WO2019136084A1 - Animal models for autoimmune diseases - Google Patents

Abstract

The present disclosure relates to transgenic animals. In particular, the present disclosure relates to transgenic animal models for autoimmune disease.

Description

ANIMAL MODELS FOR AUTOIMMUNE DISEASES

This application claims the benefit of U.S. provisional application Ser. No.

62/613,104, filed January 3, 2018, which is incorporated herein by reference in its entirety.

FIELD OF THE DISCLOSURE

The present disclosure relates to transgenic animals. In particular, the present disclosure relates to transgenic animal models for autoimmune disease.

BACKGROUND OF THE DISCLOSURE

Cutaneous lupus is an autoimmune disease associated with a wide range of dermatological manifestations. These skin pathologies may be presenting signs of systematic lupus, or can occur in the absence of the systematic disease. The precise cause of lupus is unknown and there are significant gaps in our understanding of the development of this complex disease. Modeling human diseases in mice can give important insight into molecular mechanisms controlling disease development as well provide a platform for testing novel therapeutics. However, there is currently no good model for cutaneous lupus in mice.

Existing models (e.g., M. Ghoreishi, J.P. Dutz, Autoimmunity Reviews 8 (2009) 484 -487; Furukawa, Journal of Dermatological Science (2003) 33, 81-89) are limited in replicating human disease.

Additional therapies and tools for the development of therapies are needed.

SUMMARY OF THE DISCLOSURE

The present disclosure relates to transgenic animals. In particular, the present disclosure relates to transgenic animal models for autoimmune disease or other diseases.

For example, in some embodiments, provided herein is a non-human transgenic animal (e.g., a mouse, rat, dog, or rabbit) comprising a genome that overexpresses vestigial- like family member 3 (VGLL3) in at least one tissue or cell type. In some embodiments, the tissue is skin and the animal displays signs or symptoms of lupus (e.g., cutaneous lupus). In some embodiments, the cell type is endothelial cells and the animal displays symptoms of sclerodema and/or pulmonary hypertension. In some embodiments, the cell type is B-cells, T- cells, or dendritic cells and the animal displays symptoms of autoimmune disease mediated by autoantibodies. In some embodiments, the VGKK3 gene is present as a constitutive, conditional or inducible transgene (e.g. via an inducible promoter, a constitutive promoter, or a reversible recombination system). Further embodiments provide a method of screening an intervention for a disease or condition, comprising: a) contacting the transgenic animal described herein with a candidate intervention; and b) determining the effect of the intervention on a disease or condition in the transgenic animal. In some embodiments, the intervention is of a drug, a lifestyle change, an alternative medicine therapy, or a combination thereof. In some embodiments, the disease is an autoimmune disease (e.g., lupus or cutaneous lupus).

Further embodiments provide a non-human transgenic animal comprising a genome that overespresses vestigial-like family member 3 (VGLL3) in at least one tissue or cell type, wherein the animal exhibits abherent gene expression relative to an animal that does not overexpress said VGLL3. In some embodiments, the abherent gene expression is female sex- biased expression. For example, in some embodiments, the abherent gene expression is overexpression of one or more of Tnfsfl3b, Ifnk, or Cxcll3.

Yet other embodiments provide use of the transgenic animals described herein to screen for an intervention for a disease or condition.

Additional embodiments provide primary or immortalized cell lines obtain from the described transgenic animals.

Additional embodiments of the present disclosure are provided in the description and examples below.

DESCRIPTION OF THE FIGURES

FIG. 1 shows histology of dorsal paw skin from control vs. Vgll3 overexpressing mouse.

FIG. 2 shows histology of ear skin from control vs. Vgll3 overexpressing mouse.

FIG. 3 shows overexpression of interferon-activated genes in skin ofVgll3- overexpressing mouse.

FIG. 4 shows a map of the pBK5 vector used to generate Vgll3 overexpressing mice.

FIG. 5 shows a nucleic acid sequence (SEQ ID NO: l) and amino acid sequence (SEQ ID NO:2) of a transgene used to generate Vgll3 overexpressing mice.

FIG. 6 shows that overexpression of Vgll3 in the epidermis produces a skin phenotype with gross and histologic features of cutaneous lupus a, Transgenic (TG) cassette. The bovine Keratin 5 ( K5 ) promoter drives polycistronic expression of the full-length mouse Vgll3 and mCherry red fluorescent protein linked by an internal ribosome entry site (IRES). b-glob, rabbit b-globin intronic sequence. pA . polyadenylation signal b, Detection of Vgll3 protein (red) by immunofluorescence (IF) in skin of female wild type (WT) and TG mice. Scale bar, 20 mih. c, Left panels, WT mouse compared to representative TG mouse with lupus-like skin rash. Right panels, bright field and fluorescence images of WT and representative lesional TG tail skin d, Hematoxylin & eosin staining of WT and TG volar skin sections demonstrating epidermal hyperplasia, basal cell vacuolization, apoptotic keratinocytes (arrowhead, magnified on inset), and dermal inflammatory infiltrate. Scale bar, 20 pm. e, TUNEL (red) staining of WT and TG tail skin sections. Scale bar, 50 pm. f, Periodic acid-Schiff staining of WT and TG dorsal

skin sections. Arrowheads, subtle basement membrane thickening. Scale bar, 20 pm. g, Detection of IgG and complement factor C3 by IF in WT and TG nonlesional neck skin.

Scale bar, 50 pm.

