CN110063956A

CN110063956A - The pharmaceutical composition and method for treating liver cancer

Info

Publication number: CN110063956A
Application number: CN201810095510.XA
Authority: CN
Inventors: 耿美玉; 沈爱军; 刘红椿; 张敏敏; 丁健
Original assignee: Shanghai Institute of Materia Medica of CAS
Current assignee: Shanghai Institute of Materia Medica of CAS
Priority date: 2018-01-20
Filing date: 2018-01-20
Publication date: 2019-07-30
Also published as: WO2019141235A1

Abstract

The present invention provides pharmaceutical compositions, and it includes ALK kinase inhibitor, FGFR2 kinase inhibitor and EphA5 kinase inhibitor or AKT signal pathway inhibitors, MEK signal pathway inhibitor and p38 signal pathway inhibitor.The present invention also provides the methods of the hypotype of the liver cancer in identification subject, it includes measuring the activity level of ALK kinases in the subject, FGFR2 kinases and EphA5 kinases, or the activity level of AKT signal path, MEK signal path and p38 signal path in the measurement subject.The present invention also provides Hsp90 inhibitor in preparation for inhibiting ALK kinases, FGFR2 kinases and EphA5 kinases, or the purposes in the drug for inhibiting AKT signal path, MEK signal path and p38 signal path.

Description

The pharmaceutical composition and method for treating liver cancer

Technical field

The present invention relates to the pharmaceutical compositions and method for the treatment of liver cancer, and relate more specifically to through multiple inhibiting kinases group Or corresponding signal access and treat the pharmaceutical composition and method of liver cancer.

Background technique

Liver cancer is the current the third-largest fatal tumor in the whole world.It is divided into hepatocellular carcinoma (origin according to its pathological tissue source In liver cell) and bile duct cell liver cancer (originating from stones in intrahepatic bile duct cell), wherein liver cancer accounts for 80% of primary carcinoma of liver or more.Liver Cancer is process more than one, continues to develop variation, highly heterogeneous tumour.

Drug metabolism caused by the factors such as primary drug resistance and cirrhosis causes chemotherapeutic effect poor extremely, toxic side effect By force.Later period of hepatocarcinoma shifts, and mostly leads to liver function decompensation with cirrhosis, and the poor chemotherapy of patient body situation is not resistant to By, only be applicable in molecular targeted agents.Currently, molecular targeted class drug only has multiple target point kinase inhibitor Sorafenib (Sorafenib) it lists.Sorafenib is by inhibiting the signal paths such as RAF/MAPK/ERK, VEGFR, PDGFR, STAT3 to inhibit Tumor proliferation and new vessels generate, to achieve the effect that anti-liver cancer and anti-.But its clinical treatment outcome is unsatisfactory, only 2.5% liver cancer patient part improves, and complete cure rate is 0, and is only capable of extending 2.8 months overall survival phases.

Sorafenib treatment liver cancer mainly passes through target vascular therapy new life associated kinase VEGFR1/2/3 and PDGFR β and increasing Grow relevant Flt-3, c-Kit, RET and RAF/MAPK/ERK etc..Preclinical animal model research and clinical study results are shown Sorafenib plays antitumor action in vivo and mainly passes through inhibition vascular endothelial cell proliferation, and then blocks angiogenesis, Cut off the nutrition supply of tumor tissues.But Sorafenib clinically has certain toxic side effect, cause some patientss intolerant to By, and patient's overall survival phase that part responds only extends 2-3 months, has no and cures case completely.Cause Sorafenib clinical Ineffective reason has very much, mediates including liver cancer kinases reprogramming, anti-angiogenic rebirth drug resistance and EMT caused by heterogeneous Drug resistance etc..

Due to complicated processes such as the heterogeneous characteristic of tumour height and kinases reprogrammings, it is applied alone medicine effect not aobvious enough It writes, drug combination inhibits a plurality of signal path to be increasingly becoming a kind of common recognition simultaneously.The signal paths such as EGFR, mTOR, c-Met The advanced activation in liver cancer has clinically carried out Sorafenib and EGFR inhibitor Tarceva and mTOR inhibitors drug combination Research, but regrettably, it also fails to acquirement and is substantially better than the therapeutic effect that medicine is applied alone in Sorafenib.

Extensive genome research shows averagely there is 30-40 kind gene mutation in each tumour.And solve the problems, such as this Maximum challenge is to distinguish " trunk " mutation and " branch " gene mutation.Once it is determined that key gene then can targeted target To corresponding signal path.And the discovery of oncogene driving for liver cancer at present is relatively limited, in addition to Sorafenib not yet at Function exploitation is directed to the targeted therapy scheme of other important genes.

Liver cancer molecular targeted therapy research in there are following characteristics: 1) be different from ALK fusion non-small cell lung cancer and The oncogenes such as the breast cancer of EGFR mutation rely on tumour, and the numerous wild type kinase advanced activations of liver cancer participate in regulating cell increasing jointly It grows, causes to inhibit single access that cannot reach good tumor inhibitory effect；2) presently found important mutated gene is as pressed down Oncogene TP53 and oncogene β-catenin etc. are difficult to be directly targeted, and the gene of these unconventionality expressions causes respective kinase living Change exception, and then passes through the malignant phenotype that downstream signaling pathway maintains tumour.Therefore, the molecular targeted therapy in liver cancer is still at present The research of kinase inhibitor is focused on, has clinically carried out a large amount of kinase inhibitor and has tested, such as targeting EGFR Erlotinib, rich carried out for Buddhist nun and the Lei Molu monoclonal antibody for targeting VEGFR etc. of Tivantinib, card for targeting c-Met face The research of three phases of bed, but the effect is unsatisfactory).Main cause includes: that the kinases targeted in 1) research may not be driving Key kinases but with property kinases, 2) due to liver cancer height heterogeneity inhibit single kinases cause kinases reprogramming it is compensatory Property activate other kinases, 3) molecule parting of liver cancer is unclear, not can determine that the target user of drug.

Currently, anti-liver cancer and anti-research most importantly excavates driving gene as therapy target.A large amount of genome point Analysis has obtained gene unconventionality expression information abundant, this driving candidate gene that can be targeted to scientist's searching brings huge Big chance and challenge.What gene analysis technique was more clear discloses the heterogeneity of liver cancer, can detect in average each tumour To 30-40 gene mutation.The gene of unconventionality expression is roughly divided into that and proliferation related to proliferation is two kinds uncorrelated, and wherein frequency is most High includes CTNNB1 (26.3%), TP53 (27%) and TERT955.8%) is mutated, CCND1 (7.2%) amplification etc., these Relationship between gene and the poor prognosis of liver cancer not yet proves, and tumor suppressor gene etc. is difficult to target.

In addition, research discovery liver cancer in a plurality of proliferation associated signal paths advanced activation, including VEGF/VEGFR, PDGFR, FGFR, PI3K/AKT/mTOR, c-Met, RAF/MAPK/ERK etc., but mutation of important kinases etc. is rarely found.

Sorafenib targets the kinases such as RAF/MAPK/MEK/ERK, FGFR, PDGFR and VEGFR, be listed it is unique One molecular targeted agents, however fail the survival state for really improving most of liver cancer patient, only by patient's overall survival phase Extend 2.8 months.The successful listing of Sorafenib, pushed a large amount of targeting VEGF/VEGFR, PDGFR, FGFR, c-Met, The inhibitor of the kinases such as EGFR, IGF1R, PI3K/AKT/mTOR carries out clinical research.

Have nearly 90 kinds of kinase inhibitors at present and has carried out clinical research for advanced liver cancer patient.It has completed and just In clinical research up to 450 remainders of development, kinase inhibitor accounts for nearly the 70% of clinical trial total amount.But regrettably by The reasons such as invalid and poor resistance caused by primary or acquired resistance still fail to obtain gratifying progress.

For the tumour that the oncogenes such as non-small cell lung cancer of ALK gene fusion and EGFR mutation rely on, block ALK or EGFR can reach good antitumor action.However liver cancer is different, clinically count out can for single kinase inhibitor It can be that multiple genes is made to participate in controlling its destiny due to the height heterogeneity of liver cancer.Sorafenib and Yi Weimo in clinical research Department's (mTOR inhibitors), Tarceva (EGFR inhibitor) drug combination do not obtain good result yet, may in this prompt liver cancer There are Key kinases group, whole collective effect regulates and controls liver cancer growth, needs design and rational therapeutic regimen, while blocking multiple keys The activity of kinases realizes the inhibiting effect to liver cancer.

Therefore, this field need to identify the core kinases group in liver cancer to determine the target spot of the molecular targeted therapy of liver cancer, And thus design novel therapeutic and Intervention Strategy.

Summary of the invention

The present invention is logical by the core kinases group and its corresponding signal that can be used as molecular targeted therapy target spot in identification liver cancer Road, and meet above-mentioned needs using the combination of specific kinase inhibitor to inhibit hepatoma cell proliferation and thus treat liver cancer.

In one aspect, the present invention provides pharmaceutical compositions, and it includes ALK kinase inhibitors, FGFR2 kinase inhibitor With EphA5 kinase inhibitor.The present invention also provides the methods of the liver cancer in treatment subject comprising Xiang Suoshu subject's application Pharmaceutical composition of the invention, it includes ALK kinase inhibitor, FGFR2 kinase inhibitor and EphA5 kinase inhibitors.The present invention ALK kinase inhibitor, FGFR2 kinase inhibitor and EphA5 kinase inhibitor are also provided in preparation for treating in subject Purposes in the drug of liver cancer.

On the other hand, the present invention provides pharmaceutical compositions, and it includes AKT signal pathway inhibitors, MEK signal path Inhibitor and p38 signal pathway inhibitor.The present invention also provides treatment subject in liver cancer method comprising to it is described by Examination person uses pharmaceutical composition of the invention, and it includes AKT signal pathway inhibitor, MEK signal pathway inhibitor and p38 signals Pathway inhibitor.The present invention also provides AKT signal pathway inhibitor, MEK signal pathway inhibitor and p38 signal pathway inhibitors Preparing the purposes in the drug for treating the liver cancer in subject.

In yet another aspect, the present invention provides the methods of the hypotype of the liver cancer in identification subject comprising measurement institute State the activity level of ALK kinases in subject, FGFR2 kinases and EphA5 kinases.The present invention also provides in treatment subject The method of liver cancer comprising the activity level of ALK kinases in the subject, FGFR2 kinases and EphA5 kinases is measured, and If the activity level of the ALK kinases, FGFR2 kinases and EphA5 kinases is above normal liver tissue, to the subject Apply pharmaceutical composition as described herein.The present invention also provides kits comprising for measure the ALK kinases in subject, The reagent of the activity level of FGFR2 kinases and EphA5 kinases.The present invention also provides pharmaceutical composition of the invention for treat by The purposes of liver cancer in examination person, wherein the movable water of ALK kinases, FGFR2 kinases and EphA5 kinases in the subject is average Higher than normal liver tissue.

In yet another aspect, the present invention provides the methods of the hypotype of the liver cancer in identification subject comprising measurement institute State the activity level of AKT signal path in subject, MEK signal path and p38 signal path.The present invention also provides treatment by The method of liver cancer in examination person comprising AKT signal path, MEK signal path and the p38 signal measured in the subject is logical The activity level on road, and if the activity level of the AKT signal path, MEK signal path and p38 signal path is above just Normal hepatic tissue then applies pharmaceutical composition as described herein to the subject.The present invention also provides kits comprising for surveying The reagent of the activity level of AKT signal path, MEK signal path and p38 signal path in amount subject.The kit It further include the specification for assessing the activity level of AKT signal path, MEK signal path and p38 signal path.

In yet another aspect, the present invention provides the methods of the liver cancer in treatment subject comprising Xiang Suoshu subject Apply Hsp90 inhibitor.The present invention also provides the purposes that Hsp90 inhibitor is used to prepare the drug for the treatment of liver cancer.The present invention is also Hsp90 inhibitor is provided and is preparing the purposes in the drug for inhibiting ALK kinases, FGFR2 kinases and EphA5 kinases.This hair The bright Hsp90 inhibitor that also provides is in preparing the drug for inhibiting AKT signal path, MEK signal path and p38 signal path Purposes.The present invention also provides pharmaceutical compositions, and it includes Hsp90 inhibitor and optional other therapeutic agent.

Detailed description of the invention

Numerous kinases advanced activations in Fig. 1 liver cancer cells.BEL-7402, SMMC-7721 of logarithmic growth phase, HepG2, Hep3B, SK-Hep-1, Huh-7, QGY-7703 and ZIP177 liver cancer cells are inoculated in respectively in 100mm culture dish, Degree to be fused is abandoned supernatant, is washed twice with the PBS of pre-cooling, by 1mL/2 × 10 up to 90%⁷The concentration of a cell is added The lysate that RaybioTech company kit provides cracks 30min on ice, 4 DEG C, 12,000 × g, is centrifuged 30min, takes It is detected for tyrosine phosphorylation chip clearly.With the activation level of fluorescence readings intensity and positive control ratio instruction kinases, R is utilized LISP program LISP draws thermal map.

Fig. 2 interferes single kinases not influence hepatoma cell proliferation.(A) ZIP177 or SMMC- of logarithmic growth phase 7721 cells are with 3 × 10³The density in/hole is inoculated in 96 orifice plates, overnight incubation, using RNAiMAX transfection reagent by NC and 17 The siRNA of kind kinases is transferred to cell respectively, acts on 72h, fixes 1h or more with the TCA of pre-cooling, passes through srb assay and detects cell increasing It grows；(B) logarithmic growth phase cell is with 2 × 10⁵The density in/hole is inoculated in 6 orifice plates, and overnight incubation is transfected using RNAiMAX The siRNA of NC and 17 kinds of kinases are transferred to cell by reagent, act on 72h, are collected protein sample and are detected for immunoblotting.

IC50 of Fig. 3 kinase inhibitor to liver cancer cells.ZIP177 the or SMMC-7721 cell of logarithmic growth phase with 3×10³The density in/hole is inoculated in 96 orifice plates, overnight incubation, and relative medicine is added and acts on 72h, fixes 1h with the TCA of pre-cooling More than, cell Proliferation is detected by srb assay.

Fig. 4 Ceritinib and Dasatinib drug combination inhibit hepatoma cell proliferation.The SMMC- of logarithmic growth phase 7721 or ZIP177 cell is with 3 × 10³The density in/hole is inoculated in 96 orifice plates, overnight incubation, and relative medicine is added and acts on 72h, 1h or more is fixed with the TCA of pre-cooling, cell Proliferation is detected by srb assay.

Fig. 5 Ceritinib, Dasatinib and AZD4547 drug combination inhibit hepatoma cell proliferation.Logarithmic growth phase SMMC-7721 or ZIP177 cell is with 3 × 10³The density in/hole is inoculated in 96 orifice plates, overnight incubation, and relative medicine is added and makees With 72h, 1h or more is fixed with the TCA of pre-cooling, cell Proliferation is detected by srb assay.

Tri- kinds of kinase inhibitor drug combinations of Fig. 6 inhibit ZIP177 or SMMC-7721 proliferation.Logarithmic growth phase SMMC-7721 or ZIP177 cell is with 3 × 10³The density in/hole is inoculated in 96 orifice plates, overnight incubation, and relative medicine is added and makees With 72h, 1h or more is fixed with the TCA of pre-cooling, cell Proliferation is detected by srb assay.

Tri- kinds of kinase inhibitor drug combinations of Fig. 7 inhibit a variety of hepatoma cell proliferations.

Tri- kinds of kinase inhibitor drug combinations of Fig. 8 induce cell apoptosis.(A) SMMC-7721 of logarithmic growth phase or ZIP177 cell is with 1 × 10⁵The density in/hole is inoculated in 12 orifice plates, overnight incubation, and drug effect 48h is added, and pancreatin digests, The bis- dyes of PI/Annexin-V, use Apoptosis by Flow Cytometry；(B) by cell with 2 × 10⁵The density in/hole is inoculated in 6 holes In plate, drug effect 48h is added in overnight incubation, is collected protein sample and is detected for immunoblotting.

Influence of the tri- kinds of kinase inhibitor drug combinations of Fig. 9 to the proliferation of normal cell.Logarithmic growth phase liver cell LO2 and QSG-7701 is inoculated in 96 orifice plates with 3000/ hole, gives Ceritinib (1 μM), AZD4547 after overnight incubation respectively (1 μM) and Dasatinib (1 μM) are applied alone and drug combination processing, acts on 72h, and srb assay detects cell Proliferation.

Figure 10 interferes EphA5 and Ceritinib and AZD4547 combination to inhibit hepatoma cell proliferation.Logarithmic growth phase SMMC-7721 or ZIP177 cell is with 3 × 10³The density in/hole is inoculated in 96 orifice plates, and overnight incubation is transfected using RNAiMAX NC and specified siRNA are transferred to cell by reagent, while Ceritinib and AZD4547 processing is added, and 72h are acted on, with pre-cooling TCA fixes 1h or more, detects cell Proliferation by srb assay.

Knock out LTK, FGFR2 and EphA5 does not influence hepatoma cell proliferation to Figure 11 simultaneously.The SMMC- of logarithmic growth phase 7721 or ZIP177 cell is with 3 × 10³The density in/hole is inoculated in 96 orifice plates, overnight incubation, utilizes RNAiMAX transfection reagent The siRNA of NC and LTK, FGFR2 and EphA5 are transferred to cell, 72h is acted on, fixes 1h or more with the TCA of pre-cooling, pass through SRB Method detects cell Proliferation.

Figure 12 knocks out ALK, FGFR2 and EphA5 Inhibit proliferaton and apoptosis-induced simultaneously.The SMMC- of logarithmic growth phase 7721 or ZIP177 cell is with 3 × 10³/ hole and 2 × 10⁵The density in/hole is inoculated in 96 orifice plates and 6 orifice plates, overnight incubation, into Row siRNA interference, acts on 72h.(A) 1h or more is fixed with the TCA of pre-cooling, cell Proliferation is detected by srb assay；(B) it uses RIPA lysate lytic cell is prepared sample and is detected for immunoblotting by BCA standard measure.

Downstream signaling pathway is lowered in Figure 13 Ceritinib, AZD4547 and Dasatinib combination.It takes in logarithmic growth phase SMMC-7721 or ZIP177 cell with 2 × 10⁵The density in/hole is inoculated in 6 orifice plates, overnight incubation, and Ceritinib (1 is added μM), (1 μM) effect 3h of Dasatinib (1 μM) and AZD4547, washed twice with the PBS of pre-cooling, be added 150 1 × SDS of μ l split Solution liquid prepares protein sample, detects for immunoblotting.

Figure 14 inhibits AKT, ERK and p38 access to inhibit cell Proliferation simultaneously.The SMMC-7721 of logarithmic growth phase or ZIP177 cell is respectively with 3 × 10³/ hole and 2 × 10⁵The density in/hole is inoculated in 96 orifice plates and 6 orifice plates, overnight incubation, is added Inhibitor processing, acts on 72h.Dosage is respectively MK2206 (1 μM), Trametinib (1 μM) and Skepinone-L (10 μM).(A) 1h or more is fixed with the TCA of pre-cooling, cell Proliferation is detected by srb assay；(B) RIPA lysate lytic cell is used, is led to BCA standard measure is crossed, sample is prepared and is detected for immunoblotting.

Figure 15 inhibits AKT, ERK and p38 access to induce cell apoptosis simultaneously.The SMMC-7721 of logarithmic growth phase or ZIP177 cell is with 2 × 10⁵The density in/hole is inoculated in 6 orifice plates, overnight incubation, and inhibitor processing is added, acts on 3h or 48h, Signal path is detected by immunoblotting.

Tri- kinds of kinases high level activations in hepatoma cell strain of Figure 16.Take Hep3B, HepG2, QGY- in logarithmic phase 7703, SK-Hep-1, ZIP177, SMMC-7721, BEL-7402, Huh-7 or QSG-7701 are inoculated in 6 orifice plates, to be fused Degree reaches 90%, is washed twice with the PBS of pre-cooling, with RIPA lysate lytic cell, carries out protein quantification, preparation by BCA method Sample is used for western blot analysis.

Activity of the tri- kinds of kinases of Figure 17 in liver cancer tissue is significantly higher than in liver normal tissue.It takes and freezes in liquid nitrogen The normal liver tissue of liver cancer and pairing carries out protein quantification by BCA method with RIPA lysate lytic cell, prepares sample use In western blot analysis.(A) it is opposite that p-ALK, p-FGFR2 and p-EphA5 in 24 pairs of liver cancer and normal liver tissue have been counted In the expression quantity of β-Actin；(B) representative immunoblotting testing result.

Activation level of the tri- kinds of kinases of Figure 18 in liver cancer sample has differences.Pass through three kinds of kinases of immunohistochemical analysis Activation in different hepatocarcinoma patient tissues.

Tri- kinds of kinases of Figure 19 collective height in about 13% liver cancer patient activates.Pass through SPSS Statistic software Analyze the immunohistochemical staining intensity of three kinds of kinases in organization chip.

The correlation analysis of the prognosis of tri- kinds of kinases of Figure 20 and liver cancer patient.

