated endocytosis (see, e.g., Wu et al (1987), J.biol.chem.262: 4429-4432). Methods of administering drugs include, but are not limited to, intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, epidural, and oral routes. The pharmaceutical compositions may be administered by any convenient route, such as by infusion or intravenous bolus injection, absorption through epithelial and mucosal layers (e.g., oral mucosa, rectal and small intestinal mucosa), and may be administered with other biologically active agents. The mode of administration may be systemic or local.
The pharmaceutical composition may also be delivered by a vesicle, in particular a liposome vesicle (see Langer (1990) Science 249: 1527-.
In some cases, the pharmaceutical composition may be delivered in a controlled release system. In one embodiment, a pump may be used (see Langer, supra; Sefton (1987) CRC Crit. Ref. biomed. Eng.14: 201). In another embodiment, polymeric materials may be used (see Medical Applications of Controlled Release, Langer and Wise (eds.), CRC Pres., Boca Raton, Florida (1974.) for a discussion of other Controlled Release systems, see Langer (1990) Science 249: 1527-.
The injectable preparation may include dosage forms for intravenous, subcutaneous, intradermal and intramuscular injection, instillation and the like. These injectable formulations can be prepared by known methods. For example, injectable formulations can be prepared by dissolving, suspending or emulsifying the antibody or salt thereof in a sterile aqueous or oily medium conventionally used for injection. Examples of the aqueous medium for injection include physiological saline, an isotonic solution containing glucose and other auxiliary agents, and the like. They may be used in combination with a suitable solubilizer such as alcohol (e.g., ethanol), polyol (e.g., propylene glycol, polyethylene glycol), nonionic surfactant [ e.g., polysorbate 80, HCO-50 (polyoxyethylene (50 mole) adduct of hydrogenated castor oil), etc. The oil medium can be sesame oil, soybean oil, etc. They may be used in combination with a solubilizing agent such as benzyl benzoate, benzyl alcohol, and the like. The injection thus prepared is preferably enclosed in a suitable ampoule.
Monotherapy and combination therapy the antibodies and antibody fragments of the invention are useful for treating diseases and disorders that can be ameliorated, inhibited or ameliorated by the reduction of IL-4 activity. These diseases include those characterized by aberrant expression or overexpression of IL-4 or by an aberrant host response to IL-4 production. IL-4-associated diseases to be treated with the antibodies or antibody fragments of the invention include, for example, arthritis (including septic arthritis), herpes, chronic primary urticaria, scleroderma, hypertrophic scarring, Whipple disease, benign prostatic hyperplasia, pulmonary diseases such as asthma (mild, moderate and severe), inflammatory diseases such as inflammatory bowel disease, allergic reactions, Kawasaki disease, sickle cell disease, Churg-Strauss syndrome, Graves ' disease, pre-eclampsia, Sjogren's syndrome, autoimmune lymphoproliferative syndrome, autoimmune hemolytic anemia, Barrett's esophagus, autoimmune uveitis, tuberculosis (illness), atopic dermatitis, ulcerative colitis, fibrosis and nephropathy (see U.S. Pat. No. 7,186,809).
The present invention encompasses combination therapies in which an anti-IL-4 ra antibody or antibody fragment is administered in combination with one or more therapeutic agents (or a second therapeutic agent). Co-administration and combination therapy is not limited to simultaneous administration, but also includes treatment regimens in which the anti-IL-4 Ra antibody or antibody fragment is administered at least once during a course of treatment involving administration of at least one other therapeutic agent to the patient. The second therapeutic agent may be another IL-4 antagonist, such as another antibody/antibody fragment, or a soluble cytokine receptor, an IgE antagonist, an anti-asthma drug (corticosteroids, non-steroidal drugs, beta agonists, leukotrienes, antagonists, xanthines, fluticasone, salmeterol, salbutamol) that may be administered by inhalation or other suitable means. In a specific embodiment, the anti-IL-4R antibodies or antibody fragments of the invention may be administered with an IL-1 antagonist, such as linaclocept (rilonacept) or an IL-13 antagonist. The second agent may include one or more leukotriene receptor antagonists to treat, for example, allergic inflammatory diseases such as asthma and allergy. Examples of leukotriene receptor antagonists include, but are not limited to, montelukast, pranlukast, and zafirlukast. The second agent may include a cytokine inhibitor, such as one or more TNF (Enbrel ), IL-9, IL-5, or IL-17 antagonists.
The invention also includes the use of any of the anti-IL-4 ra antibodies or antigen-binding fragments described herein for the preparation of a medicament for the treatment of a disease or condition that is ameliorated, ameliorated or inhibited by the elimination, inhibition or reduction of human interleukin-4 (hIL-4) activity. Examples of such diseases or conditions include, for example, arthritis, herpes, chronic primary urticaria, scleroderma, hypertrophic scarring, Whipple's disease, benign prostatic hyperplasia, pulmonary disease, asthma, inflammatory diseases, allergic reactions, Kawasaki disease, sickle cell disease, Churg-Strauss syndrome, Graves' disease, pre-eclampsia, Sjogren's syndrome, autoimmune lymphoproliferative syndrome, autoimmune hemolytic anemia, Barrett's esophagus, autoimmune uveitis, tuberculosis (illness), nephropathy, atopic dermatitis, and asthma.
In one aspect of the invention, a pharmaceutical composition is provided that includes an antibody or antigen-binding fragment thereof that binds to human IL-4R of the invention, and a pharmaceutically acceptable carrier.
In this context, drugs, pharmaceutical compositions and pharmaceutical preparations (medicaments) may be used interchangeably unless contradicted or otherwise specifically indicated. Pharmaceutically acceptable excipients in this context refer to nontoxic fillers, stabilizers, diluents, carriers, solvents or other formulation excipients. For example, diluents, excipients, such as microcrystalline cellulose, mannitol, and the like; fillers, such as starch, sucrose, and the like; binders, such as starch, cellulose derivatives, alginates, gelatin and/or polyvinylpyrrolidone; disintegrants, such as calcium carbonate and/or sodium bicarbonate; absorption promoters, such as quaternary ammonium compounds; surfactants such as cetyl alcohol; carriers, solvents, such as water, physiological saline, kaolin, bentonite, etc.; lubricants, such as talc, calcium/magnesium stearate, polyethylene glycol, and the like. In addition, the pharmaceutical composition of the present invention is preferably an injection.
In some embodiments of the invention, the antibody or antigen-binding fragment thereof in the pharmaceutical composition of the invention is present at a concentration of 1mg/ml to 1000mg/ml, preferably 10mg/ml to 1000mg/ml, more preferably 50mg/ml to 500mg/ml, more preferably 100mg/ml to 300 mg/ml.