FIG. 7 shows that overexpression of Vgll3 in the epidermis recapitulates the autoimmunity -prone genetic signature of human female skin a, Detection of Vgll3 and target transcripts versus example nonenriched transcript Ifnb (interferon beta, rightmost) by quantitative reverse transcription polymerase chain reaction (qRT-PCR) in skin of WT and TG mice with high Vgll3 expression (more than tenfold WT 556 average). Error bars, mean ± SEM. *, p<0.05. b, Detection of Vgll3 protein targets Cxcll3 (top panel, red) and link (bottom panel, green) by IF in WT and TG skin. Blue, DNA. Scale bar, 20 pm. c, Literature- based network analysis of genes differentially expressed in nonlesional, normal-appearing TG skin relative to WT skin by RNA sequencing (RNA seq). d, Expression in nonlesional TG versus WT skin of genes dysregulated (dysreg) in discoid lupus erythematosus (DLE; p=4.0x10-10) or subacute cutaneous lupus erythematosus (SCLE; p=2.3xl0 ⁸) versus all genes. X axis, log2 fold change (FC) in TG versus WT. e, Detection of the indicated cell markers by immunohistochemistry in WT and TG ear sections. MECA, mouse endothelial cell antigen. Scale bar, 50 pm.

FIG. 8 shows that epidermal Vgll3 overexpression drives a systemic inflammatory response with B cell expansion a, Left panel, representative images of WT and TG skin draining lymph nodes (LN) and spleens. Right panel, LN and spleen weights represented as percentage of total body weight. Error bars, mean ± SEM. **, significant, with p=0.0024 (LN) and p=0.0022 (spleen) b, CyTOF data derived from single experiment consisting of 3 age- and sex-matched WT and TG mice visualized by viSNE. Left panel, viSNE maps depicting expression of select markers. Right panel, contour plot of viSNE maps colored by density of cells isolated from the specified tissues in WT and TG mice.

FIG. 9 shows that mice with skin-directed Vgll3 overexpression develop

manifestations of systemic autoimmune disease a, Differential expression in WT and TG mouse blood of genes dysregulated in SLE peripheral blood mononuclear cells (aqua) versus all genes (peach) b, Detection of circulating antinuclear antibodies (Ig) by indirect IF in HEp-2 cells in WT, TG, and positive control (+ control, aged NZM2328) serum c, Detection of circulating anti-double-stranded DNA antibodies (a-dsDNA) by enzyme-linked immunosorbent assay. ***, significantly increased in transgenic sera at p=0.0005. d, Detection of IgG (red) and complement factor C3 (green) by IF in WT and TG glomeruli. Blue, DNA. Scale bar, 20 pm.

FIG. 10 shows that skin-directed Vgll3 overexpression leads to epidermal hyperplasia and

cutaneous inflammation a, Mouse Vgll3 shows 87% protein sequence homology to human VGLL3, including 100% sequence identity of the Vestigial/Tondu putative DNA-binding domain (pfam07545). b, Detection of endogenous Vgll3 mRNA in skin of male (N=4) and female (N=4) WT mice by qRT-PCR. P=0.053. c, Additional images of TG mice at time of euthanasia d, Hematoxylin & eosin staining of additional site-matched WT and TG sections showing characteristic changes of epidermal acanthosis, pigmentary incontinence, and variable inflammation. Scale bar, 50 pm. e, Average epidermal thickness in WT and TG skin from the

specified sites (nonlesional, grossly normal posterior dorsal skin) f, Volar sections demonstrating neutrophilic dermal infiltration and exocytosis into the epidermis occasionally seen in TG lesional sections. Scale bar, 20 pm.

FIG. 11 shows that genes dysregulated in skin of K5-Vgll3 TG mice are enriched for immunological functions a, Detection of additional target transcripts by qRT-PCR in nonlesional dorsal skin of WT and TG mice with high Vgll3 expression (more than tenfold WT average). Error bars, mean ± SEM. *, p<0.05. b, Relative detection of Vgll3 and target transcripts by RNA-seq of nonlesional, normal-appearing dorsal skin of age- and sex matched WT (N=4) and TG (N=4) mice. *, QO. l. c, Select immunological Gene Ontology terms highly enriched in TG non-lesional skin.

FIG. 12 shows expansion of immune cell populations in the K5-Vgll3 transgenic mouse.

FIG. 13 shows characterization of systemic inflammation in the K5-Vgll3 transgenic mouse by CyTOF, complete panel. Top, viSNE maps depicting expression of all markers. Bottom, contour plot of viSNE maps colored by density of cells isolated from the specified tissues in WT and TG mice. FIG. 14 shows a comparison of CyTOF-derived SPADE populations in WT and TG by

tissue a, SPADE trees for the indicated tissue types colored to show whether the relative number of cells in each node is enriched in WT (yellow) or TG (blue) samples b, Heat map for

all markers with populations numbered according to SPADE tree key.

DEFINITIONS

To facilitate an understanding of the present disclosure, a number of terms and phrases are defined below:

As used herein, the term "animal" refers to any animal (e.g., a mammal), including, but not limited to, humans, non-human primates, rodents (e.g., mice, rats, etc.), flies, and the like.

As used herein, the term "non-human animals" refers to all non-human animals including, but are not limited to, vertebrates such as rodents, non-human primates, ovines, bovines, ruminants, lagomorphs, porcines, caprines, equines, canines, felines, aves, etc.

The term "transgene" as used herein refers to a foreign, heterologous, or autologous gene that is placed into an organism (e.g., by introducing the gene into newly fertilized eggs or early embryos). The term "foreign gene" refers to any nucleic acid (e.g., gene sequence) that is introduced into the genome of an animal by experimental manipulations and may include gene sequences found in that animal so long as the introduced gene does not reside in the same location as does the naturally-occurring gene.

As used herein, the term "transgenic animal" refers to any animal containing a transgene.