Tri- kinds of kinase inhibitor drug combinations of Figure 21 inhibit the growth of SMMC-7721 Nude Mice.It inoculates SMMC-7721 cell, 5 × 10⁶/ mouse is about 100 mm to knurl product³It is grouped at random according to knurl is long-pending with weight, experimental group Three kinds for giving Dasatinib 25mg/kg, Ceritinib 25mg/kg and AZD4547 12.5mg/kg and same dose respectively Combination therapies, control group give equivalent solvent, oral administration, once a day successive administration 2 weeks.Measure the swollen of each time point Knurl product is to evaluate antitumor activity.

Tri- kinds of kinase inhibitor drug combinations of Figure 22 inhibit downstream signaling pathway.It takes appropriate tumor tissues to be ground, uses RIPA lysate cracks 30min on ice, carries out protein quantification by BCA method, detects signal path by immunoblotting.

The immunohistochemical staining of tri- kinds of tyrosine phosphorylation levels of Figure 23.Experiment terminates to take out tumour, freezes in -80 DEG C, Frozen section is prepared, immunohistochemical staining is carried out.Phosphor-ALK (GTX16377, Genetex), 1:50；phosphor- FGFR2 (ab111124, Abcam), 1:50；Phosphor-EphA5 antibody (GTX17348, Genetex), 1:50；Ki-67 Antibody (ab16667, Abcam), 1:100；CD34 antibody (Ab8158, Abcam), 1:100.

Figure 24 drug combination significantly affects mouse weight.Subcutaneous vaccination SMMC-7721 cell, 5 × 10⁶/ mouse, to Knurl product is about 100mm³Long-pending according to knurl and weight is grouped at random, experimental group gives that Dasatinib 25mg/kg, color are auspicious to be replaced respectively Three combination therapies of Buddhist nun 25mg/kg and AZD4547 12.5mg/kg and same dose, it is molten that control group gives equivalent Agent is administered orally, once a day successive administration 2 weeks.The mouse weight at each time point is measured to evaluate drug toxicity.

Figure 25 .Hsp90 and ALK, FGFR2 and EphA5 interact.(A) ZIP177 or SMMC- for taking logarithmic phase to grow 7721 are inoculated in 100mm culture dish, and degree to be fused reaches 90%, are washed twice with pre-cooling PBS, and 600 μ l lysates are added in ice Upper cracking 30min, collects lysate, and 12,000 × g, is centrifuged 30min by 4 DEG C.50 μ l are taken to prepare sample as input, remaining sample Product are separately added into EphA5, ALK, FGFR2 antibody, and 4 DEG C of shaking tables are stayed overnight, and 25 μ l albumin As/G pearl is added, and 4 DEG C of shaking tables are incubated for 4h, 2000 × rpm is centrifuged 6min, elutes 6 times, and 30 μ l 1 × SDS lysates are added and prepare sample, examine for immunoblotting It surveys；(B) ibid Hsp90 antibody incubation is added in operation, detects protein-interacting.

Figure 26 .PU-H71 pearl pulls down ALK, FGFR2 and EphA5.The ZIP177 or SMMC-7721 for taking logarithmic phase to grow connect For kind in 100mm culture dish, degree to be fused reaches 90%, is washed twice with pre-cooling PBS, and 600 μ l lysates are added and crack on ice 30min, collects lysate, and 12,000 × g, is centrifuged 30min by 4 DEG C.50 μ l are taken to prepare sample as input, remaining sample difference 80 μ l PU-H71 pearls or control pearl is added, 4 DEG C of shaking tables are stayed overnight, and 2000 × rpm is centrifuged 6min, elutes 6 times, and 30 μ l are added 1 × SDS lysate prepares sample, detects for immunoblotting.

Figure 27 .Hsp90 inhibitor inhibition Hsp90 is combined with each other with ALK, FGFR2 or EphA5's.(A) logarithmic growth phase Liver cancer cells be inoculated in 100mm culture dish, degree to be fused reaches 90%, changes serum-free medium, is added 1 μM Ganetespib acts on 4h, is washed twice with pre-cooling PBS, with the NP-40 lysate containing protease inhibitors and inhibitors of phosphatases 30min is cracked on ice, collects lysate, and 12000 × g, is centrifuged 30min by 4 DEG C.50 μ l are taken to prepare sample as input, residue Hsp90 antibody or IgG is added in sample, and 4 DEG C of shaking tables are stayed overnight, and is added 25 μ l albumin As/G pearl, and 4 DEG C of shaking tables are incubated for 4h, 2000 × Rpm, 6min centrifugation, elute 3 times, and 30 μ l 1 × SDS lysates are added and prepare sample, detect for immunoblotting；(B) Operation is same as above, and ALK, FGFR2 or EphA5 antibody mediated immunity is added and precipitates Hsp90.

Figure 28 .Ganetespib influences ALK, FGFR2 and EphA5 protein stability.(A) SMMC- of logarithmic growth phase 7721 or ZIP177 cell is with 2 × 10⁵The density in/hole is inoculated in 6 orifice plates, overnight incubation, gives 0.1 μM of Ganetespib 6h, 12h, for 24 hours or 48h is acted on, 1 × SDS lysate is added and prepares sample, is detected for immunoblotting；(B) logarithm is taken SMMC-7721 the or ZIP177 cell in growth period is with 2 × 10⁵The density in/hole is inoculated in 6 orifice plates, and overnight incubation gives 0.1 For 24 hours, Trizol one-step method extracts total serum IgE for μM Ganetespib effect, and Takara reverse transcription reagent box synthesizes cDNA, utilizes RealTime PCR detects mRNA level in-site expression.

Figure 29 .MG-132 reverses degradation of the Ganetespib to three kinds of kinases.The SMMC-7721 cell of logarithmic growth phase With 2 × 10⁵The density in/hole is inoculated in 6 orifice plates, overnight incubation, and 10 μM of MG132 effect 6h are added, are washed twice with culture solution, Fresh medium is added, while Ganetespib effect is added for 24 hours, 1 × SDS lysate is added and prepares sample, is used for protein Blotting detection.

Expression of Figure 30 .Hsp90 in liver cancer tissue is higher than normal tissue.Western blot detects 24 pairs of freezing liver cancer The expression of Hsp90 in tissue and normal tissue is compareed by internal reference of Actin.

The expression of Figure 31 .Hsp90 is positively correlated with the activation levels of three kinds of kinases.It is tested and is examined with immunohistochemistry (IHC) The expression for surveying the Hsp90 in 250 liver cancer patients, determine high hsp90 individual activate in three kinds of kinases collective heights, Yi Zhonghuo Ratio in two kinds of kinases advanced activations and the lower group of three kinds of kinase activation degree.Note, " high Hsp90 expression " is opposite In the median of whole samples.

The IC50 of Figure 32 .Hsp90 inhibitor and Sorafenib to liver cancer cells.Take a variety of liver cancer in logarithmic growth phase Cell strain is with 3 × 10³The density in/hole is inoculated in 96 orifice plates, overnight incubation, and drug effect 72h is added, solid with the TCA of pre-cooling Determine 1h or more, cell Proliferation is detected by SRB method.

IC50 of Figure 33 .Hsp90 inhibitor to normal liver cell.Logarithmic growth phase liver cell LO2 and QSG-7701 with 3000/ hole is inoculated in 96 orifice plates, and various concentration Hsp90 inhibitor is added after overnight incubation, is detected after acting on 72h with srb assay Cell Proliferation.

Figure 34 inhibits Hsp90 activity to can inhibit hepatoma cell proliferation.Take ZIP177 or SMMC- in logarithmic growth phase 7721 cells are with 3 × 10³The density in/hole is inoculated in 96 orifice plates, overnight incubation.(A) using RNAiMAX reagent be transferred to NC and Hsp90siRNA segment acts on 72h；(B) (0.01 μM, 0.1 μM, 1 μM) effect 72h of DMSO and Ganetespib is added.With pre- The fixed 1h or more of cold TCA, detects cell Proliferation by srb assay.

Figure 35 inhibits Hsp90 activity inducement Apoptosis.SMMC-7721 the or ZIP177 cell of logarithmic growth phase with 1×10⁵The density in/hole is inoculated in 12 orifice plates, overnight incubation, and (A) is interfered NC and Hsp90 using RNAiMAX transfection reagent Segment is transferred to cell, acts on 72h；(B) (0.01 μM, 0.1 μM, 1 μM) effect 48h of Ganetespib of various dose is added.Pancreas Enzymic digestion, the bis- dyes of PI/AnnexinV, utilizes flow cytomery Apoptosis.

Figure 36 inhibits Hsp90 activity down-regulation ALK, FGFR2 and EphA5 protein expression and downstream signaling pathway.Take logarithm raw Long-term SMMC-7721 or ZIP177 cell is with 1 × 10⁵The density in/hole is inoculated in 6 orifice plates, overnight incubation, and (A) is utilized RNAiMAX reagent is transferred to NC and Hsp90siRNA segment, and (B) is added Ganetespib (0.01 μM, 0.1 μM, 1 μM) and makees respectively With for 24 hours and 48h.1 × SDS lysate is added and prepares sample, is detected for immunoblotting.

Influence of Figure 37 .Ganetespib to other kinases.ZIP177 the and SMMC-7721 cell of logarithmic growth phase With 2 × 10⁶It is inoculated in 6 orifice plates, the Ganetespib effect that various concentration is added after overnight incubation for 24 hours and 48h, collects albumen Sample is detected for protein imprinting method.

Figure 38 .Ganetespib inhibits Nude Mice growth.(A) subcutaneous vaccination SMMC-7721 cell, 5 × 10⁶/ Mouse is about 100mm to knurl product³It is grouped at random according to knurl is long-pending with weight, experimental group gives Ganetespib respectively 10mg/kg and 30mg/kg, control group give equivalent solvent, intraperitoneal injection, three times a week successive administration 4 weeks.When measuring each Between the gross tumor volume put to evaluate antitumor activity；(B) corresponding time point mouse weight variation is weighed, to evaluate drug toxicity.

Influence of the Hsp90 inhibitor to signal path in Figure 39 In vivo model.It takes appropriate tumor tissues to be ground, uses RIPA lysate cracks 30min on ice, carries out protein quantification by BCA method, detects signal path by immunoblotting.

Tri- kinds of kinase inhibitor drug combinations of Figure 40 inhibit the growth of liver cancer PDX.It inoculates and establishes in mouse LI0752 liver cancer PDX model, is about 100-150mm in tumor size³When mouse is randomly divided into 5 groups, give solvent pair respectively According to, Ceritinib (25mg/kg), AZD4547 (12.5mg/kg), the joint use of Dasatinib (25mg/kg) and same dose Medicine successive administration 21 days, measures tumor size once a day three times a week.

Influence of the tri- kinds of kinase inhibitors of Figure 41 in liver cancer PDX model to three kinds of kinases and downstream signaling pathway.Small It is inoculated in mouse and establishes LI0752 liver cancer PDX model, be about 100-150mm in tumor size³When mouse is randomly divided into 5 Group, gives solvent control respectively, Ceritinib (25mg/kg), AZD4547 (12.5mg/kg), Dasatinib (25mg/kg) and The drug combination of same dose, once a day, successive administration 21 days, experiment terminated to crack tumor tissue, protein imprinting method with RIPA Detection.

The growth of Figure 42 .Ganetespib inhibition liver cancer PDX.It is inoculated in mouse and establishes LI0752 liver cancer PDX mould Type is about 100-150mm in tumor size³When mouse is randomly divided into 3 groups, give solvent control, Ganetespib respectively (30mg/kg) and Ganetespib (50mg/kg) processing, are administered three times a week and measure tumor size, and successive administration three weeks.

Influence of Figure 43 .Ganetespib to three kinds of kinases and downstream signaling pathway in liver cancer PDX.The notch graft in mouse Kind establishes LI0752 liver cancer PDX model, is about 100-150mm in tumor size³When mouse is randomly divided into 3 groups, give respectively Solvent control, Ganetespib (30mg/kg) and Ganetespib (50mg/kg), are administered three times a week, and successive administration three weeks, Experiment terminates to crack tumor tissue with RIPA, protein imprinting method detection.

Influence of Figure 44 .Ganetespib to other kinases in liver cancer PDX.It is inoculated in mouse and establishes LI0752 Liver cancer PDX model is about 100-150mm in tumor size³When mouse is randomly divided into 3 groups, give solvent control respectively, Ganetespib (30mg/kg) and Ganetespib (50mg/kg), is administered three times a week, and successive administration three weeks, experiment terminated Tumor tissue, protein imprinting method detection are cracked with RIPA.

The activation of Figure 45 .ALK, FGFR2 and EphA5 in liver cancer PDX array.

Genetic background (the Affymetrix Genome-Wide Human of the common overactivation kinases of Figure 46 .17 kind Mapping SNP6.0Array)。

Figure 47 aggregated model figure.

Specific embodiment

The present invention is logical by the core kinases group and its corresponding signal that can be used as molecular targeted therapy target spot in identification liver cancer Road, and the combination for applying specific kinase inhibitor meet above-mentioned needs to inhibit hepatoma cell proliferation and thus treat liver cancer.

Inventor is surprisingly found out that the Key kinases group in liver cancer: ALK, FGFR2 and EphA5 and its respective channels The potential drug target spot of molecular targeted therapy as liver cancer, and thus design intervention and the therapeutic strategy of liver cancer.Particularly, it sends out Bright people is surprisingly found out that tri- kinds of Ceritinib (Ceritinib), Dasatinib (Dasatinib) and AZD4547 kinases suppressions The drug combination of the inhibitor of preparation and/or its corresponding signal access significantly inhibits hepatoma cell proliferation and/or transplanted human hepatocellular carcinoma Growth.Therefore, the present invention provides the pharmaceutical composition of novel therapeutic liver cancer and methods, increase with outstanding inhibition liver cancer cells The effect of the apoptosis of the cancer cell of the effect and/or induction liver cancer grown.

Specifically, inventor has studied the activation of the kinases in liver cancer in cellular level.It was found that liver cancer has height heterogeneous Property.Numerous kinases high level activation in liver cancer cells, and it is different in different cells.It is interfered using inhibitor and siRNA Identify the Key kinases group of regulation hepatoma cell proliferation: ALK, FGFR2 and EphA5.Inhibit the activity of these three kinases simultaneously Hepatoma cell proliferation can be significantly effectively inhibited, and gained inhibitory effect is significantly better than and inhibits single kinases or two kinds of kinases The inhibitory effect of acquisition.Inhibition mainly passes through apoptosis-induced realization.

Therefore, in one aspect, the present invention provides pharmaceutical compositions, and it includes ALK kinase inhibitor, FGFR2 kinases to press down Preparation and EphA5 kinase inhibitor.The present invention also provides the methods of the liver cancer in treatment subject comprising Xiang Suoshu subject Pharmaceutical composition of the invention is applied, it includes ALK kinase inhibitor, FGFR2 kinase inhibitor and EphA5 kinase inhibitors.This Invention also provides ALK kinase inhibitor, FGFR2 kinase inhibitor and EphA5 kinase inhibitor in preparation for treating subject In liver cancer drug in purposes.

Further, inventor identify the downstream signaling pathway to play a role be mainly MAPK/ERK, PI3K/AKT and P38 signal path.Block tri- signal paths of MAPK/ERK, PI3K/AKT and p38 that can significantly effectively inhibit liver cancer simultaneously Cell Proliferation simultaneously induces cell apoptosis.

Therefore, on the other hand, the present invention provides pharmaceutical compositions, and it includes AKT signal pathway inhibitor, MEK to believe Number pathway inhibitor and p38 signal pathway inhibitor.The present invention also provides the methods of the liver cancer in treatment subject comprising to The subject applies pharmaceutical composition of the invention, and it includes AKT signal pathway inhibitor, MEK signal pathway inhibitor and p38 Signal pathway inhibitor.The present invention also provides AKT signal pathway inhibitor, MEK signal pathway inhibitor and p38 signal paths Inhibitor is preparing the purposes in the drug for treating the liver cancer in subject.

In addition, western blot analysis finds that activity of these three kinases in liver cancer tissue is significantly higher than the group by cancer In knitting.The organization chip ImmunohistochemistryResults Results of liver cancer patient confirm that these three kinases collective height in 13% patient activates. Moreover, Kaplan-Meier Plotter analysis result prompts the poor prognosis of the common activation and liver cancer patient of these three kinases It is closely related, and the being not significantly related to property of prognosis of the activation degree of single kinases and liver cancer patient.

Therefore, in yet another aspect, the present invention provides the methods of the hypotype of the liver cancer in identification subject comprising surveys Measure the activity level of ALK kinases in the subject, FGFR2 kinases and EphA5 kinases.It is tested the present invention also provides treating The method of liver cancer in person comprising measure the movable water of ALK kinases in the subject, FGFR2 kinases and EphA5 kinases It is flat, and if the activity level of the ALK kinases, FGFR2 kinases and EphA5 kinases is above normal liver tissue, Xiang Suoshu Subject applies pharmaceutical composition as described herein.The present invention also provides kits comprising swashs for measuring the ALK in subject The reagent of the activity level of enzyme, FGFR2 kinases and EphA5 kinases.The present invention also provides pharmaceutical compositions of the invention for treating The purposes of liver cancer in subject, wherein the movable water of ALK kinases, FGFR2 kinases and EphA5 kinases in the subject Averagely it is higher than normal liver tissue.

Further, inventor has found that ALK kinases, FGFR2 kinases and EphA5 kinases are Hsp90 (heat shock protein 90s) Client protein.By using Hsp90 inhibitor such as Ganetespib, the expression of ALK, FGFR2 and EphA5 albumen is significant It lowers.Therefore, ALK, FGFR2 and EphA5 can be by blocking Hsp90 activity to be inhibited simultaneously.Hsp90 inhibitor is significant Inhibit hepatoma cell proliferation.

Therefore, in yet another aspect, the present invention provides treatment subject in liver cancer method comprising to it is described by Examination person applies Hsp90 inhibitor.The present invention also provides the purposes that Hsp90 inhibitor is used to prepare the drug for the treatment of liver cancer.This hair It is bright that the method for the ALK kinases, FGFR2 kinases and EphA5 kinases that inhibit in subject is also provided comprising Xiang Suoshu subject Apply Hsp90 inhibitor.The present invention also provides Hsp90 inhibitor preparation for inhibit ALK kinases, FGFR2 kinases and Purposes in the drug of EphA5 kinases.The present invention also provides inhibit subject in AKT signal path, MEK signal path and The method of p38 signal path comprising Xiang Suoshu subject applies Hsp90 inhibitor.The present invention also provides Hsp90 inhibitor to exist Prepare the purposes in the drug for inhibiting AKT signal path, MEK signal path and p38 signal path.The present invention also provides medicines Object combination, it includes Hsp90 inhibitor and optional other therapeutic agent.

The pharmaceutical composition of I.ALK/FGFR2/EphA5 kinase inhibitor

As described above, present invention discover that ALK kinase inhibitor, FGFR2 kinase inhibitor and EphA5 kinase inhibitor Combined administration significantly effectively inhibits hepatoma cell proliferation, and thus treats liver cancer.

Therefore, the present invention provides pharmaceutical compositions, and it includes ALK kinase inhibitor, FGFR2 kinase inhibitor and EphA5 Kinase inhibitor.

As used herein, term " ALK kinases " can be used interchangeably herein with " ALK ", be that anaplastic lymphoma swashs Enzyme (Anaplastic lymphoma kinase, ALK), also referred to as alk tyrosine kinase receptor or CD246, in people by The enzyme of ALK gene coding.ALK plays an important role in brain development, and plays it to the specific neuron in nervous system Effect.ALK shows that greatly sequence is similar with LTK (leukocyte tyrosine kinase, white blood cell tyrosine kinase) Degree.

As used herein, term " ALK kinase inhibitor " can be used interchangeably herein with " ALK inhibitor ", refer to There is the reagent of inhibition effect to ALK kinases.ALK inhibitor may be used as acting on such as EML4-ALK of the variant with ALK The potential anticancer drug of the tumour of transposition.The ALK inhibitor having been approved by includes, for example, gram azoles replaces Buddhist nun (Crizotinib) (Xalkori) and Ceritinib (Zykadia), ratified by FDA for treating non-small cell lung cancer；Ai Le replaces Buddhist nun (Alectinib) (Alecensa) (Chugai submits NDA in Japan), is ratified by FDA in December, 2015.Currently The other ALK kinase inhibitor for carrying out or will carrying out clinical test includes, for example, Dalantercept, ACE-041 (Acceleron)；Brigatinib (AP26113) (Ariad) (it is also EGFR inhibitor)；Entrectinib (Nerviano)；PF-06463922(Pfizer)；TSR-011 (Tesaro)；CEP-37440(Teva)；X-396 (Xcovery)。

Being suitable for the invention ALK kinase inhibitor can be selected from, for example, Ceritinib, gram azoles replace Buddhist nun (Crizotinib, PF-02341066), TAE684 (NVP-TAE684), Alectinib (CH5424802), ALK-IN-1, Brigatinib (AP26113), GSK1838705A, AZD3463, ASP3026 and Lorlatinib (PF-6463922).Ability Other ALK kinase inhibitors known to domain can also be used for the present invention.In one embodiment, ALK kinase inhibitor is that color is auspicious For Buddhist nun (Ceritinib).

