WO2019141235A1

WO2019141235A1 - Pharmaceutical composition and method for treating liver cancer

Info

Publication number: WO2019141235A1
Application number: PCT/CN2019/072329
Authority: WO
Inventors: 耿美玉; 沈爱军; 刘红椿; 张敏敏; 丁健
Original assignee: 中国科学院上海药物研究所
Priority date: 2018-01-20
Filing date: 2019-01-18
Publication date: 2019-07-25
Also published as: CN110063956A

Abstract

A pharmaceutical composition, containing an ALK kinase inhibitor, an FGFR2 kinase inhibitor, and an EphA5 kinase inhibitor, or an AKT signal pathway inhibitor, an MEK signal pathway inhibitor, and a p38 signal pathway inhibitor. Also provided is a method for identifying the subtype of liver cancer of a testee, comprising measuring activity levels of ALK kinase, FGFR2 kinase, and EphA5 kinase in the testee, or measuring activity levels of an AKT signal pathway, an MEK signal pathway, and a p38 signal pathway in the testee. Also provided is use of an Hsp90 inhibitor in preparing drugs for inhibiting the ALK kinase, FGFR2 kinase, and EphA5 kinase, or for inhibiting the AKT signal pathway, MEK signal pathway, and p38 signal pathway.

Description

Drug combination and method for treating liver cancer

Technical field

The present invention relates to pharmaceutical combinations and methods for treating liver cancer, and more particularly to pharmaceutical combinations and methods for treating liver cancer by multiple inhibitory kinase populations or corresponding signaling pathways.

Background technique

Liver cancer is currently the third most deadly tumor in the world. According to its pathological tissue source, it is divided into hepatocellular carcinoma (originating from hepatocytes) and cholangiocarcinoma (originating from intrahepatic biliary cells), of which liver cancer accounts for more than 80% of primary liver cancer. Liver cancer is a multi-process, constantly evolving, highly heterogeneous tumor.

Abnormal drug metabolism caused by factors such as primary drug resistance and cirrhosis leads to poor efficacy of chemotherapy drugs and strong side effects. Metastasis of advanced liver cancer, accompanied by liver cirrhosis leading to liver function decompensation, patients with poor physical condition can not tolerate chemotherapy, only for molecular targeted drugs. Currently, molecular targeting drugs are only marketed by the multi-target kinase inhibitor Sorafenib. Sorafenib inhibits tumor proliferation and neovascularization by inhibiting RAF/MAPK/ERK, VEGFR, PDGFR, STAT3 and other signaling pathways, thereby achieving anti-hepatocarcinogenesis. However, the clinical treatment results are not satisfactory, only 2.5% of patients with liver cancer partially improved, the complete cure rate was 0, and only extended the overall survival of 2.8 months.

Sorafenib treats liver cancer mainly by targeting angiogenesis-related kinases VEGFR1/2/3 and PDGFRβ as well as proliferation-related Flt-3, c-Kit, RET and RAF/MAPK/ERK. Preclinical animal model studies and clinical studies have shown that sorafenib exerts anti-tumor effects in vivo mainly by inhibiting the proliferation of vascular endothelial cells, thereby blocking angiogenesis and cutting off the nutritional supply of tumor tissues. However, sorafenib has certain toxic side effects in the clinic, which causes some patients to be intolerant, while the partial survival of patients with partial response is only extended by 2-3 months, and no complete cure cases are seen. There are many reasons for the poor clinical outcome of sorafenib, including kinase reprogramming due to heterogeneity of liver cancer, anti-angiogenesis resistance and EMT-mediated resistance.

Due to the highly heterogeneous nature of tumors and the intricate processes of kinase reprogramming, the single-agent effect is not significant enough, and the simultaneous inhibition of multiple signaling pathways has become a consensus. EGFR, mTOR, c-Met and other signaling pathways are highly activated in liver cancer, and the combination of sorafenib and EGFR inhibitor erlotinib and mTOR inhibitor has been clinically studied, but unfortunately, it has not been obvious. Better than the therapeutic effect of sorafenib alone.

Extensive genomic studies have shown an average of 30-40 gene mutations in each tumor. The biggest challenge in solving this problem is to distinguish between "trunk" mutations and "twig" gene mutations. Once the key genes are identified, the corresponding signaling pathways can be targeted. At present, the discovery of liver cancer-driven oncogenes is relatively limited. In addition to sorafenib, targeted treatments for other important genes have not been successfully developed.

Molecular targeted therapy for liver cancer has the following characteristics: 1) Different from ALK-fused non-small cell lung cancer and EGFR-mutant breast cancer and other oncogene-dependent tumors, many wild-type kinases of liver cancer are highly activated and participate in regulating cell proliferation, resulting in inhibition of single cells. The pathway can not achieve a good tumor inhibition effect; 2) the important mutant genes such as the tumor suppressor gene TP53 and the oncogene β-catenin are difficult to directly target, and these abnormally expressed genes cause abnormal activation of the corresponding kinase, and then pass downstream. The signaling pathway maintains the malignant phenotype of the tumor. Therefore, the current molecular targeted therapy in liver cancer still focuses on the study of kinase inhibitors, and a large number of kinase inhibitor tests have been carried out clinically, such as Erlotinib targeting EGFR, Tivantinib targeting c-Met, and cabozantini. The Remolu monoclonal antibody targeting VEGFR has been clinically phased out, but the effect is not satisfactory. The main reasons include: 1) the kinase targeted in the study may not be a driven key kinase but a concomitant kinase, 2) due to the high heterogeneity of liver cancer inhibiting a single kinase-induced kinase reprogramming compensatory activation of other kinases, 3) The molecular typing of liver cancer is still unclear, and it is not possible to determine the applicable population of the drug.

At present, the most important anti-liver cancer research is to explore the driving gene as a therapeutic target. A large number of gene mapping analysis has obtained a wealth of gene abnormal expression information, which brings great opportunities and challenges for scientists to find driving candidate genes that can be targeted. Genetic analysis technology reveals the heterogeneity of liver cancer more clearly, with an average of 30-40 gene mutations per tumor. Abnormally expressed genes are roughly classified into two types: proliferation-related and proliferation-independent. The highest frequencies include CTNNB1 (26.3%), TP53 (27%), and TERT955.8%) mutations, CCND1 (7.2%) amplification, etc. The relationship between these genes and the poor prognosis of liver cancer has not been proven, and tumor suppressor genes and the like are difficult to target.

In addition, studies have found that multiple proliferation-related signaling pathways in liver cancer are highly activated, including VEGF/VEGFR, PDGFR, FGFR, PI3K/AKT/mTOR, c-Met, RAF/MAPK/ERK, etc., but mutations in important kinases are rare. see.

Sorafenib targets RAF/MAPK/MEK/ERK, FGFR, PDGFR and VEGFR and other kinases. It is the only molecularly targeted drug that has been marketed, but it has not really improved the survival of most patients with liver cancer. The survival period is extended by 2.8 months. The successful launch of Solafenib has led to the development of a large number of inhibitors targeting VEGF/VEGFR, PDGFR, FGFR, c-Met, EGFR, IGF1R, PI3K/AKT/mTOR and other kinases for clinical research.

Nearly 90 kinase inhibitors have been developed for clinical studies in patients with advanced liver cancer. More than 450 clinical studies have been completed and are underway, and kinase inhibitors account for nearly 70% of the total clinical trials. However, unfortunately, due to the ineffectiveness and poor tolerance caused by primary or acquired resistance, it has not been able to make gratifying progress.

For oncogene-dependent tumors such as ALK gene fusion and EGFR-mutant non-small cell lung cancer, blocking ALK or EGFR can achieve a good anti-tumor effect. However, liver cancer is different. The clinical failure of a single kinase inhibitor may be due to the high heterogeneity of liver cancer, which allows multiple genes to participate in controlling their fate. In clinical studies, the combination of sorafenib with ivivolimus (mTOR inhibitor) and erlotinib (EGFR inhibitor) has not achieved good results, suggesting that there may be a key kinase group in liver cancer, and the overall interaction regulates liver cancer. Growth requires a rational design of the drug regimen while blocking the activity of multiple key kinases to achieve inhibition of liver cancer.

Therefore, there is a need in the art to identify core kinase populations in liver cancer to determine targets for molecular targeted therapy of liver cancer, and to design novel therapeutic and intervention strategies.

Summary of the invention

The present invention satisfies the above needs by recognizing a core kinase group useful as a molecular targeted therapeutic target in liver cancer and its corresponding signaling pathway, and using a combination of specific kinase inhibitors to inhibit liver cancer cell proliferation and thereby treat liver cancer.

In one aspect, the invention provides a pharmaceutical combination comprising an ALK kinase inhibitor, a FGFR2 kinase inhibitor, and an EphA5 kinase inhibitor. The invention also provides a method of treating liver cancer in a subject, comprising administering to the subject a pharmaceutical combination of the invention comprising an ALK kinase inhibitor, a FGFR2 kinase inhibitor, and an EphA5 kinase inhibitor. The invention also provides the use of an ALK kinase inhibitor, a FGFR2 kinase inhibitor, and an EphA5 kinase inhibitor for the manufacture of a medicament for treating liver cancer in a subject.

In another aspect, the invention provides a pharmaceutical combination comprising an AKT signaling pathway inhibitor, a MEK signaling pathway inhibitor, and a p38 signaling pathway inhibitor. The invention also provides a method of treating liver cancer in a subject comprising administering to the subject a pharmaceutical combination of the invention comprising an AKT signaling pathway inhibitor, a MEK signaling pathway inhibitor, and a p38 signaling pathway inhibitor. The invention also provides the use of an AKT signaling pathway inhibitor, a MEK signaling pathway inhibitor, and a p38 signaling pathway inhibitor for the manufacture of a medicament for treating liver cancer in a subject.

In yet another aspect, the invention provides a method of identifying a subtype of liver cancer in a subject comprising measuring the level of activity of ALK kinase, FGFR2 kinase, and EphA5 kinase in the subject. The invention also provides a method of treating liver cancer in a subject, comprising measuring the activity levels of ALK kinase, FGFR2 kinase, and EphA5 kinase in the subject, and if the activities of the ALK kinase, FGFR2 kinase, and EphA5 kinase Where the level of water is above normal liver tissue, the subject is administered a combination of drugs as described herein. The invention also provides kits comprising reagents for measuring the level of activity of ALK kinase, FGFR2 kinase and EphA5 kinase in a subject. The invention also provides the use of a pharmaceutical combination of the invention for treating liver cancer in a subject, wherein the activity levels of ALK kinase, FGFR2 kinase and EphA5 kinase in the subject are higher than normal liver tissue.

In yet another aspect, the invention provides a method of identifying a subtype of liver cancer in a subject, comprising measuring an activity level of an AKT signaling pathway, a MEK signaling pathway, and a p38 signaling pathway in the subject. The invention also provides a method of treating liver cancer in a subject, comprising measuring an activity level of an AKT signaling pathway, a MEK signaling pathway, and a p38 signaling pathway in the subject, and if the AKT signaling pathway, the MEK signaling pathway Where the activity level of the p38 signaling pathway is higher than normal liver tissue, the subject is administered a pharmaceutical combination as described herein. The invention also provides kits comprising reagents for measuring the activity levels of the AKT signaling pathway, the MEK signaling pathway, and the p38 signaling pathway in a subject. The kit also includes instructions for assessing the activity levels of the AKT signaling pathway, the MEK signaling pathway, and the p38 signaling pathway.

In yet another aspect, the invention provides a method of treating liver cancer in a subject comprising administering to the subject an Hsp90 inhibitor. The invention also provides the use of an Hsp90 inhibitor for the manufacture of a medicament for the treatment of liver cancer. The invention also provides the use of an Hsp90 inhibitor for the manufacture of a medicament for inhibiting ALK kinase, FGFR2 kinase and EphA5 kinase. The invention also provides the use of an Hsp90 inhibitor for the preparation of a medicament for inhibiting the AKT signaling pathway, the MEK signaling pathway, and the p38 signaling pathway. The invention also provides a pharmaceutical combination comprising an Hsp90 inhibitor and, optionally, an additional therapeutic agent.

DRAWINGS

Figure 1. High activation of numerous kinases in liver cancer cells. The BEL-7402, SMMC-7721, HepG2, Hep3B, SK-Hep-1, Huh-7, QGY-7703 and ZIP177 liver cancer cells in the logarithmic growth phase were inoculated into 100 mm culture dishes, respectively, and the degree of fusion was 90%. Discard the supernatant, wash twice with pre-cooled PBS, add the lysate provided by RaybioTech kit at a concentration of 1 mL / 2 × 10 ⁷ cells, lyse on ice for 30 min, 4 ° C, 12,000 × g, centrifuge for 30 min, take The supernatant was used for kinase phosphorylation chip detection. The activation level of the kinase is indicated by the ratio of the fluorescence reading intensity to the positive control ratio, and the heat map is drawn using the R language program.

Figure 2. Interference with a single kinase does not affect liver cancer cell proliferation. (A) ZIP177 or SMMC-7721 cells in logarithmic growth phase were seeded in 96-well plates at a density of 3×10 ³ /well, cultured overnight, and RNA and 17 kinase siRNAs were separately transferred using RNAiMAX transfection reagent. The cells were used for 72 h, fixed with pre-cooled TCA for more than 1 h, and the cell proliferation was detected by SRB method. (B) The logarithmic growth phase cells were seeded in a 6-well plate at a density of 2 × 10 ⁵ /well, and cultured overnight. RNAiMAX Transfection Reagents NC and 17 kinase siRNAs were transferred to cells for 72 h and protein samples were collected for Western blotting.

Figure 3. IC50 of kinase inhibitors on liver cancer cells. The ZIP177 or SMMC-7721 cells in logarithmic growth phase were inoculated into 96-well plates at a density of 3×10 ³ /well, cultured overnight, added with the corresponding drug for 72 h, fixed with pre-cooled TCA for more than 1 h, and detected by SRB method. Cell Proliferation.

Figure 4. Combination of ceritinib and dasatinib inhibits proliferation of liver cancer cells. SMMC-7721 or ZIP177 cells in logarithmic growth phase were inoculated into 96-well plates at a density of 3×10 ³ /well, cultured overnight, added with the corresponding drug for 72 h, fixed with pre-cooled TCA for more than 1 h, and detected by SRB method. Cell Proliferation.

Figure 5. Combination of ceritinib, dasatinib and AZD4547 inhibits proliferation of hepatoma cells. SMMC-7721 or ZIP177 cells in logarithmic growth phase were inoculated into 96-well plates at a density of 3×10 ³ /well, cultured overnight, added with the corresponding drug for 72 h, fixed with pre-cooled TCA for more than 1 h, and detected by SRB method. Cell Proliferation.

Figure 6. Combination of three kinase inhibitors inhibits proliferation of ZIP177 or SMMC-7721. SMMC-7721 or ZIP177 cells in logarithmic growth phase were inoculated into 96-well plates at a density of 3×10 ³ /well, cultured overnight, added with the corresponding drug for 72 h, fixed with pre-cooled TCA for more than 1 h, and detected by SRB method. Cell Proliferation.

Figure 7. Combination of three kinase inhibitors inhibits proliferation of various liver cancer cells.

Figure 8. Combination of three kinase inhibitors to induce apoptosis. (A) SMMC-7721 or ZIP177 cells in logarithmic growth phase were seeded in 12-well plates at a density of 1 × 10 ⁵ /well, cultured overnight, added with drug for 48 h, trypsin digestion, PI/Annexin-V double staining Apoptosis was detected by flow cytometry; (B) cells were seeded at a density of 2 × 10 ⁵ /well in 6-well plates, cultured overnight, and drug added for 48 h, and protein samples were collected for Western blotting.

Figure 9. Effect of combination of three kinase inhibitors on proliferation of normal cells. Logarithmic growth phase hepatocytes LO2 and QSG-7701 were seeded in 96-well plates at 3000/well, and were separately administered with coloriatinib (1 μM), AZD4547 (1 μM) and dasatinib (1 μM). And combined treatment, 72h, SRB method to detect cell proliferation.

Figure 10. Interference with EphA5 in combination with ceratinib and AZD4547 inhibits proliferation of hepatoma cells. SMMC-7721 or ZIP177 cells in logarithmic growth phase were seeded in 96-well plates at a density of 3×10 ³ /well, cultured overnight, and NC and designated siRNA were transferred into cells using RNAiMAX transfection reagent, and added to the color Tini and AZD4547 were treated for 72 h, fixed with pre-cooled TCA for more than 1 h, and cell proliferation was detected by SRB method.

Figure 11. Simultaneous knockout of LTK, FGFR2 and EphA5 did not affect liver cancer cell proliferation. SMMC-7721 or ZIP177 cells in logarithmic growth phase were seeded in 96-well plates at a density of 3×10 ³ /well, cultured overnight, and siRNAs of NC and LTK, FGFR2 and EphA5 were transferred into cells using RNAiMAX transfection reagent. After 72 h, the cells were fixed with pre-cooled TCA for more than 1 h, and cell proliferation was detected by SRB method.

Figure 12. Simultaneous knockout of ALK, FGFR2 and EphA5 inhibits proliferation and induces apoptosis. SMMC-7721 or ZIP177 cells in logarithmic growth phase were seeded in 96-well and 6-well plates at a density of 3 × 10 ³ /well and 2 × 10 ⁵ /well, and cultured overnight for siRNA interference for 72 h. (A) Cell fixation was detected by SRB method after fixation with pre-cooled TCA for more than 1 h; (B) Cells were lysed with RIPA lysate and quantified by BCA method to prepare samples for Western blotting.

Figure 13. Combination of ceritinib, AZD4547, and dasatinib down-regulated downstream signaling pathways. SMMC-7721 or ZIP177 cells in logarithmic growth phase were seeded in 6-well plates at a density of 2 × 10 ⁵ /well, cultured overnight, and added coloriatinib (1 μM), dasatinib (1 μM) and AZD4547. (1 μM) for 3 h, washed twice with pre-cooled PBS, and 150 μl of 1×SDS lysate was added to prepare a protein sample for Western blotting.

Figure 14. Simultaneous inhibition of AKT, ERK and p38 pathways inhibits cell proliferation. SMMC-7721 or ZIP177 cells in logarithmic growth phase were inoculated into 96-well and 6-well plates at a density of 3×10 ³ /well and 2×10 ⁵ /well, cultured overnight, and treated with inhibitor for 72 h. . The doses administered were MK2206 (1 μM), Trametinib (1 μM) and Skepone-L (10 μM), respectively. (A) Cell fixation was detected by SRB method after fixation with pre-cooled TCA for more than 1 h; (B) Cells were lysed with RIPA lysate and quantified by BCA method to prepare samples for Western blotting.

Figure 15. Simultaneous inhibition of AKT, ERK and p38 pathways induces apoptosis. SMMC-7721 or ZIP177 cells in logarithmic growth phase were seeded in 6-well plates at a density of 2 × 10 ⁵ /well, cultured overnight, treated with inhibitor for 3 h or 48 h, and the signal pathway was detected by Western blotting.

Figure 16. Three kinases are highly activated in liver cancer cell lines. In the log phase, Hep3B, HepG2, QGY-7703, SK-Hep-1, ZIP177, SMMC-7721, BEL-7402, Huh-7 or QSG-7701 were inoculated into a 6-well plate, and the degree of fusion was 90%. Wash twice with pre-cooled PBS, lyse the cells with RIPA lysate, quantify the protein by BCA, and prepare samples for Western blot analysis.

Figure 17. The activity of the three kinases in liver cancer tissues is significantly higher than in normal liver tissues. The liver cancer and the paired normal liver tissues stored in liquid nitrogen were frozen, the cells were lysed with RIPA lysate, and the protein was quantified by the BCA method, and samples were prepared for Western blot analysis. (A) The expression levels of p-ALK, p-FGFR2 and p-EphA5 relative to β-Actin in 24 pairs of liver cancer and normal liver tissues were counted; (B) Representative Western blotting results were obtained.

Figure 18. Differences in the levels of activation of the three kinases in liver cancer samples. The activation of three kinases in tissues of different liver cancer patients was analyzed by immunohistochemistry.

Figure 19. Three kinases are highly activated in approximately 13% of liver cancer patients. The immunohistochemical staining intensity of the three kinases in the tissue microarray was analyzed by SPSS Statistic software.

Figure 20. Correlation analysis of the prognosis of three kinases in patients with liver cancer.

Figure 21. Combination of three kinase inhibitors inhibits xenograft growth in SMMC-7721 nude mice. SMMC-7721 cells were inoculated subcutaneously, 5×10 ⁶ / mice, and the tumor volume was about 100 mm. ³ The tumor volume and body weight were randomly divided into groups. The experimental group was given dasatinib 25 mg/kg and ceratinib 25 mg/kg. The drug was administered in combination with AZD4547 12.5 mg/kg and the same dose of the three drugs, and the control group was given the same amount of solvent, orally, once a day for 2 weeks. Tumor volume at each time point was measured to evaluate tumor suppressor activity.

Figure 22. Combination of three kinase inhibitors to inhibit downstream signaling pathways. Appropriate amount of tumor tissue was ground, lysed with RIPA lysate for 30 min on ice, protein quantified by BCA method, and signal pathway was detected by Western blotting.