The pharmaceutical composition of the present invention preferably has a pH of 3.0 to 9.0. Wherein, a buffer system, a preservative, a surface tension agent, a chelating agent, a stabilizer and a surfactant can be further included. In one embodiment of the invention, the pharmaceutical composition of the invention is an aqueous formulation. Such preparations are usually solutions or suspensions. In a particular embodiment of the invention, the pharmaceutical composition is a stable aqueous solution. In another embodiment of the invention, the pharmaceutical composition is a lyophilized formulation which is dissolved by the addition of a solvent and/or diluent by the physician or patient prior to use.
Example 1: construction of expression vectors for dolugumab variants
The HindIII cleavage site (b) (ii)AAGCCT) KoZAK sequence (A)GCCGCCACC) ATG, signal peptide gene ATGGAGAGAGACACACTCCTGCTATGGGTACTGCTGCTCTGGGTTCCAGGTTCCACTGGT and a dolitumumab heavy chain encoding gene (SEQ ID NO: 35, comprising a heavy chain variable region encoding gene SEQ ID NO: 27 and a constant region IgG4 encoding gene), a terminator TAATAATAA and an EcoRI encoding gene GAATCC are sequentially fused in series, and a gene fragment is obtained by using a chemical synthesis mode. The fragment is inserted into a eukaryotic expression plasmid pCDNA3.1(+) through EcoRI and HindIII sites and is verified by sequencing to obtain an expression plasmid PCDNA3.1(+) -DH for the antibody degree pilucimab heavy chain.
The HindIII cleavage site (b) (ii)AAGCCT) KoZAK sequence (A)GCCGCCACC) ATG, signal peptide gene ATGGAGAGAGACACACTCCTGCTATGGGTACTGCTGCTCTGGGTTCCAGGTTCCACTGGT and dolugumab light chain encoding gene (SEQ ID NO: 38, comprising the light chain variable region encoding gene SEQ ID NO: 28 and constant region kappa-encoding gene), terminator TAATAATAA and EcoRI-encoding gene GAATCC in this order, and a gene fragment was obtained by chemical synthesis. The fragment is inserted into a eukaryotic expression plasmid pCDNA3.1(+) through EcoRI and HindIII sites and is subjected to sequencing verification to obtain an expression plasmid PCDNA3.1(+) -DL for the antibody degree P bruumab light chain.
According to the same method, a series of expression plasmids of the dolitumumab variant are prepared, which are respectively called as: pCDNA3.1(+) -D1L, pCDNA3.1(+) -D2L, pCDNA3.1(+) -D3L, pCDNA3.1(+) -D4L, pCDNA3.1(+) -D5H, pCDNA3.1(+) -D6H, pCDNA3.1(+) -D7H, pCDNA3.1(+) -D8H, pCDNA3.1(+) -D9H, pCDNA3.1(+) -D10H, pCDNA3.1(+) -D11H, pCDNA3.1(+) -D12H, pCDNA3.1(+) -DH and pCDNA3.1(+) -DL.
Variant D1 is obtained by mutating amino acid Arg at position 24 of LVR of dolugumab to Ala, and the gene sequence of LVR encoding D1 is SEQ ID NO: 4; the mutant D2 is obtained by mutating amino acid Ser at the 28 th site of LVR of dolugumab to Arg, and the gene sequence of LVR of the encoded D2 is SEQ ID NO: 6; the mutant D3 or D4 is obtained by mutating amino acid Ser at the 32 th site of LVR of dolugumab to Arg or Lys respectively, and the gene sequences of LVR of the encoded D3 and D4 are SEQ ID NO: 8 and 10; mutant D5 is obtained by mutating Arg 100 of HVR of dolugumab to Ala, and the gene sequence of HVR of coding D5 is SEQ ID NO: 12; the mutant D6 or D7 is obtained by mutating Arg 106 th site of HVR of dolitumumab to Ala or Glu respectively, and the gene sequences of the HVR for coding D6 or D7 are SEQ ID NO: 14 and 16; mutants D8-D12 were obtained by mutating Arg 108 of HVR of dolitumumab to Ala, Glu, Gln, Tyr or Leu, respectively, and the gene sequences of HVRs encoding D8-D12 were SEQ ID NO: 18. 20, 22, 24 or 26. The heavy chain constant region of each mutant was IgG4 and the light chain constant region was kappa.
Example 2: expression and purification of dolugumab and variants thereof
Using the DNA construct described in example 1, cells FreeStyle were expressed by eukaryotic cellsTM293-F Cells (Invitrogen Corporation, R790-07) express the antibody of interest. According to FreeStyleTM293expression System operating Manual, cell Density was adjusted to 1X10 the day before plasmid transfection6One/ml. On the day of plasmid transfection, plasmids were combined according to the following table, mixed with transfection reagents and added to the cell culture medium. 37 ℃ and 8% CO2After continuous culture for 5-7 days, cell culture supernatants were collected for antibody purification.
Figure GDA0002581192150000211
Figure GDA0002581192150000221
The expression supernatant was filtered through a 0.22. mu.M filter, and the expression antibody was captured from the expression supernatant using a Mabpurix affinity column (purchased from Sepax, 65008), and after equilibration of the column with an equilibration buffer (120mM Tris +100mM NaCl, pH7.5), the column was passed through an affinity column, and eluted with an elution buffer (0.15M glacial acetic acid, pH 2.8). The purity of the purified antibody is over 95 percent by SDS PAGE and SEC detection.
Example 3: antigen binding affinity assay
In vitro affinity assays were performed using the purified antibodies described in example 2. The microplate was coated with 2. mu.g/ml of IL-4R (R & D, 7700-4R-050), 100. mu.l/well, and the plate was covered with a sealing membrane, left overnight at 4 ℃ and washed 3 times with a washing solution the following day. Then, 10% bovine serum albumin solution is prepared by washing liquid, 200 mul/hole is added into the enzyme label plate, the plate is washed by washing liquid for 3 times at 37 ℃ for 2 hours; adding a gradient diluted antibody solution into 100 mu l/hole, washing the plate for 3 times at 37 ℃ for 2 hours by using a washing solution; a dilution (2% bovine serum albumin solution prepared using a washing solution) 1/5000 diluted HRP-labeled secondary antibody (accession No. ab6858, product from Abcam corporation), added to the microplate at 100. mu.l/well, and incubated at 37 ℃ for 1 hour; washing the plate with washing solution for 5 times; adding TMB color development solution into 100 mu 1/hole, placing the mixture at room temperature and keeping out of the light for reaction for 5-10 minutes, and adding human stop solution into 50 mu l/hole to stop the reaction. And the absorbance at a wavelength of 450nm was measured.
Figure GDA0002581192150000231
Figure GDA0002581192150000241
The results show that D8 and D9 have improved EC relative to dolitumumab50EC50 was about 60% of dolitumumab, 3.200nM and 1.977nM, respectively, especially D8.
Example 4: neutralizing the biological effects of IL-4 in vitro
In vitro neutralization of IL-4 bioeffects were performed using the purified antibodies described in example 2. TF-1 cells were starved-cultured for 24h at 37 ℃ under 5% carbon dioxide using RPMI1640 basal medium (C22400500BT, from GIBCO). The next morning TF-1 cells were collected, washed 3 times with RPMI1640 medium, resuspended in complete medium (RPMI 1640 basal medium containing 10% fetal bovine serum) at a cell concentration of 4.0X 105One per ml. Using 96-well cell culture plates, the cell suspension was added, along with the antibody sample and IL-4 diluted in a gradient, and mixed well. The cells were cultured at 37 ℃ under 5% carbon dioxide for 2 days. Adding CCK-8 diluent according to the instruction of CCK-8(CK04, Dojindo Co., Ltd.), culturing at 37 deg.C under 5% carbon dioxide for 2.5h, detecting with enzyme-linked immunosorbent assay, and measuring absorbance with 630nm as reference wavelength and 450nm as measurement wavelengthAnd detecting the cell survival rate.