Ceritinib (trade name Zykadia) is the prescription medicine for treating non-small cell lung cancer, is developed by Novartis.Color is auspicious For Buddhist nun be ALK selectivity and effective inhibitor.In normal physiological, ALK makees in the development and function of neural system tissue It is functioned for committed step.However, chromosome translocation and fusion generate the oncogenic form of ALK, it is related to non-small cell lung cancer Development.Therefore Ceritinib plays the role of inhibiting the mutant enzyme and stops cell Proliferation, be finally stopped cancer development.For Non-small cell lung cancer, Ceritinib are 150mg capsule forms, and recommended dose is 750mg once a day.

As used herein, term " FGFR2 kinases " can be used interchangeably herein with " FGFR2 ", be fibroblast Growth factor acceptor 2 (Fibroblast growth factor receptor 2) kinases.FGFR2, also referred to as CD332, be By the protein for the FGFR2 gene coding being located on chromosome 10 in people.FGFR2 embryonic development and tissue repair (especially Bone and blood vessel) in play a significant role.Similar with other members of FGFR family, FGFR2 is by combining its ligand and dimerization (acceptor pair) and issue signal, lead to the cascade reaction of signal in tyrosine kinase domain active cell.In molecular water On flat, the division of these signal mediated cells, growth and differentiation.The mutation of FGFR2 is related to numerous medical symptoms, including bone development It is abnormal, for example, craniosynostosis syndrome and cancer, such as breast cancer.

As used herein, term " FGFR2 kinase inhibitor " can be used interchangeably herein with " FGFR2 inhibitor ", Refer to the reagent that there is inhibition effect to FGFR2 kinases.

Being suitable for the invention FGFR2 kinase inhibitor can be selected from, for example, AZD4547, E-3810, LY2874455, BGJ398 (NVP-BGJ398), Nintedanib (Nintedanib, BIBF1120), CH5183284 (Debio-1347), S49076, FIIN-2, MK-2461, FPA144 and Alofanib.Other FGFR2 kinase inhibitors known in the art also can be used In the present invention.In one embodiment, FGFR2 kinase inhibitor is AZD4547.

AZD4547 is the tyrosine kinase inhibitor for targeting FGFR1,2,3.It is not intended to be bound by theory, the present invention is It was found that FGFR2 kinases is one of the overactive kinases in the various kinds of cell strain of liver cancer, therefore it is believed that AZD4547 in the present invention Middle targeting FGFR2.

As used herein, term " EphA5 kinases " can be used interchangeably herein with " EphA5 ", be ephrins A Receptor 5 (ephrin type-A receptor 5) kinases.Eph receptor be in response in Eph receptor-interaction protein (ephrins, Ephrin) in conjunction with and activate one group of receptor.Eph forms sub- known to the maximum of receptor tyrosine kinase (RTK) Race.Eph/ ephrins signal transduction is related to the regulation of a large amount of critical process of embryonic development, including axon guidance, organizes selvedge Boundary is formed, cell migration, and division.In addition, confirmation Eph/ ephrins signal transduction is a variety of during maintaining adult recently Process (including long term potentiation, vascularization, stem cell differentiation and cancer) aspect plays an important role.

As used herein, term " EphA5 kinase inhibitor " can be used interchangeably herein with " EphA5 inhibitor ", Refer to the reagent that there is inhibition effect to EphA5 kinases.

Being suitable for the invention EphA5 kinase inhibitor can be selected from, for example, Dasatinib, staurosporin (Staurosporine), PP2 and AG1478.Other EphA5 kinase inhibitors known in the art can also be used for the present invention.? In one embodiment, EphA5 kinase inhibitor is Dasatinib.

Dasatinib is produced by Bristol Myers Squibb and with trade name Sprycel sale, is Bcr-Abl (" Philadelphia dyeing Body, Philadelphia chromosome ") and Src family tyrosine kinase inhibitor, approval is for chronic myelogenous leukemia (CLL) and the first-line treatment of Philadelphia Chromosome Positive acute lymphatic leukemia (Ph+ALL).The main target of Dasatinib Point is BCR/Abl, Scr, c-kit, ephrins receptor and various other tyrosine kinase.In the present invention, it was discovered that being replaced up to sand The crucial target spot of Buddhist nun is EphA5.

Inventor has found Ceritinib, and the combined administration of these three specific kinase inhibitors of AZD4547 and Dasatinib is aobvious Work effectively inhibits hepatoma cell proliferation, and determines Ceritinib, and the crucial target spot of AZD4547 and Dasatinib is respectively ALK, FGFR2 and EphA5.Therefore, ALK kinase inhibitor, FGFR2 kinase inhibitor and EphA5 kinase inhibitor can be joined Application is closed to inhibit hepatoma cell proliferation, and thus treats liver cancer.In some embodiments, pharmaceutical composition as described herein can To include one or more ALK kinase inhibitors, one or more FGFR2 kinase inhibitors and one or more EphA5 kinases Inhibitor.As used herein, term " a variety of " can be more than one, for example, two kinds, three kinds, four kinds, five kinds or more. In a preferred embodiment, pharmaceutical composition as described herein includes Ceritinib, AZD4547 and Dasatinib.

In some embodiments, pharmaceutical composition as described herein swashs comprising a effective amount of ALK kinase inhibitor, FGFR2 Enzyme inhibitor and EphA5 kinase inhibitor.As used herein, term " effective quantity " refers to the group in pharmaceutical composition as described herein Divide the amount effectively treated of realizing as a whole, such as effectively inhibits the amount of cancer cell multiplication.In some embodiments, this paper institute The pharmaceutical composition stated is applied to subject with effective quantity.

In some respects, pharmaceutical composition as described herein is applied by the dosage based on subject weight.In some embodiment party In formula, pharmaceutical composition as described herein includes ALK kinase inhibitor, the FGFR2 kinase inhibitor of the amount based on subject weight With EphA5 kinase inhibitor.

In some embodiments, the ALK kinase inhibitor based on subject weight, in pharmaceutical composition as described herein Amount about 1.0 to about 50.0mg/kg or higher, preferably from about 5.0 to 40.0mg/kg, more preferably from about 10.0 to 30.0mg/kg, In most preferably from about 12.5 to 25.0mg/kg range.In some embodiments, based on subject weight, medicine as described herein The amount of ALK kinase inhibitor in object combination is about 1.0,1.5,2.0,2.5,3.0,3.5,4.0,4.5,5.0,5.5,6.0, 6.5、7.0、7.5、8.0、8.5、9.0、9.5、10.0、10.5、 11.0、11.5、12.0、12.5、13.0、13.5、14.0、 14.5、15.0、15.5、16.0、 16.5、17.0、17.5、18.0、18.5、19.0、19.5、20.0、20.5、21.0、21.5、 22.0、22.5、23.0、23.5、24.0、24.5、25.0、25.5、26.0、26.5、27.0、 27.5、28.0、28.5、29.0、 29.5、30.0、30.5、31.0、31.5、32.0、32.5、 33.0、33.5、34.0、34.5、35.0、35.5、36.0、36.5、 37.0、37.5、38.0、 38.5、39.0、39.5、40.0、40.5、41.0、41.5、42.0、42.5、43.0、43.5、 44.0、 44.5,45.0,45.5,46.0,46.5,47.0,47.5,48.0,48.5,49.0,49.5,50.0mg/kg or higher, or Range that any aforementioned value is constituted as endpoint or in which arbitrary value, for example, about 1.1 to 1.4mg/kg etc. or about 1.1,1.2, 1.3,1.4mg/kg etc..In a preferred embodiment, the ALK based on subject weight, in pharmaceutical composition as described herein The amount of kinase inhibitor is about 12.5 or 25mg/kg, preferably from about 25mg/kg.In a preferred embodiment, by subject's weight Meter, the ALK kinase inhibitor amount of being in pharmaceutical composition as described herein is about 12.5 or 25mg/kg, preferably from about 25mg/kg Ceritinib.

In some embodiments, the FGFR2 kinase inhibition based on subject weight, in pharmaceutical composition as described herein The amount of agent is about 1.0 to about 50.0mg/kg or higher, preferably from about 5.0 to 40.0mg/kg, more preferably from about 10.0 to 30.0mg/ Kg, most preferably from about in the range of 12.5 to 25.0 mg/kg.In some embodiments, described herein based on subject weight Pharmaceutical composition in FGFR2 kinase inhibitor amount be about 1.0,1.5,2.0,2.5,3.0,3.5,4.0,4.5,5.0, 5.5、6.0、6.5、7.0、7.5、8.0、8.5、9.0、9.5、 10.0、10.5、11.0、11.5、12.0、12.5、13.0、13.5、 14.0、14.5、15.0、 15.5、16.0、16.5、17.0、17.5、18.0、18.5、19.0、19.5、20.0、20.5、 21.0、 21.5、22.0、22.5、23.0、23.5、24.0、24.5、25.0、25.5、26.0、26.5、27.0、27.5、28.0、28.5、 29.0、29.5、30.0、30.5、31.0、31.5、 32.0、32.5、33.0、33.5、34.0、34.5、35.0、35.5、36.0、 36.5、37.0、 37.5、38.0、38.5、39.0、39.5、40.0、40.5、41.0、41.5、42.0、42.5、 43.0、43.5、 44.0,44.5,45.0,45.5,46.0,46.5,47.0,47.5,48.0,48.5,49.0,49.5,50.0mg/kg or higher, Or the range that constitutes as endpoint of any aforementioned value or in which arbitrary value, for example, about 1.1 to 1.4mg/kg etc. or about 1.1, 1.2,1.3,1.4mg/kg etc..In a preferred embodiment, based on subject weight, in pharmaceutical composition as described herein The amount of FGFR2 kinase inhibitor be about 12.5 or 25mg/kg, preferably from about 12.5mg/kg.In a preferred embodiment, Based on subject weight, the FGFR2 kinase inhibitor amount of being in pharmaceutical composition as described herein is about 12.5 or 25mg/kg, excellent Select the AZD4547 of about 12.5mg/kg.

In some embodiments, the EphA5 kinase inhibition based on subject weight, in pharmaceutical composition as described herein The amount of agent is about 1.0 to about 50.0mg/kg or higher, preferably from about 5.0 to 40.0mg/kg, more preferably from about 10.0 to 30.0mg/ Kg, most preferably from about in the range of 12.5 to 25.0 mg/kg.In some embodiments, described herein based on subject weight Pharmaceutical composition in EphA5 kinase inhibitor amount be about 1.0,1.5,2.0,2.5,3.0,3.5,4.0,4.5,5.0, 5.5、6.0、6.5、7.0、7.5、8.0、8.5、9.0、9.5、 10.0、10.5、11.0、11.5、12.0、12.5、13.0、13.5、 14.0、14.5、15.0、 15.5、16.0、16.5、17.0、17.5、18.0、18.5、19.0、19.5、20.0、20.5、 21.0、 21.5、22.0、22.5、23.0、23.5、24.0、24.5、25.0、25.5、26.0、 26.5、27.0、27.5、28.0、28.5、 29.0、29.5、30.0、30.5、31.0、31.5、 32.0、32.5、33.0、33.5、34.0、34.5、35.0、35.5、36.0、 36.5、37.0、 37.5、38.0、38.5、39.0、39.5、40.0、40.5、41.0、41.5、42.0、42.5、 43.0、43.5、 44.0,44.5,45.0,45.5,46.0,46.5,47.0,47.5,48.0,48.5,49.0,49.5,50.0mg/kg or higher, Or the range that constitutes as endpoint of any aforementioned value or in which arbitrary value, for example, about 1.1 to 1.4mg/kg etc. or about 1.1, 1.2,1.3,1.4mg/kg etc..In a preferred embodiment, based on subject weight, in pharmaceutical composition as described herein The amount of EphA5 kinase inhibitor be about 12.5 or 25mg/kg, preferably from about 25mg/kg.In a preferred embodiment, it presses Subject weight's meter, the EphA5 kinase inhibitor amount of being in pharmaceutical composition as described herein are about 12.5 or 25mg/kg, preferably The Dasatinib of about 25mg/kg.

In some embodiments, pharmaceutical composition as described herein includes the about 12.5 or 25mg/kg based on subject weight ALK kinase inhibitor, the EphA5 kinases of the FGFR2 kinase inhibitor of about 12.5 or 25mg/kg and about 12.5 or 25mg/kg Inhibitor.In some embodiments, pharmaceutical composition as described herein includes about 12.5 or 25 mg/kg based on subject weight Ceritinib, the Dasatinib of the AZD4547 of about 12.5 or 25mg/kg and about 12.5 or 25 mg/kg.It is preferred real at one It applies in mode, pharmaceutical composition as described herein includes the Ceritinib of about 25mg/kg, about 12.5mg/kg based on subject weight AZD4547 and about 25mg/kg Dasatinib.

In terms of other, pharmaceutical composition as described herein is applied with fixed dosage.In some embodiments, this paper institute The pharmaceutical composition stated includes ALK kinase inhibitor, FGFR2 kinase inhibitor and the EphA5 kinase inhibitor of fixed amount.

In some embodiments, the ALK kinase inhibitor in pharmaceutical composition as described herein, FGFR2 kinase inhibitor Amount with EphA5 kinase inhibitor is about 1 each independently, 2,3,4,5,6,7,8,9,10,11,12,13,14,15,16, 17、18、19、 20、21、22、23、24、25、26、27、28、29、30、31、32、33、34、 35、36、37、38、39、40、41、 42、43、44、45、46、47、48、49、 50、55、60、65、70、75、80、85、90、95、100、105、110、115、 120、 125,130,135,140,145,150,155,160,165,170,175,180,185,190,195,200mg or higher, or Range that any aforementioned value is constituted as endpoint or in which arbitrary value, for example, about 1.1 to 1.4mg etc. or about 1.1,1.2,1.3, 1.4mg waiting.

Constituent part in other aspect, pharmaceutical composition as described herein is by as described above based on subject weight Dosage application, and other components are applied with fixed dosage as described above.In some embodiments, drug as described herein The amount of constituent part in combination is the amount in terms of subject weight as described above, and other components are fixations as described above Amount.

In some embodiments, the ALK kinase inhibitor in pharmaceutical composition as described herein, FGFR2 kinase inhibitor Be x:y:z with the weight ratio of EphA5 kinase inhibitor, wherein x, y and z be about 1 each independently, 2,3,4,5,6,7,8,9, 10,11,12, 13,14,15,16,17,18,19,20.In a preferred embodiment, in pharmaceutical composition as described herein The weight ratio of ALK kinase inhibitor, FGFR2 kinase inhibitor and EphA5 kinase inhibitor is about 2:1:2 or about 1:1:1.One In a preferred embodiment, the weight ratio of Ceritinib, AZD4547 and Dasatinib in pharmaceutical composition as described herein is about 2:1:2 or about 1:1:1.

The present invention also provides the methods of the liver cancer in treatment subject comprising Xiang Suoshu subject's application is as described herein Pharmaceutical composition, it includes ALK kinase inhibitor as described herein, FGFR2 kinase inhibitor and EphA5 kinase inhibitors.This hair It is bright that pharmaceutical composition as described herein is also provided, it includes ALK kinase inhibitor as described herein, FGFR2 kinase inhibitor and EphA5 kinase inhibitor is preparing the purposes in the drug for treating the liver cancer in subject.The present invention also provides for pressing down The method of ALK kinases processed, FGFR2 kinases and EphA5 kinases comprising pharmaceutical composition as described herein is applied to subject, Include ALK kinase inhibitor as described herein, FGFR2 kinase inhibitor and EphA5 kinase inhibitor.The present invention also provides herein The pharmaceutical composition, it includes ALK kinase inhibitor as described herein, FGFR2 kinase inhibitor and EphA5 kinase inhibitions Agent is preparing the purposes in the drug for inhibiting ALK kinases, FGFR2 kinases and EphA5 kinases.The present invention also provides be used for Inhibit the method for AKT signal path, MEK signal path and p38 signal path comprising apply to subject as described herein Pharmaceutical composition, it includes ALK kinase inhibitor as described herein, FGFR2 kinase inhibitor and EphA5 kinase inhibitors.This hair It is bright that pharmaceutical composition as described herein is also provided, it includes ALK kinase inhibitor as described herein, FGFR2 kinase inhibitor and EphA5 kinase inhibitor, in preparing the drug for inhibiting AKT signal path, MEK signal path and p38 signal path Purposes.In one embodiment, the movable water of the ALK kinases in the subject, FGFR2 kinases and EphA5 kinases is average Higher than normal liver tissue.In one embodiment, the AKT signal path in the subject, MEK signal path and p38 letter The activity level of number access is above normal liver tissue.

In some embodiments, the component in pharmaceutical composition as described herein can be identical compound.Namely It says, pharmaceutical composition of the present invention forms comprising single compound, substantially by single compound or by single compound group At the single compound targets jointly, and preferred inhibition ALK kinases, FGFR2 kinases and EphA5 kinases.

On the other hand, the present invention also provides compound, the compound targets jointly, and preferred inhibition ALK kinases, FGFR2 kinases and EphA5 kinases.Those skilled in the art will appreciate that the compound can replace drug as described herein Combination and with the technical characteristic described in each embodiment or combination of effects.

The pharmaceutical composition of II.AKT/MEK/p38 signal pathway inhibitor

As described above, invention further contemplates the associated downstream signal path of ALK, FGFR2 and EphA5, and determine Crucial downstream signaling pathway is tri- signal paths of AKT, MEK and p38.It, can be with by inhibiting this three signal paths simultaneously Significantly inhibit hepatoma cell proliferation.

Therefore, the present invention provides pharmaceutical compositions, and it includes AKT signal pathway inhibitors, MEK signal pathway inhibitor With p38 signal pathway inhibitor.

As used herein, term " AKT signal pathway inhibitor " can be used interchangeably herein with " AKT inhibitor ", Refer to the reagent that there is inhibition effect to AKT signal path.Akt access or PI3K-Akt access are in response in extracellular letter Number promote survival and growth signal transduction pathway.Key protein include PI3K (phosphatidylinositol3 3 kinase, Phosphatidylinositol 3-kinase) and Akt (protein kinase B, Protein Kinase B).PI3K-Akt access The related problem of regulation can cause signaling activity to increase, related to a variety of disorders such as cancers and type-2 diabetes mellitus.

Being suitable for the invention AKT signal pathway inhibitor can be selected from, for example, MK2206, Deguelin, Ipatasertib (GDC-0068), GSK690693, AZD5363, AT7867, Afuresertib (GSK2110183), Miltefosine and Perifosine (KRX-0401).It is that other AKT signal pathway inhibitors known in the art can also be used for The present invention.In one embodiment, AKT signal pathway inhibitor is MK2206.

MK2206 is used as allosteric AKT inhibitor.It is all three AKT isomers: the height of Akt1, Akt2 and Akt3 Selective depressant.The clinical test using MK2206 treating cancer such as colorectal cancer, breast cancer is carried out.

As used herein, term " MEK signal pathway inhibitor " can be used interchangeably herein with " mek inhibitor ", Refer to the reagent that there is inhibition effect to MEK signal path.MEK signal path or MAPK/ERK access or Ras-Raf- MEK-ERK access is a succession of protein in cell, signal is transmitted to from the receptor on cell surface endonuclear DNA.The access is related to multiple protein, including MAPK (mitogen activated protein kinases, mitogen-activated protein kinase；Being initially known as ERK, (signal external signal regulates and controls kinases, extracellular signal-regulated kinase)).In many cancers (such as melanoma), the defects of MAPK/ERK access leads to uncontrolled growth.

Being suitable for the invention MEK signal pathway inhibitor can be selected from, for example, Trimetinib (Trametinib, GSK1120212), GDC-0623, PD-325901, U0126-EtOH, Cobimetinib (XL518, GDC-0973, RG7420), GDC-0623, TAK-733, Binimetinib (MEK162), Selumetinib, PD-325901 and CI-1040. Other MEK signal pathway inhibitors known in the art can also be used for the present invention.In one embodiment, MEK signal path Inhibitor is Trimetinib.

Trimetinib is the mek inhibitor drug with anticancer activity.It inhibits MEK1 and MEK2.In May, 2013, FDA Approval Trimetinib is used to treat the patient with BRAF V600E mutation metastatic melanoma.On January 8th, 2014, FDA batches Quasi- BRAF inhibitor dabrafenib and Trimetinib joint are for treating with BRAF V600E/K mutation metastatic melanoma Patient.

As used herein, term " p38 signal pathway inhibitor " can be used interchangeably herein with " p38 inhibitor ", Refer to the reagent that there is inhibition effect to p38 signal pathway inhibitor.P38 mitogen activated protein kinases is that one kind has Silk mitogen activated protein kinase (MAPK) such as cell factor, ultraviolet radioactive, heat shock, and is joined in response to Pressure stimulation With cell differentiation, apoptosis and autophagy.The abnormal activity (be higher or lower than physiological activity) of p38 is related to Various Tissues (including nerve Member, bone, lung, heart, skeletal muscle, red blood cell and fetal tissue) in pathology affair.