Figure 23. Immunohistochemical staining of three kinase phosphorylation levels. At the end of the experiment, the tumor was taken out, frozen at -80 ° C, and frozen sections were prepared for immunohistochemical staining. phosphor-ALK (GTX16377, Genetex), 1:50; phosphor-FGFR2 (ab111124, Abcam), 1:50; phosphor-EphA5 antibody (GTX17348, Genetex), 1:50; Ki-67 antibody (ab16667, Abcam), 1:100; CD34 antibody (Ab8158, Abcam), 1:100.

Figure 24. Combination therapy significantly affects mouse body weight. SMMC-7721 cells were inoculated subcutaneously, 5×10 ⁶ / mice, and the tumor volume was about 100 mm. ³ The tumor volume and body weight were randomly divided into groups. The experimental group was given dasatinib 25 mg/kg and ceratinib 25 mg/kg. The drug was administered in combination with AZD4547 12.5 mg/kg and the same dose of three drugs, and the control group was given the same amount of solvent, orally, once a day for 2 weeks. The body weight of mice at each time point was measured to evaluate drug toxicity.

Figure 25. Hsp90 interacts with ALK, FGFR2 and EphA5. (A) The logarithmic growth of ZIP177 or SMMC-7721 was inoculated into a 100 mm culture dish, the degree of fusion reached 90%, washed twice with pre-cooled PBS, 600 μl of lysate was added and lysed on ice for 30 min, and the lysate was collected. 12,000 x g, 4 ° C, centrifuged for 30 min. Take 50μl of prepared sample as input, and add the remaining samples to EphA5, ALK, FGFR2 antibody, shake overnight at 4°C, add 25μl protein A/G beads, incubate for 4h at 4°C, 2000×rpm, centrifuge for 6min, elute 6 times. A sample was prepared by adding 30 μl of 1×SDS lysate for Western blotting; (B) Incubation with Hsp90 antibody was performed as above to detect protein interaction.

Figure 26. PU-H71 beads under ALK, FGFR2 and EphA5. The logarithmic growth of ZIP177 or SMMC-7721 was inoculated into a 100 mm culture dish, the degree of fusion was 90%, washed twice with pre-cooled PBS, 600 μl of lysate was added and lysed on ice for 30 min, and the lysate was collected, 12,000×g. , 4 ° C, centrifugation for 30 min. Take 50 μl of the prepared sample as input, and add the remaining sample to 80 μl of PU-H71 beads or control beads, shake at 4 ° C overnight, centrifuge at 2000×rpm for 6 min, elute 6 times, and add 30 μl of 1×SDS lysate to prepare samples for Western blot detection.

Figure 27. Hsp90 inhibitors inhibit the binding of Hsp90 to ALK, FGFR2 or EphA5. (A) Liver cells in logarithmic growth phase were inoculated into 100 mm culture dishes, and the degree of fusion was 90%. The serum-free medium was replaced with 1 μM Ganetespib for 4 h, washed twice with pre-cooled PBS, and containing protease inhibitors. The NP-40 lysate with phosphatase inhibitor was lysed on ice for 30 min, and the lysate was collected, 12000 x g, 4 ° C, and centrifuged for 30 min. Take 50 μl of the prepared sample as input, add the remaining sample to Hsp90 antibody or IgG, shake overnight at 4 ° C, add 25 μl of protein A/G beads, incubate for 4 h on a shaker at 4 ° C, centrifuge at 2000 × rpm, centrifuge for 3 min, elute 3 times, add 30 μl A sample was prepared from 1×SDS lysate for Western blotting; (B) As above, Hsp90 was immunoprecipitated by adding ALK, FGFR2 or EphA5 antibody.

Figure 28. Ganetespib affects the stability of ALK, FGFR2 and EphA5 proteins. (A) SMMC-7721 or ZIP177 cells in logarithmic growth phase were seeded in 6-well plates at a density of 2 × 10 ⁵ /well, cultured overnight, and given 0.1 μM Ganetespib for 6h, 12h, 24h or 48h, adding 1× SDS lysate preparation samples for Western blotting; (B) SMMC-7721 or ZIP177 cells in logarithmic growth phase were seeded in 6-well plates at a density of 2 × 10 ⁵ /well, cultured overnight, given 0.1 μM Ganetespib was used for 24h, total RNA was extracted by Trizol in one step, cDNA was synthesized by Takara reverse transcription kit, and mRNA expression was detected by RealTime PCR.

Figure 29. MG-132 reverses the degradation of three kinases by Ganetespib. SMMC-7721 cells in logarithmic growth phase were inoculated into 6-well plates at a density of 2×10 ⁵ /well, cultured overnight, added with 10 μM MG132 for 6 h, washed twice with culture medium, added with fresh medium, and added to Ganetespib. For 24 h, samples were prepared by adding 1×SDS lysate for Western blotting.

Figure 30. Hsp90 expression is higher in liver cancer tissues than in normal tissues. Western blot was used to detect the expression of Hsp90 in 24 pairs of frozen HCC tissues and normal tissues. Actin was used as an internal reference control.

Figure 31. The expression of Hsp90 is positively correlated with the level of activation of the three kinases. Immunohistochemistry (IHC) was used to detect the expression of Hsp90 in 250 patients with HCC, and it was determined that the high hsp90 individuals were highly activated by three kinases, one or two kinases were highly activated, and the three kinases were activated. The proportion in the middle. Note that "high Hsp90 expression" is the median value relative to all samples.

Figure 32. IC50 of Hsp90 inhibitor and sorafenib on liver cancer cells. A variety of liver cancer cell lines in logarithmic growth phase were inoculated into 96-well plates at a density of 3×10 ³ /well, cultured overnight, added with drug for 72 h, fixed with pre-cooled TCA for more than 1 h, and cells were detected by SRB method. proliferation.

Figure 33. IC50 of Hsp90 inhibitors on normal hepatocytes. Logarithmic growth phase hepatocytes LO2 and QSG-7701 were inoculated into 96-well plates at 3000/well. After incubation overnight, different concentrations of Hsp90 inhibitor were added. After 72 hours, cell proliferation was detected by SRB method.

Figure 34. Inhibition of Hsp90 activity inhibits proliferation of liver cancer cells. ZIP177 or SMMC-7721 cells in the logarithmic growth phase were seeded in 96-well plates at a density of 3 × 10 ³ /well and cultured overnight. (A) Transferring NC and Hsp90 siRNA fragments using RNAiMAX reagent for 72 h; (B) adding DMSO and Ganetespib (0.01 μM, 0.1 μM, 1 μM) for 72 h. Cell proliferation was detected by SRB method by pre-cooling TCA for more than 1 h.

Figure 35. Inhibition of Hsp90 activity induces apoptosis. SMMC-7721 or ZIP177 cells in logarithmic growth phase were seeded in a 12-well plate at a density of 1 × 10 ⁵ /well and cultured overnight. (A) The NCi and Hsp90 interference fragments were transferred into cells using RNAiMAX transfection reagent. 72h; (B) different doses of Ganetespib (0.01μM, 0.1μM, 1μM) were added for 48h. Trypsin digestion, double staining with PI/AnnexinV, and detection of apoptosis by flow cytometry.

Figure 36. Inhibition of Hsp90 activity downregulates ALK, FGFR2 and EphA5 protein expression and downstream signaling pathways. SMMC-7721 or ZIP177 cells in logarithmic growth phase were seeded in 6-well plates at a density of 1 × 10 ⁵ /well, cultured overnight, (A) transferred to NC and Hsp90 siRNA fragments using RNAiMAX reagent, (B) added to Ganetespib (0.01 μM, 0.1 μM, 1 μM) for 24 h and 48 h, respectively. Samples were prepared by adding 1 x SDS lysate for Western blotting.

Figure 37. Effect of Ganetespib on other kinases. The ZIP177 and SMMC-7721 cells in logarithmic growth phase were inoculated into 6-well plates at 2×10 ⁶ , and after different concentrations of Ganetespib were added for 24 h and 48 h, protein samples were collected for protein imprinting.

Figure 38. Ganetespib inhibits xenograft growth in nude mice. (A) Subcutaneously inoculated SMMC-7721 cells, 5×10 ⁶ /mouse, the tumor volume was approximately 100 mm ³ and randomly divided according to tumor volume and body weight. The experimental group was given Ganetespib 10 mg/kg and 30 mg/kg, respectively. An equal amount of solvent was administered by intraperitoneal injection, and administration was continued for 4 weeks three times a week. The tumor volume at each time point was measured to evaluate the tumor suppressor activity; (B) The body weight change of the mice at the corresponding time points was weighed to evaluate drug toxicity.

Figure 39. Effect of Hsp90 inhibitors on signaling pathways in an in vivo model. Appropriate amount of tumor tissue was ground, lysed with RIPA lysate for 30 min on ice, protein quantified by BCA method, and signal pathway was detected by Western blotting.

Figure 40. Combination of three kinase inhibitors inhibits the growth of liver cancer PDX. The LI0752 liver cancer PDX model was established by subcutaneous inoculation in mice. The mice were randomly divided into 5 groups when the tumor size was about 100-150 mm ³ , and the solvent control, coloritinib (25 mg/kg) and AZD4547 (12.5 mg) were separately administered. /kg), dasatinib (25mg/kg) and the same dose of the combination, once a day, continuous administration for 21 days, three times a week to measure tumor size.

Figure 41. Effect of three kinase inhibitors on three kinases and downstream signaling pathways in the liver cancer PDX model. The LI0752 liver cancer PDX model was established by subcutaneous inoculation in mice. The mice were randomly divided into 5 groups when the tumor size was about 100-150 mm ³ , and the solvent control, coloritinib (25 mg/kg) and AZD4547 (12.5 mg) were separately administered. /kg), dasatinib (25mg/kg) and the same dose of the combination, once a day, continuous administration for 21 days, the end of the experiment with RIPA lysed tumor tissue, Western blot detection.

Figure 42. Ganetespib inhibits the growth of liver cancer PDX. The LI0752 liver cancer PDX model was established by subcutaneous inoculation in mice. The mice were randomly divided into 3 groups at a tumor size of about 100-150 mm ³ , and treated with solvent control, Ganetespib (30 mg/kg) and Ganetespib (50 mg/kg). The tumor was administered three times a week and the tumor size was measured and administered continuously for three weeks.

Figure 43. Effect of Ganetespib on three kinases and downstream signaling pathways in hepatocellular carcinoma PDX. The LI0752 liver cancer PDX model was established by subcutaneous inoculation in mice. The mice were randomly divided into 3 groups at a tumor size of about 100-150 mm ³ and given a solvent control, Ganetespib (30 mg/kg) and Ganetespib (50 mg/kg). Three doses a week, continuous administration for three weeks, the end of the experiment with RIPA lysed tumor tissue, Western blot detection.

Figure 44. Effect of Ganetespib on other kinases in hepatocellular carcinoma PDX. The LI0752 liver cancer PDX model was established by subcutaneous inoculation in mice. The mice were randomly divided into 3 groups at a tumor size of about 100-150 mm ³ and given a solvent control, Ganetespib (30 mg/kg) and Ganetespib (50 mg/kg). Three doses a week, continuous administration for three weeks, the end of the experiment with RIPA lysed tumor tissue, Western blot detection.

Figure 45. Activation of ALK, FGFR2 and EphA5 in liver cancer PDX arrays.

Figure 46. Affymetrix Genome-Wide Human Mapping SNP 6.0 Array.

Figure 47. Overall pattern diagram.

Detailed ways

The present invention satisfies the above needs by recognizing a core kinase group useful as a molecular targeted therapeutic target in liver cancer and its corresponding signaling pathway, and administering a combination of specific kinase inhibitors to inhibit liver cancer cell proliferation and thereby treat liver cancer.

The inventors have surprisingly discovered that key kinase groups in liver cancer: ALK, FGFR2 and EphA5, and their corresponding pathways serve as potential drug targets for molecular targeted therapy of liver cancer, and thereby design intervention and therapeutic strategies for liver cancer. In particular, the inventors have surprisingly found that the combination of three kinase inhibitors of ceratinib, dasatinib and AZD4547 and/or inhibitors of their corresponding signaling pathways significantly inhibits proliferation of hepatoma cells. And / or liver cancer transplanted tumor growth. Accordingly, the present invention provides a novel pharmaceutical combination and method for treating liver cancer, which has an excellent effect of inhibiting proliferation of liver cancer cells and/or an apoptosis of cancer cells which induce liver cancer.

Specifically, the inventors studied the activation of kinases in liver cancer at the cellular level. Liver cancer was found to be highly heterogeneous. Numerous kinases are highly activated in liver cancer cells and vary in different cells. Inhibitors and siRNA interference were used to identify key kinase groups that regulate hepatoma cell proliferation: ALK, FGFR2, and EphA5. Simultaneous inhibition of the activity of these three kinases can significantly inhibit the proliferation of liver cancer cells, and the resulting inhibitory effect is significantly better than that obtained by inhibition of single kinase or both kinases. Inhibition is primarily achieved by induction of apoptosis.

Accordingly, in one aspect, the invention provides a pharmaceutical combination comprising an ALK kinase inhibitor, a FGFR2 kinase inhibitor, and an EphA5 kinase inhibitor. The invention also provides a method of treating liver cancer in a subject, comprising administering to the subject a pharmaceutical combination of the invention comprising an ALK kinase inhibitor, a FGFR2 kinase inhibitor, and an EphA5 kinase inhibitor. The invention also provides the use of an ALK kinase inhibitor, a FGFR2 kinase inhibitor, and an EphA5 kinase inhibitor for the manufacture of a medicament for treating liver cancer in a subject.

Further, the inventors identified that the downstream signaling pathways that function are mainly MAPK/ERK, PI3K/AKT, and p38 signaling pathways. Simultaneous blocking of MAPK/ERK, PI3K/AKT and p38 signaling pathways can significantly inhibit the proliferation of hepatoma cells and induce apoptosis.

Thus, in another aspect, the invention provides a pharmaceutical combination comprising an AKT signaling pathway inhibitor, a MEK signaling pathway inhibitor, and a p38 signaling pathway inhibitor. The invention also provides a method of treating liver cancer in a subject, comprising administering to the subject a pharmaceutical combination of the invention comprising an AKT signaling pathway inhibitor, a MEK signaling pathway inhibitor, and a p38 signaling pathway inhibitor. The invention also provides the use of an AKT signaling pathway inhibitor, a MEK signaling pathway inhibitor, and a p38 signaling pathway inhibitor for the manufacture of a medicament for treating liver cancer in a subject.

In addition, Western blot analysis revealed that these three kinases were significantly more active in liver cancer tissues than in adjacent tissues. Tissue microarray immunohistochemistry results in liver cancer patients confirmed that these three kinases are highly activated in 13% of patients. Moreover, Kaplan-Meier Plotter analysis suggested that the co-activation of these three kinases is closely related to the poor prognosis of patients with liver cancer, and the degree of activation of single kinase has no significant correlation with the prognosis of patients with liver cancer.

Accordingly, in yet another aspect, the invention provides a method of identifying a subtype of liver cancer in a subject comprising measuring the level of activity of ALK kinase, FGFR2 kinase, and EphA5 kinase in the subject. The invention also provides a method of treating liver cancer in a subject, comprising measuring the activity levels of ALK kinase, FGFR2 kinase, and EphA5 kinase in the subject, and if the activities of the ALK kinase, FGFR2 kinase, and EphA5 kinase Where the level of water is above normal liver tissue, the subject is administered a combination of drugs as described herein. The invention also provides kits comprising reagents for measuring the level of activity of ALK kinase, FGFR2 kinase and EphA5 kinase in a subject. The invention also provides the use of a pharmaceutical combination of the invention for treating liver cancer in a subject, wherein the activity levels of ALK kinase, FGFR2 kinase and EphA5 kinase in the subject are higher than normal liver tissue.

Further, the inventors found that ALK kinase, FGFR2 kinase and EphA5 kinase are client proteins of Hsp90 (heat shock protein 90). Expression of ALK, FGFR2 and EphA5 proteins was significantly down-regulated by the use of Hsp90 inhibitors such as Ganetespib. Therefore, ALK, FGFR2 and EphA5 can be simultaneously inhibited by blocking Hsp90 activity. Hsp90 inhibitors significantly inhibit the proliferation of liver cancer cells.

Accordingly, in yet another aspect, the invention provides a method of treating liver cancer in a subject, comprising administering to the subject an Hsp90 inhibitor. The invention also provides the use of an Hsp90 inhibitor for the manufacture of a medicament for the treatment of liver cancer. The invention also provides a method of inhibiting ALK kinase, FGFR2 kinase, and EphA5 kinase in a subject, comprising administering an Hsp90 inhibitor to the subject. The invention also provides the use of an Hsp90 inhibitor for the manufacture of a medicament for inhibiting ALK kinase, FGFR2 kinase and EphA5 kinase. The invention also provides a method of inhibiting an AKT signaling pathway, a MEK signaling pathway, and a p38 signaling pathway in a subject, comprising administering an Hsp90 inhibitor to the subject. The invention also provides the use of an Hsp90 inhibitor for the preparation of a medicament for inhibiting the AKT signaling pathway, the MEK signaling pathway, and the p38 signaling pathway. The invention also provides a pharmaceutical combination comprising an Hsp90 inhibitor and, optionally, an additional therapeutic agent.

I.ALK/FGFR2/EphA5 kinase inhibitor drug combination

As described above, the present inventors have found that the combined administration of an ALK kinase inhibitor, a FGFR2 kinase inhibitor and an EphA5 kinase inhibitor significantly inhibits the proliferation of liver cancer cells and thereby treats liver cancer.

Accordingly, the invention provides a pharmaceutical combination comprising an ALK kinase inhibitor, a FGFR2 kinase inhibitor, and an EphA5 kinase inhibitor.

As used herein, the term "ALK kinase", which is used interchangeably with "ALK", is an Anaplastic lymphoma kinase (ALK), also known as the ALK tyrosine kinase receptor or CD246, An enzyme encoded by the ALK gene in humans. ALK plays an important role in brain development and plays a role in specific neurons in the nervous system. ALK showed great sequence similarity to LTK (leukocyte tyrosine kinase).

As used herein, the term "ALK kinase inhibitor", which is used interchangeably with "ALK inhibitor", refers to an agent that has an inhibitory effect on ALK kinase. ALK inhibitors can be used as potential anticancer drugs for tumors that have a variant of ALK, such as the EML4-ALK translocation. Alka inhibitors that have been approved include, for example, Crizotinib (Xalkori) and Zykadia (Zykadia), approved by the FDA for the treatment of non-small cell lung cancer; Alectinib (Alecensa) (Chugai, has submitted NDA in Japan), approved by the FDA in December 2015. Additional ALK kinase inhibitors currently undergoing or about to undergo clinical trials include, for example, Dalantercept, ACE-041 (Acceleron); Brigatinib (AP26113) (Ariad) (which is also an EGFR inhibitor); Entrectinib (Nerviano); PF- 06463922 (Pfizer); TSR-011 (Tesaro); CEP-37440 (Teva); X-396 (Xcovery).

ALK kinase inhibitors suitable for use in the present invention may be selected, for example, from coloritripinib, crizotinib (PF-02341066), TAE684 (NVP-TAE684), Alectinib (CH5424802), ALK-IN-1, Brigatinib (AP26113), GSK1838705A, AZD3463, ASP3026 and Lorlatinib (PF-6463922). Other ALK kinase inhibitors known in the art can also be used in the present invention. In one embodiment, the ALK kinase inhibitor is Ceritinib.

Coloritinib (trade name Zykadia) is a prescription drug for the treatment of non-small cell lung cancer, developed by Novartis. Coloritinib is a selective and potent inhibitor of ALK. In normal physiology, ALK functions as a key step in the development and function of nervous system tissue. However, chromosomal translocation and fusion produce an oncogenic form of ALK that is involved in the development of non-small cell lung cancer. Coloritinib thus acts to inhibit the mutant enzyme and stop cell proliferation, ultimately stopping the development of cancer. For non-small cell lung cancer, ceritinib is in the form of a 150 mg capsule and the recommended dose is once daily, 750 mg.

As used herein, the term "FGFR2 kinase", which is used interchangeably with "FGFR2", is a Fibroblast growth factor receptor 2 kinase. FGFR2, also known as CD332, is a protein encoded by the FGFR2 gene located on chromosome 10 in humans. FGFR2 plays an important role in embryonic development and tissue repair, particularly bone and blood vessels. Similar to other members of the FGFR family, FGFR2 signals by binding to its ligand and dimerization (receptor pairing), which results in a cascade of tyrosine kinase domains that initiate intracellular signaling. At the molecular level, these signals mediate cell division, growth and differentiation. Mutations in FGFR2 are associated with numerous medical conditions, including bone dysplasia, such as craniosynostosis syndrome, and cancer, such as breast cancer.

As used herein, the term "FGFR2 kinase inhibitor", which is used interchangeably with "FGFR2 inhibitor", refers to an agent that has an inhibitory effect on FGFR2 kinase.