The results of fig. 3 show that the dolitumumab inhibits cell growth by 92%, while D8 and D9 have better inhibition effect, and the inhibition rate reaches 98%, which is obviously superior to that of the dolitumumab.
Example 5: stability of dolitumumab mutants
In order to further examine the properties of the mutated antibody, different storage conditions are designed, the SEC-HPLC method (SEC for short) is adopted to detect the purity of the main peak after the antibody is stored, the ELISA method is adopted to detect the relative activity after the antibody is stored, and the stability and activity change of the mutated antibody and the original antibody degree Pituzumab are compared.
Purified antibodies of the invention and dolugumab were added to 12.5mM sodium acetate, pH: 6.15, to a final concentration of about 2.7 mg/ml. According to the experimental results of the preliminary experiment, 35.1. mu.l of 0.2M Tris-Base is added into 1.5ml of sample to make the pH value reach about 9.0, and the mixture is filtered and subpackaged for 200. mu.l/branch and 7 branches respectively; adding 288 mul 0.2M citric acid into 2.5ml sample, acidifying to pH 3.0, filtering, and packaging into 200 mul/piece, each 12 pieces; finally, the remaining samples were sterilized by filtration, 200. mu.l/vial, and 30 vials each were dispensed. All samples were placed in sterile vials, capped with sterile rubber stoppers, and stored sealed with aluminum caps.
SEC-HPLC detection: the purity of the sample is quantitatively analyzed by separating substances with different molecular weights by gel filtration chromatography, a chromatographic column is TSK G3000SWXL, and a mobile phase: 0.2mol/L potassium phosphate buffer, 0.25mol/L potassium chloride pH6.2 + -0.1, flow rate of 0.5ml/min, and washing time of 30 min.
ELISA method (detection by microplate reader): 2 mu g/ml of IL-4R coated enzyme label plate, diluting 8 concentration gradients with the detection sample 500ng/ml being 5 times of the initial concentration, transferring to the enzyme label plate to be combined with IL-4R, adding goat anti-human Fab fragment secondary antibody (product of Jackson Immuno company), developing, reading the plate, calculating the relative activity of the antibody (the relative activity refers to that the activity of the antibody of the invention when the dolugumab activity of the same plate sample in each test point is taken as 1).
The storage conditions include high temperature, strong light irradiation, repeated freeze thawing, and strong acid. The specific operations, detection points, and detection items are shown in the following table:
Figure GDA0002581192150000251
Figure GDA0002581192150000261
high-temperature test: the incubation chamber was left at 50 ℃ for 20 days, and samples were examined at 0 o' clock, day 5, day 10, day 15 and day 20. The results are shown in fig. 4A and fig. 4B, and the SEC-HPLC experimental results show that the stability of the test sample is consistent with the change trend of the dolitumumab. The purity of the 0-sample pinuzumab is higher than that of the antibody of the invention, the pinuzumab is reduced by less than 5% along with the prolonging of high-temperature placing time, and the thermal stability has no obvious difference. The ELISA results neglect the abnormal results (second point HC-108A in FIG. 4B), the activity of the antibody of the present invention was consistently higher than that of Dupiruzumab, and the difference became larger as the high temperature storage time was prolonged, indicating that the thermal stability of the binding activity of the antibody of the present invention was better than that of Dupiruzumab.
Repeated freeze thawing: the change of the antibody and the doluvimumab of the invention is detected after repeated freeze thawing at the temperature of minus 80 ℃ for 3 times and 5 times, and the result is shown in 4C and 4D. SEC-HPLC results show that the purity of the doluvian monoclonal antibody is basically unchanged and is close to 100 percent along with the increase of the freezing and thawing times, the purity of the 0 point of the antibody is less than that of the doluvian monoclonal antibody, and the purity of the main peak is only reduced by less than 5 percent after repeated freezing and thawing. However, in the aspect of influence on activity after repeated freeze thawing, ELISA shows that the antibody of the invention is superior to doluvimab in the aspect of resisting activity reduction caused by repeated freeze thawing, and the antibody of the invention has higher relative activity after freeze thawing under the same conditions.
Strong acid influence: adjusting the pH value of the sample to 3.0 by using citric acid, standing at 25 ℃ for 3 days, and observing and detecting the pH value on the zero point, the first day and the third day respectively. As can be seen from the SEC experimental results in fig. 4E, the purity of all three samples tested was reduced by about 10% from the zero point, and by subtracting the abnormal point of the HC-R108E test on the first day in fig. 4G, the purity of all samples was hardly reduced in three days, and it was presumed from the SEC peak diagram that the sample was destroyed by the strong acid treatment from the 0 point, and polymerization and degradation occurred partially. It is seen from FIG. 4H that the binding activity of the antibody of the present invention after strong acid treatment is significantly higher than that of dolugumab under the same condition, and it is presumed that the antibody is more acid-resistant due to the decrease of isoelectric point after the sample is modified.
Illumination effect: the samples were placed in a drug stability chamber at 25 ℃ and a light intensity of 4500lx for 10 days, and the samples were examined at 0 o' clock, on the fifth day, and on the tenth day, respectively. The results are shown in FIGS. 4E and 4F. The SEC result shows that the purities of the target peaks of the dolutemab and the antibody of the invention are changed very little, and the ELISA result shows that the activity of the antibody of the invention does not decrease with the prolonging of illumination time, which shows that the light stability of the antibody of the invention is slightly superior to that of the dolutemab.
The experimental results of high temperature, strong acid, illumination and repeated freeze thawing are combined, so that the influence of various factors on the stability of the antibody is not greatly different, but in the aspect of activity, the antibody has better tolerance compared with the doluvian monoclonal antibody, and the antibody is more favorable in the later storage process.
Sequence listing
<110> Beijing Kaiyin science and technology Co., Ltd
<120> IL-4R alpha antibody and use thereof
<141> 2018-01-30
<160> 36
<170> SIPOSequenceListing 1.0
<210> 1
<211> 124
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 1
Gly Val Gly Leu Val Gly Ser Gly Gly Gly Leu Gly Gly Pro Gly Gly