Being suitable for the invention p38 signal pathway inhibitor can be selected from, for example, Skepinone-L, SB239063, SB203580, SB202190 (FHPI), BIRB 796, VX-702, SCIO 469, PH-797804 and BMS 582949.Ability Other p38 signal pathway inhibitors known to domain can also be used for the present invention.In one embodiment, p38 signal path inhibits Agent is Skepinone-L.

Skepinone-L is the first ATP competitiveness p38MAPK inhibitor with outstanding in vivo efficacy and selectivity.

Inventor find AKT signal pathway inhibitor, MEK signal pathway inhibitor and p38 signal pathway inhibitor this three The combined administration of kind signal pathway inhibitor significantly effectively inhibits hepatoma cell proliferation.Therefore, AKT signal pathway inhibitor, MEK signal pathway inhibitor and p38 signal pathway inhibitor can be administered in combination to inhibit hepatoma cell proliferation, and thus be controlled Treat liver cancer.In some embodiments, pharmaceutical composition as described herein may include one or more AKT signal paths and inhibit Agent, one or more MEK signal pathway inhibitors and one or more p38 signal pathway inhibitors.As used herein, term " a variety of " can be it is more than one, for example, two kinds, three kinds, four kinds, five kinds or more.In a preferred embodiment, originally Pharmaceutical composition described in text includes MK2206, Trimetinib and Skepinone-L.

In some embodiments, pharmaceutical composition as described herein includes a effective amount of AKT signal pathway inhibitor, MEK Signal pathway inhibitor and p38 signal pathway inhibitor.As used herein, term " effective quantity " refers to medicine group as described herein Component in conjunction realizes the amount effectively treated as a whole, such as effectively inhibits the amount of cancer cell multiplication.In some embodiments In, pharmaceutical composition as described herein is applied to subject with effective quantity.

In some respects, pharmaceutical composition as described herein is applied by the dosage based on subject weight.In some embodiment party In formula, pharmaceutical composition as described herein includes AKT signal pathway inhibitor, the MEK signal path of the amount based on subject weight Inhibitor and p38 signal pathway inhibitor.

In some embodiments, the AKT signal path suppression based on subject weight, in pharmaceutical composition as described herein The amount of preparation about 1.0 to about 50.0mg/kg or higher, preferably from about 5.0 to 40.0mg/kg, more preferably from about 10.0 to 30.0mg/kg, most preferably from about in the range of 12.5 to 25.0 mg/kg.In some embodiments, based on subject weight, this The amount of ALK kinase inhibitor in pharmaceutical composition described in text is about 1.0,1.5,2.0,2.5,3.0,3.5,4.0,4.5, 5.0、5.5、6.0、6.5、7.0、7.5、8.0、8.5、9.0、9.5、10.0、 10.5、11.0、11.5、12.0、12.5、13.0、 13.5、14.0、14.5、15.0、15.5、 16.0、16.5、17.0、17.5、18.0、18.5、19.0、19.5、20.0、20.5、 21.0、 21.5、22.0、22.5、23.0、23.5、24.0、24.5、25.0、25.5、26.0、26.5、27.0、27.5、28.0、 28.5、29.0、29.5、30.0、30.5、31.0、31.5、32.0、 32.5、33.0、33.5、34.0、34.5、35.0、35.5、 36.0、36.5、37.0、37.5、 38.0、38.5、39.0、39.5、40.0、40.5、41.0、41.5、42.0、42.5、43.0、 43.5,44.0,44.5,45.0,45.5,46.0,46.5,47.0,47.5,48.0,48.5,49.0,49.5,50.0mg/kg or It is higher, or the range that constitutes as endpoint of any aforementioned value or in which arbitrary value, for example, about 1.1 to 1.4mg/kg etc. or about 1.1,1.2,1.3,1.4mg/kg etc..In a preferred embodiment, based on subject weight, medicine group as described herein The amount of AKT signal pathway inhibitor in conjunction is about 12.5 or 25mg/kg.In a preferred embodiment, by subject's weight Meter, the AKT signal pathway inhibitor amount of being in pharmaceutical composition as described herein are the MK2206 of about 12.5 or 25mg/kg.

In some embodiments, the MEK signal path suppression based on subject weight, in pharmaceutical composition as described herein The amount of preparation about 1.0 to about 50.0mg/kg or higher, preferably from about 5.0 to 40.0mg/kg, more preferably from about 10.0 to 30.0mg/kg, most preferably from about in the range of 12.5 to 25.0 mg/kg.In some embodiments, based on subject weight, this The amount of MEK signal pathway inhibitor in pharmaceutical composition described in text is about 1.0,1.5,2.0,2.5,3.0,3.5,4.0, 4.5、5.0、5.5、6.0、6.5、7.0、7.5、8.0、8.5、9.0、9.5、 10.0、10.5、11.0、11.5、12.0、12.5、 13.0、13.5、14.0、14.5、15.0、 15.5、16.0、16.5、17.0、17.5、18.0、18.5、19.0、19.5、20.0、 20.5、 21.0、21.5、22.0、22.5、23.0、23.5、24.0、24.5、25.0、25.5、26.0、 26.5、27.0、27.5、 28.0、28.5、29.0、29.5、30.0、30.5、31.0、31.5、 32.0、32.5、33.0、33.5、34.0、34.5、35.0、 35.5、36.0、36.5、37.0、 37.5、38.0、38.5、39.0、39.5、40.0、40.5、41.0、41.5、42.0、42.5、 43.0、43.5、44.0、44.5、45.0、45.5、46.0、46.5、47.0、47.5、48.0、 48.5、49.0、49.5、 50.0mg/kg or higher, or the range that constitutes as endpoint of any aforementioned value or in which arbitrary value, for example, about 1.1 to 1.4mg/kg etc. or about 1.1,1.2,1.3,1.4mg/kg etc..In a preferred embodiment, based on subject weight, this The amount of MEK signal pathway inhibitor in pharmaceutical composition described in text is about 12.5 or 25mg/kg.In a preferred embodiment In, based on subject weight, the MEK signal pathway inhibitor amount of being in pharmaceutical composition as described herein is about 12.5 or 25mg/ The Trimetinib of kg.

In some embodiments, the p38 signal path suppression based on subject weight, in pharmaceutical composition as described herein The amount of preparation about 1.0 to about 50.0mg/kg or higher, preferably from about 5.0 to 40.0mg/kg, more preferably from about 10.0 to 30.0mg/kg, most preferably from about in the range of 12.5 to 25.0 mg/kg.In some embodiments, based on subject weight, this The amount of p38 signal pathway inhibitor in pharmaceutical composition described in text is about 1.0,1.5,2.0,2.5,3.0,3.5,4.0, 4.5、5.0、5.5、6.0、6.5、7.0、7.5、8.0、8.5、9.0、9.5、 10.0、10.5、11.0、11.5、12.0、12.5、 13.0、13.5、14.0、14.5、15.0、 15.5、16.0、16.5、17.0、17.5、18.0、18.5、19.0、19.5、20.0、 20.5、 21.0、21.5、22.0、22.5、23.0、23.5、24.0、24.5、25.0、25.5、26.0、 26.5、27.0、27.5、 28.0、28.5、29.0、29.5、30.0、30.5、31.0、31.5、 32.0、32.5、33.0、33.5、34.0、34.5、35.0、 35.5、36.0、36.5、37.0、 37.5、38.0、38.5、39.0、39.5、40.0、40.5、41.0、41.5、42.0、42.5、 43.0、43.5、44.0、44.5、45.0、45.5、46.0、46.5、47.0、47.5、48.0、 48.5、49.0、49.5、 50.0mg/kg or higher, or the range that constitutes as endpoint of any aforementioned value or in which arbitrary value, for example, about 1.1 to 1.4mg/kg etc. or about 1.1,1.2,1.3,1.4mg/kg etc..In a preferred embodiment, based on subject weight, this The amount of p38 signal pathway inhibitor in pharmaceutical composition described in text is about 12.5 or 25mg/kg.In a preferred embodiment In, based on subject weight, the p38 signal pathway inhibitor amount of being in pharmaceutical composition as described herein is about 12.5 or 25mg/ Skepinone-the L of kg.

In some embodiments, pharmaceutical composition as described herein includes the about 12.5 or 25mg/kg based on subject weight AKT signal pathway inhibitor, the MEK signal pathway inhibitor of about 12.5 or 25mg/kg and the p38 of about 12.5 or 25mg/kg Signal pathway inhibitor.In some embodiments, pharmaceutical composition as described herein includes based on subject weight about 12.5 Or the MK2206 of 25mg/kg, the Trimetinib of about 12.5 or 25mg/kg and the Skepinone-L of about 12.5 or 25mg/kg.

In terms of other, pharmaceutical composition as described herein is applied with fixed dosage.In some embodiments, this paper institute The pharmaceutical composition stated includes that the AKT signal pathway inhibitor, MEK signal pathway inhibitor and p38 signal path of fixed amount inhibit Agent.

In some embodiments, the AKT signal pathway inhibitor in pharmaceutical composition as described herein, MEK signal path The amount of inhibitor and p38 signal pathway inhibitor is about 1 each independently, 2,3,4,5,6,7,8,9,10,11,12,13,14, 15、16、 17、18、19、20、21、22、23、24、25、26、27、28、29、30、31、 32、33、34、35、36、37、38、39、 40、41、42、43、44、45、46、 47、48、49、50、55、60、65、70、75、80、85、90、95、100、105、 110、 115,120,125,130,135,140,145,150,155,160,165,170,175,180,185,190,195,200mg or It is higher, or the range that constitutes as endpoint of any aforementioned value or in which arbitrary value, for example, about 1.1 to 1.4mg etc. or about 1.1,1.2,1.3,1.4mg etc..

In some embodiments, the AKT signal pathway inhibitor in pharmaceutical composition as described herein, MEK signal path The weight ratio of inhibitor and p38 signal pathway inhibitor is x:y:z, wherein x, y and z be about 1 each independently, 2,3,4,5, 6,7,8,9,10, 11,12,13,14,15,16,17,18,19,20.In a preferred embodiment, drug as described herein The weight ratio of AKT signal pathway inhibitor, MEK signal pathway inhibitor and p38 signal pathway inhibitor in combination is about 2: 1:2 or about 1:1:1 or about 1:1:10.In a preferred embodiment, the MK2206 in pharmaceutical composition as described herein, Sibutramine Hydrochloride Weight ratio for Buddhist nun and Skepinone-L is about 1:1:10.

The present invention also provides the methods of the liver cancer in treatment subject comprising Xiang Suoshu subject's application is as described herein Pharmaceutical composition, it includes the suppressions of AKT signal pathway inhibitor as described herein, MEK signal pathway inhibitor and p38 signal path Preparation.The present invention also provides pharmaceutical compositions as described herein, and it includes AKT signal pathway inhibitors as described herein, MEK signal Pathway inhibitor and p38 signal pathway inhibitor are preparing the purposes in the drug for treating the liver cancer in subject.This hair The bright method also provided for inhibiting ALK kinases, FGFR2 kinases and EphA5 kinases comprising apply this paper institute to subject The pharmaceutical composition stated, it includes AKT signal pathway inhibitor as described herein, MEK signal pathway inhibitor and p38 signal paths Inhibitor.The present invention also provides pharmaceutical compositions as described herein, and it includes AKT signal pathway inhibitor as described herein, MEK to believe Number pathway inhibitor and p38 signal pathway inhibitor, in preparation for inhibiting ALK kinases, FGFR2 kinases and EphA5 kinases Purposes in drug.The present invention also provides for inhibiting the method for AKT signal path, MEK signal path and p38 signal path, It includes applying pharmaceutical composition as described herein to subject, and it includes AKT signal pathway inhibitor as described herein, MEK to believe Number pathway inhibitor and p38 signal pathway inhibitor.The present invention also provides pharmaceutical compositions as described herein, and it includes described herein AKT signal pathway inhibitor, MEK signal pathway inhibitor and p38 signal pathway inhibitor, preparation for inhibiting AKT to believe Purposes in the drug of number access, MEK signal path and p38 signal path.In one embodiment, in the subject The activity level of ALK kinases, FGFR2 kinases and EphA5 kinases is above normal liver tissue.In one embodiment, described The activity level of AKT signal path, MEK signal path and p38 signal path in subject is above normal liver tissue.

In some embodiments, the component in pharmaceutical composition as described herein can be identical compound.Namely It says, pharmaceutical composition of the present invention forms comprising single compound, substantially by single compound or by single compound group At the single compound targets jointly, and preferred inhibition AKT signal path, MEK signal path and p38 signal path.

On the other hand, the present invention also provides compound, the compound targets jointly, and preferred inhibition AKT signal Access, MEK signal path and p38 signal path.Those skilled in the art will appreciate that the compound can replace this paper institute The pharmaceutical composition stated and with the technical characteristic described in each embodiment or combination of effects.

III.Hsp90 inhibitor

Inventor has found that Dasatinib, Ceritinib and AZD4547 drug combination can significantly inhibit Nude Mice mould Type growth, by inhibiting the activity blocks downstream signal of interest access of three kinds of Key kinases to conduct.Wherein AZD4547 has certain Tumors inhibition activity is mainly to be realized by angiogenesis inhibiting.The stabilization that molecular chaperones Hsp90 passes through regulation client protein Property and Function participate in maintain tumour a variety of malignant phenotypes, including infinite multiplication, angiogenesis, escape apoptosis, invasion turn Move etc..Since its client protein is related to extensively, Hsp90 inhibitor has the characteristics that " the more targets of a medicine ", i.e. inhibition Hsp90 is living Property degrade multiple Very Important Person albumen simultaneously.The invention firstly uses co-IP, PU-H71 pearl pull down (pull down) experiment and Proteasome inhibitor reversal experiments proof three kinds of Key kinases ALK, FGFR2 and EphA5 in liver cancer are the clients of Hsp90 Albumen.In turn, verifying inhibits Hsp90 activity that can lower downstream AKT, ERK by three kinds of kinases of degrading on model in vivo and in vitro With p38 signal path, effectively inhibition Hepatocarcinoma Proliferation.The present invention elaborates that Hsp90 inhibitor swashs by influencing three cores for the first time Enzyme influences liver cancer growth, can be used as the molecular targeted therapy strategy of liver cancer.In addition, the present invention elaborates that Hsp90 inhibits for the first time Agent acts on the molecular mechanism of liver cancer, selects target user to provide theoretical foundation for it.

Therefore, the present invention provides the methods of the liver cancer in treatment subject comprising Xiang Suoshu subject applies Hsp90 Inhibitor.The present invention also provides the purposes that Hsp90 inhibitor is used to prepare the drug for the treatment of liver cancer.The present invention also provides inhibit by The method of ALK kinases, FGFR2 kinases and EphA5 kinases in examination person comprising Xiang Suoshu subject applies Hsp90 and inhibits Agent.The present invention also provides Hsp90 inhibitor in preparing the drug for inhibiting ALK kinases, FGFR2 kinases and EphA5 kinases Purposes.The present invention also provides inhibit subject in AKT signal path, MEK signal path and p38 signal path method, It includes applying Hsp90 inhibitor to the subject.The present invention also provides Hsp90 inhibitor in preparation for inhibiting AKT to believe Purposes in the drug of number access, MEK signal path and p38 signal path.The present invention also provides pharmaceutical composition, it includes Hsp90 inhibitor and optional other therapeutic agent.

As used herein, term " Hsp90 inhibitor " refers to the reagent inhibited to Hsp90.

Being suitable for the invention Hsp90 inhibitor can be selected from, for example, Ganetespib, NVP-AUY922, SNX- 2112,17-DMAG and PU-H71.Other Hsp90 inhibitor known in the art can also be used for the present invention.In an embodiment In, Hsp90 inhibitor is Ganetespib, NVP-AUY922, SNX-2112,17-DMAG or PU-H71, preferably Ganetespib Or NVP-AUY922.

The invention shows liver cancer cells are very sensitive to Hsp90 inhibitor, IC₅₀In hundred nanomole ranks, hence it is evident that better than facing Bed fiest-tire medication Sorafenib.In some embodiments, IC of the Hsp90 inhibitor used in the present invention to liver cancer cells₅₀It is small In 1.0 μM, less than 0.9 μM, less than 0.8 μM, less than 0.7 μM, less than 0.6 μM, less than 0.5 μM, less than 0.4 μM, less than 0.3 μ M, less than 0.2 μM, less than 0.1 μM, less than 0.09 μM, less than 0.08 μM, less than 0.07 μM, less than 0.06 μM, less than 0.05 μM, Less than 0.05 μM, less than 0.03 μM, less than 0.02 μM or less than 0.01 μM.

The invention shows use Hsp90 inhibitor, ALK, FGFR2 and EphA5 protein degradation, and downstream AKT, ERK and P38 signal path is lowered.Meanwhile the apoptosis of molecular level is verified.In some embodiments of method of the invention, to Subject, which applies Hsp90 inhibitor, reduces the activity level of ALK kinases, FGFR2 kinases and EphA5 kinases.In side of the invention In some embodiments of method, Hsp90 inhibitor is applied to subject and lowers AKT, ERK and p38 signal path.In the present invention Method some embodiments in, to subject apply Hsp90 inhibitor induction liver cancer cells apoptosis.

Being suitable for the invention Hsp90 inhibitor can be used alone, or can be applied in combination with other therapeutic agent. Therefore, the present invention also provides pharmaceutical compositions, and it includes Hsp90 inhibitor and optional other therapeutic agent.In an embodiment party In formula, pharmaceutical composition as described herein is only Hsp90 inhibitor.

In some embodiments, pharmaceutical composition as described herein includes a effective amount of Hsp90 inhibitor.Such as this paper institute With term " effective quantity " refers to that the component in pharmaceutical composition as described herein realizes the amount effectively treated as a whole, such as has Effect inhibits the amount of cancer cell multiplication.In some embodiments, pharmaceutical composition as described herein is applied to subject with effective quantity.

In some respects, pharmaceutical composition as described herein is applied by the dosage based on subject weight.In some embodiment party In formula, pharmaceutical composition as described herein includes the Hsp90 inhibitor of the amount based on subject weight.

In some embodiments, based on subject weight, Hsp90 inhibitor in pharmaceutical composition as described herein Amount is in about 1.0 to about 50.0mg/kg or higher, preferably from about 5.0 to 40.0 mg/kg, and more preferably from about 10.0 to 30.0mg/kg's In range.In some embodiments, based on subject weight, the amount of the Hsp90 inhibitor in pharmaceutical composition as described herein Be about 1.0,1.5,2.0,2.5,3.0,3.5,4.0,4.5,5.0,5.5,6.0,6.5,7.0,7.5,8.0,8.5,9.0, 9.5、10.0、10.5、11.0、11.5、12.0、12.5、13.0、 13.5、14.0、14.5、15.0、15.5、16.0、16.5、 17.0、17.5、18.0、18.5、19.0、19.5、20.0、20.5、21.0、21.5、22.0、22.5、23.0、23.5、24.0、 24.5、25.0、25.5、26.0、26.5、27.0、27.5、28.0、28.5、29.0、29.5、 30.0、30.5、31.0、31.5、 32.0、32.5、33.0、33.5、34.0、34.5、35.0、 35.5、36.0、36.5、37.0、37.5、38.0、38.5、39.0、 39.5、40.0、40.5、 41.0、41.5、42.0、42.5、43.0、43.5、44.0、44.5、45.0、45.5、46.0、 46.5、 47.0,47.5,48.0,48.5,49.0,49.5,50.0mg/kg or higher, or the model that any aforementioned value is constituted as endpoint Enclose or in which arbitrary value, for example, about 1.1 to 1.4 mg/kg etc. or about 1.1,1.2,1.3,1.4mg/kg etc..Preferably at one In embodiment, based on subject weight, the amount of the Hsp90 inhibitor in pharmaceutical composition as described herein is about 5,10,15, 20,25,30,35 or 40mg/kg, preferably from about 10,20 or 30mg/kg.In a preferred embodiment, by subject weight It counts, the Hsp90 inhibitor amount of being in pharmaceutical composition as described herein is about 5,10,15,20,25,30,35 or 40mg/kg, excellent Select the Ganetespib of about 10,20 or 30mg/kg.

In terms of other, pharmaceutical composition as described herein is applied with fixed dosage.In some embodiments, this paper institute The pharmaceutical composition stated includes the Hsp90 inhibitor of fixed amount.

In some embodiments, the Hsp90 inhibitor in pharmaceutical composition as described herein be about 1,2,3,4,5,6,7, 8、9、10、11、12、13、14、15、16、17、 18、19、20、21、22、23、24、25、26、27、28、29、30、31、32、 33、34、35、36、37、38、39、40、41、42、43、44、45、46、47、 48、49、50、55、60、65、70、75、80、85、 90、95、100、105、110、 115、120、125、130、135、140、145、150、155、160、165、170、 175、180、 185,190,195,200mg or higher, or the range that constitutes as endpoint of any aforementioned value or in which arbitrary value, for example, about 1.1 to 1.4mg etc. or about 1.1,1.2,1.3,1.4mg etc..