FGFR2 kinase inhibitors suitable for use in the present invention may be selected, for example, from AZD4547, E-3810, LY2874455, BGJ398 (NVP-BGJ398), Nindedanib (BIBF1120), CH5183284 (Debio-1347), S49076, FIIN -2, MK-2461, FPA144 and Alofanib. Other FGFR2 kinase inhibitors known in the art can also be used in the present invention. In one embodiment, the FGFR2 kinase inhibitor is AZD4547.

AZD4547 is a tyrosine kinase inhibitor that targets

FGFR

1, 2, and 3. Without wishing to be bound by theory, the present inventors have discovered that FGFR2 kinase is one of the highly activated kinases in various cell lines of liver cancer, and thus it is believed that AZD4547 targets FGFR2 in the present invention.

As used herein, the term "EphA5 kinase", which is used interchangeably with "EphA5", is an ephrin type-A receptor 5 kinase. The Eph receptor is a group of receptors that are activated in response to binding to the Eph receptor-interacting protein (ephrin, Ephrin). Eph forms the largest known subfamily of receptor tyrosine kinases (RTKs). Eph/ephrin signaling is involved in the regulation of a number of key processes in embryonic development, including axon guidance, tissue boundary formation, cell migration, and division. In addition, Eph/ephrin signaling has recently been shown to play an important role in maintaining multiple processes during adulthood, including long-term potentiation, angiogenesis, stem cell differentiation, and cancer.

As used herein, the term "EphA5 kinase inhibitor", which is used interchangeably with "EphA5 inhibitor", refers to an agent that has an inhibitory effect on EphA5 kinase.

EphA5 kinase inhibitors suitable for use in the present invention may be selected, for example, from dasatinib, staurosporine, PP2 and AG1478. Other EphA5 kinase inhibitors known in the art can also be used in the present invention. In one embodiment, the EphA5 kinase inhibitor is dasatinib.

Dasatinib is produced by Bristol-Myers Squibb and sold under the trade name Sprycel. It is a Bcr-Abl ("Philadelphia chromosome") and a Src family tyrosine kinase inhibitor approved for chronic myeloid leukemia (CLL). First-line treatment with Philadelphia chromosome-positive acute lymphoblastic leukemia (Ph+ALL). The main targets of dasatinib are BCR/Abl, Scr, c-kit, ephrin receptor and various other tyrosine kinases. In the present invention, the key target for dasatinib was found to be EphA5.

The inventors found that the combination of three specific kinase inhibitors, ceratinib, AZD4547 and dasatinib, significantly inhibited the proliferation of hepatoma cells and determined the key targets of ceratinib, AZD4547 and dasatinib, respectively. It is ALK, FGFR2 and EphA5. Therefore, an ALK kinase inhibitor, a FGFR2 kinase inhibitor, and an EphA5 kinase inhibitor can be administered in combination to inhibit proliferation of liver cancer cells, and thereby treat liver cancer. In some embodiments, a pharmaceutical combination described herein can comprise one or more ALK kinase inhibitors, one or more FGFR2 kinase inhibitors, and one or more EphA5 kinase inhibitors. As used herein, the term "various" may be more than one, for example, two, three, four, five or more. In a preferred embodiment, the pharmaceutical combination described herein comprises ceratinib, AZD4547 and dasatinib.

In some embodiments, the pharmaceutical combinations described herein comprise an effective amount of an ALK kinase inhibitor, a FGFR2 kinase inhibitor, and an EphA5 kinase inhibitor. As used herein, the term "effective amount" refers to an amount of a component of a pharmaceutical combination described herein that is effective to achieve an effective treatment, such as an amount effective to inhibit cancer cell proliferation. In some embodiments, the pharmaceutical combinations described herein are administered to a subject in an effective amount.

In some aspects, the pharmaceutical combinations described herein are administered at a dose based on the weight of the subject. In some embodiments, the pharmaceutical combinations described herein comprise an amount of an ALK kinase inhibitor, a FGFR2 kinase inhibitor, and an EphA5 kinase inhibitor, by weight of the subject.

In some embodiments, the amount of ALK kinase inhibitor in the pharmaceutical combination described herein is from about 1.0 to about 50.0 mg/kg or greater, preferably from about 5.0 to 40.0 mg/kg, more by weight of the subject, more It is preferably in the range of about 10.0 to 30.0 mg/kg, and most preferably about 12.5 to 25.0 mg/kg. In some embodiments, the amount of ALK kinase inhibitor in the pharmaceutical combination described herein is about 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, by weight of the subject. 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5, 10.0, 10.5, 11.0, 11.5, 12.0, 12.5, 13.0, 13.5, 14.0, 14.5, 15.0, 15.5, 16.0, 16.5, 17.0, 17.5, 18.0, 18.5 19.0, 19.5, 20.0, 20.5, 21.0, 21.5, 22.0, 22.5, 23.0, 23.5, 24.0, 24.5, 25.0, 25.5, 26.0, 26.5, 27.0, 27.5, 28.0, 28.5, 29.0, 29.5, 30.0, 30.5, 31.0 31.5, 32.0, 32.5, 33.0, 33.5, 34.0, 34.5, 35.0, 35.5, 36.0, 36.5, 37.0, 37.5, 38.0, 38.5, 39.0, 39.5, 40.0, 40.5, 41.0, 41.5, 42.0, 42.5, 43.0, 43.5 , 44.0, 44.5, 45.0, 45.5, 46.0, 46.5, 47.0, 47.5, 48.0, 48.5, 49.0, 49.5, 50.0 mg/kg or higher, or any of the foregoing values as a range of endpoints or any value therein, such as 1.1 to 1.4 mg/kg, etc. or about 1.1, 1.2, 1.3, 1.4 mg/kg, and the like. In a preferred embodiment, the amount of ALK kinase inhibitor in the pharmaceutical combination described herein is about 12.5 or 25 mg/kg, preferably about 25 mg/kg, by weight of the subject. In a preferred embodiment, the ALK kinase inhibitor in the pharmaceutical combination described herein is an amount of colorilineib of about 12.5 or 25 mg/kg, preferably about 25 mg/kg, by weight of the subject.

In some embodiments, the amount of FGFR2 kinase inhibitor in the pharmaceutical combination described herein is from about 1.0 to about 50.0 mg/kg or greater, preferably from about 5.0 to 40.0 mg/kg, more by weight of the subject, more It is preferably in the range of about 10.0 to 30.0 mg/kg, and most preferably about 12.5 to 25.0 mg/kg. In some embodiments, the amount of FGFR2 kinase inhibitor in the pharmaceutical combination described herein is about 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, by weight of the subject. 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5, 10.0, 10.5, 11.0, 11.5, 12.0, 12.5, 13.0, 13.5, 14.0, 14.5, 15.0, 15.5, 16.0, 16.5, 17.0, 17.5, 18.0, 18.5 19.0, 19.5, 20.0, 20.5, 21.0, 21.5, 22.0, 22.5, 23.0, 23.5, 24.0, 24.5, 25.0, 25.5, 26.0, 26.5, 27.0, 27.5, 28.0, 28.5, 29.0, 29.5, 30.0, 30.5, 31.0 31.5, 32.0, 32.5, 33.0, 33.5, 34.0, 34.5, 35.0, 35.5, 36.0, 36.5, 37.0, 37.5, 38.0, 38.5, 39.0, 39.5, 40.0, 40.5, 41.0, 41.5, 42.0, 42.5, 43.0, 43.5 , 44.0, 44.5, 45.0, 45.5, 46.0, 46.5, 47.0, 47.5, 48.0, 48.5, 49.0, 49.5, 50.0 mg/kg or higher, or any of the foregoing values as a range of endpoints or any value therein, such as 1.1 to 1.4 mg/kg, etc. or about 1.1, 1.2, 1.3, 1.4 mg/kg, and the like. In a preferred embodiment, the amount of FGFR2 kinase inhibitor in the pharmaceutical combination described herein is about 12.5 or 25 mg/kg, preferably about 12.5 mg/kg, by weight of the subject. In a preferred embodiment, the FGFR2 kinase inhibitor in the pharmaceutical combination described herein is AZD4547 in an amount of about 12.5 or 25 mg/kg, preferably about 12.5 mg/kg, by weight of the subject.

In some embodiments, the amount of EphA5 kinase inhibitor in the pharmaceutical combination described herein is from about 1.0 to about 50.0 mg/kg or greater, preferably from about 5.0 to 40.0 mg/kg, more by weight of the subject, more It is preferably in the range of about 10.0 to 30.0 mg/kg, and most preferably about 12.5 to 25.0 mg/kg. In some embodiments, the amount of EphA5 kinase inhibitor in the pharmaceutical combination described herein is about 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, by weight of the subject. 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5, 10.0, 10.5, 11.0, 11.5, 12.0, 12.5, 13.0, 13.5, 14.0, 14.5, 15.0, 15.5, 16.0, 16.5, 17.0, 17.5, 18.0, 18.5 19.0, 19.5, 20.0, 20.5, 21.0, 21.5, 22.0, 22.5, 23.0, 23.5, 24.0, 24.5, 25.0, 25.5, 26.0, 26.5, 27.0, 27.5, 28.0, 28.5, 29.0, 29.5, 30.0, 30.5, 31.0 31.5, 32.0, 32.5, 33.0, 33.5, 34.0, 34.5, 35.0, 35.5, 36.0, 36.5, 37.0, 37.5, 38.0, 38.5, 39.0, 39.5, 40.0, 40.5, 41.0, 41.5, 42.0, 42.5, 43.0, 43.5 , 44.0, 44.5, 45.0, 45.5, 46.0, 46.5, 47.0, 47.5, 48.0, 48.5, 49.0, 49.5, 50.0 mg/kg or higher, or any of the foregoing values as a range of endpoints or any value therein, such as 1.1 to 1.4 mg/kg, etc. or about 1.1, 1.2, 1.3, 1.4 mg/kg, and the like. In a preferred embodiment, the amount of EphA5 kinase inhibitor in the pharmaceutical combination described herein is about 12.5 or 25 mg/kg, preferably about 25 mg/kg, by weight of the subject. In a preferred embodiment, the EphA5 kinase inhibitor in the pharmaceutical combination described herein is dasatinib in an amount of about 12.5 or 25 mg/kg, preferably about 25 mg/kg, by weight of the subject.

In some embodiments, the pharmaceutical combinations described herein comprise about 12.5 or 25 mg/kg of an ALK kinase inhibitor, about 12.5 or 25 mg/kg of an FGFR2 kinase inhibitor, and about 12.5 or 25 mg/kg, by weight of the subject. EphA5 kinase inhibitor. In some embodiments, the pharmaceutical combinations described herein comprise about 12.5 or 25 mg/kg of ceratinib, about 12.5 or 25 mg/kg of AZD4547, and about 12.5 or 25 mg/kg of dalsate, by weight of the subject. Ni. In a preferred embodiment, the pharmaceutical combination described herein comprises about 25 mg/kg of ceratinib, about 12.5 mg/kg of AZD4547, and about 25 mg/kg of dasatinib, by weight of the subject.

In other aspects, the pharmaceutical combinations described herein are administered in a fixed dose. In some embodiments, the pharmaceutical combinations described herein comprise a fixed amount of an ALK kinase inhibitor, a FGFR2 kinase inhibitor, and an EphA5 kinase inhibitor.

In some embodiments, the amounts of the ALK kinase inhibitor, FGFR2 kinase inhibitor, and EphA5 kinase inhibitor in the pharmaceutical combinations described herein are each independently about 1, 2, 3, 4, 5, 6, 7, 8 9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33 , 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 55, 60, 65, 70, 75, 80, 85, 90 , 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, 200 mg or higher, or any The foregoing values are included as a range of endpoints or any value therein, for example, about 1.1 to 1.4 mg or the like or about 1.1, 1.2, 1.3, 1.4 mg, and the like.

In still other aspects, some of the components of the pharmaceutical combinations described herein are administered in a dosage according to the weight of the subject as described above, while the other components are administered in a fixed dose as described above. In some embodiments, the amount of a portion of the components of the pharmaceutical combinations described herein is the amount by weight of the subject as described above, while the other components are in a fixed amount as described above.

In some embodiments, the weight ratio of the ALK kinase inhibitor, the FGFR2 kinase inhibitor, and the EphA5 kinase inhibitor in the pharmaceutical combination described herein is x:y:z, wherein x, y, and z are each independently about 1 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20. In a preferred embodiment, the weight ratio of the ALK kinase inhibitor, the FGFR2 kinase inhibitor, and the EphA5 kinase inhibitor in the pharmaceutical combination described herein is about 2:1:2 or about 1:1:1. In a preferred embodiment, the weight ratio of chromatinib, AZD4547, and dasatinib in the pharmaceutical combination described herein is about 2:1:2 or about 1:1:1.

The invention also provides a method of treating liver cancer in a subject, comprising administering to the subject a pharmaceutical combination described herein comprising an ALK kinase inhibitor, a FGFR2 kinase inhibitor, and an EphA5 kinase inhibitor described herein. . The invention also provides a pharmaceutical combination as described herein, comprising the use of an ALK kinase inhibitor, a FGFR2 kinase inhibitor, and an EphA5 kinase inhibitor described herein, in the manufacture of a medicament for treating liver cancer in a subject. The invention also provides a method for inhibiting ALK kinase, FGFR2 kinase, and EphA5 kinase, comprising administering to a subject a pharmaceutical combination described herein, comprising an ALK kinase inhibitor, a FGFR2 kinase inhibitor, and an EphA5 kinase described herein. Inhibitor. The invention also provides a pharmaceutical combination as described herein, comprising an ALK kinase inhibitor, a FGFR2 kinase inhibitor, and an EphA5 kinase inhibitor described herein, for use in the manufacture of a medicament for inhibiting ALK kinase, FGFR2 kinase, and EphA5 kinase . The invention also provides methods for inhibiting the AKT signaling pathway, the MEK signaling pathway, and the p38 signaling pathway, comprising administering to a subject a pharmaceutical combination described herein comprising an ALK kinase inhibitor, a FGFR2 kinase inhibitor described herein And EphA5 kinase inhibitors. The invention also provides a pharmaceutical combination comprising an ALK kinase inhibitor, a FGFR2 kinase inhibitor, and an EphA5 kinase inhibitor described herein for the manufacture of a medicament for use in inhibiting the AKT signaling pathway, the MEK signaling pathway, and the p38 signaling pathway Use in. In one embodiment, the activity levels of ALK kinase, FGFR2 kinase, and EphA5 kinase in the subject are higher than normal liver tissue. In one embodiment, the activity levels of the AKT signaling pathway, the MEK signaling pathway, and the p38 signaling pathway in the subject are higher than normal liver tissue.

In some embodiments, the components of the pharmaceutical combinations described herein can be the same compound. That is, the pharmaceutical combination of the present invention comprises a single compound, consists essentially of a single compound, or consists of a single compound that targets, and preferably inhibits, ALK kinase, FGFR2 kinase and EphA5 kinase.

In another aspect, the invention also provides compounds that co-target, and preferably inhibit, ALK kinase, FGFR2 kinase, and EphA5 kinase. Those skilled in the art will recognize that the compounds can be combined with the technical features or effects described in the various embodiments in place of the pharmaceutical combinations described herein.

II. Combination of AKT/MEK/p38 signaling pathway inhibitors

As described above, the present invention further investigates the relevant downstream signaling pathways of ALK, FGFR2 and EphA5, and identifies that the key downstream signaling pathways are the three signaling pathways AKT, MEK and p38. By inhibiting these three signaling pathways simultaneously, the proliferation of liver cancer cells can be significantly inhibited.

Accordingly, the present invention provides a pharmaceutical combination comprising an AKT signaling pathway inhibitor, a MEK signaling pathway inhibitor, and a p38 signaling pathway inhibitor.

As used herein, the term "AKT signaling pathway inhibitor", which is used interchangeably with "AKT inhibitor", refers to an agent that has an inhibitory effect on the AKT signaling pathway. The Akt pathway or the PI3K-Akt pathway is a signal transduction pathway that promotes survival and growth in response to extracellular signals. Key proteins include PI3K (phosphatidylinositol 3-kinase) and Akt (Protein Kinase B). Problems associated with PI3K-Akt pathway regulation can lead to increased signaling activity, which is associated with a variety of diseases such as cancer and type 2 diabetes.

The AKT signaling pathway inhibitor suitable for use in the present invention may be selected, for example, from MK2206, Deguelin, Ipatasertib (GDC-0068), GSK690693, AZD5363, AT7867, Afuresertib (GSK2110183), Miltefosine and Perifosine (KRX-0401). Other AKT signaling pathway inhibitors known in the art are also useful in the present invention. In one embodiment, the AKT signaling pathway inhibitor is MK2206.

MK2206 is used as an allosteric AKT inhibitor. It is a highly selective inhibitor of all three AKT isoforms: Aktl, Akt2 and Akt3. Clinical trials using MK2206 to treat cancer such as colorectal cancer and breast cancer have been conducted.

As used herein, the term "MEK signaling pathway inhibitor", which is used interchangeably with "MEK inhibitor", refers to an agent that has an inhibitory effect on the MEK signaling pathway. The MEK signaling pathway or the MAPK/ERK pathway or the Ras-Raf-MEK-ERK pathway is a cascade of proteins in cells that transmit signals from receptors on the cell surface to DNA within the nucleus. This pathway involves a variety of proteins, including MAPK (mitogen-activated protein kinase; originally called ERK (extracellular signal-regulated kinase)). In many cancers, such as melanoma, defects in the MAPK/ERK pathway result in uncontrolled growth.

MEK signaling pathway inhibitors suitable for use in the present invention may be selected, for example, from trimetinib (GSK1120212), GDC-0623, PD-325901, U0126-EtOH, Cobimetinib (XL518, GDC-0973, RG7420), GDC -0623, TAK-733, Binimetinib (MEK162), Selumetinib, PD-325901 and CI-1040. Other MEK signaling pathway inhibitors known in the art can also be used in the present invention. In one embodiment, the MEK signaling pathway inhibitor is trimetinib.

Trimetinib is a MEK inhibitor drug with anticancer activity. It inhibits MEK1 and MEK2. In May 2013, the FDA approved trimetinib for the treatment of patients with BRAF V600E mutation metastatic melanoma. On January 8, 2014, the FDA approved the combination of the BRAF inhibitor dalafinib and trimetinib for the treatment of patients with BRAF V600E/K mutant metastatic melanoma.

As used herein, the term "p38 signaling pathway inhibitor", which is used interchangeably with "p38 inhibitor", refers to an agent that has an inhibitory effect on a p38 signaling pathway inhibitor. The p38 mitogen-activated protein kinase is a class of mitogen-activated protein kinases (MAPKs) that respond to stress stimuli such as cytokines, ultraviolet radiation, heat shock, and are involved in cell differentiation, apoptosis, and autophagy. Abnormal activity of p38 (above or below physiological activity) involves pathological events in a variety of tissues including neurons, bone, lung, heart, skeletal muscle, red blood cells, and fetal tissue.

The p38 signaling pathway inhibitor suitable for use in the present invention may be selected, for example, from Skepinone-L, SB239063, SB203580, SB202190 (FHPI), BIRB 796, VX-702, SCIO 469, PH-797804 and BMS 582949. Other p38 signaling pathway inhibitors known in the art can also be used in the present invention. In one embodiment, the p38 signaling pathway inhibitor is Skepinone-L.

Skepinone-L is the first ATP-competitive p38 MAPK inhibitor with excellent in vivo potency and selectivity.

The inventors found that the combined administration of three signaling pathway inhibitors, AKT signaling pathway inhibitor, MEK signaling pathway inhibitor and p38 signaling pathway inhibitor, significantly inhibited hepatoma cell proliferation. Thus, AKT signaling pathway inhibitors, MEK signaling pathway inhibitors, and p38 signaling pathway inhibitors can be administered in combination to inhibit hepatoma cell proliferation and thereby treat liver cancer. In some embodiments, a pharmaceutical combination described herein can comprise one or more AKT signaling pathway inhibitors, one or more MEK signaling pathway inhibitors, and one or more p38 signaling pathway inhibitors. As used herein, the term "various" may be more than one, for example, two, three, four, five or more. In a preferred embodiment, the pharmaceutical combination described herein comprises MK2206, trimetinib and Skepinone-L.

In some embodiments, the pharmaceutical combinations described herein comprise an effective amount of an AKT signaling pathway inhibitor, a MEK signaling pathway inhibitor, and a p38 signaling pathway inhibitor. As used herein, the term "effective amount" refers to an amount of a component of a pharmaceutical combination described herein that is effective to achieve an effective treatment, such as an amount effective to inhibit cancer cell proliferation. In some embodiments, the pharmaceutical combinations described herein are administered to a subject in an effective amount.

In some aspects, the pharmaceutical combinations described herein are administered at a dose based on the weight of the subject. In some embodiments, the pharmaceutical combinations described herein comprise an amount of an AKT signaling pathway inhibitor, a MEK signaling pathway inhibitor, and a p38 signaling pathway inhibitor, by weight of the subject.