1 5 10 15
Ser Leu Ala Leu Ser Cys Ala Gly Ser Gly Pro Thr Pro Ala Ala Thr
20 25 30
Ala Met Thr Thr Val Ala Gly Ala Pro Gly Leu Gly Leu Gly Thr Val
35 40 45
Ser Ser Ile Ser Gly Ser Gly Gly Ala Thr Thr Thr Ala Ala Ser Val
50 55 60
Leu Gly Ala Pro Thr Ile Ser Ala Ala Ala Ser Leu Ala Thr Leu Thr
65 70 75 80
Leu Gly Met Ala Ser Leu Ala Ala Gly Ala Thr Ala Val Thr Thr Cys
85 90 95
Ala Leu Ala Ala Leu Ser Ile Thr Ile Ala Pro Ala Thr Thr Gly Leu
100 105 110
Ala Val Thr Gly Gly Gly Thr Thr Val Thr Val Ser
115 120
<210> 2
<211> 112
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 2
Ala Ile Val Met Thr Gly Ser Pro Leu Ser Leu Pro Val Thr Pro Gly
1 5 10 15
Gly Pro Ala Ser Ile Ser Cys Ala Ser Ser Gly Ser Leu Leu Thr Ser
20 25 30
Ile Gly Thr Ala Thr Leu Ala Thr Thr Leu Gly Leu Ser Gly Gly Ser
35 40 45
Pro Gly Leu Leu Ile Thr Leu Gly Ser Ala Ala Ala Ser Gly Val Pro
50 55 60
Ala Ala Pro Ser Gly Ser Gly Ser Gly Thr Ala Pro Thr Leu Leu Ile
65 70 75 80
Ser Ala Val Gly Ala Gly Ala Val Gly Pro Thr Thr Cys Met Gly Ala
85 90 95
Leu Gly Thr Pro Thr Thr Pro Gly Gly Gly Thr Leu Leu Gly Ile Leu
100 105 110
<210> 3
<211> 112
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 3
Ala Ile Val Met Thr Gly Ser Pro Leu Ser Leu Pro Val Thr Pro Gly
1 5 10 15
Gly Pro Ala Ser Ile Ser Cys Ala Ser Ser Gly Ser Leu Leu Thr Ser
20 25 30
Ile Gly Thr Ala Thr Leu Ala Thr Thr Leu Gly Leu Ser Gly Gly Ser
35 40 45
Pro Gly Leu Leu Ile Thr Leu Gly Ser Ala Ala Ala Ser Gly Val Pro
50 55 60
Ala Ala Pro Ser Gly Ser Gly Ser Gly Thr Ala Pro Thr Leu Leu Ile
65 70 75 80
Ser Ala Val Gly Ala Gly Ala Val Gly Pro Thr Thr Cys Met Gly Ala
85 90 95
Leu Gly Thr Pro Thr Thr Pro Gly Gly Gly Thr Leu Leu Gly Ile Leu
100 105 110
<210> 4
<211> 336
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
gacatcgtga tgacccagag ccccctgagc ctgcccgtga cccccggcga gcccgccagc 60
atcagctgca ggagcagcca gagcctgctg tacaggatcg gctacaacta cctggactgg 120
tacctgcaga agagcggcca gagcccccag ctgctgatct acctgggcag caacagggcc 180
agcggcgtgc ccgacaggtt cagcggcagc ggcagcggca ccgacttcac cctgaagatc 240
agcagggtgg aggccgagga cgtgggcttc tactactgca tgcaggccct gcagaccccc 300
tacaccttcg gccagggcac caagctggag atcaag 336
<210> 5
<211> 112
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 5
Ala Ile Val Met Thr Gly Ser Pro Leu Ser Leu Pro Val Thr Pro Gly
1 5 10 15
Gly Pro Ala Ser Ile Ser Cys Ala Ser Ser Gly Ser Leu Leu Thr Ser
20 25 30
Ile Gly Thr Ala Thr Leu Ala Thr Thr Leu Gly Leu Ser Gly Gly Ser
35 40 45
Pro Gly Leu Leu Ile Thr Leu Gly Ser Ala Ala Ala Ser Gly Val Pro
50 55 60
Ala Ala Pro Ser Gly Ser Gly Ser Gly Thr Ala Pro Thr Leu Leu Ile
65 70 75 80
Ser Ala Val Gly Ala Gly Ala Val Gly Pro Thr Thr Cys Met Gly Ala
85 90 95
Leu Gly Thr Pro Thr Thr Pro Gly Gly Gly Thr Leu Leu Gly Ile Leu
100 105 110
<210> 6
<211> 336
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
gacatcgtga tgacccagag ccccctgagc ctgcccgtga cccccggcga gcccgccagc 60
atcagctgca ggagcagcca gagcctgctg tacaagatcg gctacaacta cctggactgg 120
tacctgcaga agagcggcca gagcccccag ctgctgatct acctgggcag caacagggcc 180
agcggcgtgc ccgacaggtt cagcggcagc ggcagcggca ccgacttcac cctgaagatc 240
agcagggtgg aggccgagga cgtgggcttc tactactgca tgcaggccct gcagaccccc 300
tacaccttcg gccagggcac caagctggag atcaag 336
<210> 7
<211> 112
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 7
Ala Ile Val Met Thr Gly Ser Pro Leu Ser Leu Pro Val Thr Pro Gly
1 5 10 15
Gly Pro Ala Ser Ile Ser Cys Ala Ser Ser Gly Ser Leu Leu Thr Ser
20 25 30
Ile Gly Thr Ala Thr Leu Ala Thr Thr Leu Gly Leu Ser Gly Gly Ser
35 40 45
Pro Gly Leu Leu Ile Thr Leu Gly Ser Ala Ala Ala Ser Gly Val Pro
50 55 60
Ala Ala Pro Ser Gly Ser Gly Ser Gly Thr Ala Pro Thr Leu Leu Ile
65 70 75 80
Ser Ala Val Gly Ala Gly Ala Val Gly Pro Thr Thr Cys Met Gly Ala
85 90 95
Leu Gly Thr Pro Thr Thr Pro Gly Gly Gly Thr Leu Leu Gly Ile Leu
100 105 110
<210> 8
<211> 336
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
gacatcgtga tgacccagag ccccctgagc ctgcccgtga cccccggcga gcccgccagc 60
atcagctgcg ccagcagcca gagcctgctg tacagcatcg gctacaacta cctggactgg 120
tacctgcaga agagcggcca gagcccccag ctgctgatct acctgggcag caacagggcc 180
agcggcgtgc ccgacaggtt cagcggcagc ggcagcggca ccgacttcac cctgaagatc 240
agcagggtgg aggccgagga cgtgggcttc tactactgca tgcaggccct gcagaccccc 300
tacaccttcg gccagggcac caagctggag atcaag 336
<210> 9
<211> 112
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 9
Ala Ile Val Met Thr Gly Ser Pro Leu Ser Leu Pro Val Thr Pro Gly
1 5 10 15
Gly Pro Ala Ser Ile Ser Cys Ala Ser Ser Gly Ser Leu Leu Thr Ser
20 25 30
Ile Gly Thr Ala Thr Leu Ala Thr Thr Leu Gly Leu Ser Gly Gly Ser
35 40 45
Pro Gly Leu Leu Ile Thr Leu Gly Ser Ala Ala Ala Ser Gly Val Pro
50 55 60
Ala Ala Pro Ser Gly Ser Gly Ser Gly Thr Ala Pro Thr Leu Leu Ile
65 70 75 80
Ser Ala Val Gly Ala Gly Ala Val Gly Pro Thr Thr Cys Met Gly Ala
85 90 95
Leu Gly Thr Pro Thr Thr Pro Gly Gly Gly Thr Leu Leu Gly Ile Leu
100 105 110
<210> 10
<211> 336
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 10
gacatcgtga tgacccagag ccccctgagc ctgcccgtga cccccggcga gcccgccagc 60
atcagctgca ggagcagcca gaggctgctg tacagcatcg gctacaacta cctggactgg 120
tacctgcaga agagcggcca gagcccccag ctgctgatct acctgggcag caacagggcc 180
agcggcgtgc ccgacaggtt cagcggcagc ggcagcggca ccgacttcac cctgaagatc 240
agcagggtgg aggccgagga cgtgggcttc tactactgca tgcaggccct gcagaccccc 300
tacaccttcg gccagggcac caagctggag atcaag 336
<210> 11
<211> 124
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 11
Gly Val Gly Leu Val Gly Ser Gly Gly Gly Leu Gly Gly Pro Gly Gly
1 5 10 15
Ser Leu Ala Leu Ser Cys Ala Gly Ser Gly Pro Thr Pro Ala Ala Thr
20 25 30
Ala Met Thr Thr Val Ala Gly Ala Pro Gly Leu Gly Leu Gly Thr Val
35 40 45
Ser Ser Ile Ser Gly Ser Gly Gly Ala Thr Thr Thr Ala Ala Ser Val
50 55 60
Leu Gly Ala Pro Thr Ile Ser Ala Ala Ala Ser Leu Ala Thr Leu Thr
65 70 75 80
Leu Gly Met Ala Ser Leu Ala Ala Gly Ala Thr Ala Val Thr Thr Cys
85 90 95
Ala Leu Ala Ala Leu Ser Ile Thr Ile Ala Pro Ala Thr Thr Gly Leu
100 105 110
Ala Val Thr Gly Gly Gly Thr Thr Val Thr Val Ser
115 120
<210> 12
<211> 372
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 12
gaggtgcagc tggtggagag cggcggcggc ctggagcagc ccggcggcag cctgaggctg 60
agctgcgccg gcagcggctt caccttcagg gactacgcca tgacctgggt gaggcaggcc 120
cccggcaagg gcctggagtg ggtgagcagc atcagcggca gcggcggcaa cacctactac 180
gccgacagcg tgaagggcag gttcaccatc agcagggaca acagcaagaa caccctgtac 240
ctgcagatga acagcctgag ggccgaggac accgccgtgt actactgcgc caaggacagg 300
ctgagcatca ccatcaggcc cgagtactac ggcctggacg tgtggggcca gggcaccacc 360
gtgaccgtga gc 372
<210> 13
<211> 124
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 13
Gly Val Gly Leu Val Gly Ser Gly Gly Gly Leu Gly Gly Pro Gly Gly
1 5 10 15
Ser Leu Ala Leu Ser Cys Ala Gly Ser Gly Pro Thr Pro Ala Ala Thr
20 25 30
Ala Met Thr Thr Val Ala Gly Ala Pro Gly Leu Gly Leu Gly Thr Val
35 40 45
Ser Ser Ile Ser Gly Ser Gly Gly Ala Thr Thr Thr Ala Ala Ser Val
50 55 60
Leu Gly Ala Pro Thr Ile Ser Ala Ala Ala Ser Leu Ala Thr Leu Thr
65 70 75 80
Leu Gly Met Ala Ser Leu Ala Ala Gly Ala Thr Ala Val Thr Thr Cys
85 90 95
Ala Leu Ala Ala Leu Ser Ile Thr Ile Ala Pro Ala Thr Thr Gly Leu
100 105 110
Ala Val Thr Gly Gly Gly Thr Thr Val Thr Val Ser
115 120
<210> 14
<211> 372
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 14
gaggtgcagc tggtggagag cggcggcggc ctggagcagc ccggcggcag cctgaggctg 60