As used herein, the term "gene transfer system" refers to any means of delivering a composition comprising a nucleic acid sequence to a cell or tissue. For example, gene transfer systems include, but are not limited to, vectors (e.g., retroviral, adenoviral, adeno- associated viral, and other nucleic acid-based delivery systems), microinjection of naked nucleic acid, polymer-based delivery systems (e.g., liposome-based and metallic particle- based systems), biolistic injection, and the like. As used herein, the term "viral gene transfer system" refers to gene transfer systems comprising viral elements (e.g., intact viruses, modified viruses and viral components such as nucleic acids or proteins) to facilitate delivery of the sample to a desired cell or tissue. As used herein, the term "adenovirus gene transfer system" refers to gene transfer systems comprising intact or altered viruses belonging to the family Adenoviridae. As used herein, the term "site-specific recombination target sequences" refers to nucleic acid sequences that provide recognition sequences for recombination factors and the location where recombination takes place.

As used herein, the term "nucleic acid molecule" refers to any nucleic acid containing molecule, including but not limited to, DNA or RNA. The term encompasses sequences that include any of the known base analogs of DNA and RNA including, but not limited to,

4-acetylcytosine, 8-hydroxy-N6-methyladenosine, aziridinylcytosine, pseudoisocytosine,

5-(carboxyhydroxylmethyl) uracil, 5-fluorouracil, 5-bromouracil, 5- carboxymethylaminomethyl-2-thiouracil, 5-carboxymethylaminomethyluracil, dihydrouracil, inosine, N6-isopentenyladenine, 1 -methyladenine, 1 -methylpseudouracil, 1 -methylguanine, l-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-methyladenine, 7-methylguanine, 5-methylaminomethyluracil, 5- methoxyaminomethyl-2-thiouracil, beta-D-mannosylqueosine,

5'-methoxycarbonylmethyluracil, 5-methoxyuracil, 2-methylthio-N6-isopentenyladenine, uracil-5-oxyacetic acid methylester, uracil-5-oxyacetic acid, oxybutoxosine, pseudouracil, queosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, N- uracil-5-oxyacetic acid methylester, uracil-5-oxyacetic acid, pseudouracil, queosine, 2- thiocytosine, and 2,6-diaminopurine.

The term "gene" refers to a nucleic acid ( e.g ., DNA) sequence that comprises coding sequences necessary for the production of a polypeptide, precursor, or RNA (e.g., rRNA, tRNA). The polypeptide can be encoded by a full length coding sequence or by any portion of the coding sequence so long as the desired activity or functional properties (e.g., enzymatic activity, ligand binding, signal transduction, immunogenicity, etc.) of the full-length or fragment are retained. The term also encompasses the coding region of a structural gene and the sequences located adjacent to the coding region on both the 5' and 3' ends for a distance of about 1 kb or more on either end such that the gene corresponds to the length of the full- length mRNA. Sequences located 5' of the coding region and present on the mRNA are referred to as 5' non-translated sequences. Sequences located 3' or downstream of the coding region and present on the mRNA are referred to as 3' non-translated sequences. The term "gene" encompasses both cDNA and genomic forms of a gene. A genomic form or clone of a gene contains the coding region interrupted with non-coding sequences termed "introns" or "intervening regions" or "intervening sequences." Introns are segments of a gene that are transcribed into nuclear RNA (hnRNA); introns may contain regulatory elements such as enhancers. Introns are removed or "spliced out" from the nuclear or primary transcript; introns therefore are absent in the messenger RNA (mRNA) transcript. The mRNA functions during translation to specify the sequence or order of amino acids in a nascent polypeptide.

As used herein, the term "heterologous gene" refers to a gene that is not in its natural environment. For example, a heterologous gene includes a gene from one species introduced into another species. A heterologous gene also includes a gene native to an organism that has been altered in some way (e.g., mutated, added in multiple copies, linked to non-native regulatory sequences, etc). Heterologous genes are distinguished from endogenous genes in that the heterologous gene sequences are typically joined to DNA sequences that are not found naturally associated with the gene sequences in the chromosome or are associated with portions of the chromosome not found in nature (e.g., genes expressed in loci where the gene is not normally expressed).

As used herein, the term "oligonucleotide," refers to a short length of single-stranded polynucleotide chain. Oligonucleotides are typically less than 200 residues long (e.g., between 15 and 100), however, as used herein, the term is also intended to encompass longer polynucleotide chains. Oligonucleotides are often referred to by their length. For example a 24 residue oligonucleotide is referred to as a "24-mer". Oligonucleotides can form secondary and tertiary structures by self-hybridizing or by hybridizing to other polynucleotides. Such structures can include, but are not limited to, duplexes, hairpins, cruciforms, bends, and triplexes.

The term "isolated" when used in relation to a nucleic acid, as in "an isolated oligonucleotide" or "isolated polynucleotide" refers to a nucleic acid sequence that is identified and separated from at least one component or contaminant with which it is ordinarily associated in its natural source. Isolated nucleic acid is such present in a form or setting that is different from that in which it is found in nature. In contrast, non-isolated nucleic acids as nucleic acids such as DNA and RNA found in the state they exist in nature. For example, a given DNA sequence (e.g., a gene) is found on the host cell chromosome in proximity to neighboring genes; RNA sequences, such as a specific mRNA sequence encoding a specific protein, are found in the cell as a mixture with numerous other mRNAs that encode a multitude of proteins. However, isolated nucleic acid encoding a given protein includes, by way of example, such nucleic acid in cells ordinarily expressing the given protein where the nucleic acid is in a chromosomal location different from that of natural cells, or is otherwise flanked by a different nucleic acid sequence than that found in nature. The isolated nucleic acid, oligonucleotide, or polynucleotide may be present in single- stranded or double-stranded form. When an isolated nucleic acid, oligonucleotide or polynucleotide is to be utilized to express a protein, the oligonucleotide or polynucleotide will contain at a minimum the sense or coding strand (i.e., the oligonucleotide or polynucleotide may be single-stranded), but may contain both the sense and anti-sense strands (i.e., the oligonucleotide or polynucleotide may be double-stranded).