In some embodiments, the amount of AKT signaling pathway inhibitor in the pharmaceutical combination described herein is from about 1.0 to about 50.0 mg/kg or greater, preferably from about 5.0 to 40.0 mg/kg, by weight of the subject, More preferably, it is in the range of about 10.0 to 30.0 mg/kg, and most preferably about 12.5 to 25.0 mg/kg. In some embodiments, the amount of ALK kinase inhibitor in the pharmaceutical combination described herein is about 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, by weight of the subject. 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5, 10.0, 10.5, 11.0, 11.5, 12.0, 12.5, 13.0, 13.5, 14.0, 14.5, 15.0, 15.5, 16.0, 16.5, 17.0, 17.5, 18.0, 18.5 19.0, 19.5, 20.0, 20.5, 21.0, 21.5, 22.0, 22.5, 23.0, 23.5, 24.0, 24.5, 25.0, 25.5, 26.0, 26.5, 27.0, 27.5, 28.0, 28.5, 29.0, 29.5, 30.0, 30.5, 31.0 31.5, 32.0, 32.5, 33.0, 33.5, 34.0, 34.5, 35.0, 35.5, 36.0, 36.5, 37.0, 37.5, 38.0, 38.5, 39.0, 39.5, 40.0, 40.5, 41.0, 41.5, 42.0, 42.5, 43.0, 43.5 , 44.0, 44.5, 45.0, 45.5, 46.0, 46.5, 47.0, 47.5, 48.0, 48.5, 49.0, 49.5, 50.0 mg/kg or higher, or any of the foregoing values as a range of endpoints or any value therein, such as 1.1 to 1.4 mg/kg, etc. or about 1.1, 1.2, 1.3, 1.4 mg/kg, and the like. In a preferred embodiment, the amount of AKT signaling pathway inhibitor in the pharmaceutical combination described herein is about 12.5 or 25 mg/kg, by weight of the subject. In a preferred embodiment, the AKT signaling pathway inhibitor in the pharmaceutical combination described herein is MK2206 in an amount of about 12.5 or 25 mg/kg, by weight of the subject.

In some embodiments, the amount of MEK signaling pathway inhibitor in the pharmaceutical combination described herein is from about 1.0 to about 50.0 mg/kg or greater, preferably from about 5.0 to 40.0 mg/kg, by weight of the subject, More preferably, it is in the range of about 10.0 to 30.0 mg/kg, and most preferably about 12.5 to 25.0 mg/kg. In some embodiments, the amount of MEK signaling pathway inhibitor in the pharmaceutical combination described herein is about 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, by weight of the subject. 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5, 10.0, 10.5, 11.0, 11.5, 12.0, 12.5, 13.0, 13.5, 14.0, 14.5, 15.0, 15.5, 16.0, 16.5, 17.0, 17.5, 18.0, 18.5, 19.0, 19.5, 20.0, 20.5, 21.0, 21.5, 22.0, 22.5, 23.0, 23.5, 24.0, 24.5, 25.0, 25.5, 26.0, 26.5, 27.0, 27.5, 28.0, 28.5, 29.0, 29.5, 30.0, 30.5, 31.0, 31.5, 32.0, 32.5, 33.0, 33.5, 34.0, 34.5, 35.0, 35.5, 36.0, 36.5, 37.0, 37.5, 38.0, 38.5, 39.0, 39.5, 40.0, 40.5, 41.0, 41.5, 42.0, 42.5, 43.0, 43.5, 44.0, 44.5, 45.0, 45.5, 46.0, 46.5, 47.0, 47.5, 48.0, 48.5, 49.0, 49.5, 50.0 mg/kg or higher, or any of the foregoing values as a range of endpoints or any value therein, for example About 1.1 to 1.4 mg/kg or the like or about 1.1, 1.2, 1.3, 1.4 mg/kg, and the like. In a preferred embodiment, the amount of MEK signaling pathway inhibitor in the pharmaceutical combination described herein is about 12.5 or 25 mg/kg, by weight of the subject. In a preferred embodiment, the MEK signaling pathway inhibitor in the pharmaceutical combination described herein is trimetinib in an amount of about 12.5 or 25 mg/kg, by weight of the subject.

In some embodiments, the amount of the p38 signaling pathway inhibitor in the pharmaceutical combination described herein is from about 1.0 to about 50.0 mg/kg or greater, preferably from about 5.0 to 40.0 mg/kg, by weight of the subject, More preferably, it is in the range of about 10.0 to 30.0 mg/kg, and most preferably about 12.5 to 25.0 mg/kg. In some embodiments, the amount of the p38 signaling pathway inhibitor in the pharmaceutical combination described herein is about 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, by weight of the subject. 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5, 10.0, 10.5, 11.0, 11.5, 12.0, 12.5, 13.0, 13.5, 14.0, 14.5, 15.0, 15.5, 16.0, 16.5, 17.0, 17.5, 18.0, 18.5, 19.0, 19.5, 20.0, 20.5, 21.0, 21.5, 22.0, 22.5, 23.0, 23.5, 24.0, 24.5, 25.0, 25.5, 26.0, 26.5, 27.0, 27.5, 28.0, 28.5, 29.0, 29.5, 30.0, 30.5, 31.0, 31.5, 32.0, 32.5, 33.0, 33.5, 34.0, 34.5, 35.0, 35.5, 36.0, 36.5, 37.0, 37.5, 38.0, 38.5, 39.0, 39.5, 40.0, 40.5, 41.0, 41.5, 42.0, 42.5, 43.0, 43.5, 44.0, 44.5, 45.0, 45.5, 46.0, 46.5, 47.0, 47.5, 48.0, 48.5, 49.0, 49.5, 50.0 mg/kg or higher, or any of the foregoing values as a range of endpoints or any value therein, for example About 1.1 to 1.4 mg/kg or the like or about 1.1, 1.2, 1.3, 1.4 mg/kg, and the like. In a preferred embodiment, the amount of the p38 signaling pathway inhibitor in the pharmaceutical combination described herein is about 12.5 or 25 mg/kg, by weight of the subject. In a preferred embodiment, the p38 signaling pathway inhibitor in the pharmaceutical combination described herein is Skepinone-L in an amount of about 12.5 or 25 mg/kg, by weight of the subject.

In some embodiments, the pharmaceutical combinations described herein comprise about 12.5 or 25 mg/kg of an AKT signaling pathway inhibitor, about 12.5 or 25 mg/kg of a MEK signaling pathway inhibitor, and about 12.5 or 25 mg/kg by weight of the subject. Kg of p38 signaling pathway inhibitor. In some embodiments, the pharmaceutical combination described herein comprises about 12.5 or 25 mg/kg of MK2206, about 12.5 or 25 mg/kg of trimetinib, and about 12.5 or 25 mg/kg of Skepinone-L by weight of the subject. .

In other aspects, the pharmaceutical combinations described herein are administered in a fixed dose. In some embodiments, the pharmaceutical combinations described herein comprise a fixed amount of an AKT signaling pathway inhibitor, a MEK signaling pathway inhibitor, and a p38 signaling pathway inhibitor.

In some embodiments, the amounts of the AKT signaling pathway inhibitor, the MEK signaling pathway inhibitor, and the p38 signaling pathway inhibitor in the pharmaceutical combinations described herein are each independently about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, 200 mg or higher Or any of the foregoing values as a range of endpoints or any value therein, such as about 1.1 to 1.4 mg or the like or about 1.1, 1.2, 1.3, 1.4 mg, and the like.

In some embodiments, the weight ratio of the AKT signaling pathway inhibitor, the MEK signaling pathway inhibitor, and the p38 signaling pathway inhibitor in the pharmaceutical combination described herein is x:y:z, wherein x, y, and z are each independently It is about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20. In a preferred embodiment, the weight ratio of the AKT signaling pathway inhibitor, the MEK signaling pathway inhibitor, and the p38 signaling pathway inhibitor in the pharmaceutical combination described herein is about 2:1:2 or about 1:1:1 or Approximately 1: 1:10. In a preferred embodiment, the weight ratio of MK2206, trimetinib, and Skepinone-L in the pharmaceutical combinations described herein is about 1:1:10.

The invention also provides a method of treating liver cancer in a subject, comprising administering to the subject a pharmaceutical combination described herein comprising an AKT signaling pathway inhibitor, a MEK signaling pathway inhibitor, and a p38 signal as described herein. Pathway inhibitors. The invention also provides a pharmaceutical combination as described herein, comprising an AKT signaling pathway inhibitor, a MEK signaling pathway inhibitor, and a p38 signaling pathway inhibitor described herein, in the manufacture of a medicament for treating liver cancer in a subject use. The invention also provides methods for inhibiting ALK kinase, FGFR2 kinase, and EphA5 kinase, comprising administering to a subject a pharmaceutical combination described herein comprising an AKT signaling pathway inhibitor, a MEK signaling pathway inhibitor, and Inhibitor of the p38 signaling pathway. The invention also provides a pharmaceutical combination comprising a AKT signaling pathway inhibitor, a MEK signaling pathway inhibitor, and a p38 signaling pathway inhibitor described herein, for use in the manufacture of a medicament for inhibiting ALK kinase, FGFR2 kinase, and EphA5 kinase Use in. The invention also provides methods for inhibiting the AKT signaling pathway, the MEK signaling pathway, and the p38 signaling pathway, comprising administering to a subject a pharmaceutical combination described herein, comprising an AKT signaling pathway inhibitor, a MEK signaling pathway described herein Inhibitors and inhibitors of the p38 signaling pathway. The invention also provides a pharmaceutical combination comprising a AKT signaling pathway inhibitor, a MEK signaling pathway inhibitor, and a p38 signaling pathway inhibitor described herein, for use in the inhibition of AKT signaling, MEK signaling, and p38 signaling The use of pathway drugs. In one embodiment, the activity levels of ALK kinase, FGFR2 kinase, and EphA5 kinase in the subject are higher than normal liver tissue. In one embodiment, the activity levels of the AKT signaling pathway, the MEK signaling pathway, and the p38 signaling pathway in the subject are higher than normal liver tissue.

In some embodiments, the components of the pharmaceutical combinations described herein can be the same compound. That is, the pharmaceutical combination of the present invention comprises a single compound, consists essentially of a single compound, or consists of a single compound that collectively targets, and preferably inhibits, the AKT signaling pathway, the MEK signaling pathway, and the p38 signaling pathway. .

In another aspect, the invention also provides compounds that co-target, and preferably inhibit, the AKT signaling pathway, the MEK signaling pathway, and the p38 signaling pathway. Those skilled in the art will recognize that the compounds can be combined with the technical features or effects described in the various embodiments in place of the pharmaceutical combinations described herein.

III.Hsp90 inhibitor

The inventors found that the combination of dasatinib, ceratinib and AZD4547 significantly inhibited the growth of xenograft models in nude mice and blocked the signaling of downstream important signaling pathways by inhibiting the activity of three key kinases. Among them, AZD4547 has certain tumor inhibitory activity mainly by inhibiting angiogenesis. Molecular chaperone Hsp90 participates in the maintenance of various malignant phenotypes of tumors by regulating the stability and function of client proteins, including immortalization, angiogenesis, escape from apoptosis, invasion and metastasis. Because of its wide range of client proteins, Hsp90 inhibitors are characterized by "one drug, multiple targets" that inhibit Hsp90 activity while degrading multiple important client proteins. The present invention first utilizes co-IP, PU-H71 pull down experiments and proteasome inhibitor reversal experiments to demonstrate that the three key kinases ALK, FGFR2 and EphA5 are the client proteins of Hsp90 in liver cancer. Furthermore, the inhibition of Hsp90 activity in vivo and in vitro models can effectively inhibit the proliferation of liver cancer by degrading three kinases and down-regulating downstream AKT, ERK and p38 signaling pathways. The present invention describes for the first time that Hsp90 inhibitors can affect the growth of liver cancer by affecting three core kinases, and can be used as a molecular targeted therapeutic strategy for liver cancer. In addition, the present invention describes for the first time the molecular mechanism of Hsp90 inhibitors acting on liver cancer, and provides a theoretical basis for selecting suitable populations.

Accordingly, the invention provides a method of treating liver cancer in a subject comprising administering to the subject an Hsp90 inhibitor. The invention also provides the use of an Hsp90 inhibitor for the manufacture of a medicament for the treatment of liver cancer. The invention also provides a method of inhibiting ALK kinase, FGFR2 kinase, and EphA5 kinase in a subject, comprising administering an Hsp90 inhibitor to the subject. The invention also provides the use of an Hsp90 inhibitor for the manufacture of a medicament for inhibiting ALK kinase, FGFR2 kinase and EphA5 kinase. The invention also provides a method of inhibiting an AKT signaling pathway, a MEK signaling pathway, and a p38 signaling pathway in a subject, comprising administering an Hsp90 inhibitor to the subject. The invention also provides the use of an Hsp90 inhibitor for the preparation of a medicament for inhibiting the AKT signaling pathway, the MEK signaling pathway, and the p38 signaling pathway. The invention also provides a pharmaceutical combination comprising an Hsp90 inhibitor and, optionally, an additional therapeutic agent.

As used herein, the term "Hsp90 inhibitor" refers to an agent that has an inhibitory effect on Hsp90.

Hsp90 inhibitors suitable for use in the present invention may be selected, for example, from Ganetespib, NVP-AUY922, SNX-2112, 17-DMAG, and PU-H71. Other Hsp90 inhibitors known in the art can also be used in the present invention. In one embodiment, the Hsp90 inhibitor is Ganetespib, NVP-AUY922, SNX-2112, 17-DMAG or PU-H71, preferably Ganetespib or NVP-AUY922.

The present invention shows that liver cancer cells are very sensitive to Hsp90 inhibitors, IC ₅₀ is in the level of 100 nanomolar, which is obviously superior to the clinical first-line drug sorafenib. In some embodiments, the present invention is used in the Hsp90 inhibitors of liver cancer cells IC ₅₀ less than l.OuM, less than 0.9 [, less than 0.8 M, less than 0.7 [mu, less than 0.6 [mu, 0.5uM less than, less than 0.4 M, less than 0.3μM , less than 0.2 μM, less than 0.1 μM, less than 0.09 μM, less than 0.08 μM, less than 0.07 μM, less than 0.06 μM, less than 0.05 μM, less than 0.05 μM, less than 0.03 μM, less than 0.02 μM or less than 0.01 μM.

The present invention shows the degradation of ALK, FGFR2 and EphA5 proteins using Hsp90 inhibitors, and down-regulation of downstream AKT, ERK and p38 signaling pathways. At the same time, apoptosis at the molecular level was verified. In some embodiments of the methods of the invention, administering an Hsp90 inhibitor to a subject reduces the level of activity of ALK kinase, FGFR2 kinase, and EphA5 kinase. In some embodiments of the methods of the invention, administration of an Hsp90 inhibitor to a subject downregulates the AKT, ERK, and p38 signaling pathways. In some embodiments of the methods of the invention, administering an Hsp90 inhibitor to the subject induces apoptosis of the liver cancer cells.

Hsp90 inhibitors suitable for use in the present invention may be used alone or in combination with additional therapeutic agents. Accordingly, the invention also provides a pharmaceutical combination comprising an Hsp90 inhibitor and, optionally, an additional therapeutic agent. In one embodiment, the pharmaceutical combination described herein is only an Hsp90 inhibitor.

In some embodiments, the pharmaceutical combinations described herein comprise an effective amount of an Hsp90 inhibitor. As used herein, the term "effective amount" refers to an amount of a component of a pharmaceutical combination described herein that is effective to achieve an effective treatment, such as an amount effective to inhibit cancer cell proliferation. In some embodiments, the pharmaceutical combinations described herein are administered to a subject in an effective amount.

In some aspects, the pharmaceutical combinations described herein are administered at a dose based on the weight of the subject. In some embodiments, the pharmaceutical combinations described herein comprise an amount of an Hsp90 inhibitor, by weight of the subject.

In some embodiments, the amount of Hsp90 inhibitor in the pharmaceutical combination described herein is from about 1.0 to about 50.0 mg/kg or greater, preferably from about 5.0 to 40.0 mg/kg, more preferably, by weight of the subject. It is in the range of about 10.0 to 30.0 mg/kg. In some embodiments, the amount of Hsp90 inhibitor in the pharmaceutical combination described herein is about 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, by weight of the subject. 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5, 10.0, 10.5, 11.0, 11.5, 12.0, 12.5, 13.0, 13.5, 14.0, 14.5, 15.0, 15.5, 16.0, 16.5, 17.0, 17.5, 18.0, 18.5, 19.0, 19.5, 20.0, 20.5, 21.0, 21.5, 22.0, 22.5, 23.0, 23.5, 24.0, 24.5, 25.0, 25.5, 26.0, 26.5, 27.0, 27.5, 28.0, 28.5, 29.0, 29.5, 30.0, 30.5, 31.0, 31.5, 32.0, 32.5, 33.0, 33.5, 34.0, 34.5, 35.0, 35.5, 36.0, 36.5, 37.0, 37.5, 38.0, 38.5, 39.0, 39.5, 40.0, 40.5, 41.0, 41.5, 42.0, 42.5, 43.0, 43.5, 44.0, 44.5, 45.0, 45.5, 46.0, 46.5, 47.0, 47.5, 48.0, 48.5, 49.0, 49.5, 50.0 mg/kg or higher, or any of the foregoing values as a range of endpoints or any value therein, for example about 1.1 To 1.4 mg/kg or the like or about 1.1, 1.2, 1.3, 1.4 mg/kg, and the like. In a preferred embodiment, the amount of Hsp90 inhibitor in the pharmaceutical combination described herein is about 5, 10, 15, 20, 25, 30, 35 or 40 mg/kg, preferably about 10, by weight of the subject. , 20 or 30 mg/kg. In a preferred embodiment, the Hsp90 inhibitor in the pharmaceutical combination described herein is in an amount of about 5, 10, 15, 20, 25, 30, 35 or 40 mg/kg, preferably about 10, by weight of the subject. , 20 or 30 mg/kg of Ganetespib.

In other aspects, the pharmaceutical combinations described herein are administered in a fixed dose. In some embodiments, the pharmaceutical combinations described herein comprise a fixed amount of an Hsp90 inhibitor.

In some embodiments, the Hsp90 inhibitors in the pharmaceutical combinations described herein are about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 , 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130 , 135, 140, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, 200 mg or higher, or any of the foregoing values as a range of endpoints or any value therein, such as about 1.1 To 1.4 mg or the like or about 1.1, 1.2, 1.3, 1.4 mg, and the like.

The invention also provides a method of treating liver cancer in a subject comprising administering to the subject an Hsp90 inhibitor described herein. The invention also provides the use of an Hsp90 inhibitor as described herein for the manufacture of a medicament for the treatment of liver cancer in a subject. The invention also provides methods for inhibiting ALK kinase, FGFR2 kinase, and EphA5 kinase, comprising administering to a subject an Hsp90 inhibitor described herein. The invention also provides the use of an Hsp90 inhibitor described herein in the manufacture of a medicament for inhibiting ALK kinase, FGFR2 kinase and EphA5 kinase. The invention also provides methods for inhibiting the AKT signaling pathway, the MEK signaling pathway, and the p38 signaling pathway, comprising administering to a subject an Hsp90 inhibitor described herein. The invention also provides the use of an Hsp90 inhibitor described herein in the manufacture of a medicament for use in inhibiting the AKT signaling pathway, the MEK signaling pathway, and the p38 signaling pathway. In one embodiment, the activity levels of ALK kinase, FGFR2 kinase, and EphA5 kinase in the subject are higher than normal liver tissue. In one embodiment, the activity levels of the AKT signaling pathway, the MEK signaling pathway, and the p38 signaling pathway in the subject are higher than normal liver tissue.

In still other aspects, the Hsp90 inhibitors described herein are optionally used with additional therapeutic agents. That is, the invention also provides a pharmaceutical combination comprising an Hsp90 inhibitor as described herein and an additional therapeutic agent. The invention also provides a method of treating liver cancer in a subject comprising administering to the subject a pharmaceutical combination described herein comprising an Hsp90 inhibitor described herein and an additional therapeutic agent. The invention also provides a pharmaceutical combination as described herein, comprising the use of an Hsp90 inhibitor described herein and an additional therapeutic agent, in the manufacture of a medicament for treating liver cancer in a subject. The invention also provides a method for inhibiting ALK kinase, FGFR2 kinase, and EphA5 kinase comprising administering to a subject a pharmaceutical combination described herein comprising an Hsp90 inhibitor described herein and an additional therapeutic agent. The invention also provides a pharmaceutical combination comprising a Hsp90 inhibitor described herein and an additional therapeutic agent for use in the manufacture of a medicament for inhibiting ALK kinase, FGFR2 kinase and EphA5 kinase. The invention also provides methods for inhibiting the AKT signaling pathway, the MEK signaling pathway, and the p38 signaling pathway, comprising administering to a subject a pharmaceutical combination described herein comprising an Hsp90 inhibitor described herein and an additional therapeutic agent. The invention also provides a pharmaceutical combination as described herein, comprising the use of an Hsp90 inhibitor described herein and an additional therapeutic agent, in the manufacture of a medicament for use in inhibiting the AKT signaling pathway, the MEK signaling pathway, and the p38 signaling pathway. In one embodiment, the additional therapeutic agent is, for example, sorafenib. In one embodiment, the activity levels of ALK kinase, FGFR2 kinase, and EphA5 kinase in the subject are higher than normal liver tissue. In one embodiment, the activity levels of the AKT signaling pathway, the MEK signaling pathway, and the p38 signaling pathway in the subject are higher than normal liver tissue.