agctgcgccg gcagcggctt caccttcagg gactacgcca tgacctgggt gaggcaggcc 120
cccggcaagg gcctggagtg ggtgagcagc atcagcggca gcggcggcaa cacctactac 180
gccgacagcg tgaagggcag gttcaccatc agcagggaca acagcaagaa caccctgtac 240
ctgcagatga acagcctgag ggccgaggac accgccgtgt actactgcgc caaggacgcc 300
ctgagcatca ccatcaggcc caggtactac ggcctggacg tgtggggcca gggcaccacc 360
gtgaccgtga gc 372
<210> 15
<211> 124
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 15
Gly Val Gly Leu Val Gly Ser Gly Gly Gly Leu Gly Gly Pro Gly Gly
1 5 10 15
Ser Leu Ala Leu Ser Cys Ala Gly Ser Gly Pro Thr Pro Ala Ala Thr
20 25 30
Ala Met Thr Thr Val Ala Gly Ala Pro Gly Leu Gly Leu Gly Thr Val
35 40 45
Ser Ser Ile Ser Gly Ser Gly Gly Ala Thr Thr Thr Ala Ala Ser Val
50 55 60
Leu Gly Ala Pro Thr Ile Ser Ala Ala Ala Ser Leu Ala Thr Leu Thr
65 70 75 80
Leu Gly Met Ala Ser Leu Ala Ala Gly Ala Thr Ala Val Thr Thr Cys
85 90 95
Ala Leu Ala Ala Leu Ser Ile Thr Ile Ala Pro Ala Thr Thr Gly Leu
100 105 110
Ala Val Thr Gly Gly Gly Thr Thr Val Thr Val Ser
115 120
<210> 16
<211> 372
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 16
gaggtgcagc tggtggagag cggcggcggc ctggagcagc ccggcggcag cctgaggctg 60
agctgcgccg gcagcggctt caccttcagg gactacgcca tgacctgggt gaggcaggcc 120
cccggcaagg gcctggagtg ggtgagcagc atcagcggca gcggcggcaa cacctactac 180
gccgacagcg tgaagggcag gttcaccatc agcagggaca acagcaagaa caccctgtac 240
ctgcagatga acagcctgag ggccgaggac accgccgtgt actactgcgc caaggacagg 300
ctgagcatca ccatcgcccc caggtactac ggcctggacg tgtggggcca gggcaccacc 360
gtgaccgtga gc 372
<210> 17
<211> 124
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 17
Gly Val Gly Leu Val Gly Ser Gly Gly Gly Leu Gly Gly Pro Gly Gly
1 5 10 15
Ser Leu Ala Leu Ser Cys Ala Gly Ser Gly Pro Thr Pro Ala Ala Thr
20 25 30
Ala Met Thr Thr Val Ala Gly Ala Pro Gly Leu Gly Leu Gly Thr Val
35 40 45
Ser Ser Ile Ser Gly Ser Gly Gly Ala Thr Thr Thr Ala Ala Ser Val
50 55 60
Leu Gly Ala Pro Thr Ile Ser Ala Ala Ala Ser Leu Ala Thr Leu Thr
65 70 75 80
Leu Gly Met Ala Ser Leu Ala Ala Gly Ala Thr Ala Val Thr Thr Cys
85 90 95
Ala Leu Ala Ala Leu Ser Ile Thr Ile Ala Pro Ala Thr Thr Gly Leu
100 105 110
Ala Val Thr Gly Gly Gly Thr Thr Val Thr Val Ser
115 120
<210> 18
<211> 372
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 18
gaggtgcagc tggtggagag cggcggcggc ctggagcagc ccggcggcag cctgaggctg 60
agctgcgccg gcagcggctt caccttcagg gactacgcca tgacctgggt gaggcaggcc 120
cccggcaagg gcctggagtg ggtgagcagc atcagcggca gcggcggcaa cacctactac 180
gccgacagcg tgaagggcag gttcaccatc agcagggaca acagcaagaa caccctgtac 240
ctgcagatga acagcctgag ggccgaggac accgccgtgt actactgcgc caaggacagg 300
ctgagcatca ccatcaggcc cgcctactac ggcctggacg tgtggggcca gggcaccacc 360
gtgaccgtga gc 372
<210> 19
<211> 124
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 19
Gly Val Gly Leu Val Gly Ser Gly Gly Gly Leu Gly Gly Pro Gly Gly
1 5 10 15
Ser Leu Ala Leu Ser Cys Ala Gly Ser Gly Pro Thr Pro Ala Ala Thr
20 25 30
Ala Met Thr Thr Val Ala Gly Ala Pro Gly Leu Gly Leu Gly Thr Val
35 40 45
Ser Ser Ile Ser Gly Ser Gly Gly Ala Thr Thr Thr Ala Ala Ser Val
50 55 60
Leu Gly Ala Pro Thr Ile Ser Ala Ala Ala Ser Leu Ala Thr Leu Thr
65 70 75 80
Leu Gly Met Ala Ser Leu Ala Ala Gly Ala Thr Ala Val Thr Thr Cys
85 90 95
Ala Leu Ala Ala Leu Ser Ile Thr Ile Ala Pro Ala Thr Thr Gly Leu
100 105 110
Ala Val Thr Gly Gly Gly Thr Thr Val Thr Val Ser
115 120
<210> 20
<211> 372
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 20
gaggtgcagc tggtggagag cggcggcggc ctggagcagc ccggcggcag cctgaggctg 60
agctgcgccg gcagcggctt caccttcagg gactacgcca tgacctgggt gaggcaggcc 120
cccggcaagg gcctggagtg ggtgagcagc atcagcggca gcggcggcaa cacctactac 180
gccgacagcg tgaagggcag gttcaccatc agcagggaca acagcaagaa caccctgtac 240
ctgcagatga acagcctgag ggccgaggac accgccgtgt actactgcgc caaggacagg 300
ctgagcatca ccatcgagcc caggtactac ggcctggacg tgtggggcca gggcaccacc 360
gtgaccgtga gc 372
<210> 21
<211> 124
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 21
Gly Val Gly Leu Val Gly Ser Gly Gly Gly Leu Gly Gly Pro Gly Gly
1 5 10 15
Ser Leu Ala Leu Ser Cys Ala Gly Ser Gly Pro Thr Pro Ala Ala Thr
20 25 30
Ala Met Thr Thr Val Ala Gly Ala Pro Gly Leu Gly Leu Gly Thr Val
35 40 45
Ser Ser Ile Ser Gly Ser Gly Gly Ala Thr Thr Thr Ala Ala Ser Val
50 55 60
Leu Gly Ala Pro Thr Ile Ser Ala Ala Ala Ser Leu Ala Thr Leu Thr
65 70 75 80
Leu Gly Met Ala Ser Leu Ala Ala Gly Ala Thr Ala Val Thr Thr Cys
85 90 95
Ala Leu Ala Ala Leu Ser Ile Thr Ile Ala Pro Ala Thr Thr Gly Leu
100 105 110
Ala Val Thr Gly Gly Gly Thr Thr Val Thr Val Ser
115 120
<210> 22
<211> 372
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 22
gaggtgcagc tggtggagag cggcggcggc ctggagcagc ccggcggcag cctgcgcctg 60
agctgcgccg gcagcggctt caccttccgc gactacgcca tgacctgggt gcgccaggcc 120
cccggcaagg gcctggagtg ggtgagcagc atcagcggca gcggcggcaa cacctactac 180
gccgacagcg tgaagggccg cttcaccatc agccgcgaca acagcaagaa caccctgtac 240
ctgcagatga acagcctgcg cgccgaggac accgccgtgt actactgcgc caaggaccgc 300
ctgagcatca ccatccgccc ccagtactac ggcctggacg tgtggggcca gggcaccacc 360
gtgaccgtga gc 372
<210> 23
<211> 124
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 23
Gly Val Gly Leu Val Gly Ser Gly Gly Gly Leu Gly Gly Pro Gly Gly
1 5 10 15
Ser Leu Ala Leu Ser Cys Ala Gly Ser Gly Pro Thr Pro Ala Ala Thr
20 25 30
Ala Met Thr Thr Val Ala Gly Ala Pro Gly Leu Gly Leu Gly Thr Val
35 40 45
Ser Ser Ile Ser Gly Ser Gly Gly Ala Thr Thr Thr Ala Ala Ser Val
50 55 60
Leu Gly Ala Pro Thr Ile Ser Ala Ala Ala Ser Leu Ala Thr Leu Thr
65 70 75 80
Leu Gly Met Ala Ser Leu Ala Ala Gly Ala Thr Ala Val Thr Thr Cys
85 90 95
Ala Leu Ala Ala Leu Ser Ile Thr Ile Ala Pro Ala Thr Thr Gly Leu
100 105 110
Ala Val Thr Gly Gly Gly Thr Thr Val Thr Val Ser
115 120
<210> 24
<211> 372
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 24
gaggtgcagc tggtggagag cggcggcggc ctggagcagc ccggcggcag cctgcgcctg 60
agctgcgccg gcagcggctt caccttccgc gactacgcca tgacctgggt gcgccaggcc 120
cccggcaagg gcctggagtg ggtgagcagc atcagcggca gcggcggcaa cacctactac 180
gccgacagcg tgaagggccg cttcaccatc agccgcgaca acagcaagaa caccctgtac 240
ctgcagatga acagcctgcg cgccgaggac accgccgtgt actactgcgc caaggaccgc 300
ctgagcatca ccatccgccc ctactactac ggcctggacg tgtggggcca gggcaccacc 360
gtgaccgtga gc 372
<210> 25
<211> 124
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 25
Gly Val Gly Leu Val Gly Ser Gly Gly Gly Leu Gly Gly Pro Gly Gly
1 5 10 15
Ser Leu Ala Leu Ser Cys Ala Gly Ser Gly Pro Thr Pro Ala Ala Thr
20 25 30
Ala Met Thr Thr Val Ala Gly Ala Pro Gly Leu Gly Leu Gly Thr Val
35 40 45
Ser Ser Ile Ser Gly Ser Gly Gly Ala Thr Thr Thr Ala Ala Ser Val
50 55 60
Leu Gly Ala Pro Thr Ile Ser Ala Ala Ala Ser Leu Ala Thr Leu Thr
65 70 75 80
Leu Gly Met Ala Ser Leu Ala Ala Gly Ala Thr Ala Val Thr Thr Cys
85 90 95
Ala Leu Ala Ala Leu Ser Ile Thr Ile Ala Pro Ala Thr Thr Gly Leu
100 105 110
Ala Val Thr Gly Gly Gly Thr Thr Val Thr Val Ser
115 120
<210> 26
<211> 372
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 26
gaggtgcagc tggtggagag cggcggcggc ctggagcagc ccggcggcag cctgcgcctg 60
agctgcgccg gcagcggctt caccttccgc gactacgcca tgacctgggt gcgccaggcc 120
cccggcaagg gcctggagtg ggtgagcagc atcagcggca gcggcggcaa cacctactac 180
gccgacagcg tgaagggccg cttcaccatc agccgcgaca acagcaagaa caccctgtac 240
ctgcagatga acagcctgcg cgccgaggac accgccgtgt actactgcgc caaggaccgc 300
ctgagcatca ccatccgccc cctgtactac ggcctggacg tgtggggcca gggcaccacc 360