As used herein, the term "purified" or "to purify" refers to the removal of components (e.g., contaminants) from a sample. For example, antibodies are purified by removal of contaminating non-immunoglobulin proteins; they are also purified by the removal of immunoglobulin that does not bind to the target molecule. The removal of non

immunoglobulin proteins and/or the removal of immunoglobulins that do not bind to the target molecule results in an increase in the percent of target-reactive immunoglobulins in the sample. In another example, recombinant polypeptides are expressed in bacterial host cells and the polypeptides are purified by the removal of host cell proteins; the percent of recombinant polypeptides is thereby increased in the sample.

DETAILED DESCRIPTION OF THE DISCLOSURE

The present disclosure relates to transgenic animals. In particular, the present disclosure relates to transgenic animal models for autoimmune disease.

Autoimmune diseases affect 7.5% of the US population, and they are among the leading causes of death and disability. A notable feature of many autoimmune diseases is their greater prevalence in females than in males, but the underlying mechanisms of this have remained unclear. Through the use of high-resolution global transcriptome analyses, experiments described herein demonstrated a female-biased molecular signature associated with susceptibility to autoimmune disease and linked this to extensive sex-dependent co expression networks. This signature was independent of biological age and sex-hormone regulation and was regulated by the transcription factor VGLL3, which also had a strong female-biased expression. On a genome-wide level, VGLL3 -regulated genes had a strong association with multiple autoimmune diseases, including lupus, scleroderma and Sjogren’s syndrome, and had a prominent transcriptomic overlap with inflammatory processes in cutaneous lupus. These results identified a VGLL3-regulated network as a previously unknown inflammatory pathway that promotes female-biased autoimmunity. They demonstrate the importance of studying immunological processes in females and males separately and provide new avenues for therapeutic development (Liang et al., 2017 18: 152).

The present disclosure contemplates the generation of transgenic animals that over or under express VGLL3 in one or more tissues. In some embodiments, transgenic animals display an altered phenotype (e.g., presence of lupus (e.g., cutaneous lupus) as compared to wild-type animals). Methods for analyzing the presence or absence of such phenotypes include but are not limited to, those disclosed herein. Exemplary transgenic animals of the present disclosure are described in Example 1 below.

In some embodiments, the transgene comprises SEQ ID NO: l or sequences with at least 80% homology to SEQ ID NO: l. In some embodiments, variants that encode latered VGLL3 polypeptides (e.g., SEQ ID NO:2 or sequences as laeast 80% (e.g., 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%) identical to SEQ ID NO:2) (e.g., that alter activity or expression of VGLL3) are utilized.

In some embodiments, conservative or non-conservative substitutions are made. For example, it is contemplated that isolated replacement of a leucine with an isoleucine or valine, an aspartate with a glutamate, a threonine with a serine, or a similar replacement of an amino acid with a structurally related amino acid (e.g., conservative mutations) will not have a major effect on the biological activity of the resulting molecule. Conservative replacements are those that take place within a family of amino acids that are related in their side chains. Genetically encoded amino acids can be divided into four families: (1) acidic (aspartate, glutamate); (2) basic (lysine, arginine, histidine); (3) nonpolar (alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan); and (4) uncharged polar (glycine, asparagine, glutamine, cysteine, serine, threonine, tyrosine). Phenylalanine, tryptophan, histidine, and tyrosine are sometimes classified jointly as aromatic amino acids. In similar fashion, the amino acid repertoire can be grouped as (1) acidic (aspartate, glutamate); (2) basic (lysine, arginine, histidine), (3) aliphatic (glycine, alanine, valine, leucine, isoleucine, serine, threonine), with serine and threonine optionally be grouped separately as aliphatic hydroxyl; (4) aromatic (phenylalanine, tyrosine, tryptophan); (5) amide (asparagine, glutamine); and (6) sulfur containing (cysteine and methionine) (e.g., Stryer ed.,

Biochemistry, pg. 17-21, 2nd ed, WH Freeman and Co., 1981).

"Nonconservative" changes (e.g., replacement of a glycine with a tryptophan) are also contemplated. Analogous minor variations can also include amino acid deletions or insertions, or both. Guidance in determining which amino acid residues can be substituted, inserted, or deleted without abolishing biological activity can be found using computer programs (e.g., LASERGENE software, DNASTAR Inc., Madison, Wis.).

In some embodiments, VGLL3 is expressed (e.g., over or under expressed) in specific cell types of a transgenic animal. For example, in some embodiments, VGLL3 is expressed in endothelial cells. In some embodiments, such animals develop sclerodema-like features and pulmonary hypertension. In some embodiments, VGLL3 is expressed in immune system cells (e.g., B-cells, T-cells, or dendritic cells). In some embodiments, such animal develop autoimmune diseases mediated by autoantibodies.

In some embodiments, tissue specific promoters are utilized to direct expression of VGLL3 in endothelial cells, immune cells, or skin cells. Exemplary promoters include, but are not limited to, BK5 promoter, Keratin 14 promoter, filaggrin promoter, transglutaminase 3 promoter, CDl lc promoter, fascin promoter, fms-like tyrosine kinase-l (FLT-l) promoter, intercellular adhesion molecule-2 (ICAM-2) promoter, von Willebrand factor (vWF) promoter, and Integrin, alpha M (ITGAM) promoter, although other promoters may be utilized.

In some embodiments, inducible promoters are utilized to control expression of VGLL3. Examples include, but are not limited to, tetracycline-inducible systems (See e.g., Liu et al, Methods Mol Biol. 2013; 1027; herein incorporated by reference in its entirety).

In some embodiments, the VGLL3 gene is present as a conditional transgene. For example, in some embodiments, Cre/Lox or Flp recombinase-mediated modifications are used to allow for inducible knockout (See e.g., Ryding, Journal of Endocrinology (2001) 171, 1-14; herein incorporated by reference in its entirety).