IV. Identification of subgroups of liver cancer patients

As described above, the inventors found that the activation levels of three key kinases of ALK, FGFR2 and EphA5 in liver cancer were significantly higher than in normal liver tissues. Moreover, the overall survival of liver cancer patients with high activation of these three key kinases was significantly shorter than that of other subgroups of liver cancer patients, indicating a correlation between common high activation and poor prognosis in patients with liver cancer. Therefore, liver cancer patients in which these three key kinases are highly activated constitute a specific subgroup different from other liver cancer patients. By measuring the activation levels of these three key kinases in liver cancer patients and assessing whether they are highly activated at the same time, liver cancer patients can be grouped and a subset of liver cancer patients particularly suitable for the present invention can be identified.

Accordingly, in one aspect, the invention provides a method of identifying a subtype of liver cancer in a subject comprising measuring the level of activity of ALK kinase, FGFR2 kinase, and EphA5 kinase in the subject. The invention also provides a method of treating liver cancer in a subject, comprising measuring the activity levels of ALK kinase, FGFR2 kinase, and EphA5 kinase in the subject, and if the activities of the ALK kinase, FGFR2 kinase, and EphA5 kinase Where the level of water is above normal liver tissue, the subject is administered a combination of drugs as described herein. The invention also provides kits comprising reagents for measuring the level of activity of ALK kinase, FGFR2 kinase and EphA5 kinase in a subject. The kit also includes instructions for assessing the level of activity of ALK kinase, FGFR2 kinase, and EphA5 kinase.

The level of activity of ALK kinase, FGFR2 kinase and EphA5 kinase in a subject can be determined by methods and/or reagents known in the art. For example, it can be determined using immunohistochemical methods well known in the art. Antibodies for the determination of ALK kinase, FGFR2 kinase and EphA5 kinase are known to those skilled in the art. For example, p-ALK (GTX16377, Genetex, Irvine, CA); p-FGFR2 (ab111124, Abcam, Cambridge, MA); p-EphA5 antibody (GTX17348, Genetex, Irvine, CA).

In another aspect, the invention provides a method of identifying a subtype of liver cancer in a subject, comprising measuring an activity level of an AKT signaling pathway, a MEK signaling pathway, and a p38 signaling pathway in the subject. The invention also provides a method of treating liver cancer in a subject, comprising measuring an activity level of an AKT signaling pathway, a MEK signaling pathway, and a p38 signaling pathway in the subject, and if the AKT signaling pathway, the MEK signaling pathway Where the activity level of the p38 signaling pathway is higher than normal liver tissue, the subject is administered a pharmaceutical combination as described herein. The invention also provides kits comprising reagents for measuring the activity levels of the AKT signaling pathway, the MEK signaling pathway, and the p38 signaling pathway in a subject. The kit also includes instructions for assessing the activity levels of the AKT signaling pathway, the MEK signaling pathway, and the p38 signaling pathway.

The level of activity of the AKT signaling pathway, the MEK signaling pathway, and the p38 signaling pathway in a subject can be determined by methods and/or reagents known in the art. For example, the level of activity of proteins associated with the AKT signaling pathway, the MEK signaling pathway, and the p38 signaling pathway can be determined using immunohistochemical methods well known in the art. Antibodies for determining the level of activity of proteins associated with the AKT signaling pathway, the MEK signaling pathway, and the p38 signaling pathway are known to those skilled in the art.

In yet another aspect, the invention provides reagents for detecting the activity levels of ALK kinase, FGFR2 kinase, and EphA5 kinase and/or reagents for detecting activity levels of the AKT signaling pathway, the MEK signaling pathway, and the p38 signaling pathway for use in determining Whether the subject belongs to a particular liver cancer subgroup; for determining whether the subject is suitable for administering the pharmaceutical combination of the invention and/or for treating by the method of the invention; for diagnosing the patient; and/or Use for prognosis patients.

As used herein, the term "treating" generally refers to obtaining the desired pharmacological and/or physiological effects. The effect may be prophylactic according to the prevention of the disease or its symptoms in whole or in part; and/or may be therapeutic according to the partial or complete stabilization or cure of the disease and/or side effects due to the disease. As used herein, "treatment" encompasses any treatment for a patient's condition, including: (a) prevention of a disease or condition in a patient who is susceptible to an infectious disease or condition but has not yet diagnosed the disease; (b) inhibition of the symptoms of the disease, That is, to prevent its development; or (c) to alleviate the symptoms of the disease, that is, to cause the disease or symptoms to degenerate.

In some embodiments, the activity levels of ALK kinase, FGFR2 kinase, and EphA5 kinase in the subject are each independently higher than normal liver tissue or both about 5% to 1000% or more higher than normal liver tissue, eg, at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85% , 90%, 95%, 100%, 150%, 200%, 250%, 300%, 350%, 400%, 450%, 500%, 550%, 600%, 650%, 700%, 750%, 800 %, 850%, 900%, 950%, 1000% or more, or any of the foregoing values as a range of endpoints or any value therein, such as from about 7% to about 28%, etc. or about 7%, 14%, 21 %, 28%, etc.

In some embodiments, the activity levels of the AKT signaling pathway, the MEK signaling pathway, and the p38 signaling pathway in the subject are each independently higher than normal liver tissue or both about 5% to 1000 higher than normal liver tissue. % or more, such as about at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 150%, 200%, 250%, 300%, 350%, 400%, 450%, 500%, 550%, 600%, 650% , 700%, 750%, 800%, 850%, 900%, 950%, 1000% or more, or any of the foregoing values as a range of endpoints or any value therein, such as from about 7% to about 28%, etc. or About 7%, 14%, 21%, 28%, etc.

As used herein, the terms "activity level", "activation level" and "activation level" are used interchangeably in the context of a kinase, and generally refer to phosphorylation levels and the like.

In some embodiments, the subject is a mammal. In one embodiment, the subject is a mouse. In another embodiment, the subject is a human.

As described above, the pharmaceutical combination of the present invention is effective for inhibiting proliferation of liver cancer cells. In some embodiments, the liver cancer cell inhibition rate (also referred to herein as liver cancer inhibition rate or tumor inhibition rate or inhibition rate) of the pharmaceutical combination of the invention may be from about 5% to 100%, such as about at least 5%, 10 %, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100%, or any of the foregoing values as a range of endpoints or any value therein, such as from about 7% to about 28%, etc. or about 7%, 14%, 21%, 28%, etc. In some preferred embodiments, the liver cancer cell inhibition rate of the pharmaceutical combination of the invention can be about at least 40%, 50%, 60%, 70%, 80% or 90%.

The pharmaceutical combination of the present invention inhibits proliferation of liver cancer cells mainly by inducing apoptosis. In some embodiments, the pharmaceutical combination of the invention induces about 5% to 1000% or more, such as about at least 5%, 10%, 15%, 20%, more than the liver cancer cells treated without the combination of the invention. 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 150% , 200%, 250%, 300%, 350%, 400%, 450%, 500%, 550%, 600%, 650%, 700%, 750%, 800%, 850%, 900%, 950%, 1000 % or more, or any of the foregoing values, as a range of endpoints or any value therein, such as from about 7% to about 28%, or about 7%, 14%, 21%, 28%, and the like. In some preferred embodiments, the pharmaceutical combination of the invention induces at least about 100%, 200%, 300%, 400%, 500%, 600%, 700% more cells than the liver cancer cells not treated with the combination of the invention. Apoptosis.

The pharmaceutical combination of the present invention results in a decrease in the viability of liver cancer cells. In some embodiments, the pharmaceutical combination of the invention results in a decrease in liver cancer cell viability from about 5% to 100%, such as about at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100%, or any The foregoing values are included as a range of endpoints or any value therein, such as from about 7% to about 28%, etc., or about 7%, 14%, 21%, 28%, and the like. In some preferred embodiments, the pharmaceutical combination of the invention results in a decrease in liver cell viability of at least about 40%, 50%, 60%, 70%, 80% or 90%.

As previously mentioned, the activity levels of ALK kinase, FGFR2 kinase and EphA5 kinase in a subset of liver cancer patients identified by the methods of the invention are higher than in normal liver tissue. In some embodiments, the activity levels of ALK kinase, FGFR2 kinase, and EphA5 kinase in a subset of liver cancer patients identified by the methods of the invention are about 5 to 1000% or more, such as about at least 5%, higher than normal liver tissue. 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% , 95%, 100%, 150%, 200%, 250%, 300%, 350%, 400%, 450%, 500%, 550%, 600%, 650%, 700%, 750%, 800%, 850 %, 900%, 950%, 1000% or more, or any of the foregoing values as a range of endpoints or any value therein, such as from about 7% to about 28%, etc. or about 7%, 14%, 21%, 28 %Wait.

As described above, the activity levels of the AKT signaling pathway, the MEK signaling pathway, and the p38 signaling pathway in the subpopulation of liver cancer patients identified by the method of the present invention are higher than in normal liver tissue. In some embodiments, the activity levels of the AKT signaling pathway, the MEK signaling pathway, and the p38 signaling pathway in a subset of liver cancer patients identified by the methods of the invention are about 5 to 1000% or more higher than normal liver tissue, eg, at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85% , 90%, 95%, 100%, 150%, 200%, 250%, 300%, 350%, 400%, 450%, 500%, 550%, 600%, 650%, 700%, 750%, 800 %, 850%, 900%, 950%, 1000% or more, or any of the foregoing values as a range of endpoints or any value therein, such as from about 7% to about 28%, etc. or about 7%, 14%, 21 %, 28%, etc.

As previously mentioned, the overall survival of a subset of liver cancer patients identified by the methods of the present invention is shorter than that of other subgroups of liver cancer patients. In some embodiments, the overall survival of a subset of liver cancer patients identified by the methods of the invention is about at least 0 to 50 months shorter than other subgroups of liver cancer patients, such as at least about 1, 2, 3 weeks, or at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 55, 60, 65, 70, 75, 80 months, or any of the foregoing values as a range of endpoints or any value therein, such as from about 3.5 days to about 5.5 days, etc., or about 3.5, 4.5, 5.5 days, and the like. The overall survival rate of the subgroup of liver cancer patients identified by the method of the present invention is lower than that of other subgroups of liver cancer patients. In some embodiments, the overall survival rate of a subset of liver cancer patients identified by the methods of the invention is about 5% to 1000% or more lower than other subgroups of liver cancer patients, such as about at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100% , 150%, 200%, 250%, 300%, 350%, 400%, 450%, 500%, 550%, 600%, 650%, 700%, 750%, 800%, 850%, 900%, 950 %, 1000% or more, or any of the foregoing values as a range of endpoints or any value therein, such as from about 7% to about 28%, etc., or about 7%, 14%, 21%, 28%, and the like.

Administration of a pharmaceutical combination of the present invention to a subject having liver cancer can effectively inhibit proliferation of liver cancer cells and prolong the survival of the subject. In some embodiments, the survival of a subject to which the pharmaceutical combination of the invention is administered can be extended by from about 1% to 1000% or more, such as about at least 5%, 10%, 15%, 20%, 25%. 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 150%, 200 %, 250%, 300%, 350%, 400%, 450%, 500%, 550%, 600%, 650%, 700%, 750%, 800%, 850%, 900%, 950%, 1000% or More or any of the foregoing values are included as a range of endpoints or any value therein, such as from about 7% to about 28%, etc., or about 7%, 14%, 21%, 28%, and the like.

Administration of a pharmaceutical combination of the invention to a subject is effective to reduce the level of activity of ALK kinase, EphA5 kinase, and FGFR2 kinase. In some embodiments, the level of activity of ALK kinase, EphA5 kinase, and FGFR2 kinase in the subject is independently reduced from about 1 to 100%, eg, about 1%, prior to treatment, after administration of the pharmaceutical combination of the invention, 2%, 3%, 4%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70% , 75%, 80%, 85%, 90%, 95% or 99% or 100%, or any of the foregoing values as a range of endpoints or any value therein, such as from about 7% to about 28%, etc. or about 7% , 14%, 21%, 28%, etc.

Administration of a pharmaceutical combination of the invention to a subject can effectively reduce the activity levels of the AKT signaling pathway, the MEK signaling pathway, and the p38 signaling pathway. In some embodiments, the activity levels of the AKT signaling pathway, the MEK signaling pathway, and the p38 signaling pathway in the subject are each independently reduced by about 1 to 100%, eg, about, prior to treatment, following administration of the pharmaceutical combination of the invention. 1%, 2%, 3%, 4%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65% 70%, 75%, 80%, 85%, 90%, 95% or 99% or 100%, or any of the foregoing values as a range of endpoints or any value therein, such as from about 7% to about 28%, etc. or About 7%, 14%, 21%, 28%, etc.

V. Application method

The components of the pharmaceutical combination of the present invention may be formulated separately, or some or all of them may be formulated together. In one embodiment, the pharmaceutical combinations of the invention may be formulated into pharmaceutical compositions suitable for single or multiple administrations.

The components of the pharmaceutical combination of the present invention may be administered individually, or some or all of them may be co-administered. The components of the pharmaceutical combinations of the invention may be administered substantially simultaneously, or some or all of them may be administered substantially simultaneously.

The components of the pharmaceutical combinations of the invention may each be administered independently in a variety of suitable routes including, but not limited to, orally or parenterally (by intravenous, intramuscular, topical or subcutaneous routes). In some embodiments, the components of the pharmaceutical combination of the invention may each be administered orally or by injection, such as intravenous or intraperitoneal.

The components of the pharmaceutical combination of the present invention may each independently be a suitable dosage form including, but not limited to, tablets, troches, pills, capsules (eg, hard capsules, soft capsules, enteric capsules, microcapsules). , elixirs, granules, syrups, injections (intramuscular, intravenous, intraperitoneal), granules, emulsions, suspensions, solutions, dispersions, and dosage forms for sustained release preparations for oral or parenteral administration.

The components of the pharmaceutical combinations of the invention may each independently comprise a pharmaceutically acceptable carrier and/or excipient.

The components of the pharmaceutical combination of the present invention may each independently be every 1 day, every 2 days, every 3 days, every 4 days, every 5 days, every 6 days, every week, every 2 weeks, every 3 weeks, or every month. Or apply at a lower frequency.

The components of the pharmaceutical combination of the present invention may each be administered once, twice, three times, four times, five times, six times, seven times, eight times, nine times, or ten times or more per day independently.

The components of the pharmaceutical combination of the present invention may each independently be consecutive for 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13, day, day, day, day, day, day, day, day, day, day, day, day, day Or 30 days or more.

One of the components of the pharmaceutical combination of the present invention may be 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 before or after the other component. Apply on days or 10 days or more. For example, in one embodiment, component 1 of the pharmaceutical combination of the invention is administered on day 1 and component 2 of the pharmaceutical combination of the invention is administered after 2 days (ie, day 3), and Component 1 in the pharmaceutical combination of the present invention was administered 3 days later (i.e., day 6).

The pharmaceutical combination of the invention may also comprise additional therapeutic agents. In one embodiment, the additional therapeutic agent is a cancer therapeutic known in the art, preferably a liver cancer therapeutic, more preferably sorafenib.

Where a series of numerical values are recited in this application, it should be understood that any recited value may be the upper or lower limit of the numerical range. It is also to be understood that the invention is intended to cover all such s s 。。。。。。。。。。。。。。。。。。。。。。。。。。。。。。。。 The scope of the invention should be understood to include all values within the scope. For example, 1-10 should be understood to include all of the

values

1, 2, 3, 4, 5, 6, 7, 8, 9, and 10, and includes fractional values as appropriate. A range expressed as "up to" a value (eg, up to 5) is to be understood as all values (including the upper limit of the range), such as 0, 1, 2, 3, 4, and 5, and includes, as appropriate, Value. It should be understood to include 0.5, 1, 2, 3, 4, 5, 6 or 7 days for up to a week or within a week. Similarly, a range defined by "at least" is understood to include the provided lower value and all the higher values.

All percentage forms are weight/weight unless otherwise indicated.

As used herein, "about" is understood to include within three standard deviations of the average or within the standard tolerances of the particular field. In certain embodiments, an approximation is understood to be a variation of no more than 0.5. "About" modifies all of the values listed thereafter. For example, "about 1, 2, 3" means "about 1", "about 2", and "about 3".

The articles "a" and "an" are used in the present invention to mean one or more than one (i.e., at least one) grammatical object of the article. For example, "a feature" refers to one element or more than one element.

The term "comprising" is used in the present invention to mean the phrase "including but not limited to" and used interchangeably.

The term "or" is used interchangeably in the present invention to mean the term "and/or" and may be used interchangeably, unless the context clearly indicates otherwise.

The term "for example" is used in the present invention to mean the phrase "such as but not limited to" and can be used interchangeably.

It will be understood by those skilled in the art that the technical features described above in the respective embodiments may be used alone or in combination with the technical solutions of the various aspects of the present invention.

Some embodiments of the invention are illustrated by the following non-limiting examples.

Example

Example 1-8: Recognition and combined inhibition of the ALK/FGFR2/EphA5 kinase population

1. Instrumentation

Model 5417R Freezer High Speed Centrifuge from Eppendorf (Barkhausenweg, Hamburg, Germany);

Model 3111 carbon dioxide cell incubator from Forma Scientific (Marietta, OH, USA);

Beckman 6605698 cell counter from Beckman Coulter (Fullerton, CA, USA);

Adjustable wavelength microplate reader VERSAma× from Molecular Device (Sunnyvale, CA, USA);

Flow cytometer FACSCalibur ^TM, from Becton Dickinson (Sunnyvale, CA, USA );

Vii7 PCR Nanovue plus spectrometer from GE Healthcare;

Horizontal oscillator from IKA (Germany);

Multilabel Reader from PerkinElmer (Waltham, MA, USA);

Vii7 real-time quantitative PCR instrument from Life Technology;

IncuCyte Zoom Zoom Live Cell Analysis System from Essen Bioscience (Ann Arbor, Michigan, USA).

2. Drugs and reagents

Solafenib, Ganetespib, NVP-AUY922, PU-H71, SNX2112, 17-DMAG, MK2206, trimetinib, MG132 and Skeponeone-L are commercially available from Selleck (USA). The compound used in the experiment was formulated into a 10 mM stock solution in DMSO and stored at -20 °C. Dilute to the desired concentration with physiological saline before use. The final concentration of DMSO does not exceed 0.1%. Benzosulforyl B (SRB) and DMSO are commercially available from Sigma.

The protease inhibitor cocktail and the phospholipase inhibitor PhosSTOP are commercially available from Roche Biotechnology Co., Ltd. HRP-labeled secondary antibodies are commercially available from Merck organisms;

Prestained protein marker 26616 commercially available from Thermo Scientific Pierce; chromonic solution ECL Plus Western Blot detection system, SuperSignal West Pico Chemiluminescent Substrate commercially available from ^{Thermo Scientific Pierce; Clarity TM Western ECL} Substrate commercially available from Bio-Rad. SDS, TEMED, 30% acrylamide, glycine and ammonium persulfate are all chemically pure. Transfection reagent Lipofectamin 2000 Reagent and interference reagent

RNAiMAX Transfection Reagent is commercially available from Invitrogen (Carlsbad, CA, USA).

3. Cell culture

The tumor cell lines used in the present invention are shown in Table 1 below. Cell culture follows the guidelines of the cell provider. 10% fetal bovine serum (FBS; from Gibco, Grand Island, NY, USA) was added to the cell culture medium. All cells were routinely cultured in a 37 ° C 5% CO ₂ saturated humidity incubator.