gtgaccgtga gc 372
<210> 27
<211> 372
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 27
gaggtgcagc tggtggagag cggcggcggc ctggagcagc ccggcggcag cctgaggctg 60
agctgcgccg gcagcggctt caccttcagg gactacgcca tgacctgggt gaggcaggcc 120
cccggcaagg gcctggagtg ggtgagcagc atcagcggca gcggcggcaa cacctactac 180
gccgacagcg tgaagggcag gttcaccatc agcagggaca acagcaagaa caccctgtac 240
ctgcagatga acagcctgag ggccgaggac accgccgtgt actactgcgc caaggacagg 300
ctgagcatca ccatcaggcc caggtactac ggcctggacg tgtggggcca gggcaccacc 360
gtgaccgtga gc 372
<210> 28
<211> 336
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 28
gacatcgtga tgacccagag ccccctgagc ctgcccgtga cccccggcga gcccgccagc 60
atcagctgca ggagcagcca gagcctgctg tacagcatcg gctacaacta cctggactgg 120
tacctgcaga agagcggcca gagcccccag ctgctgatct acctgggcag caacagggcc 180
agcggcgtgc ccgacaggtt cagcggcagc ggcagcggca ccgacttcac cctgaagatc 240
agcagggtgg aggccgagga cgtgggcttc tactactgca tgcaggccct gcagaccccc 300
tacaccttcg gccagggcac caagctggag atcaag 336
<210> 29
<211> 8
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 29
Gly Pro Thr Pro Ala Ala Thr Ala
1 5
<210> 30
<211> 8
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 30
Ile Ser Gly Ser Gly Gly Ala Thr
1 5
<210> 31
<211> 4
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 31
Leu Gly Ser Gly
1
<210> 32
<211> 9
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 32
Met Gly Ala Leu Gly Thr Pro Thr Thr
1 5
<210> 33
<211> 451
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 33
Gly Val Gly Leu Val Gly Ser Gly Gly Gly Leu Gly Gly Pro Gly Gly
1 5 10 15
Ser Leu Ala Leu Ser Cys Ala Gly Ser Gly Pro Thr Pro Ala Ala Thr
20 25 30
Ala Met Thr Thr Val Ala Gly Ala Pro Gly Leu Gly Leu Gly Thr Val
35 40 45
Ser Ser Ile Ser Gly Ser Gly Gly Ala Thr Thr Thr Ala Ala Ser Val
50 55 60
Leu Gly Ala Pro Thr Ile Ser Ala Ala Ala Ser Leu Ala Thr Leu Thr
65 70 75 80
Leu Gly Met Ala Ser Leu Ala Ala Gly Ala Thr Ala Val Thr Thr Cys
85 90 95
Ala Leu Ala Ala Leu Ser Ile Thr Ile Ala Pro Ala Thr Thr Gly Leu
100 105 110
Ala Val Thr Gly Gly Gly Thr Thr Val Thr Val Ser Ser Ala Ser Thr
115 120 125
Leu Gly Pro Ser Val Pro Pro Leu Ala Pro Cys Ser Ala Ser Thr Ser
130 135 140
Gly Ser Thr Ala Ala Leu Gly Cys Leu Val Leu Ala Thr Pro Pro Gly
145 150 155 160
Pro Val Thr Val Ser Thr Ala Ser Gly Ala Leu Thr Ser Gly Val His
165 170 175
Thr Pro Pro Ala Val Leu Gly Ser Ser Gly Leu Thr Ser Leu Ser Ser
180 185 190
Val Val Thr Val Pro Ser Ser Ser Leu Gly Thr Leu Thr Thr Thr Cys
195 200 205
Ala Val Ala His Leu Pro Ser Ala Thr Leu Val Ala Leu Ala Val Gly
210 215 220
Ser Leu Thr Gly Pro Pro Cys Pro Pro Cys Pro Ala Pro Gly Pro Leu
225 230 235 240
Gly Gly Pro Ser Val Pro Leu Pro Pro Pro Leu Pro Leu Ala Thr Leu
245 250 255
Met Ile Ser Ala Thr Pro Gly Val Thr Cys Val Val Val Ala Val Ser
260 265 270
Gly Gly Ala Pro Gly Val Gly Pro Ala Thr Thr Val Ala Gly Val Gly
275 280 285
Val His Ala Ala Leu Thr Leu Pro Ala Gly Gly Gly Pro Ala Ser Thr
290 295 300
Thr Ala Val Val Ser Val Leu Thr Val Leu His Gly Ala Thr Leu Ala
305 310 315 320
Gly Leu Gly Thr Leu Cys Leu Val Ser Ala Leu Gly Leu Pro Ser Ser
325 330 335
Ile Gly Leu Thr Ile Ser Leu Ala Leu Gly Gly Pro Ala Gly Pro Gly
340 345 350
Val Thr Thr Leu Pro Pro Ser Gly Gly Gly Met Thr Leu Ala Gly Val
355 360 365
Ser Leu Thr Cys Leu Val Leu Gly Pro Thr Pro Ser Ala Ile Ala Val
370 375 380
Gly Thr Gly Ser Ala Gly Gly Pro Gly Ala Ala Thr Leu Thr Thr Pro
385 390 395 400
Pro Val Leu Ala Ser Ala Gly Ser Pro Pro Leu Thr Ser Ala Leu Thr
405 410 415
Val Ala Leu Ser Ala Thr Gly Gly Gly Ala Val Pro Ser Cys Ser Val
420 425 430
Met His Gly Ala Leu His Ala His Thr Thr Gly Leu Ser Leu Ser Leu
435 440 445
Ser Leu Gly
450
<210> 34
<211> 219
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 34
Ala Ile Val Met Thr Gly Ser Pro Leu Ser Leu Pro Val Thr Pro Gly
1 5 10 15
Gly Pro Ala Ser Ile Ser Cys Ala Ser Ser Gly Ser Leu Leu Thr Ser
20 25 30
Ile Gly Thr Ala Thr Leu Ala Thr Thr Leu Gly Leu Ser Gly Gly Ser
35 40 45
Pro Gly Leu Leu Ile Thr Leu Gly Ser Ala Ala Ala Ser Gly Val Pro
50 55 60
Ala Ala Pro Ser Gly Ser Gly Ser Gly Thr Ala Pro Thr Leu Leu Ile
65 70 75 80
Ser Ala Val Gly Ala Gly Ala Val Gly Pro Thr Thr Cys Met Gly Ala
85 90 95
Leu Gly Thr Pro Thr Thr Pro Gly Gly Gly Thr Leu Leu Gly Ile Leu
100 105 110
Ala Thr Val Ala Ala Pro Ser Val Pro Ile Pro Pro Pro Ser Ala Gly
115 120 125
Gly Leu Leu Ser Gly Thr Ala Ser Val Val Cys Leu Leu Ala Ala Pro
130 135 140
Thr Pro Ala Gly Ala Leu Val Gly Thr Leu Val Ala Ala Ala Leu Gly
145 150 155 160
Ser Gly Ala Ser Gly Gly Ser Val Thr Gly Gly Ala Ser Leu Ala Ser
165 170 175
Thr Thr Ser Leu Ser Ser Thr Leu Thr Leu Ser Leu Ala Ala Thr Gly
180 185 190
Leu His Leu Val Thr Ala Cys Gly Val Thr His Gly Gly Leu Ser Ser
195 200 205
Pro Val Thr Leu Ser Pro Ala Ala Gly Gly Cys
210 215
<210> 35
<211> 1353
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 35
gaggtgcagc tggtggagag cggcggcggc ctggagcagc ccggcggcag cctgaggctg 60
agctgcgccg gcagcggctt caccttcagg gactacgcca tgacctgggt gaggcaggcc 120
cccggcaagg gcctggagtg ggtgagcagc atcagcggca gcggcggcaa cacctactac 180
gccgacagcg tgaagggcag gttcaccatc agcagggaca acagcaagaa caccctgtac 240
ctgcagatga acagcctgag ggccgaggac accgccgtgt actactgcgc caaggacagg 300
ctgagcatca ccatcaggcc caggtactac ggcctggacg tgtggggcca gggcaccacc 360
gtgaccgtga gcagcgccag caccaagggc cccagcgtgt tccccctggc cccctgcagc 420
aggagcacca gcgagagcac cgccgccctg ggctgcctgg tgaaggacta cttccccgag 480
cccgtgaccg tgagctggaa cagcggcgcc ctgaccagcg gcgtgcacac cttccccgcc 540
gtgctgcaga gcagcggcct gtacagcctg agcagcgtgg tgaccgtgcc cagcagcagc 600
ctgggcacca agacctacac ctgcaacgtg gaccacaagc ccagcaacac caaggtggac 660
aagagggtgg agagcaagta cggccccccc tgccccccct gccccgcccc cgagttcctg 720
ggcggcccca gcgtgttcct gttccccccc aagcccaagg acaccctgat gatcagcagg 780
acccccgagg tgacctgcgt ggtggtggac gtgagccagg aggaccccga ggtgcagttc 840
aactggtacg tggacggcgt ggaggtgcac aacgccaaga ccaagcccag ggaggagcag 900
ttcaacagca cctacagggt ggtgagcgtg ctgaccgtgc tgcaccagga ctggctgaac 960
ggcaaggagt acaagtgcaa ggtgagcaac aagggcctgc ccagcagcat cgagaagacc 1020
atcagcaagg ccaagggcca gcccagggag ccccaggtgt acaccctgcc ccccagccag 1080
gaggagatga ccaagaacca ggtgagcctg acctgcctgg tgaagggctt ctaccccagc 1140
gacatcgccg tggagtggga gagcaacggc cagcccgaga acaactacaa gaccaccccc 1200
cccgtgctgg acagcgacgg cagcttcttc ctgtacagca ggctgaccgt ggacaagagc 1260
aggtggcagg agggcaacgt gttcagctgc agcgtgatgc acgaggccct gcacaaccac 1320
tacacccaga agagcctgag cctgagcctg ggc 1353
<210> 36
<211> 657
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 36
gacatcgtga tgacccagag ccccctgagc ctgcccgtga cccccggcga gcccgccagc 60
atcagctgca ggagcagcca gagcctgctg tacagcatcg gctacaacta cctggactgg 120
tacctgcaga agagcggcca gagcccccag ctgctgatct acctgggcag caacagggcc 180
agcggcgtgc ccgacaggtt cagcggcagc ggcagcggca ccgacttcac cctgaagatc 240
agcagggtgg aggccgagga cgtgggcttc tactactgca tgcaggccct gcagaccccc 300
tacaccttcg gccagggcac caagctggag atcaagagga ccgtggccgc ccccagcgtg 360
ttcatcttcc cccccagcga cgagcagctg aagagcggca ccgccagcgt ggtgtgcctg 420
ctgaacaact tctaccccag ggaggccaag gtgcagtgga aggtggacaa cgccctgcag 480
agcggcaaca gccaggagag cgtgaccgag caggacagca aggacagcac ctacagcctg 540
agcagcaccc tgaccctgag caaggccgac tacgagaagc acaaggtgta cgcctgcgag 600
gtgacccacc agggcctgag cagccccgtg accaagagct tcaacagggg cgagtgc 657