In some embodiments, CRISPR/Cas 9 systems are used to generate transgenic animals (See e.g., Zhang F, Wen Y, Guo X (2014) Human Molecular Genetics. 23 (Rl): R40-6; herein incorporated by reference in its entirety).

The transgenic animals of the present disclosure find use in drug (e.g., autoimmune disease therapy) screens. In some embodiments, test compounds (e.g., a drug that is suspected of being useful to treat an autoimmune disease such as lupus (e.g., cutaneous lupus)) and control compounds (e.g., a placebo) are administered to the transgenic animals and the control animals and the effects evaluated.

The transgenic animals can be generated via a variety of methods. In some embodiments, embryonal cells at various developmental stages are used to introduce transgenes for the production of transgenic animals. Different methods are used depending on the stage of development of the embryonal cell. The zygote is the best target for micro injection. In the mouse, the male pronucleus reaches the size of approximately 20 micrometers in diameter that allows reproducible injection of 1-2 picoliters (pl) of DNA solution. The use of zygotes as a target for gene transfer has a major advantage in that in most cases the injected DNA will be incorporated into the host genome before the first cleavage (Brinster et a/., Proc. Natl. Acad. Sci. USA 82:4438-4442 (1985)). As a consequence, all cells of the transgenic non-human animal will carry the incorporated transgene. This will in general also be reflected in the efficient transmission of the transgene to offspring of the founder since 50% of the germ cells will harbor the transgene. U.S. Pat. No. 4,873,191 describes a method for the micro-injection of zygotes; the disclosure of this patent is incorporated herein in its entirety. Additional methods for generating transgenic animal are described, for example, in Palmiter, Ann. Rev. Genet. 20:465-99 (1986); Gordon, Methods in enzymology, vol.225; and Camper, Biotechniques. Vol 5. No 7. (1987); each of which is herein incorporated by reference in its entirety.

In other embodiments, retroviral infection is used to introduce transgenes into a non human animal. In some embodiments, the retroviral vector is utilized to transfect oocytes by injecting the retroviral vector into the perivitelline space of the oocyte (U.S. Pat. No.

6,080,912, incorporated herein by reference). In other embodiments, the developing non human embryo can be cultured in vitro to the blastocyst stage. During this time, the blastomeres can be targets for retroviral infection (Janenich, Proc. Natl. Acad. Sci. USA 73: 1260 (1976)). Efficient infection of the blastomeres is obtained by enzymatic treatment to remove the zona pellucida (Hogan et al. , in Manipulating the Mouse Embryo, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1986)). The viral vector system used to introduce the transgene is typically a replication-defective retrovirus carrying the transgene (Jahner et al, Proc. Natl. Acad Sci. USA 82:6927 (1985)). Transfection is easily and efficiently obtained by culturing the blastomeres on a monolayer of virus-producing cells (Stewart, et al, EMBO I, 6:383 (1987)). Alternatively, infection can be performed at a later stage. Virus or virus-producing cells can be injected into the blastocoele (Jahner et al,

Nature 298:623 (1982)). Most of the founders will be mosaic for the transgene since incorporation occurs only in a subset of cells that form the transgenic animal. Further, the founder may contain various retroviral insertions of the transgene at different positions in the genome that generally will segregate in the offspring. In addition, it is also possible to introduce transgenes into the germline, albeit with low efficiency, by intrauterine retroviral infection of the midgestation embryo (Jahner et al, supra (1982)). Additional means of using retroviruses or retroviral vectors to create transgenic animals known to the art involve the micro-injection of retroviral particles or mitomycin C-treated cells producing retrovirus into the perivitelline space of fertilized eggs or early embryos (PCT International Application WO 90/08832 (1990), and Haskell and Bowen, Mol. Reprod. Dev., 40:386 (1995)).

In other embodiments, the transgene is introduced into embryonic stem cells and the transfected stem cells are utilized to form an embryo. ES cells are obtained by culturing pre- implantation embryos in vitro under appropriate conditions (Evans et al., Nature 292: 154 (1981); Bradley et al, Nature 309:255 (1984); Gossler et al. , Proc. Acad. Sci. USA 83:9065 (1986); and Robertson et al, Nature 322:445 (1986)). Transgenes can be efficiently introduced into the ES cells by DNA transfection by a variety of methods known to the art including calcium phosphate co-precipitation, protoplast or spheroplast fusion, lipofection and DEAE-dextran-mediated transfection. Transgenes may also be introduced into ES cells by retrovirus-mediated transduction or by micro-injection. Such transfected ES cells can thereafter colonize an embryo following their introduction into the blastocoel of a blastocyst- stage embryo and contribute to the germ line of the resulting chimeric animal (for review,

See, Jaenisch, Science 240: 1468 (1988)). Prior to the introduction of transfected ES cells into the blastocoel, the transfected ES cells may be subjected to various selection protocols to enrich for ES cells which have integrated the transgene assuming that the transgene provides a means for such selection. Alternatively, the polymerase chain reaction may be used to screen for ES cells that have integrated the transgene. This technique obviates the need for growth of the transfected ES cells under appropriate selective conditions prior to transfer into the blastocoel.

In still other embodiments, homologous recombination is utilized to knock-out gene function or create deletion mutants (e.g., truncation mutants). Methods for homologous recombination are described in U.S. Pat. No. 5,614,396, incorporated herein by reference.

In some embodiments, the present disclosure provides drug screening assays (e.g., to screen for drugs to treat autoimmune disease).

Specifically, the present disclosure provides screening methods for identifying modulators, i.e., candidate or test compounds or agents (e.g., proteins, peptides,

peptidomimetics, peptoids, small molecules or other drugs) which decrease symptoms of autoimmune disease.