HepG2 and Hep3B are available from ATCC. SMMC-7721, QGY-7703, ZIP177, BEL-7402, Huh-7, SK-Hep-1 and human immortalized hepatocytes QSG-7701 are available from the Cell Culture Bank of the Chinese Academy of Sciences. Huh-7 and SK-Hep-1 cells were cultured in DMEM medium containing 10% Gibco fetal bovine serum; HepG2 and Hep3B cells were cultured in EMEM medium containing 10% Gibco fetal bovine serum; SMMC-7721, QGY- 7703, ZIP177 and BEL-7402 cells were cultured in RIPM 1640 medium containing 10% Gibco fetal bovine serum. All cell lines available from ATCC were identified by STR. Table 1. Cell background and source

细胞名称Cell name	组织类型Organization type	来源source
SMMC-7721SMMC-7721	人肝癌Human liver cancer	中科院典型培养物保藏委员会细胞库Chinese Academy of Sciences Typical Culture Collection Committee Cell Bank
QGY-7703QGY-7703	人肝癌Human liver cancer	中科院典型培养物保藏委员会细胞库Chinese Academy of Sciences Typical Culture Collection Committee Cell Bank
ZIP177ZIP177	人肝癌Human liver cancer	中科院典型培养物保藏委员会细胞库Chinese Academy of Sciences Typical Culture Collection Committee Cell Bank
BEL-7402BEL-7402	人肝癌Human liver cancer	中科院典型培养物保藏委员会细胞库Chinese Academy of Sciences Typical Culture Collection Committee Cell Bank
HepG2HepG2	人肝癌Human liver cancer	ATCCATCC
Hep3BHep3B	人肝癌Human liver cancer	ATCCATCC
SK-Hep-1SK-Hep-1	人肝癌Human liver cancer	中科院典型培养物保藏委员会细胞库Chinese Academy of Sciences Typical Culture Collection Committee Cell Bank
Huh-7Huh-7	人肝癌Human liver cancer	中科院典型培养物保藏委员会细胞库Chinese Academy of Sciences Typical Culture Collection Committee Cell Bank
QSG-7701QSG-7701	人肝细胞Human hepatocyte	中科院典型培养物保藏委员会细胞库Chinese Academy of Sciences Typical Culture Collection Committee Cell Bank

4. Experimental methods

4.1. Human Receptor Tyrosine Kinase Chip

SMMC-7721, ZIP177, BEL-7402, QGY-7703, HepG2, Hep3B, Huh-7 or SK-Hep-1 cells in good growth condition were inoculated into 100 mm culture dishes to a degree of fusion of 90%, pre-cooled The cells were washed twice with 1×PBS, added to the designated lysate at a density of 1 mL/2×10 ⁷ cells, lysed on ice for 30 min, centrifuged at 30 μm at 4° C., 12,000×g, and the supernatant was taken for subsequent chip experiments. RayBiotech's human protein phosphorylation chip has 71 important kinases closely related to the development of liver cancer including HGFR, VEGFR, PDGFR and IGF1R. The experimental operation and analysis were completed by Guangzhou Ruibo Company.

4.2. siRNA interference

The interference fragment was dissolved in deionized water in DEPC water to prepare an initial concentration of 10 μM. use

The transfection reagent was transferred to the cells according to the product instructions. The specific method is as follows: ZIP177 or SMMC-7721 cells in logarithmic growth phase are trypsinized and inoculated into 6-well plates at 2×10 ⁵ cells/well, the degree of fusion is about 30-50%, and 40 pmol siRNA is used. Serum was diluted to 100 μL in antibiotic-free Opti-MEM medium. 2 μL of RNAiMAX reagent was diluted to 100 μL with serum-free and antibiotic-free Opti-MEM medium, mixed, and allowed to stand at room temperature for 5 min. The two were mixed and allowed to stand at room temperature for 15 min. At the same time, the cell culture medium was changed to 800 μL serum-free antibiotic-free Opti-MEM medium, and the mixture was added to a 6-well cell culture plate, and cultured for 4-6 hours, and then replaced. Fresh complete medium was maintained at 37 ° C with 5% CO ₂ .

EphA5, LTK, EphA1, EphA3, EphB2, EphB3, FRK, ABL1, EGFR, Insulin R, TXK, TNK1, TrkB, ACK1 and c-Met siRNA fragments were purchased from Sigma (USA); FGFR2, ALK interference fragment from Shanghai Jima Pharmaceutical Technology Co., Ltd. synthesis. The sequence is as follows (sense chain):

Table 2. siRNA sequences used in the present invention (SEQ ID NOS: 1-34)

4.3. Cell survival experiment

Liver cells in logarithmic growth phase were inoculated into 96-well plates at a density of 3000-4000/well, and treated according to the experimental protocol. The experiment was terminated with pre-cooled TCA at 4 ° C for 1 h, and dried in a constant temperature oven at 60 ° C. Incubate with 100 μL of 4 mg/L phenylsulforamide B (SRB) for 15 min. The unbound SRB was washed away with a 1% aqueous glacial acetic acid solution, dried in a constant temperature oven at 60 ° C, dissolved in 10 mmol/L Tris-HCl, and the absorbance at 560 nm was read by a microplate reader. Inhibition rate = (OD _{control group -} OD _{experimental group} ) / OD _{control group} .

4.4. Western blot analysis

The cells were washed twice with pre-cooled 1 x PBS, and RIPA lysate was added and lysed on ice for 30 min. The supernatant was taken at 4 ° C, centrifuged at 12,000 x g for 30 mim. The BCA protein was quantified and a protein sample was prepared by adding 1 x SDS lysate. The protein samples were placed in SDS-polyacrylamide gels of different densities and electrophoresed at 80 V in Tris-Glycine-SDS running buffer [25 mmol/L Tris, 250 mmol/L glycine (pH 8.3), 0.1% SDS]. Separation was carried out by electrophoresis at 20 min and 120 V for about 2 h. The protein was transferred from the gel to the nitrocellulose filter by semi-dry blotting or wet transfer. The transfer buffer formulation was 192 mmol/L glycine, 25 mmol/L Tris, 20% methanol, and transferred according to the desired protein molecular weight. 2h. The transfer condition and protein band position were determined by Ponceau S staining, and the corresponding target band was cut according to the molecular weight of the protein marker, and then the blocking solution (TBST containing 5% skim milk powder or TBST of 3% BSA) was used. Block for 60 min and incubate with the corresponding antibody overnight at 4 °C. The TBST washing solution [20 mM Tris-HCl (pH 7.2-7.4, room temperature), 150 mM NaCl, 0.1% (v/v) Tween 20] was washed 3 times for 10 min each time. Horseradish peroxidase-labeled secondary antibody (1:2000) diluted with 3% BSA was added and incubated for 1 h at room temperature. It was then rinsed three times with TBST for 10 min each time. Appropriate luminescent reagents were selected for color development based on the exposure intensity. The luminescent reagents were ECL Plus Western Blot detection system and Advance ECL Western blot detection system, and SuperSignal West Pico Chemiluminescent Substrate. The antibodies used in the present invention are shown in Table 3 below.

Table 3. Antibody summary

抗体antibody	货号Item number	供货商supplier
EphA5抗体EphA5 antibody	sc-927Sc-927	Santa CruzSanta Cruz
ALK(C26G7)兔mAbALK (C26G7) rabbit mAb	33333333	CSTCST
FGFR2抗体FGFR2 antibody	GTX10647GTX10647	GenetexGenetex
phosphor-p38抗体Phosphor-p38 antibody	5536S5536S	CSTCST
p38抗体P38 antibody	2972S2972S	CSTCST
phosphor-AKT抗体phosphor-AKT antibody	4060S4060S	CSTCST

AKT抗体AKT antibody	4691L4691L	CSTCST
phosphor-ERK抗体phosphor-ERK antibody	4370L4370L	CSTCST
ERK抗体ERK antibody	4695S4695S	CSTCST
β-肌动蛋白抗体--actin antibody	AM1021BAM1021B	AbgentAbgent
Hsp90(C45G5)兔mAbHsp90 (C45G5) rabbit mAb	48774877	CSTCST
phosphor-ALK抗体phosphor-ALK antibody	GTX16377GTX16377	GentexGentex
phosphor-FGFR2抗体phosphor-FGFR2 antibody	Ab111124Ab111124	AbcamAbcam
phosphor-EphA5抗体phosphor-EphA5 antibody	GTX17348GTX17348	GentexGentex
CD34CD34	Ab8158Ab8158	AbcamAbcam
Ki67Ki67	Ab16667Ab16667	AbcamAbcam
phosphor-STAT3抗体phosphor-STAT3 antibody	91369136	CSTCST
STAT3抗体STAT3 antibody	91939193	CSTCST
phosphor-JNK抗体phosphor-JNK antibody	92559255	CSTCST
JNK抗体JNK antibody	92529252	CSTCST
phosphor-FRS2α抗体phosphor-FRS2α antibody	38643864	CSTCST
Hsp70抗体Hsp70 antibody	1776-11776-1	EpitomicsEpitomics
LTK抗体LTK antibody	ab129155Ab129155	AbcamAbcam
EphA1抗体EphA1 antibody	A7328A7328	AbclonalAbclonal
EphA3抗体EphA3 antibody	A8414A8414	AbclonalAbclonal
EphB2抗体EphB2 antibody	A9813A9813	AbclonalAbclonal
EphB3抗体EphB3 antibody	GTX107882GTX107882	GentexGentex
ACK1抗体ACK1 antibody	31313131	CSTCST
TrkB抗体TrkB antibody	46074607	CSTCST
TXK抗体TXK antibody	sc-377202Sc-377202	SantacruzSantacruz
TNK1抗体TNK1 antibody	sc-390359Sc-390359	SantacruzSantacruz
c-Met抗体c-Met antibody	81988198	CSTCST
FRK抗体FRK antibody	A3295A3295	AbclonalAbclonal
胰岛素R抗体Insulin R antibody	30143014	CSTCST

EGFR抗体EGFR antibody	37773777	CSTCST
ABL1抗体ABL1 antibody	2862p2862p	CSTCST

4.5. Immunoprecipitation

SMMC-7721 or ZIP177 cells in good growth state were inoculated into a 100 mm culture dish and cultured for 24 hours. Subsequent experiments were performed when the cell fusion degree was 60% to 70%. The serum-free medium was starved, and the corresponding concentration of Hsp90 inhibitor was added for 4 hours. The cells were washed twice with pre-cooled 1×PBS, and 600 μL of 1×RIPA lysate (50 mM Tris (pH 7.4), 1 mM EDTA, 150 mM NaCl, 1 mM NaF, 1 mM Na ₃ VO ₄ , 1% NP-40, 1 mM was added. PMSF, 0.25% sodium deoxycholate, protease inhibitor cocktail (Roche) was lysed on ice for 1 h. The dish was gently shaken several times during the period to allow sufficient lysis. Centrifuge at 12,000 x g for 20 min at 4 °C. After taking the supernatant and BCA to adjust the total protein amount, a small amount of the sample was added to 2×SDS loading buffer and boiled at 100 ° C for 10 min as a control; the remaining sample was added with 25 μL of protein A/G Agrose, and incubated at 4 ° C for vertical mixing. After standing on ice for 5 min, centrifuge at 2000×rpm for 6 min, then the beads were washed with 500 μL of 1×RIPA lysate (without protease inhibitor mixture), allowed to stand for 5 min, centrifuged at 2000×rpm for 6 min, and the supernatant was removed. Then, the required amount of 2×SDS-PAGE loading buffer was added, and the mixture was boiled at 100 ° C for 10 min, and detected by Western blotting.

4.6. Flow cytometry to detect apoptosis

The cells in the logarithmic growth phase, such as SMMC-7721 or ZIP177, were seeded in a 6-well plate at a density of 2×10 ⁵ cells/well, and cultured overnight at 37° C. in a saturated humidity incubator containing 5% CO ₂ . After 48 h of treatment, the cells were trypsinized and collected in a 2 mL centrifuge tube and centrifuged at 600 x g for 5 min at 4 °C. The supernatant was discarded, and BD's Annexin V-FITC Apoptosis Detection Kit was used to detect apoptosis by staining phosphatidylserine (PS) with PI stained DNA and FITC-Annexin V, respectively.

4.7. In vivo nude mice transplanted tumor experiment

BALB/c nude nude mice: SPF grade, female, 5-6 weeks old, weighing 16-20 grams, purchased from Beijing Weitong Lihua Experimental Animal Technology Co., Ltd. The animals used in this experiment strictly adhered to the ethical standards for animal feeding and use of the Shanghai Institute of Materia Medica, Chinese Academy of Sciences. Naked mice were kept in the absence of special pathogens, and the light was replaced every 12 hours. The feed and water were disinfected before use.

Human hepatoma SMMC-7721 cells were subcutaneously inoculated into the right axilla of nude mice at 5×10 ⁶ / each, and the diameter of the transplanted tumor was measured with a vernier caliper. When the tumor volume reached -100 mm ³ , the animals were randomly divided into groups of 6 only. 25 mg/kg of ceratinib (0.5% methylcellulose/0.5% Tween 80), 25 mg/kg dasatinib (0.5% CMC sodium) and 12.5 mg/kg AZD4547 (1% Tween-80) Use with the combination of three drugs, once a day orally. The control group was given an equal amount of solvent for 2 weeks. Mouse body weight and tumor length (L) and width (W) were measured three times a week, and the tumor volume TV = L x W ² /2 was calculated therefrom. Relative tumor volume RTV = Vt / V0, Vt refers to the tumor volume on the day of measurement, and V0 refers to the initial tumor volume before administration. The relative tumor growth rate T/C (%) was used as an index for evaluating antitumor activity, and T/C (%) = average TV/control group TV×100% of the administration group. Efficacy evaluation criteria: T/C%>60% was ineffective; T/C%≤60% and statistically treated p<0.05 was effective. At the same time, the body weight of the mice was weighed and used to evaluate drug toxicity.

4.8. Patient sample and tissue chip

Patient tissue chips and frozen tissue were purchased from Zuocheng Biological. Immunohistochemistry was performed according to routine procedures, p-ALK 1:50; p-FGFR2 1:50; p-EphA5 antibody 1:50; CD34 antibody 1:100; Ki-67 antibody 1:100. Chip analysis and interpretation were completed by Zuocheng Bio. Kaplan-Meier plotter was used to analyze the correlation between the degree of kinase activation and overall survival. Frozen tumors and paired normal tissues were added to the RIPA lysate for grinding and lysis. The sample was quantitatively prepared by the BCA method. Protein analysis was performed by Western blotting.

4.9. Statistical analysis

Significant analysis between groups was performed using the T test, and p < 0.05 was considered to be significantly different. Multi-group analysis was performed using Two-way Anova. *, p < 0.05; **, p < 0.01; ***, p < 0.001.

Example 1. Identifying highly activated kinases in liver cancer

A large number of previous studies have found that many kinases in liver cancer are highly activated. In order to screen for key molecules, the receptor tyrosine kinase phosphorylation chip was first used to detect the activation level of kinases in liver cancer cells. The kinase chip immobilizes antibodies of different kinases on the nitrocellulose membrane, adheres to the protein in the cell or tissue lysate according to the principle of sandwich immunoassay, binds to the substrate on the membrane with the pan-phosphorylated antibody, and incubates the secondary antibody and then adds the luminescent solution. The chemiluminescence intensity is detected and the degree of kinase activation is determined. The kinase chip can efficiently and rapidly detect multiple kinase activations and is suitable for extensive screening. The chip selected in the present invention contains 71 receptor tyrosine kinases involved in the development of liver cancer. For the reliable and informative results, kinase expression was detected in 8 liver cancer cells from different tissue sources and different gene backgrounds (Table 4).

Table 4. Activation of 71 kinases in 8 liver cancer cells (basal phosphorylation)

The top 20 kinases in each cell were screened according to the level of kinase activation and clustered (Figure 1). There are 9 kinds of highly activated kinases in 8 cells: EphB3, TrkB, ALK, EphA3, EphA5, LTK, c-Met, EphB2, FRK; 4 species are highly activated in 7 cells: ACK1, TNK1 TXK, FGFR2; two species highly activated in 6 cells: ABL1, EphA1; two species highly activated in 5 cells: EGFR, Insulin R. These 17 kinases are highly activated kinases in liver cancer cell lines and may be important molecules regulating cell proliferation. The highly activated kinases in the 8 liver cancer cells are not identical. This result also validates the highly heterogeneous nature of liver cancer at the kinase level.

Activation of ALK, FGFR2 and EphA5 kinase in liver cancer PDX arrays was also examined by immunohistochemistry (IHC). All three kinases were highly activated in the selected LI0752 model (Figure 45).

In order to further investigate the activation principle, SNP6.0 chip was used to detect single nucleotide polymorphism and copy number variation of genes in 8 liver cancer cells. The results showed that mutations in 17 kinases mainly occurred in introns or nonsense mutations (Fig. 46), and no clinically significant mutations were observed. At the same time, the genes in 8 liver cancer cells were not significantly amplified (Table 5).

Table 5. Copy number of 17 common over-activated kinases

基因gene	BEL-7402BEL-7402	HePG2HePG2	Hep3BHep3B	Huh-7Huh-7	QGY-7703QGY-7703	SK-Hep-1SK-Hep-1	SMMC-772SMMC-772	ZIP177 ZIP177

ABL1ABL1	44	22	33	44	66	22	33	33
ALK ALK	33	33	22	44	33	33	33	22
EGFR EGFR	33	22	44	55	44	44	33	22
EphA1 EphA1	33	22	33	55	33	33	33	33
EphA3 EphA3	22	22	22	88	33	33	22	22
EphA5 EphA5	22	22	44	33	33	22	22	22
EphB2 EphB2	33	22	22	44	33	33	33	33
EphB3 EphB3	33	22	33	44	44	22	33	33
FGFR2 FGFR2	22	33	22	44	33	33	22	22
FRK FRK	22	22	33	55	33	22	22	22
INSR INSR	22	22	33	44	33	22	22	22
LTK LTK	33	22	33	33	44	22	33	33
MET MET	22	22	33	66	33	44	22	22
NTRK2 NTRK2	33	22	33	55	55	22	33	33
TNK1 TNK1	33	22	33	44	44	33	33	33
TNK2 TNK2	33	22	33	33	44	33	33	33
TXK TXK	22	22	44	22	33	22	22	22

Example 2: Effect of interference with single kinase on proliferation of hepatoma cells

In order to determine the real-molecule kinase activation key cell proliferation of, first, 17 kinds of siRNA these kinases ZIP177 and two cells SMMC-7721, and IC ₅₀ values corresponding synchronous detection kinase inhibitor. The 17 highly activated kinases and their corresponding inhibitors are shown in Table 6. The results show no interference single kinase on Proliferation significant effect, inhibition rate of less than 10% (FIG. 2), and the IC ₅₀ values of inhibitors were higher (FIG. 3). This suggests that hepatoma cell proliferation may be regulated by multiple kinases. A combination of key kinases is needed to achieve good proliferation inhibition.

Table 6. 17 highly activated kinases and corresponding inhibitors

其中激酶过度激活的细胞株数量Number of cell lines in which kinase is over-activated	RTKRTK		抑制剂Inhibitor
88	EphB3EphB3	达沙替尼Dasatinib
	TrkBTrkB	GNF-5837GNF-5837
	ALKALK	色瑞替尼Coloritinib
	EphA3EphA3	达沙替尼Dasatinib
	EphA5EphA5	达沙替尼Dasatinib
	LTKLTK	色瑞替尼Coloritinib
	HGFRHGFR	SGX-523SGX-523
	EphB2EphB2	达沙替尼 Dasatinib
	FRKFRK
达沙替尼Dasatinib
77	TNK1TNK1	XMD8-92XMD8-92
	TXK TXK		Lck抑制剂2Lck inhibitor 2
	ACK1ACK1	AIM-100AIM-100
	FGFR2 FGFR2		AZD4547AZD4547
66	ABL1ABL1	伊马替尼 Imatinib
	EphA1EphA1
达沙替尼Dasatinib
55	EGFREGFR	吉非替尼Gefitinib
	Insulin RInsulin R	LinsitinibLinsitinib

Example 3: Effect of combination of kinase inhibitors on proliferation of hepatoma cells

Since both methods of gene intervention and small molecule inhibitors have demonstrated that blocking single kinase activity does not effectively inhibit liver cancer cell proliferation, the inventors studied a key kinase population that regulates hepatoma cell proliferation and simultaneously inhibited it to achieve good results. As previously described, the kinases EphB3, TrkB, ALK, EphA3, EphA5, LTK, c-Met, EphB2 and FRK are highly activated in 8 cells.

The four corresponding inhibitors, dasatinib, GNF-5873, ceratinib and SGX-523, were first combined for combination (Table 6). In general, a 1 μM concentration of a kinase inhibitor significantly inhibits target activity. Therefore, a 1 μM dose well below the IC ₅₀ value was used in the experiment. The results showed that the combination of ceritinib and dasatinib had the highest inhibition rate, and the inhibition rate was similar to that of the three drugs or four drugs, which was about 40% (Fig. 4). However, GNF-5873 and SGX-523 did not exert significant proliferation inhibition effects.

Next, ceritinib and dasatinib were administered in combination with other inhibitors for 72 h. The results showed that the combination of ceratinib, dasatinib and AZD4547 significantly inhibited the proliferation of ZIP177 and SMMC-7721 with inhibition rates of 67.4% and 76.4%, respectively (Figures 5 and 6). This indicates that these three compounds are effective drug combinations in ZIP177 and SMMC-7721.

At the same time, this conclusion was verified in six other cells, QGY-7703, BEL-7402, HepG2, Hep3B, Huh-7, and SK-Hep-1 (Fig. 7). This indicates that the combination of three drugs, namely, ceratinib, dasatinib and AZD4547, is universally effective in inhibiting the proliferation of hepatoma cells, and significant cell proliferation inhibition is obtained in various liver cancer cell lines.

The effect of a combination of three kinase inhibitors on the proliferation of normal cells was also measured (Figure 9).