Claims (13)

1. An antibody or antigen-binding fragment thereof that specifically binds to human interleukin-4 receptor alpha (hIL-4 Ra), comprising a heavy chain variable region (HVR) and a light chain variable region (LVR),
the heavy chain variable region comprises:
HCDR1 having an amino acid sequence of Gly-Phe-Thr-Phe-Arg-Asp-Tyr-Ala;
HCDR2 having an amino acid sequence of Ile-Ser-Gly-Ser-Gly-Gly-Asn-Thr; and the combination of (a) and (b),
the amino acid sequence of the HCDR3 is Ala-Lys-Asp-Xaa1-Leu-Ser-Ile-Thr-Ile-Xaa2-Pro-Xaa3-Tyr-Tyr-Gly-Leu-Asp-Val, wherein Xaa1 is Arg, Xaa2 is Arg, and Xaa3 is Ala or Glu;
the light chain variable region comprises:
LCDR1 with the amino acid sequence of Gln-Xaa4-Leu-Leu-Tyr-Xaa5-Ile-Gly-Tyr-Asn-Tyr, wherein Xaa4 is Ser, and Xaa5 is Ser;
LCDR2 with the amino acid sequence of Leu-Gly-Ser; and the combination of (a) and (b),
LCDR3 with the amino acid sequence of Met-Gln-Ala-Leu-Gln-Thr-Pro-Tyr-Thr.
2. The antibody or antigen-binding fragment thereof of claim 1, which is a variant of dolitumumab, wherein Arg 108 of the heavy chain variable region (HVR) of dolitumumab is mutated to Ala or Glu.
3. A pharmaceutical composition comprising the antibody or antigen-binding fragment thereof of any one of claims 1-2 and a pharmaceutically acceptable carrier.
4. An isolated nucleic acid molecule encoding the antibody or antigen-binding fragment thereof of any one of claims 1-2.
5. An expression vector comprising the nucleic acid molecule of claim 4.
6. A host cell comprising the expression vector of claim 5.
7. The host cell of claim 6 which is a eukaryotic cell.
8. A method of making an antibody or antigen-binding fragment thereof that specifically binds to human IL-4R, the method comprising expressing the nucleic acid molecule of claim 4 under conditions that favor expression of the antibody or antigen-binding fragment thereof of any one of claims 1-2, and recovering the expressed antibody or antigen-binding fragment thereof.
9. Use of an antibody or antigen-binding fragment thereof according to any one of claims 1-2 in the manufacture of a medicament for the prevention or treatment of a disease or disorder associated with IL-4/IL-4 ra signaling in a human.
10. The use of claim 9, wherein the disease or condition is selected from the group consisting of: asthma, atopic dermatitis, arthritis, herpes, chronic primary urticaria, scleroderma, hypertrophic scarring, Whipole's disease, benign prostatic hyperplasia, COPD, atopic dermatitis, idiopathic pulmonary fibrosis, allergic reactions, Kawasaki disease, sickle cell disease, Churg-Strauss syndrome, Graves' disease, pre-eclampsia, Sjogren's syndrome, autoimmune lymphoproliferative syndrome, autoimmune hemolytic anemia, Barrett's esophagus, autoimmune uveitis, tuberculosis, or nephropathy.
11. An article of manufacture or kit comprising a container comprising the antibody or antigen-binding fragment thereof of claim 1 or 2, or the pharmaceutical composition of claim 3, and a package insert carrying instructions for use of the medicament.
12. The article of manufacture or kit of claim 11, further comprising one or more containers comprising one or more additional agents for preventing or treating a disease or disorder associated with IL-4/IL-4 ra signaling in a human.
13. The article of manufacture or kit of claim 12, wherein the other agent is a hormonal agent, an immunosuppressive agent or an antihistamine.
CN201810100470.3A 2018-02-01 2018-02-01 IL-4R alpha antibodies and uses thereof Active CN110105451B (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
CN202110070349.2A CN113150146B (en) 2018-02-01 2018-02-01 IL-4R alpha antibodies and uses thereof
CN201810100470.3A CN110105451B (en) 2018-02-01 2018-02-01 IL-4R alpha antibodies and uses thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201810100470.3A CN110105451B (en) 2018-02-01 2018-02-01 IL-4R alpha antibodies and uses thereof