In certain embodiments, drug screening methods of the present disclosure utilize VGLL3 overexpressing transgenic animals or cell lines (e.g. primary or immortalized cell lines) derived from such animals. In some embodiments, the transgenic animals exhibit cutaneous lupus. For example, in some embodiments, test compounds are administered to transgenic animals of the present disclosure and the effect of the test compound on transgene expression and/or function is assayed. In other embodiments, test compounds are administered to transgenic animals of the present disclosure and the effect of the test compound on autominnue disease in the animal is assessed. The test compounds of the present disclosure can be obtained using any suitable method, including biological libraries; peptoid libraries (libraries of molecules having the functionalities of peptides, but with a novel, non-peptide backbone, which are resistant to enzymatic degradation but which nevertheless remain bioactive; see, e.g., Zuckennann et al., J. Med. Chem. 37: 2678-85 (1994)); spatially addressable parallel solid phase or solution phase libraries; synthetic library methods requiring deconvolution; the 'one-bead one- compound' library method; and synthetic library methods using affinity chromatography selection. The biological library and peptoid library approaches are preferred for use with peptide libraries, while the other four approaches are applicable to peptide, non-peptide oligomer or small molecule libraries of compounds (Lam (1997) Anticancer Drug Des. 12: 145).

Examples of methods for the synthesis of molecular libraries can be found in the art, for example in: DeWitt et al, Proc. Natl. Acad. Sci. U.S.A. 90:6909 (1993); Erb et al, Proc. Nad. Acad. Sci. USA 91 : 11422 (1994); Zuckermann et al, J. Med. Chem. 37:2678 (1994); Cho et al, Science 261: 1303 (1993); Carrell et al, Angew. Chem. Int. Ed. Engl. 33.2059 (1994); Carell et al, Angew. Chem. Int. Ed. Engl. 33:2061 (1994); and Gallop et al, J. Med. Chem. 37: 1233 (1994).

Libraries of compounds may be presented in solution (e.g., Houghten, Biotechniques 13:412-421 (1992)), or on beads (Lam, Nature 354:82-84 (1991)), chips (Fodor, Nature 364:555-556 (1993)), bacteria or spores (U.S. Pat. No. 5,223,409; herein incorporated by reference), plasmids (Cull et al, Proc. Nad. Acad. Sci. USA 89: 18651869 (1992)) or on phage (Scott and Smith, Science 249:386-390 (1990); Devlin Science 249:404-406 (1990); Cwirla et al, Proc. Natl. Acad. Sci. 87:6378-6382 (1990); Felici, J. Mol. Biol. 222:301 (1991)).

In some embodiments, test compound are candidate lupus therapies or interventions (e.g., including but not limited to, non-steroidal anti-inflammatory agents, anti-malarial drug, corticosteroids (system and topical), immunosuppressants, biologies, alternative medicine (e.g., DHEA, fish oil, acupuncture), dietary changes, lifestyle changes, and combinations thereof).

Embodiments of this disclosure further pertain to novel agents identified by the above- described screening methods. EXPERIMENTAL

The following examples are provided in order to demonstrate and further illustrate certain preferred embodiments and aspects of the present disclosure and are not to be construed as limiting the scope thereof.

Example 1

Transgenic animals were generated using the transgene shown in FIGs 4-5. The VGLL3 gene is inserted into the transgene shown in FIG. 4 between the beta-globin intron and the PolyA tail and the resulting transgene was interested into the Kpnl cloning site of Bluescript KS (-) to generate pBK5. DNA was prepared and microinjected into fertilized mouse eggs. Transgenic mice were identified using PCR, and bred to produce offspring. Figures 1-3 show results obtained from transgenic animals that overexpress Vgll3. FIG. 1 shows histology of dorsal paw skin from control vs. Vgll3 overexpressing mouse. FIG. 2 shows histology of ear skin from control vs. Vgll3 overexpressing mouse. FIG. 3 shows overexpression of interferon-activated genes in skin of Vgll3-overexpressing mouse. Via immunofluorescence, increased apoptosis in tail and ear skin of Vgll3 overexpressing mice compared to control was observed. Via immunofluorescence, Ig deposits were detected in the skin of Vgll3 overexpressing mice.

Example 2

Methods

Mice and primary keratinocyte isolation and culture

The K5-Vgll3-IRES- mCherry ( K5-Vgll3 ) transgenic cassette was generated as follows: The Vgll3-lRES-mCherry insert was synthesized de novo by GenScript and subcloned into the pBK5 vector (Ramirez et al, Differentiation 58, 53-64,

doi: 10.1046/j .1432-0436.1994.5810053. x (1994)). Vgll3 coding sequence was taken from NCBI Reference Sequence NM_028572. l. mCherry coding sequence was taken from GenBank Accession No. AY678264 nt 1-71121. Following sequence verification, the transgenic cassette was isolated by restriction enzyme digest, purified, and injected into C57BL/6 mouse oocytes in the University of Michigan Transgenic Core. All mice were housed and maintained according to University of Michigan IACUC guidelines under animal protocol #PR000006657. Offspring were genotyped using the following PCR primers: Forward: 5’ ATCGTGCCAAGTGTGGGCTTCGATACA 3’ ((SEQ ID NO:3) (located in the Vgll3 coding sequence), Reverse: 5’

CACATTGCCAAAAGACGGCAATATGG 3’(SEQ ID NO:4) (located in the IRES).

Primary keratinocytes were isolated as previously described (Shaner et al, Nat Biotechnol 22, 1567-1572, doi: l0. l038/nbtl037 (2004)) with the following change: skin was incubated for 1.5 hours at 37°C rather than overnight at 4°C. Cells were expanded in culture for 3 days and harvested for RNA using Buffer RLT (Qiagen) per the

manufacturer’s protocol.