Example 4: Biological effects: combination of ceritinib, AZD4547 and dasatinib Apoptosis

The above results show that the combination of the drug alone and the two drugs can not effectively inhibit the proliferation of liver cancer cells. However, the combination of three kinase inhibitors, ceratinib, AZD4547, and dasatinib, significantly inhibited liver cancer cell proliferation (Figures 6 and 7). Further, the biological effects produced by the combination of these three drugs were examined. There are many biological effects that cause inhibition of proliferation, including cell cycle arrest, apoptosis, necrosis, cellular senescence, autophagy, and the like. For 48 h, flow cytometry revealed that the combination of the three drugs significantly induced apoptosis in SMMC-7721 and ZIP177 cells, and the combination of any two drugs alone could not induce apoptosis (Fig. 8A). At the same time, Western blotting showed that the combination of three drugs significantly enhanced the cleavage of PARP and Caspase3 (Fig. 8B), and verified the effect of apoptosis at the molecular level.

Example 5: Recognition of ALK, FGFR2, EphA5 as the key to regulate the proliferation of hepatoma cells Kinase

As discussed above, the combination of three kinase inhibitors, ceratinib, AZD4547, and dasatinib, can significantly inhibit cell proliferation, suggesting that key molecules that regulate cell fate are likely to be encompassed in the targets of the three drugs.

Dasatinib has numerous targets, including more than 70 kinase targets. First, ceratinib was combined with AZD4547 to interfere with genes in Raybio's custom-made dasatinib target-interfering library. The results showed that the interference of EphA5 and the two drugs significantly inhibited the proliferation of SMMC-7721 and ZIP177 hepatoma cells, and the inhibition rates were 65.35% and 71.45%, respectively (Fig. 10), which was equivalent to the combination of the three drugs. This indicates that EphA5 is a key target for dasatinib in the present invention.

AZD4547 is a selective inhibitor of the FGFR family that targets

FGFRs

1, 2, and 3. Therefore, the main target of AZD4547 in the present invention is FGFR2.

LTK is highly homologous to ALK. Coloritinib is a dual target drug for ALK and LTK. The Human Protein Atlas database analysis showed that LTK expression was weak in liver cancer and ALK expression was strong. ALK and LTK were knocked out in combination with FGFR2 and EphA5, respectively, using siRNA. The results showed that simultaneous knockout of LTK, FGFR2 and EphA5 did not significantly inhibit cell proliferation of SMMC-7721 and ZIP177 (Fig. 11). However, simultaneous knockdown of ALK, FGFR2, and EphA5 effectively inhibited cell proliferation by inducing apoptosis (Fig. 12), indicating that ALK is a target for the action of ceritinib in liver cancer.

Based on the above results, preliminary conclusions were drawn that ALK, FGFR2 and EphA5 are key kinases that regulate the proliferation of hepatoma cells.

The above experiments confirmed that ALK, FGFR2 and EphA5 are core kinase groups that regulate the proliferation of hepatoma cells in various liver cancer cell lines. Simultaneous inhibition of these three kinase activities can significantly inhibit the proliferation of hepatoma cells, mainly through the induction of apoptosis.

Example 6: Identification of downstream key signaling pathways involved in ALK, FGFR2, and EphA5 kinase AKT, ERK and p38

The above results indicate that simultaneous inhibition of ALK, FGFR2 and EphA5 causes apoptosis. The relevant downstream signaling pathways are for further investigation. The PI3K/AKT, MAPK/ERK and p38 signaling pathways are important signaling pathways downstream of receptor tyrosine kinases and are involved in the regulation of cell survival and proliferation. The anaplastic lymphoma kinase ALK usually undergoes point mutations, gene amplification or gene fusion to activate downstream pathways. ALK gene recombination was first discovered in patients with anaplastic large cell non-Hodgkin's lymphoma more than 20 years ago. With the deepening of research, ALK has become a potential biomarker for tumor therapy, and it is a therapeutic target for a variety of solid tumors and blood diseases including non-small cell lung cancer. In 2007, scientists discovered ALK gene fusion in 3-7% of patients with non-small cell lung cancer. This important discovery has driven the early clinical trial of the ALK/c-MET dual-target drug crizotinib and enabled it to be successfully marketed for the treatment of ALK gene fusion in non-small cell lung cancer in just four years. Activation of ALK is involved in the regulation of tumor survival and proliferation. A variety of ALK inhibitors are currently in clinical research. The downstream of ALK regulation is mainly MAPK/ERK, PI3K/AKT signaling pathway.

The receptor tyrosine kinase Ephrin family is divided into two subgroups EphA and EphB according to their ligand affinity and extracellular structure differences. It has been reported that 9 EphA (1-9) members and 6 EphB (1-6) members are bound to the EphA and EphB family ligands, respectively. Eph receptors bind to Eph ligands to activate downstream pathways, mediate cell-cell interactions, and are involved in the regulation of cell survival, proliferation, angiogenesis, adhesion, and migration. Clinically, activation of EphA5 is closely related to tumor growth and poor prognosis in patients.

The receptor tyrosine kinase FGFR comprises three domains: an extracellular segment, a single transmembrane structure, and an intracellular segment. The extracellular domain binds to the ligand FGF and transmits signals into the cell, causing activation of downstream MAPK/ERK, PI3K/AKT, JAK/STAT signaling pathways. Its signaling is mainly dependent on the linker proteins FRS, Grb2, Gab1 complex. Twenty-two FGF ligands have been discovered, 18 of which bind to the receptor FGFR (1-4), respectively. Activation of the FGF signaling pathway mediates important processes such as tumor survival, proliferation, metastasis, angiogenesis, and drug resistance. High activation of FGFR2 in liver cancer has been reported to be associated with poor prognosis in patients.

Based on this, the downstream MAPK/ERK, MAPK/JNK/p38, PI3K/AKT and JAK/STAT signaling pathways inhibiting the proliferation of hepatoma cells by ceritinib, AZD4547 and dasatinib were investigated. Western blotting showed that the combination of ceratinib, AZD4547 and dasatinib significantly inhibited the expression of p-AKT, p-ERK and p-p38, but had no significant effect on the expression of p-STAT3 and p-JNK (Fig. 13). ). This suggests that the combination of ceritinib, AZD4547 and dasatinib may inhibit the proliferation of liver cancer cells by causing down-regulation of downstream AKT, ERK and p38 signaling pathways.

To identify key downstream signaling pathways, the AKT inhibitor MK2206, the ERK inhibitor trimetinib, and the p38 inhibitor Skeponeone-L were administered in combination. The doses administered were MK2206 (1 μM), Trametinib (1 μM) and Skepone-L (10 μM), respectively. The results showed that inhibition of these three signaling pathways significantly inhibited hepatoma cell proliferation (Fig. 14), mainly by inducing apoptosis (Fig. 15).

In summary, many kinases in liver cancer cells have been highly activated in in vitro models, among which ALK, FGFR2 and EphA5 are key kinases that regulate the proliferation of hepatoma cells. Simultaneous inhibition of these three kinases induces apoptosis by blocking the activity of AKT, ERK and p38 signaling pathways, thereby inhibiting the growth of liver cancer cells.

Example 7: Co-activation of ALK/FGFR2/EphA5 is closely related to poor prognosis of liver cancer

The above results show that ALK, FGFR2 and EphA5 are highly activated in liver cancer cell lines, and jointly regulate liver cancer proliferation. Simultaneous inhibition of the activity of the three kinases blocked the downstream PI3K/AKT, MAPK/ERK and p38 pathways. To further explore the clinical significance, the activation of these three key kinases in liver cancer tissues of patients with liver cancer and their correlation with the prognosis of patients with liver cancer were investigated.

First, it was examined whether the activation of three kinases in liver cancer cells and normal liver cells was different. The results showed that the expression of p-ALK, p-FGFR2 and p-EphA5 was significantly higher in 8 liver cancer cells than in the immortalized human normal liver cell QSG-7701 (Fig. 16). Further, the activity of three kinases in 24 pairs of frozen liver cancer tissues and normal liver tissues was examined. The level of activation of the three kinases in liver cancer tissues was found to be significantly higher than in normal tissues (Fig. 17).

Immunohistochemical examination showed that the expression of p-ALK, p-FGFR2 and p-EphA5 were different in different liver cancer samples (Fig. 18). Three kinases were highly activated in approximately 13% of liver cancer patients (Figure 19). Kaplan-Meier Plotter analysis found that single activation of ALK, FGFR2, or EphA5 was not significantly associated with poor prognosis in patients with liver cancer, and that patients with three kinases co-activated had significantly shorter overall survival than other subpopulations (Figure 20). This indicates that the high expression of p-ALK, p-FGFR2 and p-EphA5 is positively correlated with poor prognosis in patients with liver cancer. Thus, the present invention identifies a subset of specific liver cancer patients with a worse prognosis than other subpopulations, with p-ALK, p-FGFR2 and p-EphA5 co-expressing together.

Example 8: Combination of ceritinib, dasatinib and AZD4547 inhibits human liver cancer Mouse xenograft growth

The above results showed that the three kinases ALK/FGFR2/EphA5 jointly regulate the proliferation of hepatoma cells, and the downstream ones are directed to the AKT, ERK and p38 signaling pathways. Western blot analysis of patient tissues and tissue microarray analysis revealed that ALK/FGFR2/EphA5 was co-activated in approximately 13% of liver cancer patients, and the overall survival of this subgroup was shorter than that of other subpopulations. It is shown that the three kinases are the core kinase groups in liver cancer and can be used as targets for subsequent molecular targeted therapy.

Based on this, further research on the corresponding molecular targeted therapeutic strategies is needed. Cell level results showed that the combination of three kinase inhibitors significantly inhibited the proliferation of hepatoma cells. To further evaluate the clinical application prospects of this regimen for the treatment of liver cancer, human hepatoma cell SMMC-7721 nude mouse xenograft model was selected to investigate three kinase inhibitors. In vivo tumor suppressor activity. Four drug-administered groups were administered, and the combination of coloritripinib 25 mg/kg, dasatinib 25 mg/kg, and AZD4547 12.5 mg/kg and the same dose of the three drugs were administered. The control group was given an equal amount of vehicle/solvent. Oral once a day for 2 weeks.

The results showed that the tumor-inhibiting activities of the two administration groups using colorizone and dasatinib alone were weak, less than 10%. The tumor suppressing rate of the administration group using AZD4547 alone was about 50%. The combination of rititinib, dasatinib and AZD4547 gave the highest tumor inhibition rate of 80.5% (Fig. 21). It was demonstrated that the combination of ceratinib, dasatinib and AZD4547 obtained a significantly better in vivo tumor suppressing effect in a mouse model compared to the individual use of each drug.

Immunohistochemical staining of CD34 showed that AZD4547 exerted an anti-tumor effect mainly by inhibiting angiogenesis (Fig. 23). It is indicated that the combination of three drugs can significantly inhibit tumor growth in vivo. Monitoring changes in mouse body weight found that the combination resulted in a decrease in body weight in mice but did not result in death in mice (Figure 24).

In SMMC-7721 xenografts, the experimental doses of dasatinib, ceratinib and AZD4547 significantly inhibited the expression of p-ALK, p-FGFR2, p-EphA5 and other targets. Separate use has a weak inhibitory activity against downstream MAPK/ERK, PI3K/AKT and p38 signaling pathways. The combination significantly inhibited the expression levels of p-AKT, p-ERK and p-p38 (Fig. 22). The results of immunohistochemistry were consistent with Western blotting. The combination of three kinase inhibitors reduced Ki67 expression and inhibited the proliferation of liver cancer cells. The single use of AZD4547 significantly reduced the expression of the angiogenesis marker CD34, indicating that its anti-tumor activity is primarily due to inhibition of angiogenesis (Figure 23).

Example 9-11: Effect of Hsp90 inhibitor on liver cancer

1. Instrumentation

Beckman 6605698 cell counter from Beckman Coulter (Fullerton, CA, USA);

Flow cytometer FACSCalibur ^TM, from Becton Dickinson (Sunnyvale, CA, USA );

Vii7 PCR Nanovue plus spectrometer from GE Healthcare;

Horizontal oscillator from IKA (Germany);

Multilabel Reader from PerkinElmer (Waltham, MA, USA);

Vii7 real-time quantitative PCR instrument from Life Technology;

2. Drugs and reagents

Solafenib, Ganetespib, NVP-AUY922, PU-H71, SNX2112, 17-DMAG, MK2206, trimetinib, MG132 and Skeponeone-L are commercially available from Selleck (USA). The compound used in the experiment was formulated into a 10 mM stock solution in DMSO, frozen at -20 ° C, and diluted to the desired concentration with physiological saline before use. The final concentration of DMSO was not more than 0.1%. Benzosulforyl B (SRB) and DMSO are commercially available from Sigma.

The protease inhibitor cocktail and phospholipase inhibitor PhosSTOP are commercially available from Roche Biotechnology Co., Ltd.; HRP-labeled secondary antibodies are commercially available from Merck organisms;

Prestained protein marker 26616 commercially available from Thermo Scientific Pierce; chromonic solution ECL Plus Western Blot detection system, SuperSignal West Pico Chemiluminescent Substrate commercially available from ^{Thermo Scientific Pierce; Clarity TM Western ECL} Substrate commercially available from Bio-Rad; SDS, TEMED, 30% acrylamide, glycine and ammonium persulfate are chemically pure. Transfection reagent Lipofectamin 2000 Reagent and interference reagent

3. Cell culture

The tumor cell lines used in the present invention are shown in Table 1. Cell cultures follow the guidelines of the cell provider. 10% fetal bovine serum (FBS; Gibco, Grand Island, NY, USA) was added to the cell culture medium. All cells were routinely cultured in a 37 ° C 5% CO ₂ saturated humidity incubator.

HepG2 and Hep3B are available from ATCC. SMMC-7721, QGY-7703, ZIP177, BEL-7402, Huh-7, SK-Hep-1 and human immortalized hepatocytes QSG-7701 are available from the Cell Culture Bank of the Chinese Academy of Sciences. Huh-7 and SK-Hep-1 cells were cultured in DMEM medium containing 10% Gibco fetal bovine serum; HepG2 and Hep3B cells were cultured in EMEM medium containing 10% Gibco fetal bovine serum; SMMC-7721, QGY- 7703, ZIP177 and BEL-7402 cells were cultured in RIPM 1640 medium containing 10% Gibco fetal bovine serum. All cell lines available from ATCC were identified by STR.

4. Experimental methods

4.1. Real-time quantitative PCR

The cells in the log phase were seeded in a 6-well plate at a density of 2×10 ⁵ cells/well. After the culture overnight, the drug was treated for 24 hours. The supernatant was discarded, washed once with pre-cooled PBS, and 1 mL of Trizol was added to each well. . Trizol extracts total RNA in one step. The RNA was reverse transcribed into cDNA using the Takara Reverse Transcription Kit as a template for subsequent experiments. Next adoption

^{Premi × E × Taq TM II (} Tli RNaseH Plus) for real-time quantitative PCR kit according to the instructions, the detection level of the target gene mRNA expression levels.

The primers required for the experiment were synthesized by Bioengineering Biotechnology (Shanghai) Co., Ltd., and the sequence is as follows (SEQ ID NO: 35-42):

ALK-Forward: TCTCATCGCAGCCGATATGG

ALK-reverse: GGCATCTCCTTAGAACGCTCT

FGFR2-forward: AGCACCATACTGGACCAACAC

FGFR2-reverse: GGCAGGAGAACTTTGAGAGTG

EphA5-Forward: GTGACCGATGAACCTCCCAAA

EphA5-reverse: CCAGGTCTGCACACTTGACAG

Β-actin-forward: CATGTACGTTGCTATCCAGGC

--actin-reverse: CTCCTTAATGTCACGCACGAT

4.2. siRNA interference

The transfection reagent was transferred to the cells according to the product instructions. The specific method is as follows: ZIP177 or SMMC-7721 cells in logarithmic growth phase are trypsinized and inoculated into 6-well plates at 2×10 ⁵ cells/well, the degree of fusion is about 30-50%, and 40 pmol siRNA is used. Serum was diluted to 100 μL in antibiotic-free Opti-MEM medium. 2 μL of RNAiMAX reagent was diluted to 100 μL with serum-free and antibiotic-free Opti-MEM medium, mixed, and allowed to stand at room temperature for 5 min. The two were mixed and allowed to stand at room temperature for 15 min. At the same time, the cell culture medium was changed to 800 μL serum-free antibiotic-free Opti-MEM medium, and the mixture was added to a 6-well cell culture plate, and cultured for 4-6 hours, and then replaced. Fresh complete medium was continued and cultured at 37 ° C with 5% CO ₂ .

The Hsp90 siRNA fragment was purchased from Sigma (USA) and the sequence is as follows (sense strand) (SEQ ID NO: 43-44):

1: GCUUGACAGAUCCCAGUAAdTdT

2: GCUGGUGCAGAUAUCUCUAdTdT

4.3. Western blot analysis

The cells were washed twice with pre-cooled 1 x PBS, and RIPA lysate was added and lysed on ice for 30 min. The supernatant was taken at 4 ° C, centrifuged at 12,000 x g for 30 mim. The BCA protein was quantified and a protein sample was prepared by adding 1 x SDS lysate. The protein samples were placed in different density SDS-polyacrylamide gels and separated in a Tris-Glycine-SDS running buffer by electrophoresis at 80 V for about 20 min and 120 V for about 2 h. The protein was transferred from the gel to a nitrocellulose filter by semi-dry blotting or wet transfer. The transfer buffer formulation was 192 mmol/L glycine, 25 mmol/L Tris, 20% methanol. Transfer according to the molecular weight of the desired protein for 1-2h. Metastasis and protein band position were determined by Ponceau S staining. The corresponding band was cut according to the molecular weight of the protein Marker, and then blocked with a blocking solution (TBST containing 5% skim milk powder or TBST of 3% BSA) for 60 min at room temperature, and incubated with the corresponding antibody at 4 ° C overnight. The TBST washing solution was washed 3 times at room temperature for 10 min each time. Horseradish peroxidase-labeled secondary antibody (1:2000) diluted with 3% BSA was added and incubated for 1 h at room temperature. It was then rinsed three times with TBST for 10 min each time. Suitable luminescent reagents are selected for color development based on exposure intensity, including ECL Plus Western Blot detection system and Advance ECL Western blot detection system, and SuperSignal West Pico Chemiluminescent Substrate. The antibodies used in the present invention are shown in Table 3.

4.4. Immunoprecipitation

SMMC-7721 or ZIP177 cells in good growth state were inoculated into a 100 mm culture dish and cultured for 24 hours. Subsequent experiments were performed when the cell fusion degree was 60-70%. Change serum-free culture to be hungry. The corresponding concentration of Hsp90 inhibitor was added for 4 h. The cells were washed twice with pre-cooled 1×PBS, and lysed with 600 μL of 1×RIPA lysate for 1 h on ice. The dish was gently shaken several times during the period to allow sufficient lysis. Centrifuge at 12,000 x g for 20 min at 4 °C. After taking the supernatant and BCA to adjust the total protein amount, a small amount of the sample was added to 2×SDS loading buffer and boiled at 100 ° C for 10 min as a control; the remaining sample was added with 25 μL of protein A/G Agrose, and incubated at 4 ° C for vertical mixing. The cells were allowed to stand on ice for 5 min, centrifuged at 2000 x rpm for 6 min, and then the beads were washed with 500 μL of 1×RIPA lysate (containing no protease inhibitor mixture). After standing for 5 min, centrifuge at 2000×rpm for 6 min, remove the supernatant, repeat this six times, then add the required amount of 2×SDS-PAGE loading buffer, cook at 100 ° C for 10 min, and detect by Western blotting.

4.5.PU-H71 beads pull down experiment

SMMC-7721 or ZIP177 cells in good growth state were inoculated into a 100 mm culture dish and cultured for 24 hours. Subsequent experiments were performed when the cell fusion degree was 60-70%. The cells were washed twice with pre-cooled 1×PBS, and 200 μL of Felts lysate (20 mM HEPES, 50 mM KCl, 5 mM MgCl ₂ , 0.01% NP-40, freshly prepared 20 mM Na ₂ MoO ₄ , pH 7.2-7.3, protease inhibition) was added. Mixture (Roche)), lysed on ice for 1 h. The dish was gently shaken several times during the period to allow sufficient lysis. Centrifuge at 12,000 x g for 20 min at 4 °C. After taking the supernatant and BCA to adjust the total protein amount, take a small amount of sample and add 2×SDS loading buffer at 100 °C for 10 min as a control; take 250 μg protein to adjust the volume to 200-300 μL, add 80 μL PU-H71 beads or control. The beads were incubated overnight at 4 ° C with vertical mixing. The beads were washed with lysate, centrifuged at 2000 x rpm for 6 min, and the supernatant was removed. This was repeated six times. Then, the required amount of 2×SDS-PAGE loading buffer was added, and the mixture was boiled at 100 ° C for 10 min, and detected by Western blotting.

4.6. Flow cytometry to detect apoptosis

Cells in the logarithmic growth phase such as SMMC-7721 or ZIP177 were seeded in a 6-well plate at a density of 2 × 10 ⁵ cells/well, and cultured overnight at 37 ° C in a saturated humidity incubator containing 5% CO ₂ . Add drug treatment for 48h. The cells were trypsinized and collected in a 2 mL centrifuge tube and centrifuged at 600 x g for 5 min at 4 °C. The supernatant was discarded, and apoptosis was detected by PI staining DNA and FITC-Annexin V staining with phosphatidylserine (PS) using BD's Annexin V-FITC apoptosis assay kit.