Related Child Applications (1)

Application Number Title Priority Date Filing Date
CN202110070349.2A Division CN113150146B (en) 2018-02-01 2018-02-01 IL-4R alpha antibodies and uses thereof

Publications (2)

Publication Number Publication Date
CN110105451A CN110105451A (en) 2019-08-09
CN110105451B true CN110105451B (en) 2020-12-18

Family

ID=67483207

Family Applications (2)

Application Number Title Priority Date Filing Date
CN201810100470.3A Active CN110105451B (en) 2018-02-01 2018-02-01 IL-4R alpha antibodies and uses thereof
CN202110070349.2A Active CN113150146B (en) 2018-02-01 2018-02-01 IL-4R alpha antibodies and uses thereof

Family Applications After (1)

Application Number Title Priority Date Filing Date
CN202110070349.2A Active CN113150146B (en) 2018-02-01 2018-02-01 IL-4R alpha antibodies and uses thereof

Country Status (1)

Country Link
CN (2) CN110105451B (en)

Families Citing this family (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113166259A (en) * 2018-11-09 2021-07-23 亚洲大学校产学协力团 Human antibodies with high affinity for human IL-4 receptor alpha and uses thereof
CN111825766B (en) 2019-10-31 2021-05-11 上海洛启生物医药技术有限公司 anti-IL-4R single domain antibody and application thereof
CN113527485A (en) 2020-04-17 2021-10-22 上海麦济生物技术有限公司 Anti-human interleukin-4 receptor alpha antibody and preparation method and application thereof
JP2023534422A (en) * 2020-07-09 2023-08-09 ベイジン カイン テクノロジー シェア－ホールディング シーオー．， エルティーディー． Antibody that binds to surface antigen of hepatitis B virus and use thereof
CN112362876B (en) * 2020-08-06 2023-12-15 武汉天德生物科技有限公司 Colloidal gold test strip for detecting early senile dementia and preparation method thereof
CN112540179B (en) * 2020-08-06 2023-07-07 武汉天德生物科技有限公司 ELISA kit for testing content of ApoE4 protein
CN114605539B (en) * 2020-12-09 2024-01-02 南京融捷康生物科技有限公司 Humanized anti-IL-4 Rα single domain antibodies and uses thereof
CN113713103A (en) * 2021-08-31 2021-11-30 中南大学湘雅三医院 Application of miR-124-3p agonist in preparation of IL4R alpha protein expression inhibitor

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1886426A (en) * 2003-11-07 2006-12-27 伊姆尼斯公司 Antibodies that bind interleukin-4 receptor
CN102197052A (en) * 2008-10-29 2011-09-21 瑞泽恩制药公司 High affinity human antibodies to human IL-4 receptor

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1886426A (en) * 2003-11-07 2006-12-27 伊姆尼斯公司 Antibodies that bind interleukin-4 receptor
CN102197052A (en) * 2008-10-29 2011-09-21 瑞泽恩制药公司 High affinity human antibodies to human IL-4 receptor
CN103739711A (en) * 2008-10-29 2014-04-23 瑞泽恩制药公司 High affinity human antibodies to human ill-4 receptor
EP3064511A1 (en) * 2008-10-29 2016-09-07 Regeneron Pharmaceuticals, Inc. High affinity human antibodies to human il-4 receptor
CN106267190A (en) * 2008-10-29 2017-01-04 瑞泽恩制药公司 The neutralizing high affinity human antibody of anti-human IL 4 receptor

Also Published As

Publication number Publication date
CN113150146B (en) 2022-07-12
CN110105451A (en) 2019-08-09
CN113150146A (en) 2021-07-23

Similar Documents

Publication Publication Date Title
CN110105451B (en) IL-4R alpha antibodies and uses thereof
US10287348B2 (en) Antigen binding proteins capable of binding thymic stromal lymphopoietin
KR102271204B1 (en) Multispecific antibody constructs
US11402383B2 (en) Nucleic acid encoding PCSK9 antibody
CN110551215A (en) anti-interleukin-17A antibodies, pharmaceutical compositions thereof, and uses thereof
CA3124726A1 (en) Monoclonal antibody against human interleukin-4 receptor alpha and use thereof
WO2020135710A1 (en) Antibody against human il-4ra and use thereof
CN113501878B (en) Antibodies against human TSLP and uses thereof
KR20180089514A (en) Multispecific antibody molecules with specificity for TNF-alpha, IL-17A and IL-17F
EP4137517A1 (en) Antibody to human interleukin-4 receptor ?, preparation method therefor and use thereof
KR102652133B1 (en) IL-4Rα antibody and its uses
IL300660A (en) Anti-par-2 antibodies and methods of use thereof
US11312781B2 (en) Antigen binding molecules that bind LIGHT
EP3999113A1 (en) Anti-pd-l1 antibodies
JP2022540859A (en) Novel BSSL antibody
CN117015553A (en) Recombinant fusion proteins comprising an interleukin-18 binding protein and an antigen binding fragment of an antisera albumin, compositions and uses thereof
US11827673B2 (en) Antigen binding molecules that bind light
RU2807060C1 (en) Antibody against human interleukin-4 alpha receptor, method of its preparation and its application
US20240228605A9 (en) Antibodies against human tslp and use thereof
KR20230042030A (en) Anti-IgE Engineered Antibodies and Their Applications

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
REG Reference to a national code

Ref country code: HK

Ref legal event code: DE

Ref document number: 40012690

Country of ref document: HK

CB03 Change of inventor or designer information

Inventor after: Xu Zheng

Inventor after: Li Xiang

Inventor after: Song Rui

Inventor before: Xu Zheng

Inventor before: Li Xiang

Inventor before: Song Rui

CB03 Change of inventor or designer information
GR01 Patent grant
GR01 Patent grant