Tissue collection

For harvest of tissues for generating RNA and frozen or paraffin sectioning, transgenic mice and wild type (WT) controls were euthanized at 8 weeks of age or older. Whole blood was obtained by cardiac stick and RNA isolated using the Mouse RiboPure- Blood RNA Isolation Kit (Thermo Fisher Scientific) or TriPure Isolation Reagent (MilliporeSigma) per manufacturer protocols. Nonlesional skin was removed from the lower back by punch biopsy. Ears were removed in entirety. Skin from the indicated sites was otherwise harvested and processed as previously described (Johnston, A. et al. J Immunol 190, 2252-2262, doi: l 0.4049/jimmunol.1201505 (2013)). For harvest of tissues for mass cytometry (CyTOF) and flow cytometry, sex-matched transgenic and WT littermates were sacrificed at 8 weeks of age or older. Ears, spleen, and skin-draining (cervical and inguinal) lymph nodes were removed in entirety. The ear and dorsal skin samples were minced with a sterile razor and transferred to l8ml RPMI (Gibco) containing 10% fetal calf serum (Atlanta Biologicals) and 1% Penicillin-Streptomycin (Gibco) (hereafter, RPMI complete media). To each sample, 2ml of a skin digestion solution consisting of Hanks’ Balanced Salt Solution (Gibco) with lmg/ml DNAse I (Sigma-Aldrich), lmg/ml Hyaluronidase type V (Sigma-Aldrich), and 5mg/ml

Collagenase type IV (Sigma-Aldrich) was added. Samples were rotated for 2 hours at 37°C to digest. Following digestion, samples were filtered through a 40 pm cell strainer, washed with fresh RPMI complete media, and incubated on ice. Spleens and lymph nodes (4 lymph nodes combined for each animal) were weighed before being ground through a 70 pm cell strainer and suspended in RPMI complete media. For spleen samples, media was removed, and cells were incubated in RBC lysis buffer (Invitrogen) for two minutes (min). Lysis buffer was removed, and spleen samples were resuspended in fresh RPMI complete media. Quantitative reverse transcription polymerase chain reaction (qRT-PCR) and statistical analysis

RNA was converted to cDNA using a High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems). qRT-PCR was performed using TaqMan Universal PCR Master Mix (Applied Biosystems). TaqMan primer sets and probes were purchased from Applied Biosystems by Life Technologies and are listed in Table 1. All values were normalized to the housekeeping gene 18S. All qRT-PCR data are presented as mean ± SEM. Data were tested for statistical significance using two tailed Student t test assuming

homoscedasticity. For Fig. 7a, p values calculated for 3 WT and 2 TG biological replicates were as follows: Vgll3, 0.039; Statl, 0.018; Ly6c, 0.014; 117, 5.2xl0 ⁵; Ifnk, 0.045;

Tnfsfol3/BAFF, 0.018; Ifnb, 0.574. For Fig. 11a, p values calculated for 4 WT and 2 TG biological replicates were as follows: C3, 0.089; Fas, 0.013; FasL, 0.0071; Cxcl9, 0.031; CxcllO, 0.17; Cxcll3, 2. lxl0 ⁶. These data are representative of at least two independent experiments.

Table 1

RNA-sequencing (RNA-seq) and gene expression analyses Stranded mRNA libraries were prepared from nonlesional (posterior dorsal) skin, cultured keratinocytes, and whole blood from age- and sex-matched WT and TG mice (2 male and 2 female each) using the TruSeq RNA library prep kit (Illumina) and sequenced on the Illumina HiSeq 4000 sequencer by the University of Michigan DNA Sequencing Core. Data were quality controlled and analyzed using the pipeline described previously for RNA-seq analysis, including adapter trimming (Bolger et al, Bioinformatics 30, 2114- 2120, doi: l0. l093/bioinformatics/btul70 (2014)), read mapping, and quantification of gene expression (Anders et al, Bioinformatics 31, 166-169,

doi: l0.l093/bioinformatics/btu638 (2015)). The GENCODE release ml8 (GRCm38) from mouse was used. Samples were for average abundance of > 1 read per gene across all samples. DESeq was used for expression normalization. Generalized linear regression was used for differential expression analysis using negative binomial distribution to model the count data (Love et al, Genome Biol 15, 550, doi: l0. H86/sl3059-0l4-0550-8 (2014)). False discovery rate (FDR) was used to control the multiple testing. DEGs were defined as having FDR<l0% and with |log2Fold Change|>l. Data were tested for normality and statistical significance calculated using either a two-tailed Student t test, Mann- Whitney U test, or Friedman’s test, as appropriate. Significance was defined as p<0.05. Literature- based network analysis was performed using the Genomatix Pathway System (GePS) Software (www.genomatix.de). For Fig. lib, Q values were as follows: C3, 2.4x10-5;

Fas, 9.7xl0 ³; Fasl, 0.71; Cxcl9, 0.021; CxcllO, 0.014; Statl, 5.3x10-4; Ly6d, 0.060; Ly6c2 0.19; 117, 0.024; Tnfsfl 3 3 AFF, 5.1x10-8; Vgll3, 0.025.

For identification of genes dysregulated in discoid (DLE) and subacute cutaneous lupus erythematosus (SCLE), microarray data from 26 DLE and 23 SCLE lesional skin biopsies and 7 normal skin biopsies (GSE81071) were utilized to identify genes that are differentially expressed in DLE and SCLE skin (termed dysregulated in text to avoid confusion with transgenic DEGs) at the FDR<l0% and with |log2Fold Change|>l threshold. For identification of genes dysregulated in blood of systemic lupus

erythematosus (SLE) patients, RNA-seq data from whole blood of 99 SLE and 18 healthy control patients were analyzed as above and used to identify genes that are differentially expressed in blood of

SLE patients (termed dysregulated in text to avoid confusion with transgenic DEGs). Analysis was performed only for genes expressed in at least 20% of the normal samples. For investigation of target overlap with DLE and SCLE skin and SLE blood, only genes with identical names in mouse and human were included. Data availability

The RNA-seq data sets have been deposited in the Gene Expression Omnibus database.