4.7. Cell survival experiment

The liver cancer cells in the logarithmic growth phase were inoculated into 96-well plates at a density of 3000-4000/well, and processed according to the experimental protocol. At the end of the experiment, the pre-cooled TCA was fixed at 4 ° C for 1 h, and dried in a constant temperature oven at 60 ° C. Incubate with 100 μL of 4 mg/L phenylsulforamide B (SRB) for 15 min. The unbound SRB was washed away with a 1% aqueous glacial acetic acid solution, dried in a constant temperature oven at 60 ° C, and dissolved by adding 10 mmol/L Tris-HCl. The microplate reader reads the absorbance at 560 nm wavelength. Inhibition rate = (OD _{control group -} OD _{experimental group} ) / OD _{control group} .

4.8. In vivo nude mice xenograft experiments

BALB/c nude nude mice: SPF grade, female, 5-6 weeks old, weighing 16-20 g, purchased from Beijing Weitong Lihua Experimental Animal Technology Co., Ltd. The animals used in this experiment strictly adhered to the ethical standards for animal feeding and use of the Shanghai Institute of Materia Medica, Chinese Academy of Sciences. Naked mice were kept in the absence of special pathogens, and the light was replaced every 12 hours. The feed and water were disinfected before use.

Human liver cancer SMMC-7721 cells were subcutaneously inoculated into the right axilla of nude mice at 5×10 ⁶ / each. The diameter of the transplanted tumor was measured using a vernier caliper. When the tumor volume reached -100 mm ³ , the animals were randomized into groups of 6 each. 10 mg/kg and 30 mg/kg Ganetespib (10% DMSO + 18% ethylene oxide castor oil + 3.6% glucose + double distilled water) were administered, respectively. The control group was given an equal amount of solvent. Intraperitoneal injection three times a week for 4 weeks. Mouse body weight and tumor length (L) and width (W) were measured three times a week, and the tumor volume TV = L x W ² /2 was calculated therefrom. Relative tumor volume RTV = Vt / V0, Vt refers to the tumor volume on the day of measurement, and V0 refers to the initial tumor volume before administration. The relative tumor growth rate T/C (%) was used as an index for evaluating antitumor activity, and T/C (%) = average TV/control group TV×100% of the administration group. Efficacy evaluation criteria: T/C%>60% was ineffective; T/C%≤60% and statistically treated p<0.05 was effective. At the same time, the body weight of the mice was weighed and used to evaluate drug toxicity.

4.9. Patient-derived tumor xenograft model (PDX model)

Tumor xenografts were directly established from patient tumors and routinely passaged by subcutaneous transplantation into female BALB/c Nude mice (Wuxi Apptech). All experimental procedures were approved by the Wuxi Apptech Laboratory Animal Management and Use Committee. For each model, P3-P5 generation xenografts were harvested from 2 mice when the xenografts reached a size of about 100 to 150 mm ³ and were treated after randomization (n=6 per group). Oral administration of ceritinib (1:1 ratio of 0.5% methylcellulose and 0.5% Tween 80), AZD4547 (1% Tween 80) or dasatinib (0.05% carboxymethylcellulose) once daily sodium). Ganetespib (10/18 DRD (10% dimethyl sulfoxide (DMSO), 18% Cremophor RH40, 3.6% dextrose in water) was injected intraperitoneally three times a week. For combination treatment, the drugs are administered simultaneously. The width (W) and length (L) of each tumor were measured by a caliper, measured three times per week using the equation V = (L × W ² )/2 and the tumor volume (TV) was calculated. Individual relative tumor volume (RTV) was calculated as _{_{follows: RTV = V t / V 0}} , where V _t is the volume per day, and refer to the volume V ₀ at the start of treatment. The RTV at the indicated days is shown as the mean ± SEM of the mouse group indication. At the indicated times, mice were sacrificed, tumor tissues were excised and homogenized in cold RIPA lysis buffer (Beyotime, Nantong, China) supplemented with protease and phosphatase inhibitors (Merck, Darmstadt, Germany) and then immunized Imprinted.

4.10. Statistical analysis

Unpaired two-tailed t-test was used for the significance analysis between groups, and p<0.05 was considered to be significantly different. Multi-group analysis was performed using Two-way Anova. *, p < 0.05; **, p < 0.01; ***, p < 0.001.

Example 9: Confirmation that ALK, FGFR2 and EphA5 are client proteins of Hsp90

The Susan Lindquist team found that Hsp90 interacts with more than 60% of the kinase. The binding of Hsp90 to a client protein depends on its protein thermostability. Moreover, numerous studies have found that the key kinase client proteins regulated by Hsp90 in different systems are different. For example, in the gastrointestinal stromal tumors, mainly c-kit, breast cancer is HER2, non-small cell lung cancer is EGFR and ALK, and melanoma is mainly BRAF. Therefore, the key question to be solved is whether Hsp90 affects the growth of liver cancer through three key kinases in the liver cancer system.

The Susan Lindquist team found that multiple members of the FGFR and EphA families are client proteins of Hsp90 and also demonstrated that ALK interacts with Hsp90. Protein interaction database data show that Hsp90 binds to ALK, EphA and FGFR family proteins (https://www.picard.ch). Hsp90 is mainly distributed in cytoplasm, and a small amount is distributed in the subcellular organelles such as nucleus and mitochondria, while ALK, EphA5 and FGFR2 are membrane proteins. There is a premise that Hsp90 binds directly to ALK, EphA5 and FGFR2.

PU-H71 is an Hsp90 inhibitor that has entered clinical studies by inhibiting molecular chaperone circulation by binding to the N-terminus of Hsp90, blocking Hsp90 binding to client proteins. In 2012, the Gabriela Chiosis team found that PU-H71 specifically binds to a complex of Hsp90 and oncoprotein in tumors. For example, in BCR-Abl-dependent chronic myeloid leukemia, BCR-Abl is abnormally expressed and its stability is dependent on Hsp90. PU-H71 can selectively bind to it without binding to wild-type c-Abl. Therefore, PU-H71 beads are an ideal tool for studying client proteins.

First, the relationship between endogenous Hsp90 and ALK, FGFR2 and EphA5 in hepatoma cells was investigated by immunoprecipitation experiments. The immunoprecipitation of Hsp90 and three kinases and the results of PU-H71 beads showed that Hsp90 interacted with ALK, FGFR2 and EphA5. These three kinases are likely to be client proteins of Hsp90 (Figures 25 and 26).

Ganetespib is the fastest-growing Hsp90 inhibitor in clinical research, competitively binding to the N-terminal domain of Hsp90, blocking the molecular chaperone cycle, thereby inhibiting the binding of Hsp90 to client proteins. Co-immunoprecipitation experiments showed that the addition of Ganetespib for a short time treatment significantly inhibited the binding of Hsp90 to ALK, FGFR2 and EphA5 (Fig. 27).

Hsp90 inhibitors block the molecular chaperone cycle, resulting in client proteins not being matured by normal processing. Misfolded proteins will be ubiquitinated and degraded by the proteasome pathway. To further verify that the three kinases are client proteins of Hsp90, inhibitor intervention and siRNA interference treatment were performed simultaneously to investigate the effect on the stability of the three kinase proteins. Different concentrations (0.01 μM, 0.1 μM, 1 μM) of Hsp90 inhibitor Ganetespib were added for 24 h, and the 0.1 μM dose significantly down-regulated the expression of ALK, FGFR2 and EphA5 proteins (Fig. 36B). When 0.1 μM Ganetespib was added for 6h, 12h, 24h and 48h, the results showed that the expression of three kinase proteins was down-regulated at 12h and completely inhibited by 24h (Fig. 28A). RealTime-PCR results showed that different concentrations of Ganetespib had no significant effect on the expression of three kinase mRNA levels for 24 h (Fig. 28B). This indicates that Ganetespib down-regulates the expression of ALK, FGFR2 and EphA5 by affecting protein stability.

The protease inhibitor MG132 blocks the degradation of proteins via this pathway by inhibiting the action of the proteasome. To further verify that ALK, FGFR2 and EphA5 were degraded via the proteasome pathway, 10 μM MG132 was added for pretreatment for 6 h, the supernatant was discarded, fresh medium was added for three times, and 0.1 μM Ganetespib was added for 24 h. The results showed that MG132 reversed the degradation of ALK, FGFR2, and EphA5 by Ganetespib (Fig. 29).

Based on the above studies, co-IP, PU-H71 beads pull down experiments, small molecule inhibitor interventions and MG132 reversal experiments demonstrated that ALK, FGFR2 and EphA5 are Hsp90 client proteins. It was shown that the effects of inhibiting ALK, FGFR2 and EphA5 can be achieved by blocking the activity of Hsp90. The next step will be to examine the regulation and regulation of Hsp90 on liver cancer proliferation.

Example 10: Blocking Hsp90 activity inhibits liver cancer proliferation by degrading three kinases

The above experiments have demonstrated that ALK, FGFR2 and EphA5 are client proteins of Hsp90 in liver cancer cells.

The expression of Hsp90 in liver cancer tissues was examined. The expression of Hsp90 in liver cancer tissues was higher than that in normal tissues as determined by Western blot (Fig. 30).

At the same time, IHC experiments showed that Hsp90 expression was positively correlated with the activation levels of the three kinases in HCC patients (Fig. 31), in individuals with high Hsp90 expression in a population with three kinases highly activated (left column) The ratio of the number to the total (78.1%) is the highest. Note that "high Hsp90 expression" is the median value relative to all samples.

Next, we will investigate whether Hsp90 controls liver cancer proliferation through three kinases, ALK, FGFR2 and EphA5. First, the IC ₅₀ values of various Hsp90 inhibitors against 6 liver cancer cells ZIP177, SMMC-7721, HepG2, QGY-7703, Huh-7 and BEL-7402 were determined. The results showed that liver cancer cells were sensitive to Hsp90 inhibitors, and the IC ₅₀ was in the level of 100 nanomolar, which was significantly better than the clinical first-line drug sorafenib (Fig. 32). The IC50 of Hsp90 inhibitors on normal hepatocytes was also tested (Figure 33).

The effect of siRNA transient interference with Hsp90 and the addition of Hsp90 inhibitor on the proliferation of hepatoma cells was investigated. The results showed that cell proliferation was significantly inhibited by RNA interference (Fig. 34A) or addition of inhibitor (Fig. 34B) to block Hsp90 activity in SMMC-7721 and ZIP177 cells.

Further, the main biological effects caused by blocking Hsp90 activity were examined. Apoptosis was detected by flow cytometry using siRNA transiently interfering with Hsp90 and adding different concentrations (0.01 μM, 0.1 μM, 1 μM) of Hsp90 inhibitor for 48 h. The results showed that both gene interference (Fig. 35A) and inhibitor (Fig. 35B) caused significant apoptosis. Western blot results showed that gene interference (Figure 36A) and inhibitor (Figure 36B) resulted in degradation of ALK, FGFR2, and EphA5 proteins, as well as down-regulation of downstream AKT, ERK, and p38 signaling pathways, while facilitating PARP and Caspase3 cleavage, thereby Levels verify its apoptotic effect. The effects of Ganetespib on other kinases were also tested (Figure 37).

In conclusion, we investigated the blocking of Hsp90 activity by siRNA interference and inhibitors, and verified that inhibition of Hsp90 activity can cause degradation of ALK, FGFR2 and EphA5 proteins, and then down-regulate the expression of downstream p-ERK, p-AKT and p-p38. Promotes PARP and Caspase3 cleavage and induces apoptosis. At the cellular level in vitro, it was verified that Hsp90 regulates hepatoma cell proliferation through three key kinases ALK, FGFR2 and EphA5.

Example 11: Hsp90 inhibitor inhibits growth of SMMC-7721 nude mice xenografts

The results of the above siRNA interference and small molecule inhibitors indicate that Hsp90 is essential for maintaining the survival and proliferation of hepatoma cells, and that inhibition of Hsp90 activity can block the proliferation of hepatoma cells by down-regulating the activities of the key kinases ALK, FGFR2 and EphA5.

Next, the in vivo tumor suppressor activity of Hsp90 inhibitor was investigated by using the liver cancer cell SMMC-7721 nude mouse xenograft model. Two administration groups were set, and Ganetespib was administered at 10 mg/kg and 30 mg/kg, respectively. The control group was given an equal amount of solvent. Intraperitoneal injection three times a week for 4 weeks. The results show that Ganetespib dose-dependently inhibits xenograft growth. The tumor-inhibiting activity of the 10 mg/kg dose group was weak, and the inhibition rate was 21.5%; the 30 mg/kg dose group had a high inhibition rate of 87.4%, indicating that Ganetespib can significantly inhibit the tumor model of liver cancer in vivo in a dose-dependent manner. Growth (Fig. 38A). At the same time, the body weight changes of the mice were monitored, and it was found that the administration process did not cause significant weight loss, and no mice died, and the survival condition was good, indicating that the Ganetespib side effects were small (Fig. 38B).

Further, the corresponding signal path changes were detected by Western blotting. The results showed that Ganetespib dose-dependently down-regulated the expression of ALK, FGFR2 and EphA5 proteins, and significantly down-regulated the downstream signaling pathways of p-AKT, p-ERK and p-p38, consistent with in vitro results (Fig. 39).

So far, the present invention has determined that ALK, FGFR2 and EphA5 are client proteins of Hsp90 at the in vitro cell level and in vivo nude mouse xenograft models, and are essential for the proliferation of liver cancer. Inhibition of Hsp90 activity can degrade three kinases to inhibit the proliferation of liver cancer. The present invention demonstrates the feasibility and clinical application potential of Hsp90 inhibitors for the treatment of liver cancer, and finds an alternative strategy for the combination of coloritripinib, dasatinib and AZD4547, and provides a new molecular targeted therapeutic strategy for liver cancer. The theoretical and practical basis.

Example 12: The body of a kinase inhibitor and an Hsp90 inhibitor in a liver cancer PDX model Internal effect

The inventors have also established a liver cancer PDX model to further test the in vivo effects of ALK, FGFR2 and EphA5 kinase inhibitors and Hsp90 inhibitors.

The results of the kinase inhibitor assay showed that ALK, FGFR2 and EphA5 kinase inhibitors (chromatinib (25 mg/kg), AZD4547 (12.5 mg/kg) compared to the control and ALK, FGFR2 and EphA5 kinase inhibitors alone. The combined use of dasatinib (25 mg/kg) significantly inhibited the growth of liver cancer PDX in vivo in mice (Fig. 40). Moreover, Western blotting showed that three kinase inhibitors down-regulated three kinases and downstream signaling pathways in the liver cancer PDX model (Figure 41).

The results of the Hsp90 inhibitor Ganetespib showed that the Ganetespib doses of 30 mg/kg and 50 mg/kg both significantly inhibited the growth of liver cancer PDX in vivo compared to the control (Fig. 42). Moreover, Western blotting showed that Ganetespib down-regulated three kinases and downstream signaling pathways in the hepatocellular carcinoma PDX model (Figure 43). The effect of Ganetespib on other kinases in hepatocellular carcinoma PDX was also tested by Western blotting (Figure 44).

Conclusion and discussion of the invention

1. Conclusion

1) The present inventors have found that receptor tyrosine kinases ALK, FGFR2 and EphA5 are co-activated in liver cancer patients, and the survival of liver cancer cells is regulated by downstream AKT, ERK and p38 signaling pathways, and a new target for molecular targeted therapy of liver cancer is proposed (Fig. 47).

2) The co-activation of three kinases is closely related to the poor prognosis of patients with liver cancer, and has certain clinical value.

3) In vitro and in vivo models demonstrate that Hsp90 inhibitors inhibit the proliferation of hepatoma cells by inhibiting the activity levels of ALK, FGFR2 and EphA5 kinases and downstream signaling pathways, providing theoretical support for the use of Hsp90 inhibitors for the treatment of liver cancer.

2. Discussion

2.1. Treatment target discovery

Since the successful launch of Gleevec, a small molecule inhibitor targeting Bcr-Abl in 2001, anti-tumor research has opened a new era of molecular targeted therapy. In 2002, scientist Weinstein discovered that knocking out the transcription factor c-Myc in osteogenic sarcoma cells leads to cell differentiation and apoptosis. This phenomenon in which tumorigenesis depends on a specific gene is called "oncogene dependence." This discovery has greatly accelerated the development of molecular targeted therapies. The small molecule inhibitor crizotinib targeting ALK and c-Met first launched a new clinical research model, targeting patients with EML4-ALK fusion, which took only 4 years from clinical research to successful marketing. Compared with the first molecularly targeted drug Gleevec, it is a great improvement in 41 years. Therefore, the driving gene targeting "oncogene dependence" has become the main research direction of clinical cancer treatment. The clinical diagnosis and treatment of non-small cell lung cancer is a good example of success.

However, liver cancer is highly heterogeneous, the signaling pathway is complex, and no driver-type genes have been found, which poses a huge challenge to the development of molecularly targeted drugs. A large number of genetic analysis results in a more comprehensive understanding of the abnormal expression of genes in liver cancer, the most frequent mutations are TP53, β-catenin and telomerase reverse transcriptase, which are currently not targeted, but are common in other solid tumors. The genes of the driven genes such as ALK, EGFR and c-Met have extremely low mutation rates in liver cancer. Comprehensive multi-faceted factors, the current anti-hepatocarcinoma molecular targeted drugs for clinical research is mainly targeted at kinases, including anti-angiogenic drugs and targeted high-activating c-Met, mTOR, FGFR, MEK and ERK drugs alone and in combination .

Based on the current state of clinical research, the present invention focuses primarily on highly activated kinases in liver cancer. The receptor tyrosine kinase chip was used to detect the activation level of kinase in hepatoma cells, and it was found that there were 17 kinases activated in more than 5 cells, and no abnormalities such as mutation and amplification were observed. This explains to some extent the ineffectiveness of specific kinase inhibitors for liver cancer and the failure of clinical kinase inhibitors. Given the high heterogeneity of tumors, the combination of drugs to simultaneously block multiple important kinases has become an important therapeutic strategy.

In the process of liver cancer, the kinase network is in a dynamic process, and random combination therapy does not effectively exert anti-tumor effects. Leading to multiple combined clinical trials failed. In the present invention, it was first discovered that three kinases of ALK, FGFR2 and EphA5 form a core kinase group to control the growth of liver cancer cells and transplanted tumors. Moreover, the co-activation of the three kinases is positively associated with poor prognosis in patients with liver cancer, with approximately 3% of patients having a high degree of activation, with a shorter overall survival. This result is of great significance for the clinical grouping of liver cancer patients, and is expected to become a "predictive marker" for patient diagnosis or subgroup enrollment.

2.2. Treatment strategy research

ALK/FGFR2/EphA5 is essential for the growth of liver cancer, while inhibiting three kinases significantly inhibits the growth of liver cancer in vitro and in vivo. The development of multi-targeted drugs that target both kinases is an ideal solution to this problem. There is also a need for an effective alternative strategy. Hsp90 has become an important anti-tumor target for the regulation of the stability of most tumor-related developmental kinases, and is particularly effective for kinase-mediated tumors. A variety of Hsp90 inhibitors have been used for non-small cell lung cancer for ALK fusion. Clinical Phase 2-3 study of HER2-positive breast cancer. The experiments of the present invention demonstrate that ALK, FGFR2 and EphA5 are important client proteins of Hsp90 in liver cancer. Blocking Hsp90 activity can effectively inhibit liver cancer growth by inhibiting three key kinases and downstream signaling pathways. This also illustrates the molecular mechanism of Hsp90 inhibitors for the treatment of liver cancer, and provides a theoretical basis for its clinical application. More importantly, patients co-activated with p-ALK/p-FGFR2/p-EphA5 may be sensitive populations of Hsp90 inhibitors, providing Hsp90 inhibitors with a population suitable for liver cancer.

In general, the present inventors have discovered key kinase groups ALK, FGFR2 and EphA5 that regulate the fate of liver cancer, and at the same time verified the correlation between activation and poor prognosis of patients. Accordingly, the present invention establishes a molecular targeted therapeutic strategy for this subpopulation, namely the combination of three kinase inhibitors and the Hsp90 inhibitor alone. It provides a new direction and preliminary theoretical basis for molecular targeted therapy of liver cancer.

Claims

A pharmaceutical combination comprising an ALK kinase inhibitor, a FGFR2 kinase inhibitor, and an EphA5 kinase inhibitor.
A pharmaceutical combination comprising an AKT signaling pathway inhibitor, a MEK signaling pathway inhibitor, and a p38 signaling pathway inhibitor.
A method of identifying a subtype of liver cancer in a subject, comprising measuring the level of activity of ALK kinase, FGFR2 kinase, and EphA5 kinase in the subject.
A method of identifying a subtype of liver cancer in a subject, comprising measuring an activity level of an AKT signaling pathway, a MEK signaling pathway, and a p38 signaling pathway in the subject.
Use of Hsp90 inhibitors in the manufacture of a medicament for inhibiting ALK kinase, FGFR2 kinase and EphA5 kinase.
Use of Hsp90 inhibitors in the preparation of a medicament for inhibiting the AKT signaling pathway, the MEK signaling pathway, and the p38 signaling pathway.