The present invention also provides the methods of the liver cancer in treatment subject comprising Xiang Suoshu subject's application is as described herein Hsp90 inhibitor.The present invention also provides Hsp90 inhibitor as described herein to prepare the medicine for treating the liver cancer in subject Purposes in object.The present invention also provides for inhibiting the method for ALK kinases, FGFR2 kinases and EphA5 kinases comprising to by Examination person applies Hsp90 inhibitor as described herein.The present invention also provides Hsp90 inhibitor as described herein in preparation for pressing down Purposes in the drug of ALK kinases processed, FGFR2 kinases and EphA5 kinases.The present invention also provides for inhibit AKT signal path, The method of MEK signal path and p38 signal path comprising apply Hsp90 inhibitor as described herein to subject.This hair It is bright also to provide Hsp90 inhibitor as described herein in preparation for inhibiting AKT signal path, MEK signal path and p38 signal logical Purposes in the drug on road.In one embodiment, the ALK kinases in the subject, FGFR2 kinases and EphA5 kinases Activity level be above normal liver tissue.In one embodiment, the AKT signal path in the subject, MEK letter The activity level of number access and p38 signal path is above normal liver tissue.

At other aspect, Hsp90 inhibitor as described herein is optionally used together with other therapeutic agent.Namely It says, the present invention also provides pharmaceutical compositions, and it includes Hsp90 inhibitor as described herein and other therapeutic agents.The present invention also mentions For the method for the liver cancer in treatment subject comprising Xiang Suoshu subject applies pharmaceutical composition as described herein, and it includes this Hsp90 inhibitor and other therapeutic agent described in text.The present invention also provides pharmaceutical compositions as described herein, and it includes this paper institutes The Hsp90 inhibitor and other therapeutic agent stated are preparing the purposes in the drug for treating the liver cancer in subject.This hair The bright method also provided for inhibiting ALK kinases, FGFR2 kinases and EphA5 kinases comprising applied to subject described herein Pharmaceutical composition, it includes Hsp90 inhibitor as described herein and other therapeutic agents.The present invention also provides medicines as described herein Object combination, it includes Hsp90 inhibitor as described herein and other therapeutic agents, in preparation for inhibiting ALK kinases, FGFR2 Purposes in the drug of kinases and EphA5 kinases.The present invention also provides for inhibit AKT signal path, MEK signal path and The method of p38 signal path comprising apply pharmaceutical composition as described herein to subject, it includes Hsp90 as described herein Inhibitor and other therapeutic agent.The present invention also provides pharmaceutical compositions as described herein, and it includes Hsp90 as described herein inhibition Agent and other therapeutic agent, in preparing the drug for inhibiting AKT signal path, MEK signal path and p38 signal path Purposes.In one embodiment, the other therapeutic agent is, for example, Sorafenib.In one embodiment, described The activity level of ALK kinases, FGFR2 kinases and EphA5 kinases in subject is above normal liver tissue.Implement at one In mode, the activity level of AKT signal path, MEK signal path and p38 signal path in the subject is above normally Hepatic tissue.

IV. the identification of liver cancer patient subgroup

As described above, inventor has found that activation levels of the tri- kinds of Key kinases of ALK, FGFR2 and EphA5 in liver cancer are significant Higher than in normal liver tissue.Moreover, the overall survival phase for the liver cancer patient that wherein these three Key kinases collective heights activate Considerably shorter than other liver cancer patient subgroups show the correlation between collective height activation and the poor prognosis of liver cancer patient.Cause This, wherein the liver cancer patient of these three Key kinases collective heights activation constitute be different from one of other liver cancer patients it is specific Subgroup.By the activation levels of these three Key kinases in measurement liver cancer patient, assessing it, whether collective height is activated, can be right Liver cancer patient is grouped, and is identified particularly suitable for liver cancer patient subgroup of the invention.

Therefore, in one aspect, the present invention provides the methods of the hypotype of the liver cancer in identification subject comprising measurement The activity level of ALK kinases, FGFR2 kinases and EphA5 kinases in the subject.The present invention also provides treatment subjects In liver cancer method comprising measure the movable water of ALK kinases in the subject, FGFR2 kinases and EphA5 kinases It is flat, and if the activity level of the ALK kinases, FGFR2 kinases and EphA5 kinases is above normal liver tissue, Xiang Suoshu Subject applies pharmaceutical composition as described herein.The present invention also provides kits comprising swashs for measuring the ALK in subject The reagent of the activity level of enzyme, FGFR2 kinases and EphA5 kinases.The kit further include for assess ALK kinases, The specification of the activity level of FGFR2 kinases and EphA5 kinases.

The activity level of ALK kinases, FGFR2 kinases and EphA5 kinases in subject can be by known in the art Method and/or reagent measurement.It is, for example, possible to use immunohistochemical methods well known in the art to measure.For measuring ALK The antibody of kinases, FGFR2 kinases and EphA5 kinases is known to the skilled in the art.For example, p-ALK (GTX16377, Genetex, Irvine, CA)；P-FGFR2 (ab111124, Abcam, Cambridge, MA)；p-EphA5antibody (GTX17348, Genetex, Irvine, CA).

On the other hand, the present invention provides the methods of the hypotype of the liver cancer in identification subject comprising measurement institute State the activity level of AKT signal path in subject, MEK signal path and p38 signal path.The present invention also provides treatment by The method of liver cancer in examination person comprising AKT signal path, MEK signal path and the p38 signal measured in the subject is logical The activity level on road, and if the activity level of the AKT signal path, MEK signal path and p38 signal path is above just Normal hepatic tissue then applies pharmaceutical composition as described herein to the subject.The present invention also provides kits comprising for surveying The reagent of the activity level of AKT signal path, MEK signal path and p38 signal path in amount subject.The kit It further include the specification for assessing the activity level of AKT signal path, MEK signal path and p38 signal path.

The activity level of AKT signal path, MEK signal path and p38 signal path in subject can pass through ability Method known to domain and/or reagent measurement.It is, for example, possible to use immunohistochemical method measurement well known in the art with The activity level of AKT signal path, MEK signal path and the relevant protein of p38 signal path.For measuring and AKT signal The antibody of the activity level of access, MEK signal path and the relevant protein of p38 signal path is known to those skilled in the art 's.

In yet another aspect, the present invention also provides the movable waters for detecting ALK kinases, FGFR2 kinases and EphA5 kinases Flat reagent and/or the reagent of the activity level for detecting AKT signal path, MEK signal path and p38 signal path are used In determining whether subject belongs to the purposes of specific liver cancer subgroup；For judging that subject is appropriate for apply medicine of the invention The purposes that object is combined and/or treated by means of the present invention；For diagnosing the purposes of patient；And/or it is used for pre- future trouble The purposes of person.

As used herein, term " treatment " generally refers to obtain the pharmacology and/or physiological effect needed.The effect is according to complete Fully or partially prevent disease or its symptom, can be preventative；And/or according to partially or completely stable or healing disease And/or it due to the side effect that disease generates, can be therapeutic." treatment " used herein, which covers, appoints patient disease What is treated, comprising: (a) prevents easy infection disease or symptom but be not diagnosed to be disease or symptom that the patient of illness is occurred also； (b) symptom for inhibiting disease, that is, prevent its development；Or (c) alleviate the symptom of disease, that is, disease or symptom is caused to be degenerated.

In some embodiments, the activity level of the ALK kinases in subject, FGFR2 kinases and EphA5 kinases is each From independently higher than normal liver tissue or higher than normal liver tissue by about 5% to 1000% or more, for example, about at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 150%, 200%, 250%, 300%, 350%, 400%, 450%, 500%, 550%, 600%, 650%, 700%, 750%, 800%, 850%, 900%, 950%, 1000% or more or any aforementioned value The range that is constituted as endpoint or in which arbitrary value, for example, about 7% to about 28% is equal or about 7%, 14%, 21%, 28% etc..

In some embodiments, the AKT signal path in the subject in subject, MEK signal path and p38 letter The activity level of number access is higher than normal liver tissue each independently or higher than normal liver tissue about 5% to 1000% or more It is more, for example, about at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 150%, 200%, 250%, 300%, 350%, 400%, 450%, 500%, 550%, 600%, 650%, 700%, 750%, 800%, 850%, 900%, 950%, 1000% or more, or the range that constitutes as endpoint of any aforementioned value or in which arbitrary value, for example, about 7% to about 28% Deng or about 7%, 14%, 21%, 28% etc..

As used herein, term " activity level ", " activation levels " and " activation level " is in the context for being related to kinases Use with can be interchanged, and typically refer to phosphorylation level etc..

In some embodiments, the subject is mammal.In one embodiment, the subject is small Mouse.In another embodiment, the subject is people.

As previously mentioned, pharmaceutical composition of the invention effectively inhibits hepatoma cell proliferation.In some embodiments, of the invention The liver cancer cells inhibiting rate (referred to herein as liver cancer inhibiting rate or tumor control rate or inhibiting rate) of pharmaceutical composition can be with Be about 5% to 100%, for example, about at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100%, or Range that any aforementioned value is constituted as endpoint or in which arbitrary value, for example, about 7% to about 28% grade or about 7%, 14%, 21%, 28% etc..In some preferred embodiments, the liver cancer cells inhibiting rate of pharmaceutical composition of the invention can be about at least 40%, 50%, 60%, 70%, 80% or 90%.

Pharmaceutical composition of the invention mainly inhibits hepatoma cell proliferation and inducing cell apoptosis.In some embodiments In, liver cancer cells mostly about 5% to 1000% that pharmaceutical composition induction ratio of the invention is handled without pharmaceutical composition of the invention or More, for example, about at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 150%, 200%, 250%, 300%, 350%, 400%, 450%, 500%, 550%, 600%, 650%, 700%, 750%, 800%, 850%, 900%, 950%, 1000% or more, or the range that constitutes as endpoint of any aforementioned value or in which arbitrary value Apoptosis, for example, about 7% to about 28% etc. or about 7%, 14%, 21%, 28% etc..In some preferred embodiments, pharmaceutical composition of the invention is lured Lead about at least 100% more than the liver cancer cells without pharmaceutical composition processing of the invention, 200%, 300%, 400%, 500%, 600%, 700% Apoptosis.

Pharmaceutical composition of the invention causes liver cancer cells vigor to decline.In some embodiments, medicine group of the invention Conjunction cause liver cancer cells vigor decline about 5% to 100%, for example, about at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100%, or the range that constitutes as endpoint of any aforementioned value or in which arbitrary value, for example, about 7% to About 28% etc. or about 7%, 14%, 21%, 28% etc..In some preferred embodiments, pharmaceutical composition of the invention leads to liver Cancer cell vigor decline about at least 40%, 50%, 60%, 70%, 80% or 90%.

As previously mentioned, ALK kinases, FGFR2 kinases in the liver cancer patient subgroup identified by means of the present invention and The activity level of EphA5 kinases is higher than in normal liver tissue.In some embodiments, it identifies by means of the present invention The activity level of ALK kinases, FGFR2 kinases and EphA5 kinases in liver cancer patient subgroup higher than normal liver tissue about 5 to 1000% or more, for example, about at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 150%, 200%, 250%, 300%, 350%, 400%, 450%, 500%, 550%, 600%, 650%, 700%, 750%, 800%, 850%, 900%, 950%, 1000% or more, or the range that constitutes as endpoint of any aforementioned value or in which arbitrary value, for example, about 7% to About 28% etc. or about 7%, 14%, 21%, 28% etc..

As previously mentioned, the AKT signal path, MEK signal in the liver cancer patient subgroup identified by means of the present invention are logical The activity level of road and p38 signal path is higher than in normal liver tissue.In some embodiments, by means of the present invention The activity level of AKT signal path, MEK signal path and p38 signal path in the liver cancer patient subgroup of identification compares normal hepatocytes Organize it is high by about 5 to 1000% or more, for example, about at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 150%, 200%, 250%, 300%, 350%, 400%, 450%, 500%, 550%, 600%, 650%, 700%, 750%, 800%, 850%, 900%, 950%, 1000% or more, or the range that constitutes as endpoint of any aforementioned value or in which it is any Value, for example, about 7% to about 28% etc. or about 7%, 14%, 21%, 28% etc..

As previously mentioned, the overall survival phase of the liver cancer patient subgroup identified by means of the present invention is shorter than other liver cancer trouble Person's subgroup.In some embodiments, the overall survival phase of the liver cancer patient subgroup identified by means of the present invention is than other Liver cancer patient subgroup is about at least 0 to 50 month short, such as short about at least 1,2,3 week, or about at least 1,2,3,4,5,6,7, 8、9、10、11、12、13、14、15、16、17、18、19、20、21、22、23、 24、25、26、27、28、29、30、31、32、33、 34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,55,60,65,70,75,80 months, or Range that any aforementioned value of person is constituted as endpoint or in which arbitrary value, for example, about 3.5 days to about 5.5 days it is equal or about 3.5, 4.5,5.5 days etc..The overall survival rate of the liver cancer patient subgroup identified by means of the present invention is sub- lower than other liver cancer patients Group.In some embodiments, the overall survival rate of the liver cancer patient subgroup identified by means of the present invention is than other liver cancer Patient subgroups low about 5% to 1000% or more, for example, about at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 150%, 200%, 250%, 300%, 350%, 400%, 450%, 500%, 550%, 600%, 650%, 700%, 750%, 800%, 850%, 900%, 950%, 1000% or more, or the range that constitutes as endpoint of any aforementioned value or in which Arbitrary value, for example, about 7% to about 28% etc. or about 7%, 14%, 21%, 28% etc..

Hepatoma cell proliferation can effectively be inhibited by applying pharmaceutical composition of the invention to the subject with liver cancer, and be extended The life cycle of subject.In some embodiments, the life cycle for being administered the subject of pharmaceutical composition of the invention can prolong Grow about 1% to 1000% or more, for example, about at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 150%, 200%, 250%, 300%, 350%, 400%, 450%, 500%, 550%, 600%, 650%, 700%, 750%, 800%, 850%, 900%, 950%, 1000% or more, or the range that constitutes as endpoint of any aforementioned value or in which it is any Value, for example, about 7% to about 28% etc. or about 7%, 14%, 21%, 28% etc..

Applying pharmaceutical composition of the invention to subject can be effectively reduced ALK kinases, EphA5 kinases and FGFR2 kinases Activity level.In some embodiments, after applying pharmaceutical composition of the invention, ALK kinases, EphA5 in subject The activity level of kinases and FGFR2 kinases relative to reducing about 1 to 100% each independently before treatment, for example, about 1%, 2%, 3%, 4%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 99% or 100%, or the range that constitutes as endpoint of any aforementioned value or Arbitrary value therein, for example, about 7% to about 28% etc. or about 7%, 14%, 21%, 28% etc..

Applying pharmaceutical composition of the invention to subject can be effectively reduced AKT signal path, MEK signal path and p38 The activity level of signal path.In some embodiments, the AKT letter after applying pharmaceutical composition of the invention, in subject The activity level of number access, MEK signal path and p38 signal path relative to reduced each independently before treatment about 1 to 100%, for example, about 1%, 2%, 3%, 4%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 99% or 100%, or it is any aforementioned Range that value is constituted as endpoint or in which arbitrary value, for example, about 7% to about 28% grade or about 7%, 14%, 21%, 28% Deng.

V. method of application

Component in pharmaceutical composition of the invention can be individually separated preparation or some or all of match jointly System.In one embodiment, pharmaceutical composition of the invention can be configured to be suitable for the pharmaceutical composition of single or multiple applications Object.

Component in pharmaceutical composition of the invention can respectively be administered alone or some or all of apply jointly With.Component in pharmaceutical composition of the invention is applied or some or all of substantially same when can be substantially different When apply.

Component in pharmaceutical composition of the invention can be applied each independently with suitable various approach, including, but not It is limited to, it is oral or extra-parenteral (passing through intravenous, intramuscular, part or subcutaneous route).In some embodiments, medicine of the invention The component of object combination can be administered orally or inject each independently application, such as intravenous injection or intraperitoneal injection.

Component in pharmaceutical composition of the invention can be suitable dosage form each independently, include, but are not limited to piece Agent, lozenge, pill, capsule (such as hard capsule, soft capsule, capsulae enterosolubilis, microcapsules), elixir, granule, syrup, note Penetrate agent (intramuscular, intravenous, intraperitoneal), granule, emulsion, suspension, solution, dispersing agent and for it is oral or it is non-oral to The dosage form of the sustained release preparation of medicine.

Component in pharmaceutical composition of the invention can contain pharmaceutically acceptable carrier and/or figuration each independently Agent.

Component in pharmaceutical composition of the invention can every 1 day each independently, it is 2 days every, 3 days every, 4 days every, 5 days every, Every 6 days, weekly, every 2 weeks, every 3 weeks or monthly or with the application of lower frequency.

Component in pharmaceutical composition of the invention can apply 1 time, 2 times, 3 times, 4 times, 5 times, 6 daily each independently Secondary, 7 times, 8 times, 9 times or 10 times or more time.

Component in pharmaceutical composition of the invention can continuous 1 day each independently, 2 days, 3 days, 4 days, 5 days, 6 days, 7 It, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 15 days, 16 days, 17 days, 18 days, 19 days, 20 days, 21 days, 22 It, 23 days, 24 days, 25 days, 26 days, 27 days, 28 days, 29 days or 30 days or more application long.

One of component in pharmaceutical composition of the invention component can before or after another component 1 day, 2 It, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days or 10 days or more application.For example, in one embodiment, the 1st It applies the component 1 in pharmaceutical composition of the invention, and (that is, the 3rd day) applies the group in pharmaceutical composition of the invention after 2 days Divide 2, and in the component 1 again after 3 days (that is, the 6th day) in application pharmaceutical composition of the invention.

Pharmaceutical composition of the invention can also include other therapeutic agent.In one embodiment, described other to control Treating agent is cancer therapeutic agent known in the art, preferably therapeutic agent for liver cancer, more preferable Sorafenib.

Occur a series of all places for enumerating numerical value in this application, it should be understood that any cited numerical value can be number It is worth the upper limit or lower limit of range.It will also be understood that the present invention covers all such numberical ranges, that is, there is numerical upper limits and numerical value One range of the combination of lower limit, wherein the respective numerical value of upper and lower bound can be any number enumerated in the present invention. Range provided by the invention is understood to include all values within the scope of this.For example, 1-10 be understood to include value 1,2,3,4, 5, the whole in 6,7,8,9 and 10, and optionally include fractional value.It is expressed as " at most (up to) " some value (such as at most 5) Range be interpreted as all values (upper limit including the range), such as 0,1,2,3,4 and 5, and optionally include fractional value. It at most one week or is understood to include in one week 0.5,1,2,3,4,5,6 or 7 day.Similarly, the range by " at least " limiting Lower value provided by being understood to include and all higher values.

Unless otherwise indicated, all percents are w/ws.

As used in the present invention, " about " it is understood to include the mark in three standard deviations of average value or in specific area In the quasi- margin of tolerance.In some embodiments, about it is interpreted as the variation no more than 0.5." about " all thereafter enumerate is modified Value.For example, " about 1,2,3 " expression " about 1 ", " about 2 ", " about 3 ".

Article " one (a) " and " one (an) " are in the present invention to refer to one or be somebody's turn to do more than one (that is, at least one) The grammer object of article.For example, " element " refers to an element or more than one element.

Term " includes " is in the present invention to refer to phrase " including but not limited to " and can be used interchangeably with it.

Unless the context clearly indicates otherwise, term "or" in the present invention inclusive to refer to term "and/or" simultaneously It can be used interchangeably with it.

Term " such as " in the present invention to refer to phrase " such as, but not limited to " and can be used interchangeably with it.

It will be understood by those skilled in the art that the technical characteristic recorded in each embodiment above can be alone or in combination Ground and the solution pool of various aspects of the invention use.

Some embodiments of the present invention pass through non-limiting embodiment explanation hereafter.

Embodiment

The identification of embodiment 1-8:ALK/FGFR2/EphA5 kinases group and joint inhibit

1. instrument and equipment

5417R type high-speed refrigerated centrifuge comes from Eppendorf (Barkhausenweg, Hamburg, Germany)；

3111 type carbon dioxide cell incubators come from Forma Scientific (Marietta, OH, USA)；

6605698 type cell counter of Beckman comes from Beckman Coulter (Fullerton, CA, USA)；

Wavelengthtunable decline orifice plate microplate reader VERSAma ×, from Molecular Device (Sunnyvale, CA, USA)；

Flow cytometer FACSCalibur^TM, come from Becton Dickinson (Sunnyvale, CA, USA)；

Vii7PCR Nanovue plus spectrometer comes from GE Healthcare；

Horizontal oscillator tube comes from IKA (Germany)；

Multilabel Reader comes from PerkinElmer (Waltham, MA, USA)；

Vii7 real-time PCR comes from Life Technology；

IncuCyte Zoom zoom live cell assays system, from Essen Bioscience (Ann Arbor, Michigan, USA).

2. drug and reagent

Sorafenib, Ganetespib, NVP-AUY922, PU-H71, SNX2112,17-DMAG, MK2206, Sibutramine Hydrochloride replace Buddhist nun, MG132 and Skepinone-L are available commercially from Selleck (USA).Compound used therefor is made into the storage of 10mM with DMSO in experiment Standby liquid, freezes in -20 DEG C.Before use with normal saline dilution to required concentration.The final concentration of DMSO is no more than 0.1%.Benzene sulphur The red bright B (SRB) of sieve acyl and DMSO are available commercially from Sigma.

Protease inhibitor cocktail and inhibitor of phospholipase enzymes PhosSTOP are available commercially from Roche Biotechnology Co., Ltd. The secondary antibody of HRP label is available commercially from Merck biology；Pre-dyed protein marker 26616 is available commercially from Thermo Scientific Pierce；Color development liquid ECL Plus Western Blot detection system, SuperSignal West Pico Chemiluminescent Substrate is available commercially from Thermo Scientific Pierce； Clarity^TMWestern ECL Substrate is available commercially from Bio-Rad.SDS, TEMED, 30% acrylamide, glycine and Ammonium persulfate etc. is that chemistry is pure.Transfection reagent Lipofectamin 2000Reagent and interference reagentRNAiMAX Transfection Reagent available commercially from Invitrogen (Carlsbad, CA, USA)。

3. cell culture

Tumor cell line used is as shown in table 1 below in the present invention.Cell culture, which follows cell and provides mechanism, instructs condition. 10% fetal calf serum (Fetal bovine serum, FBS are added in cell culture medium；From Gibco, Grand Island, NY, USA).All cells contain 5%CO at 37 DEG C₂Saturated humidity incubator in routine culture.

HepG2 and Hep3B are available from ATCC.SMMC-7721,QGY-7703,ZIP177, BEL-7402,Huh-7,SK- Hep-1 and people's immortalized hepatocyte QSG-7701 is available from the American Type Culture Collection committee, Chinese Academy of Sciences cell bank.Huh-7 With SK-Hep-1 cell culture in the DMEM culture medium of the fetal calf serum containing 10%Gibco；HepG2 and Hep3B cell culture in In the EMEM culture medium of the fetal calf serum containing 10%Gibco；The training of SMMC-7721, QGY-7703, ZIP177 and BEL-7402 cell It supports in the RIPM1640 culture medium of the fetal calf serum containing 10%Gibco.All cell strains available from ATCC are identified by STR.

1. cellular context of table and source

Cell Name	Organization type	Source
			SMMC-7721	Human liver cancer	The American Type Culture Collection committee, Chinese Academy of Sciences cell bank
QGY-7703	Human liver cancer	The American Type Culture Collection committee, Chinese Academy of Sciences cell bank
			ZIP177	Human liver cancer	The American Type Culture Collection committee, Chinese Academy of Sciences cell bank
BEL-7402	Human liver cancer	The American Type Culture Collection committee, Chinese Academy of Sciences cell bank
			HepG2	Human liver cancer	ATCC
Hep3B	Human liver cancer	ATCC
			SK-Hep-1	Human liver cancer	The American Type Culture Collection committee, Chinese Academy of Sciences cell bank
Huh-7	Human liver cancer	The American Type Culture Collection committee, Chinese Academy of Sciences cell bank
			QSG-7701	Human liver cell	The American Type Culture Collection committee, Chinese Academy of Sciences cell bank

4. experimental method

4.1. human receptor tyrosine kinase enzyme chip

By growth conditions good SMMC-7721, ZIP177, BEL-7402, QGY-7703, HepG2, Hep3B, Huh-7 Or SK-Hep-1 cell inoculation, in 100mm culture dish, degree to be fused reaches 90%, is washed twice with 1 × PBS of pre-cooling, with 1mL/2×10⁷Specified lysate is added in the density of a cell, cracks 30min on ice, and 4 DEG C, 12,000 × g is centrifuged 30mim, takes Supernatant is operated for subsequent array experiment.The human protein phosphatase chip of RayBiotech company have including HGFR, VEGFR, The 71 important kinases closely related with liver cancer genesis and development of PDGFR and IGF1R, experimental implementation and analysis are by the auspicious rich public affairs in Guangzhou Department completes.

4.2.siRNA interference

Interference fragment is dissolved in the DEPC water of RNAase, is made into 10 μM of initial concentrations.Using SiRNA is transferred to cell according to the description of product by RNAiMAX transfection reagent.The specific method is as follows: in logarithmic growth phase ZIP177 or SMMC-7721 cell is after pancreatin digests by 2 × 10⁵Cells/well is inoculated into 6 orifice plates, degree about 30- to be fused 50%, 40pmol siRNA is diluted to 100 μ L with serum-free antibiotic-free Opti-MEM culture medium.2 μ L RNAiMAX are tried Agent is diluted to 100 μ L with serum-free antibiotic-free Opti-MEM culture medium, mixes, is stored at room temperature 5min.The two is mixed, room temperature 15min is stood, cell culture fluid is changed to 800 μ L serum-free antibiotic-free Opti-MEM culture mediums at the same time, by this Mixture is added in 6 porocyte culture plates, after cultivating 4-6h, changes fresh complete medium into, 37 DEG C contain 5%CO₂Condition Under continue to cultivate.

EphA5、LTK、EphA1、EphA3、EphB2、EphB3、FRK、ABL1、 EGFR、Insulin R、TXK、TNK1、 TrkB, ACK1 and c-Met siRNA fragment are purchased from Sigma (USA)；FGFR2, ALK interference fragment are by Shanghai Ji Ma pharmaceutical technology Co., Ltd's synthesis.Sequence is following (positive-sense strand):

SiRNA sequence used in 2. present invention of table (SEQ ID NO:1-34)

4.3. cell survival is tested

The liver cancer cells in logarithmic growth phase are taken to be inoculated in 96 orifice plates with 3000-4000/ hole density, according to experiment side Case is handled, and experiment terminates the TCA with pre-cooling in 4 DEG C of fixed 1h, dries in 60 DEG C of constant temperature ovens, 100 μ L 4mg/L are added The red bright B (SRB) of benzene sulphur sieve acyl be incubated for 15min.Unbonded SRB is washed away with 1% glacial acetic acid aqueous solution, is dried in 60 DEG C of constant temperature Case drying, is added 10mmol/L Tris-HCl dissolution, and microplate reader reads 560nm wavelength light absorption value.Inhibiting rate=(OD_{Control group}- OD_{Experimental group})/OD_{Control group}。

4.4. Western blot analysis

1 × PBS that cell is pre-chilled is washed twice, addition RIPA lysate is placed in cracks 30min on ice.4 DEG C, 12, 000 × g centrifugation 30mim takes supernatant.BCA method protein quantification is added 1 × SDS lysate and prepares protein sample.Protein sample is placed in In the SDS- polyacrylamide gel of different densities, Tris- glycine-SDS electrophoretic buffer [25mmol/L Tris, 250 Mmol/L glycine (pH8.3), 0.1%SDS] in separated with 80V electrophoresis about 20min and 120V electrophoresis about 2h.With half-dried Albumen is transferred to nitrocellulose filter from gel by blotting or wet robin, and transferring buffered formula of liquid is the sweet ammonia of 192mmol/L Acid, 25mmol/L Tris, 20% methanol shift 1-2h by required molecular weight of albumen size.With Ponceaux (Ponceau S) It dyes and determines transfer case and protein band position, shear corresponding purpose band according to protein marker molecular weight, then with envelope Liquid (TBST of TBST or 3%BSA containing 5% skimmed milk power) room temperature closing 60min is closed, is incubated for corresponding antibody in 4 DEG C Overnight.With TBST cleaning solution [20mM Tris-HCl (pH7.2-7.4, room temperature), 150mM NaCl, 0.1% (v/v) Tween20] room temperature washing 3 times, each 10min.Be added with the secondary antibody of the diluted horseradish peroxidase-labeled of 3%BSA (1: 2000), it is incubated at room temperature 1h.Then three times with TBST rinsing, each 10min.Suitable luminescence reagent is selected according to exposure intensity Colour developing, luminescence reagent have ECL Plus Western Blot detection system and Advance ECL protein respectively Blotting detection system and SuperSignal West Pico Chemiluminescent Substrate. Antibody used is as shown in table 3 below in the present invention.

3. antibody of table summarizes

4.5. co-immunoprecipitation

By the good SMMC-7721 or ZIP177 cell inoculation of growth conditions in 100mm culture dish, culture is for 24 hours.To thin Born of the same parents' degrees of fusion carries out subsequent experimental when being 60%-70%.Serum-free medium starvation is changed, the Hsp90 inhibitor of respective concentration is added, Act on 4h.1 × PBS of cell pre-cooling is washed twice, 600 μ 1 × RIPA of L lysates of addition (50mM Tris (pH 7.4), 1mM EDTA, 150mM NaCl, 1mM NaF, 1mM Na₃VO₄, 1% NP-40,1mM PMSF, 0.25% NaTDC, egg White Protease Inhibitor Cocktail (Roche)) 1h is cracked on ice.Period softly shakes culture dish for several times, keeps cracking abundant.4℃,12, 000 × g is centrifuged 20min.After taking supernatant, BCA quantitatively to adjust neat total protein concentration, take a small amount of sample that 2 × SDS sample-loading buffer is added 100 DEG C are boiled 10min, as control；25 μ L proteinA/G Agrose are added in remaining sample, and 4 DEG C of vertical mixed are incubated overnight. 5min is stood on ice, and 2000 × rpm is centrifuged 6min, and then microballon (is inhibited with 500 μ 1 × RIPA of L lysates without protease Agent composition) washing, after standing 5min, 2000 × rpm is centrifuged 6min, removes supernatant, so repeats six times, requirement is then added 2 × SDS-PAGE sample-loading buffer, 100 DEG C are boiled 10min, immunoblotting detection.

4.6. Flow cytometry apoptosis

By cell such as SMMC-7721 or ZIP177 in logarithmic growth phase with 2 × 10⁵The density of cells/well is inoculated in In 6 orifice plates, contain 5%CO in 37 DEG C₂Saturated humidity incubator in overnight incubation, drug-treated 48h is added, is digested with pancreatin thin Born of the same parents are simultaneously collected in 2mL centrifuge tube, and 4 DEG C of 600 × g are centrifuged 5min.Supernatant is abandoned, is withered using the Annexin V-FITC of BD company Detection kit is died, respectively with PI dye DNA and FITC-Annexin V dye phosphatidylserine (PS) to detect Apoptosis.

4.7. Nude Mice is tested in body

BALB/c nude nude mouse: SPF grades, female mice, 5-6 week old, 16-20 grams of weight, purchased from the experiment of Beijing dimension tonneau China Zoo technical Co., Ltd.The animal use of this experiment strictly observes Chinese Academy of Sciences's Shanghai institute of materia medica animal feeding and uses human relations Reason standard.Nude mouse is raised under the conditions of without special pathogen, the every 12h of illumination substitute it is primary, feed and water it is sterilized after can It uses.

By human hepatocarcinoma BEL-7402, by 5 × 10⁶/ armpit on the right side of nude mouse is only inoculated respectively, use vernier Slide calliper rule measure transplantable tumor diameter, when gross tumor volume reaches -100mm³When, animal is grouped at random, every group 6.It gives respectively 25mg/kg Ceritinib (0.5% methylcellulose/0.5%Tween 80), 25mg/kg Dasatinib (0.5%CMC sodium) and 12.5mg/kg AZD4547 (1%Tween-80) is applied alone and three kinds of combination therapies, takes orally once a day.Control group is given Give equivalent solvent, successive administration 2 weeks.Mouse weight and tumour long (L) and width (W) are measured three-times-weekly, and thus calculate tumour Volume TV=L × W²/2.Relative tumour volume RTV=Vt/V0, Vt refer to that the gross tumor volume on the measurement same day, V0 show before medicine Beginning gross tumor volume.Using Relative tumor proliferation rate T/C (%) as antitumor activity evaluation index, T/C (%)=administration group is average TV/ control group is averaged TV × 100%.The standard of curative effect evaluation: T/C% > 60% is invalid；T/C%≤60% and through statistics at It is effective for managing p < 0.05.Individual mice weight is weighed simultaneously, for evaluating drug toxicity.

4.8. clinical samples and organization chip

Patient tissue chip and freezing tissue are purchased from assistant really biology.Immunohistochemistry is carried out according to routine operation, p-ALK 1: 50；p-FGFR2 1:50；P-EphA5 antibody 1:50；CD34 antibody 1:100；Ki-67 antibody 1:100.Chip analysis and interpretation It is completed by Zuo Cheng biotech firm.It is related to overall survival phase using Kaplan-Meier plotter analysis kinase activation degree Property.Grinding cracking is carried out by the tumour of freezing and with normal tissue addition RIPA lysate.BCA standard measure prepares sample.Egg White matter blotting carries out analysis of protein.

4.9. statistical analysis

Significance analysis is examined using T between group, and p < 0.05 is considered having significant difference.Multiple groups Fen Xi not use Two- way Anova.*, p < 0.05；*, p < 0.01；* *, p < 0.001.

Embodiment 1. identifies overactive kinases in liver cancer

The discovery of numerous studies early period, numerous kinases advanced activations in liver cancer.It is sharp first in order to screen key molecule therein With the activation levels of kinases in receptor tyrosine kinase phosphorylation chip detection liver cancer cells.Kinases chip resists different kinases Body is fixed on nitrocellulose filter, it then follows protein binding in sandwich immunoassays principle, with cell or tissue lysate, use are general Luminescent solution is added after being incubated for secondary antibody in Binding Capacity on phospho-AB and film, and detection chemiluminescence is strong and weak, determines kinase activator journey Degree.Kinases chip can efficiently, quickly detect a variety of kinase activation situations, be suitable for screening extensively.The core selected in the present invention Piece includes relevant 71 receptor tyrosine kinases of liver cancer genesis and development.For the reliable and full and accurate of result, while having detected Kinase expression (table 4) in different tissue sources, 8 plants of liver cancer cells of different genes background.

The activation (basal phosphorylated) of 71 kinds of kinases in 4.8 plants of liver cancer cells of table

It is ranked up according to kinase activation level, screens and be in the first two ten kinases in every plant of cell, carry out cluster point It analyses (Fig. 1).Overactive kinases has 9 kinds in 8 plants of cells: EphB3, TrkB, ALK, EphA3, EphA5, LTK, c- Met,EphB2,FRK；It is overactive in 7 plants of cells to have 4 kinds: ACK1, TNK1, TXK, FGFR2；The height in 6 plants of cells Activation has 2 kinds: ABL1, EphA1；It is overactive in 5 plants of cells to have 2 kinds: EGFR, Insulin R.This 17 kinds of kinases are The higher kinases of universal activation level in hepatoma cell strain, it may be possible to the important molecule of regulating cell proliferation.8 plants of liver cancer cells In overactive kinases it is not fully identical.This result demonstrates the heterogeneous characteristic of liver cancer height in kinases level simultaneously.

Work of ALK, FGFR2 and EphA5 kinases in liver cancer PDX array is also had detected by immunohistochemistry (IHC) Change.In selected LI0752 model, three kinds of equal advanced activations of kinases (Figure 45).

In order to further investigate its active principles, the monokaryon glycosides of gene in 8 plants of liver cancer cells is detected using SNP6.0 chip Sour polymorphism and copy number variation.The mutation of 17 kinds of kinases occurs mainly in either nonsense mutation etc. in introne as the result is shown (Figure 46) there are no the mutation of clinical meaning.Gene is no in 8 plants of liver cancer cells simultaneously obviously expands (table 5).

The copy number of 5.17 kinds of table common overactivation kinases

Gene	BEL-7402	HePG2	Hep3B	Huh-7	QGY-7703	SK-Hep-1	SMMC-7721	ZIP177
									ABL1	4	2	3	4	6	2	3	3
ALK	3	3	2	4	3	3	3	2
									EGFR	3	2	4	5	4	4	3	2
EphA1	3	2	3	5	3	3	3	3
									EphA3	2	2	2	8	3	3	2	2
EphA5	2	2	4	3	3	2	2	2
									EphB2	3	2	2	4	3	3	3	3
EphB3	3	2	3	4	4	2	3	3
									FGFR2	2	3	2	4	3	3	2	2
FRK	2	2	3	5	3	2	2	2
									INSR	2	2	3	4	3	2	2	2
LTK	3	2	3	3	4	2	3	3
									MET	2	2	3	6	3	4	2	2
NTRK2	3	2	3	5	5	2	3	3
									TNKI	3	2	3	4	4	3	3	3
TNK2	3	2	3	3	4	3	3	3
									TXK	2	2	4	2	3	2	2	2

Embodiment 2: influence of the single kinases to hepatoma cell proliferation is interfered

In order to determine the key molecule for really influencing cell Proliferation in activated protein kinase, first in ZIP177 and SMMC-7721 SiRNA interference, and the IC of synchronous detection respective kinase inhibitor are carried out to this 17 kinds of kinases in two plants of cells₅₀Value.17 kinds of height The kinases of activation and its corresponding inhibitor are shown in Table 6.It interferes single kinases not make significant difference hepatoma cell proliferation as the result is shown, presses down Rate processed is respectively less than 10% (Fig. 2), and the IC of each inhibitor₅₀It is worth higher (Fig. 3).This shows that hepatoma cell proliferation may be by more Kind kinase regulatory.Combination intervention Key kinases are needed to reach good proliferation inhibiting effect.

6.17 kinds of overactive kinases of table and corresponding inhibitor

Embodiment 3: influence of the drug combination of kinase inhibitor to hepatoma cell proliferation

Since two methods of Gene intervention and micromolecular inhibitor effect prove to block single kinase activity ineffective Inhibit hepatoma cell proliferation, inventor studies the Key kinases group of regulation hepatoma cell proliferation and inhibits it to reach simultaneously Good result.As previously mentioned, kinases EphB3, TrkB, ALK, EphA3, EphA5, LTK, c-Met, EphB2 and FRK are at 8 plants Advanced activation in cell.

Four kinds of corresponding inhibitor Dasatinibs, GNF-5873, Ceritinib and SGX-523 permutation and combination are carried out first Drug combination (table 6).In general, the kinase inhibitor of 1 μM of concentration can significantly inhibit target active.Therefore, it is selected in experiment remote Lower than IC₅₀1 μM of dosage of value.The inhibiting rate highest of Ceritinib and Dasatinib drug combination as the result is shown, with three kinds of drugs Or the inhibiting rate of four kinds of combination therapies is suitable, is about 40% (Fig. 4).And GNF-5873 and SGX-523 do not play it is bright Aobvious proliferation inhibiting effect.

Next, Ceritinib and Dasatinib and other inhibitor drug combinations are acted on 72h.Color is auspicious as the result is shown ZIP177 and SMMC-7721 proliferation is significantly inhibited for tri- kinds of Buddhist nun, Dasatinib and AZD4547 drug combinations, inhibiting rate is respectively 67.4% and 76.4% (Figures 5 and 6).This shows that these three compounds are effective medicine group in ZIP177 and SMMC-7721 It closes.

Meanwhile it being tested in other six plants of cells QGY-7703, BEL-7402, HepG2, Hep3B, Huh-7 and SK-Hep-1 The conclusion (Fig. 7) is demonstrate,proved.This shows the combination of tri- kinds of Ceritinib, Dasatinib and AZD4547 drugs to inhibition liver cancer cells Proliferation has universality, and significant cell inhibitory effect is obtained in various hepatoma cell strains.

Also measure influence (Fig. 9) of three kinds of kinase inhibitor drug combinations to the proliferation of normal cell.

Embodiment 4: biological effect: Ceritinib, AZD4547 and Dasatinib drug combination induce cell apoptosis

The above results show that drug is applied alone and two kinds of drug combinations cannot effectively inhibit hepatoma cell proliferation.However, three Kind of kinase inhibitor Ceritinib, AZD4547 and Dasatinib drug combination can significantly inhibit hepatoma cell proliferation (Fig. 6 and 7).Further, biological effect caused by these three drug combinations is investigated.The biology of Proliferation Ability is caused to be imitated Should there are many kinds of, including cell-cycle arrest, Apoptosis, necrosis, cell ageing, cell autophagy etc..Act on 48h, streaming Cell art detection three kinds of drug combinations of discovery significantly induce SMMC-7721 and ZIP177 Apoptosis, and are applied alone and any two kinds Drug combination cannot be apoptosis-induced (Fig. 8 A).The three kinds of drug combinations of discovery of immunoblotting detection simultaneously significantly increase PARP With the cutting (Fig. 8 B) of Caspase3, Apoptosis effect is demonstrated in molecular level.

Embodiment 5: Key kinases of identification ALK, FGFR2, the EphA5 as regulation hepatoma cell proliferation

As discussed above, three kinds of kinase inhibitor Ceritinibs, AZD4547 and Dasatinib combination can significantly press down Cell Proliferation processed shows that the key molecule of regulating cell destiny is likely to cover in the target spot of three kinds of drugs.

Dasatinib has numerous target spots, including more than 70 kinases target spots.Firstly, Ceritinib and AZD4547 are joined With, while the gene in the Dasatinib target spot interference library of Raybio company customization is interfered.It interferes as the result is shown EphA5 and two kinds of drug collective effects significantly inhibit SMMC-7721 and ZIP177 hepatoma cell proliferation, and inhibiting rate is respectively 65.35% and 71.45% (Figure 10) is suitable with three kinds of combination therapies effects.This shows that EphA5 is up to sand in the present invention For the crucial target spot of Buddhist nun.

AZD4547 is FGFR familyselective inhibitor, targets FGFR1,2,3.Therefore the main target of AZD4547 in the present invention Point is FGFR2.

LTK and ALK very high homology.Ceritinib is double target drugs of ALK and LTK. The Human Protein LTK expression is faint in liver cancer as the result is shown for Atlas database analysis, and ALK expression is stronger.With siRNA by ALK and LTK respectively with FGFR2 and EphA5 joint knocks out.Knocking out LTK, FGFR2 and EphA5 does not significantly inhibit SMMC-7721 simultaneously as the result is shown With the cell Proliferation (Figure 11) of ZIP177.However, it is effective and inducing cell apoptosis to knock out ALK, FGFR2 and EphA5 simultaneously Inhibit cell Proliferation (Figure 12), shows that ALK is the target spot that Ceritinib plays a role in liver cancer.

Preliminary conclusion is obtained based on the above results, and ALK, FGFR2 and EphA5 are the key that regulation hepatoma cell proliferation swashs Enzyme.

The above experiment determines that ALK, FGFR2 and EphA5 are the core for regulating and controlling hepatoma cell proliferation in various hepatoma cell strains Heart kinases group.Inhibit these three kinase activities that can significantly inhibit hepatoma cell proliferation simultaneously, mainly passes through apoptosis-induced realization.

Embodiment 6: relevant downstream key signal access AKT, ERK and the p38 of identification ALK, FGFR2, EphA5 kinases

The above result shows that inhibiting ALK, FGFR2 and EphA5 to cause Apoptosis simultaneously.Associated downstream signal path needs Further investigate.PI3K/AKT, MAPK/ERK and p38 signal path are the signal of interest accesses in receptor tyrosine kinase downstream, Participate in modulating apoptosis in platelets and proliferation.Anaplastic lymphoma kinase ALK usually occurs point mutation, gene magnification or gene and melts It closes, and then activates downstream passages.ALK gene was found in Anaplastic large cell patients with non Hodgkin lymphoma for the first time before more than 20 years Recombination.With going deep into for research, ALK is had become for potential oncotherapy biomarker, and being includes non-small cell lung A variety of solid tumors and hemopathic therapy target including cancer etc..Non-small cell lung cancer of the scientist's discovery in 2007 in 3-7% There are ALK gene fusions in patient.This important discovery has pushed the early stage of the bis- target drug crizotinib of ALK/c-MET to face Bed test, and it is made successfully to list the non-small cell lung cancer for treating ALK gene fusion in short 4 years.ALK's swashs It is living to participate in the links such as modulate tumor survival proliferation.It is in clinical research there are many ALK inhibitor at present.ALK regulation Downstream be mainly MAPK/ERK, PI3K/AKT signal path.

Receptor tyrosine kinase Ephrin family is different according to its ligand affinity and extracellular fragment architectural difference is divided into two greatly Subgroup EphA and EphB.Reported discovery 9 EphA (1-9) members and 6 EphB (1-6) members at present, respectively with EphA and EphB family ligand binding.Eph receptor and Eph ligand binding activate downstream passages, and the interaction between mediated cell participates in The life processes such as modulating apoptosis in platelets, proliferation, angiogenesis, adherency and movement migration.Clinically, the activation of EphA5 and patient Tumour growth and poor prognosis are closely related.

Receptor tyrosine kinase FGFR includes three structural domains: extracellular fragment, single pass transmembrane structure and intracellular section.Its extracellular fragment Signal is passed in conjunction with ligand FGF intracellular, causes the signal paths such as downstream MAPK/ERK, PI3K/AKT, JAK/STAT living Change.The transmitting of its signal relies primarily on the realization of adaptor protein FRS, Grb2, Gab1 compound.Have now been found that 22 kinds of FGF ligands, Wherein combined respectively with receptor FGFR (1-4) for 18 kinds.The activation of FGF signal path has mediated tumor survival, proliferation, transfer, blood The significant process such as pipe new life and drug resistance.Report that FGFR2 advanced activation in liver cancer is related to patient's poor prognosis.

Based on this, to Ceritinib, AZD4547 and Dasatinib inhibit hepatoma cell proliferation downstream MAPK/ERK, MAPK/JNK/p38, PI3K/AKT, JAK/STAT signal path are investigated.Immunoblotting testing result shows that color is auspicious P-AKT, p-ERK and p-p38 expression are significantly inhibited for Buddhist nun, AZD4547 and Dasatinib drug combination, and to p-STAT3 and p- JNK expression does not make significant difference (Figure 13).This shows that Ceritinib, AZD4547 and Dasatinib drug combination may be by drawing Play the Proliferation Ability that liver cancer cells were lowered and realized in the expression of downstream AKT, ERK and p38 signal path.

In order to determine crucial downstream signaling pathway, by AKT inhibitor MK2206, ERK inhibitor Trimetinib and p38 Inhibitor Skepinone-L drug combination.Dosage be respectively MK2206 (1 μM), Trametinib (1 μM) and Skepinone-L(10μM).The results show that this three signal paths is inhibited to significantly inhibit hepatoma cell proliferation (Figure 14) simultaneously, Main pass through induces cell apoptosis realization (Figure 15).

To sum up, numerous kinases advanced activations in liver cancer cells are found in model in vitro, wherein ALK, FGFR2 and EphA5 is the Key kinases for regulating and controlling hepatoma cell proliferation.Inhibit these three kinases can be by blocking AKT, ERK and p38 letter simultaneously Number pathway activity and induce cell apoptosis, thus inhibit liver cancer cell growth.

The common activation of embodiment 7:ALK/FGFR2/EphA5 is closely related with liver cancer poor prognosis

The above results show that ALK, FGFR2 and EphA5 universal advanced activation in hepatoma cell strain regulate and control liver cancer jointly Proliferation.Inhibit the activity of three kinds of kinases that can block PI3K/AKT, MAPK/ERK and p38 access in downstream simultaneously.In order into one Step probes into clinical meaning, has investigated activation situation and its and liver cancer of these three Key kinases in the liver cancer tissue of liver cancer patient The correlation of the prognosis of patient.

Firstly, whether activation of the three kinds of kinases of detection in liver cancer cells and normal liver cell be variant.The results show that In 8 plants of liver cancer cells, the expression of p-ALK, p-FGFR2 and p-EphA5 are apparently higher than the Human normal hepatocyte QSG- in immortalization In 7701 (Figure 16).Further, the activity that three kinds of kinases freeze in liver cancer tissue and normal liver tissue at 24 Duis is detected.It was found that Activation levels of three kinds of kinases in liver cancer tissue are significantly higher than (Figure 17) in the normal tissue.

Immunohistochemical detection is the results show that in different liver cancer samples, the table of p-ALK, p-FGFR2 and p-EphA5 Up to different (Figure 18).The collective height activation (Figure 19) in about 13% liver cancer patient of three kinds of kinases.Kaplan-Meier Plotter analysis finds, the poor prognosis of the single activation of ALK, FGFR2 or EphA5 and liver cancer patient without significant correlation, And the overall survival phase for the patient that wherein three kinds of kinases activate jointly is considerably shorter than other subgroups (Figure 20), shows p-ALK, p- The common high expression of FGFR2 and p-EphA5 is positively correlated with liver cancer patient poor prognosis.Therefore, the present invention, which identifies, has than it The specific liver cancer patient subgroup of the worse prognosis of his subgroup, the wherein common high expression of p-ALK, p-FGFR2 and p-EphA5.

Embodiment 8: Ceritinib, Dasatinib and AZD4547 drug combination inhibit the growth of human liver cancer Nude Mice

The above results discovery tri- kinds of kinases of ALK/FGFR2/EphA5 regulate and control hepatoma cell proliferation jointly, refer to jointly downstream To AKT, ERK and p38 signal path.Western blot analysis and organization chip the immunohistochemical analysis discovery of patient tissue, ALK/FGFR2/EphA5 is activated jointly in about 13% liver cancer patient, and subgroup patient's overall survival phase is sub- compared to other Group is shorter.Synthesis shows that three kinds of kinases are the core kinases groups in liver cancer, can be used as the target spot of subsequent molecular targeted therapy.

Based on this, need further to study corresponding molecular targeted therapy strategy.Cellular level three kinds of kinases as the result is shown Inhibitor drug combination significantly inhibits hepatoma cell proliferation, before the program is to the clinical application of liver cancer treatment for further evaluation Scape, the in-vivo tumour for having selected human liver cancer cells Hep G2 Model in Nude Mice to investigate three kinds of kinase inhibitors inhibit Activity.4 administration groups are set, give Ceritinib 25mg/kg, 25 mg/kg and AZD4547 12.5mg/ of Dasatinib respectively Three kinds of combination therapies of kg and same dose.Control group gives equivalent carrier/solvent.It takes orally once a day, continuously gives Medicine 2 weeks.

The tumors inhibition activity for using individually 2 administration groups of Ceritinib and Dasatinib as the result is shown is very weak, Less than 10%.The tumor control rate that the administration group of AZD4547 is used alone is about 50%.Ceritinib, Dasatinib and AZD4547 drug combination obtains highest tumor control rate, is 80.5% (Figure 21).Prove Ceritinib, Dasatinib and The combination of AZD4547 obtains the significant preferably in-vivo tumour compared with the exclusive use of each drug in mouse model and inhibits Effect.

CD34 immunohistochemical staining is the results show that AZD4547 is mainly to pass through angiogenesis inhibiting to have played antitumor work With (Figure 23).Show that three kinds of combination therapies can significantly inhibit In vivo model tumour growth.Monitor mouse weight variation hair Existing, drug combination causes mouse weight to decline, but does not result in dead mouse (Figure 24).

In SMMC-7721 transplantable tumor, Dasatinib, Ceritinib and the AZD4547 of test dose significantly inhibit p- The expression of the target spots such as ALK, p-FGFR2, p-EphA5.Individual use is to downstream MAPK/ERK, PI3K/AKT and p38 signal path Inhibitory activity is weaker.Drug combination significantly inhibits p-AKT, p-ERK and p-p38 expression (Figure 22).ImmunohistochemistryResults Results with Immunoblotting is consistent.Three kinds of kinase inhibitor drug combinations reduce Ki67 expression, inhibit the proliferation of liver cancer cells. The exclusive use of AZD4547 substantially reduces the expression of angiogenesis marker CD34, show its anti-tumor activity mainly due to Angiogenesis inhibiting (Figure 23).

Effect of the embodiment 9-11:Hsp90 inhibitor to liver cancer

1. instrument and equipment

Vii7PCR Nanovue plus spectrometer comes from GE Healthcare；

Horizontal oscillator tube comes from IKA (Germany)；

Multilabel Reader comes from PerkinElmer (Waltham, MA, USA)；

Vii7 real-time PCR comes from Life Technology；

2. drug and reagent

Sorafenib, Ganetespib, NVP-AUY922, PU-H71, SNX2112,17-DMAG, MK2206, Sibutramine Hydrochloride replace Buddhist nun, MG132 and Skepinone-L are available commercially from Selleck (USA).Compound used therefor is made into the storage of 10mM with DMSO in experiment Standby liquid, freezes in -20 DEG C, and before use with normal saline dilution to required concentration, the final concentration of DMSO is no more than 0.1%.Benzene sulphur The red bright B (SRB) of sieve acyl and DMSO are available commercially from Sigma.

Protease inhibitor cocktail and inhibitor of phospholipase enzymes PhosSTOP are available commercially from Roche Biotechnology Co., Ltd； The secondary antibody of HRP label is available commercially from Merck biology；Pre-dyed protein marker 26616 is available commercially from Thermo Scientific Pierce；Color development liquid ECL Plus Western Blot detection system, SuperSignal West Pico Chemiluminescent Substrate is available commercially from Thermo Scientific Pierce； Clarity^TMWestern ECL Substrate is available commercially from Bio-Rad；SDS, TEMED, 30% acrylamide, glycine and Ammonium persulfate etc. is that chemistry is pure.Transfection reagent Lipofectamin 2000Reagent and interference reagentRNAiMAX Transfection Reagent available commercially from Invitrogen (Carlsbad, CA, USA)。

3. cell culture

Tumor cell line used is as shown in table 1 in the present invention.Cell culture, which follows cell and provides mechanism, instructs condition. 10% fetal calf serum (Fetal bovine serum, FBS are added in cell culture medium；Gibco, Grand Island, NY, USA).All cells contain 5%CO at 37 DEG C₂Saturated humidity incubator in routine culture.

HepG2, Hep3B are available from ATCC.SMMC-7721,QGY-7703,ZIP177, BEL-7402,Huh-7,SK- Hep-1 and people's immortalized hepatocyte QSG-7701 is available from the American Type Culture Collection committee, Chinese Academy of Sciences cell bank.Huh-7 With SK-Hep-1 cell culture in the DMEM culture medium of the fetal calf serum containing 10%Gibco；HepG2 and Hep3B cell culture in In the EMEM culture medium of the fetal calf serum containing 10%Gibco；The training of SMMC-7721, QGY-7703, ZIP177 and BEL-7402 cell It supports in the RIPM1640 culture medium of the fetal calf serum containing 10%Gibco.All cell strains available from ATCC are identified by STR.

4. experimental method

4.1. real-time quantitative PCR

Take the cell of growth logarithmic phase with 2 × 10⁵The density of cells/well is inoculated in 6 orifice plates, and medicine is given after overnight incubation Object processing for 24 hours, is abandoned supernatant, is washed one time with the PBS of pre-cooling, and 1mL Trizol cracking is added in every hole.The extracting of Trizol one-step method is total RNA.Use Takara company reverse transcription reagent box by RNA reverse transcription for cDNA, as subsequent experimental template.Next it usesPremi×E×Taq^TMII (Tli RNaseH Plus) kit carries out real-time quantitative PCR according to operating instruction, Testing goal gene mRNA levels expression quantity.

Primer needed for testing is synthesized by Sangon Biotech (Shanghai) Co., Ltd., sequence it is following (SEQ ID NO: 35-42):

ALK- is positive: TCTCATCGCAGCCGATATGG

ALK- is reversed: GGCATCTCCTTAGAACGCTCT

FGFR2-forward direction: AGCACCATACTGGACCAACAC

FGFR2-is reversed: GGCAGCGAAACTTGACAGTG

EphA5-forward direction: GTGACCGATGAACCTCCCAAA

EphA5-is reversed: CCAGGTCTGCACACTTGACAG

Beta-actin-forward direction: CATGTACGTTGCTATCCAGGC

Beta-actin-is reversed: CTCCTTAATGTCACGCACGAT

4.2.siRNA interference

Interference fragment is dissolved in the DEPC water of RNAase, is made into 10 μM of initial concentrations.Using SiRNA is transferred to cell according to the description of product by RNAiMAX transfection reagent.The specific method is as follows: in logarithmic growth phase ZIP177 or SMMC-7721 cell is after pancreatin digests by 2 × 10⁵Cells/well is inoculated into 6 orifice plates, degree about 30- to be fused 50%, 40pmol siRNA is diluted to 100 μ L with serum-free antibiotic-free Opti-MEM culture medium.2 μ L RNAiMAX are tried Agent is diluted to 100 μ L with serum-free antibiotic-free Opti-MEM culture medium, mixes, is stored at room temperature 5min.The two is mixed, room temperature 15min is stood, cell culture fluid is changed to 800 μ L serum-free antibiotic-free Opti-MEM culture mediums at the same time, by this Mixture is added in 6 porocyte culture plates, after cultivating 4-6h, changes fresh complete medium into, contains 5%CO at 37 DEG C₂Item Continue to cultivate under part.

Hsp90siRNA segment is purchased from Sigma (USA), and sequence is following (positive-sense strand) (SEQ ID NO:43-44):

1:GCUUGACAGAUCCCAGUAAdTdT

2:GCUGGUGCAGAUAUCUCUAdTdT

4.3. Western blot analysis

1 × PBS that cell is pre-chilled is washed twice, addition RIPA lysate is placed in cracks 30min on ice.4 DEG C, 12, 000 × g centrifugation 30mim takes supernatant.BCA method protein quantification is added 1 × SDS lysate and prepares protein sample.Protein sample is placed in In different densities SDS- polyacrylamide gel, in Tris- glycine-SDS electrophoretic buffer with 80V electrophoresis about 20min and 120V electrophoresis about 2h is separated.Albumen is transferred to nitrocellulose filter from gel with half-dried blotting or wet robin, is turned Shifting buffer formulation is 192mmol/L glycine, 25mmol/L Tris, 20% methanol.Turn by required molecular weight of albumen size Move 1-2h.It is dyed with Ponceaux (Ponceau S) and determines transfer case and protein band position.According to albumen Marker molecule Amount shears corresponding purpose band, is then closed with confining liquid (TBST of TBST or 3%BSA containing 5% skimmed milk power) room temperature 60min is incubated overnight with corresponding antibody in 4 DEG C.With TBST cleaning solution room temperature washing 3 times, each 10min.It is added with 3% The secondary antibody (1:2000) of the diluted horseradish peroxidase-labeled of BSA is incubated at room temperature 1h.Then three times with TBST rinsing, often Secondary 10min.Suitable luminescence reagent colour developing is selected according to exposure intensity, luminescence reagent includes ECL Plus Western Blot Detection system and Advance ECL immunoblotting detection system and SuperSignal West Pico Chemiluminescent Substrate.Antibody used is as shown in table 3 in the present invention.

4.4. co-immunoprecipitation

By the good SMMC-7721 or ZIP177 cell inoculation of growth conditions in 100mm culture dish, culture is for 24 hours.To thin Born of the same parents' degrees of fusion carries out subsequent experimental when being 60-70%.Change serum-free medium starvation.The Hsp90 inhibitor of respective concentration is added, makees Use 4h.1 × PBS of cell pre-cooling is washed twice, and 600 μ L 1 × RIPA lysates are added and crack 1h on ice.Period softly shakes Dynamic culture dish for several times, keeps cracking abundant.4 DEG C, 12,000 × g centrifugation 20min.After taking supernatant, BCA quantitatively to adjust neat total protein concentration, It takes a small amount of sample to be added 100 DEG C of 2 × SDS sample-loading buffer and boils 10min, as control；25 μ L are added in remaining sample ProteinA/G Agrose, 4 DEG C of vertical mixed are incubated overnight.5min is stood on ice, and 2000 × rpm is centrifuged 6min, then microballon It is washed with 500 μ 1 × RIPA of L lysates (being free of protease inhibitor cocktail).After standing 5min, 2000 × rpm centrifugation 6min removes supernatant, so repeats six times, 2 × SDS-PAGE sample-loading buffer of requirement is then added, and 100 DEG C are boiled 10min, Immunoblotting detection.

4.5.PU-H71 pearl pulls down experiment

By the good SMMC-7721 or ZIP177 cell inoculation of growth conditions in 100mm culture dish, culture is for 24 hours.To thin Born of the same parents' degrees of fusion carries out subsequent experimental when being 60-70%.1 × PBS of cell pre-cooling is washed twice, and 200 μ L Felts are added and split Solve liquid (20mM HEPES, 50mM KCl, 5mM MgCl₂, 0.01%NP-40, freshly prepared 20mM Na₂MoO₄, pH 7.2-7.3, protease inhibitor cocktail (Roche)), 1h is cracked on ice.Period softly shakes culture dish for several times, fills cracking Point.4 DEG C, 12,000 × g centrifugation 20min.After taking supernatant, BCA quantitatively to adjust neat total protein concentration, a small amount of sample is taken to be added on 2 × SDS 100 DEG C of sample buffer are boiled 10min, as control；Taking 250 μ g albumen adjustment volume is 200-300 μ L, and 80 μ L PU-H71 are added Pearl or control pearl, 4 DEG C of vertical mixed are incubated overnight.Pearl is washed with lysate, 2000 × rpm is centrifuged 6min, removes supernatant, such as This is repeated six times, and 2 × SDS-PAGE sample-loading buffer of requirement is then added, and 100 DEG C are boiled 10min, immunoblotting inspection It surveys.

4.6. Flow cytometry apoptosis

By cell such as SMMC-7721 or ZIP177 in logarithmic growth phase with 2 × 10⁵The density of cells/well is inoculated in In 6 orifice plates, contain 5%CO in 37 DEG C₂Saturated humidity incubator in overnight incubation.Drug-treated 48h is added.It is thin with pancreatin digestion Born of the same parents are simultaneously collected in 2mL centrifuge tube, and 4 DEG C of 600 × g are centrifuged 5min.Supernatant is abandoned, is withered using the Annexin V-FITC of BD company Detection kit is died, contaminates DNA with PI respectively, FITC-Annexin V contaminates phosphatidylserine (PS) and detects Apoptosis.

4.7. cell survival is tested

The liver cancer cells in logarithmic growth phase are taken to be inoculated in 96 orifice plates with the density in the hole 3000-4000/, according to real Proved recipe case is handled.Experiment terminates the TCA with pre-cooling in 4 DEG C of fixed 1h, dries in 60 DEG C of constant temperature ovens.100 μ L are added The red bright B (SRB) of benzene sulphur sieve acyl of 4mg/L is incubated for 15min.Unbonded SRB is washed away with 1% glacial acetic acid aqueous solution, in 60 DEG C of perseverances Warm baking oven drying, is added 10mmol/L Tris-HCl dissolution.Microplate reader reads 560 nm wavelength light absorption values.Inhibiting rate= (OD_{Control group}-OD_{Experimental group})/OD_{Control group}。

4.8. Nude Mice is tested in body

By human hepatocarcinoma BEL-7402, by 5 × 10⁶/ armpit on the right side of nude mouse is only inoculated respectively.Use vernier Slide calliper rule measure transplantable tumor diameter.When gross tumor volume reaches -100mm³When, animal is grouped at random, every group 6.It gives respectively 10mg/kg and 30mg/kg Ganetespib (+3.6% glucose of 10%DMSO+18% ethylene oxide castor oil+distilled water). Control group gives equivalent solvent.It is injected intraperitoneally three times a week, successive administration 4 weeks.It measures mouse weight three-times-weekly and tumour is long (L) and it is wide (W), and thus calculate gross tumor volume TV=L × W²/2.Relative tumour volume RTV=Vt/V0, Vt refer to the measurement same day Gross tumor volume, V0 shows the starting tumor volume before medicine.It is commented using Relative tumor proliferation rate T/C (%) as anti-tumor activity Valence index, T/C (%)=administration group TV/ control group that is averaged are averaged TV × 100%.The standard of curative effect evaluation: T/C% > 60% is nothing Effect；T/C%≤60% and to be statistically analyzed p < 0.05 be effective.Individual mice weight is weighed simultaneously, for evaluating drug poison Property.

4.9. patient's derivative tumors heteroplastic transplantation model (PDX model)

Tumor xenogeneic graft is directly established from patient tumors, and passes through subcutaneous transplantation to female BAl BIc/c Nude mouse (Wuxi Apptech) and routine passage.All experimental arrangements are by Wuxi Apptech management of laboratory animal and the committee of using Approval.It is about 100 to 150mm when xenograft reaches size for each model³When, P3-P5 generation is harvested from 2 mouse Xenograft post-processes them in randomization (each group, n=6).Ceritinib (ratio 1:1 is administered orally once a day 0.5% methylcellulose and 0.5% Tween 80), (0.05% carboxymethyl is fine for AZD4547 (1% Tween 80) or Dasatinib Tie up plain sodium).Ganetespib (10/18DRD (10% dimethyl sulfoxide (DMSO), 18% Cremophor are injected intraperitoneally three-times-weekly The dextrose of RH40,3.6% in water)).For combined treatment, drug is administered simultaneously.Pass through the width of each tumour of calliper to measure (W) and it is long (L), use equation V=(L × W²)/2 measure weekly three times and calculate gross tumor volume (TV).Individual Relative tumor body Product (RTV) calculates as follows: RTV=V_t/V₀, wherein V_tIt is daily volume, and V₀Represent volume when processing starts.It is indicating The RTV of number of days is shown as the average value ± SEM of mouse group instruction.At the appointed time, put to death mouse, tumor resection tissue and by its In the cold RIPA lysis buffer for being supplemented with protease and inhibitors of phosphatases (Merck, Darmstadt, Germany) Homogenate, then carries out immunoblotting in (Beyotime, Nantong, China).

4.10. statistical analysis

Significance analysis is examined using non-matching sided t between group, and p < 0.05 is considered having significant difference.Multiple groups are not analyzed Using Two-way Anova.*, p < 0.05；*, p < 0.01；* *, p < 0.001.

Embodiment 9: confirmation ALK, FGFR2 and EphA5 are the client proteins of Hsp90

Susan Lindquist research team finds the kinase interactions of Hsp90 and 60% or more.Hsp90 and client The combination of albumen depends on its albumen thermal instability.And it is numerous the study found that the key that Hsp90 regulates and controls in different systems swashs Enzyme client protein is different.It is HER2, non-small cell lung cancer in breast cancer for example, being mainly c-kit in gastrointestinal stromal tumor In be EGFR and ALK, mainly BRAF in melanoma.Therefore the critical issue to be solved is exactly, in liver cancer system, Whether Hsp90, which passes through three kinds of Key kinases, influences the growth of liver cancer.

Multiple members of research discovery FGFR and EphA family, Susan Lindquist team are client's egg of Hsp90 It is white, while also turning out that ALK and Hsp90 interacts.Protein interaction data library data show Hsp90 and ALK, EphA and FGFR family protein, which exists, be combined with each other (https: //www.picard.ch).Hsp90 is mainly distributed in cytoplasm, on a small quantity The subcellular organelles such as nucleus and mitochondria are distributed in, and ALK, EphA5 and FGFR2 are memebrane protein.There are Hsp90 and ALK, The premise that EphA5 and FGFR2 are bound directly.

PU-H71 is the Hsp90 inhibitor for coming into clinical research, is inhibited and being incorporated into the N-terminal of Hsp90 point Sub- companion's circulation, blocks Hsp90 in conjunction with client protein.2012, Gabriela Chiosis team research discovery PU-H71 Specifically combine the compound of Hsp90 and cancer protein in tumour.For example, in BCR-Abl dependence chronic myelogenous leukemia In, BCR-Abl unconventionality expression, stability dependency is in Hsp90.PU-H71 alternative is in connection, without with wild type c- Abl is combined.Therefore, PU-H71 pearl is the ideal tools for studying client protein.

Firstly, investigating endogenous Hsp90 and ALK, FGFR2 and EphA5 in liver cancer cells using co-immunoprecipitation experiment Relationship.The antibody mediated immunity of Hsp90 and three kinds of kinases precipitating and PU-H71 pearl pull down the experimental results showed that Hsp90 and ALK, FGFR2 Exist with EphA5 and interacts.These three kinases are likely to the client protein (Figure 25 and 26) of Hsp90.

Ganetespib is the most fast Hsp90 inhibitor of current clinical progress, competitively combines the N-terminal of Hsp90 Structural domain, blocker molecule companion's cyclic process, to inhibit the combination of Hsp90 and client protein.Co-immunoprecipitation experiment shows The addition Ganetespib short time handles the combination (Figure 27) that can significantly inhibit Hsp90 and ALK, FGFR2 and EphA5.

Hsp90 inhibitor blocker molecule companion's cyclic process causes client protein not by normal process maturation.False folding Albumen will be degraded by ubiquitination and through proteasome pathway.In order to further verify client's egg that three kinds of kinases are Hsp90 It is white, while inhibitor intervention and siRNA interference processing are carried out to investigate the influence to three kinds of kinase protein stability.It is added not For 24 hours, 0.1 μM of dosage can be lowered significantly for the Hsp90 inhibitor Ganetespib effect of same concentration (0.01 μM, 0.1 μM, 1 μM) ALK, FGFR2 and EphA5 protein expression (Figure 36 B).0.1 μM of Ganetespib is added and acts on 6h, 12h, for 24 hours and 48h respectively, Effect 12h lowers three kinds of kinase protein horizontal expressions as the result is shown, completely inhibits protein expression (Figure 28 A) for 24 hours.RealTime- Various concentration Ganetespib effect does not make significant difference (Figure 28 B) to three kinds of kinases mRNA level in-site expression for 24 hours to PCR as the result is shown. Show that Ganetespib lowers ALK, FGFR2 and EphA5 expression by influencing protein stability.

Protease inhibitors MG132 is degraded by the effect blocks protein of protease inhibition body through the approach.In order into One step card ALK, FGFR2 and EphA5 degrade via proteasome pathway, and 10 μM of MG132 pretreatment 6h are added, abandons supernatant, adds Enter fresh medium to wash three times, adds 0.1 μM of Ganetespib effect for 24 hours.MG132 can be reversed as the result is shown Degradation (Figure 29) of the Ganetespib to ALK, FGFR2, EphA5.

Based on the studies above, experiment, micromolecular inhibitor intervention and MG132 are pulled down using co-IP, PU-H71 pearl and is reversed in fact Verify the client protein that bright ALK, FGFR2 and EphA5 are Hsp90.Showing can be by blocking the activity of Hsp90 to reach simultaneously Inhibit the effect of ALK, FGFR2 and EphA5.In next step by main examination Hsp90 to the regulating and controlling effect and regulation machine of Hepatocarcinoma Proliferation System.

Embodiment 10: Hsp90 activity is blocked to pass through three kinds of kinase inhibition Hepatocarcinoma Proliferations of degradation

In verified liver cancer cells, ALK, FGFR2 and EphA5 are the client proteins of Hsp90 for above-mentioned experiment.

Have detected expression of the Hsp90 in liver cancer tissue.As measured by Wester blot, Hsp90 is in liver cancer group Expression in knitting is higher than normal tissue (Figure 30).

Meanwhile IHC experiment is shown in liver cancer patient, the expression of Hsp90 is positively correlated (figure with the activation levels of three kinds of kinases 31), wherein in the group of three kinds of kinases collective heights activation (column in left side), the individual amount of high Hsp90 expression relative to Overall ratio (78.1%) highest.Note, " high Hsp90 expression " are the medians relative to whole samples.

Next it will investigate whether Hsp90 passes through tri- kinds of kinases control Hepatocarcinoma Proliferations of ALK, FGFR2 and EphA5.Firstly, surveying Fixed a variety of Hsp90 inhibitor are to 6 plants of liver cancer cells ZIP177, SMMC-7721, HepG2, QGY-7703, Huh-7 and BEL- 7402 IC₅₀Value.Liver cancer cells are very sensitive to Hsp90 inhibitor as the result is shown, IC₅₀In hundred nanomole ranks, hence it is evident that be better than Clinical fiest-tire medication Sorafenib (Figure 32).Hsp90 inhibitor is also tested for the IC50 (Figure 33) of normal liver cell.

It has investigated siRNA instantaneous interference Hsp90 and influence of the Hsp90 inhibitor to hepatoma cell proliferation is added.As a result It is shown in SMMC-7721 and ZIP177 cell through RNA interference (Figure 34 A) or inhibitor (Figure 34 B) is added to block Hsp90 activity inhibits cell Proliferation significantly.

And then have detected principal biological effect caused by blocking Hsp90 activity.Using siRNA instantaneous interference Hsp90 and The Hsp90 inhibitor that various concentration (0.01 μM, 0.1 μM, 1 μM) is added handles 48h, is withered by Flow cytometry cell It dies.Gene interference (Figure 35 A) and inhibitor (Figure 35 B) cause significant Apoptosis as the result is shown.Immunoblotting knot Fruit shows that gene interference (Figure 36 A) and inhibitor (Figure 36 B) lead to ALK, FGFR2 and EphA5 protein degradation and downstream AKT, ERK and p38 signal path are lowered, while promoting PARP and Caspase3 cutting, are thus verified it in molecular level and are withered Die effect.It is also tested for influence (Figure 37) of the Ganetespib to other kinases simultaneously.

To sum up, it has investigated and has blocked Hsp90 activity using two methods of siRNA interference and inhibitor, demonstrated and inhibit Hsp90 Activity can cause ALK, FGFR2 and EphA5 protein degradation, then lower downstream p-ERK, p-AKT and p-p38 expression, promote PARP and Caspase3 cutting, it is apoptosis-induced.In vitro cellular level demonstrate Hsp90 by three kinds of Key kinases ALK, FGFR2 and EphA5 regulates and controls hepatoma cell proliferation.

Embodiment 11:Hsp90 inhibitor inhibits the growth of SMMC-7721 Nude Mice

Above-mentioned siRNA interference and micromolecular inhibitor exercising result show Hsp90 for maintain liver cancer cells survival and Be proliferated it is most important, and inhibit Hsp90 activity can by lower Key kinases ALK, FGFR2 and EphA5 activity block Hepatoma cell proliferation.

Next the internal swollen of Hsp90 inhibitor has been investigated using Hepatocellular carcinoma cell line Model in Nude Mice Tumor inhibitory activity.2 administration groups are set, give Ganetespib 10mg/kg and 30mg/kg respectively.Control group gives equivalent Solvent.It is injected intraperitoneally three times a week, successive administration 4 weeks.Ganetespib dose-dependently inhibits transplantable tumor raw as the result is shown It is long.The tumors inhibition activity of the administration group of 10mg/kg dosage is weaker, inhibiting rate 21.5%；The administration group of 30mg/kg dosage It is 87.4% with high inhibiting rate, shows that Ganetespib being capable of significant dose-dependent inhibition liver cancer In vivo model tumour life Long (Figure 38 A).Mouse weight variation is monitored simultaneously, discovery administration process does not cause significant weight to drop, and has no dead mouse, Survival state is good, illustrates Ganetespib toxic side effect very little (Figure 38 B).

Further, changed using immunoblotting detection corresponding signal access.Ganetespib dosage as the result is shown ALK, FGFR2 and EphA5 protein expression are lowered to dependence, and it is logical significantly to lower p-AKT, p-ERK and p-p38 downstream signal Road, it is consistent in vitro results (Figure 39).

So far, the present invention determined in Model in Nude Mice on cellular level and in vivo in vitro ALK, FGFR2 and EphA5 is the client protein of Hsp90, most important to Hepatocarcinoma Proliferation.The Hsp90 activity three kinds of kinases that can degrade are inhibited to reach suppression The effect of Hepatocarcinoma Proliferation processed.Present invention demonstrates feasibilities and clinical application potentiality that Hsp90 inhibitor is used for liver cancer treatment, and It has found the alternative strategy of Ceritinib, Dasatinib and AZD4547 drug combination, is mentioned for the molecular targeted therapy strategy of liver cancer New theory and realistic basis are supplied.

Embodiment 12: the vivo efficacy of kinase inhibitor and Hsp90 inhibitor in liver cancer PDX model

The present inventor also set up liver cancer PDX model with further test ALK, FGFR2 and EphA5 kinase inhibitor and The vivo efficacy of Hsp90 inhibitor.

The test result of kinase inhibitor show with compare and ALK, FGFR2 and EphA5 kinase inhibitor individually make With comparing, ALK, FGFR2 and EphA5 kinase inhibitor (Ceritinib (25mg/kg), AZD4547 (12.5mg/kg), are replaced up to sand Buddhist nun (25mg/kg)) be combined in the growth (Figure 40) for significantly inhibiting liver cancer PDX in mouse in vivo.Moreover, protein prints Mark method shows that three kinds of kinase inhibitors lower three kinds of kinases and downstream signaling pathway (Figure 41) in liver cancer PDX model.

The test result of Hsp90 inhibitor Ganetespib shows compared with the control, 30mg/kg and 50mg/kg dosage Ganetespib significantly inhibit the growth (Figure 42) of liver cancer PDX in vivo in mouse.Moreover, immunoblotting is shown Ganetespib lowers three kinds of kinases and downstream signaling pathway (Figure 43) in liver cancer PDX model.Also pass through immunoblotting Test influence (Figure 44) of the Ganetespib to other kinases in liver cancer PDX.

Invention conclusion and discussion

1. conclusion

1) present invention discover that receptor tyrosine kinase ALK, FGFR2 and EphA5 are activated jointly in liver cancer patient, under The regulation liver cancer cells survival of AKT, ERK and p38 signal path is swum, the novel targets (Figure 47) of liver cancer molecular targeted therapy are proposed.

2) the common activation of three kinds of kinases is closely related with the poor prognosis of liver cancer patient, has certain clinical value.

3) external model verifying Hsp90 inhibitor is logical by inhibition ALK, FGFR2 and EphA5 kinases and downstream signal in vivo The activity level on road and inhibit hepatoma cell proliferation, provide theories integration for liver cancer treatment for Hsp90 inhibitor.

2. discussing

2.1. therapy target is found

Since the micromolecular inhibitor Gleevec of targeting Bcr-Abl in 2001 successfully lists, antitumor research is opened point New era of sub- targeted therapy.Scientist Weinstein discovery in 2002 knocks out transcription factor c- in osteogenic sarcoma cell The phenomenon that Myc causes cell differentiation and apoptosis to generate, and this tumor development depends on some specific gene is known as " oncogene It relies on ".This discovery has greatly accelerated the development of molecular targeted therapy.Target the micromolecular inhibitor of ALK and c-Met Crizotinib enables new clinical research mode for the first time, and medication crowd is locked in the patient of EML4-ALK fusion, the drug From clinical research to successfully list only used it is 4 years short.Compared to first 41 years molecular targeted agents Gleevec used time, is one Kind greatly progress.Therefore, the driving gene for targeting " oncogene dependence " becomes the main research of clinically oncotherapy Direction.Wherein the clinical diagnosis and treatment of non-small cell lung cancer is successful model.

But liver cancer height is heterogeneous, signal path is intricate, not yet finds driving gene, this is to molecular targeted The exploitation of drug brings huge challenge.A large amount of genetic analysis result makes the gene more comprehensively recognized in liver cancer different Normal expression, it is TP53, β-catenin and reverse transcriptase of telomere that wherein the frequency of mutation is highest, cannot still be targeted at present, And driving gene common in other solid tumors such as ALK, EGFR and c-Met gene mutation rate in liver cancer is extremely low.It is comprehensive Many factors, anti-liver cancer and anti-molecular targeted agents carry out clinical research mainly or are directed to kinases, including anti-angiogenic rebirth at present The drug of c-Met, mTOR, FGFR, MEK and ERK of drug and targeting high level activation etc. is applied alone and drug combination.

Based on Status quo of clinical study, the present invention is mainly focused on overactive kinases in liver cancer.Receptor tyrosine kinase Chip detects the activation levels of kinases in liver cancer cells, it is found that the kinases activated in 5 plants or more cells has 17 kinds, and have no Mutation and amplification etc. are abnormal.This explains that specific kinase inhibitor is invalid to liver cancer and clinically kinase inhibitor to a certain extent The reason of failure.In view of the height heterogeneity of tumour, drug combination is important to block multiple important kinases to be increasingly becoming simultaneously Therapeutic strategy.

Kinases network is in the process of dynamic change in liver cancer, and random drug combination can not effectively play antitumor work With.Multiple drug combination clinical tests are caused to end in failure.In the present invention, tri- kinds of ALK, FGFR2 and EphA5 are found for the first time and is swashed Enzyme forms a core kinases group, controls the growth of liver cancer cells and transplantable tumor.Moreover, the common activation of three kinds of kinases and liver The poor prognosis of cancer patient is positively correlated, three kinds of kinases collective height activation, subgroup patient's overall survival in about 13% patient Phase is shorter.This result divides group to be of great significance for clinically liver cancer patient, is expected to become patient's diagnosis or subgroup Enrolled " predicting marker ".

2.2. therapeutic strategy is probed into

ALK/FGFR2/EphA5 is most important for the growth of liver cancer, while three kinds of kinases being inhibited to significantly inhibit liver cancer Internal outgrowth.The multiple target point drug of three kinds of kinases of exploitation while targeting is the promising approach for solving the problems, such as this.It has also needed The alternative strategy of effect.Hsp90 has become due to regulating and controlling the stability of most of tumor development associated kinase in order to which important resists Tumor targets, and it is especially effective for the tumour of kinase regulatory, carry out there are many Hsp90 inhibitor and has been merged for ALK Non-small cell lung cancer and clinical 2-3 phase of breast cancer of the HER2 positive study.The experiment proves that ALK in liver cancer, FGFR2 and EphA5 is the Very Important Person albumen of Hsp90.Block Hsp90 activity can by inhibit three kinds of Key kinases and under It swims signal path and effectively inhibits liver cancer growth.This also elaborates molecular mechanism of the Hsp90 inhibitor for liver cancer treatment, is it Application clinically provides theoretical foundation.Prior, the patient that p-ALK/p-FGFR2/p-EphA5 is activated jointly can To be the sensitive group of Hsp90 inhibitor, liver cancer target user is provided for Hsp90 inhibitor.

Generally, it present invention finds Key kinases group ALK, FGFR2 and EphA5 of regulation liver cancer destiny, verifies simultaneously The correlation of its activation and patient poor prognosis.Correspondingly, the present invention establishes the molecular targeted therapy plan for the subgroup Slightly, i.e., three kinds of kinase inhibitor drug combinations and Hsp90 inhibitor are applied alone.New side is provided for the molecular targeted therapy of liver cancer To with preliminary theoretical basis.

Claims

1. a kind of pharmaceutical composition, it includes ALK kinase inhibitor, FGFR2 kinase inhibitor and EphA5 kinase inhibitors.

2. a kind of pharmaceutical composition, it includes the inhibition of AKT signal pathway inhibitor, MEK signal pathway inhibitor and p38 signal path Agent.

3. a kind of method of the hypotype of the liver cancer in identification subject comprising measure ALK kinases in the subject, The activity level of FGFR2 kinases and EphA5 kinases.

4. a kind of method of the hypotype of the liver cancer in identification subject comprising measure AKT signal path in the subject, The activity level of MEK signal path and p38 signal path.

5.Hsp90 inhibitor is preparing the purposes in the drug for inhibiting ALK kinases, FGFR2 kinases and EphA5 kinases.

6.Hsp90 inhibitor is in preparing the drug for inhibiting AKT signal path, MEK signal path and p38 signal path Purposes.