Histology and immunostaining

Hematoxylin (Surgipath, 3801540) & eosin (Surgipath, 3801600) (H&E) staining was performed per standard protocols. Epidermal thickness was quantified on the H&E stained sections using Adobe Photoshop. For each animal, -100 measurements were taken from 8 different fields of view for each section analyzed. Epidermal thickness was measured from the stratum basale to stratum granulosum, excluding the stratum comeum and hair follicles for each animal.

Immunofluorescence (IF) to detect Vgll3 and target proteins was performed as follows: For Cxcll3 detection, formalin fixed, paraffin-embedded tissue sections were deparaffmized, rehydrated, and heated at 95°C for 20 min in pH 6 antigen retrieval buffer. Slides were blocked and incubated with goat anti-mouse Cxcll3 antibody (R&D system, AF470-SP)) overnight at 4°C. For Vgll3 and Ifiik detection, cryosections were subjected to acetone fixation. Slides were blocked and incubated with rabbit anti mouse Vgll3 antibody (St John’s Laboratory, STJ115228) or sheep anti-mouse interferon kappa antibody (R&D system, AF5206), respectively. All slides were then incubated with biotinylated secondary antibodies (Vector Laboratories) as appropriate, incubated with fluorochrome-conjugated streptavidin (Streptavidin, Alexa Fluor 488 conjugate (Fisher Scientific, S32354) or Streptavidin, Alexa Fluor 594 conjugate (Life Technologies, S32356)) as appropriate, and mounted. Images were acquired using Zeiss Axioskop 2 microscope and analyzed by SPOT software V.5.1. Periodic acid-Schiff staining of paraffin sections was performed as per Sigma Periodic Acid Staining Procedure. TUNEL staining of paraffin sections was performed using the In Situ Cell Death Detection Kit, TMR red (Roche). Slides were mounted with ProLong Gold Antifade Mountant with DAPI. IF of immune complex components was performed as follows: Slides with tissue cryosections were dried for 1 hour at 37°C, incubated in 4% paraformaldehyde for 20 min, and blocked. C3-FITC (ICL, GC3-90F-Z) and IgG-Texas Red-X (Thermo Fisher Scientific, T-862) goat anti-mouse antibodies were then added, and slides were incubated at 4°C for 1 hour.

Hoechst stain (BD Biosciences, 561906) was added. Slides were dried and mounted using ProLong Gold Antifade Mountant (Thermo Fisher Scientific). Images were captured as above.

Immunohistochemistry of frozen sections was performed as previously described (Johnston et al, supra) using antibodies specific for CD4 (BD Biosciences, 550280),

CD8a (BD Biosciences, 550821), CDl lc (BD Biosciences, 550283), Cdl9 (BD

Biosciences, 550284), F4/80 (eBioscience, 14-4801-82), Ki-67 (DAKO, M7249), and Meca-32 (Developmental Studies Hybridoma Bank, MECA-32-s). Antibodies were detected using either rabbit anti-rat IgG biotinylated, goat anti-rabbit IgG biotinylated (Vector Laboratories), or rabbit anti -hamster IgG biotinylated (Southern Biotech) secondary antibodies, amplified with Avidin/Biotinylated Enzyme Complex (Vector), and visualized using the enzyme substrate diaminobenzidine (Vector). Slides were counterstained with hematoxylin. Images were captured using a Leica DM L82 microscope with an atached Q Imaging MicroPubbsher 3.3 Mega Pixel camera and Q368 capture Pro software. For detection of antinuclear antibodies, serum was diluted 1 :50 and used for indirect IF on Kallestad® HEp-2 Slides (Bio-Rad) with FITC goat anti-mouse Ig antibody (BD Biosciences) as the detection reagent. For all histology and staining, data presented are representative of three or more biological replicates.

Mass cytometry (CyTOF)

Stimulation: Tissue was harvested and cell suspensions prepared as above. All samples were then stimulated for 3 hours at 37°C in RPMI complete media with 5ng/ml phorbol l2-myristate l3-acetate (Sigma), lug/ml ionomycin (Sigma), 3ug/mL Golgistop with Brefeldin A (BioLegend), and 0.67uL/mL BD GolgiStop Protein Transport Inhibitor with Monensin (Fisher Scientific), then incubated on ice until staining.

Antibody conjugation with lanthanide metal: The lanthanide metals (Fluidigm) were conjugated to the antibodies using Maxpar Antibody Labeling Kit (Fluidigm) per manufacturer’s instructions. Briefly, 2.5mM Maxpar polymer was preloaded with lanthanide metal at 37°C for 1 hour and buffer exchanged to conjugation buffer using a 3K Nanosep Centrifugal Device (Pall Life Sciences). The antibody was partially reduced using TCEP at 37°C for 30 min and buffer exchanged to conjugation buffer using an Amicon Ultra-0.5 ml 50kDa Centrifugal Filter Concentrator (Millipore). The lanthanide- loaded polymer was conjugated to partially reduced antibody following overnight incubation at RT. The unbound metal was removed from the metal-tagged antibody by washing with wash buffer in a 50 kDa concentrator. The final concentration of metal- tagged antibody was determined by measuring the absorbance at 280 nm against the wash buffer. See Table 2 for antibodies. Staining of cells with metal-tagged antibodies: Cell-ID Cisplatin-l95Pt and Cell-ID Intercalator Iridium-

191/193 (Fluidigm) were used to identify live cells. The cells were washed once with pre warmed serum-free media by pelleting at 300 x g for 5 min at RT and stained with 1.25mM live/dead stain (Cell- ID Cisplatin-l95Pt diluted in serum-free media from 500 mM stock) at RT for 5 min. Free cisplatin was quenched by washing the cells with serum- containing media. CyPBS (lx PBS without heavy metal contaminants, prepared from 10 X PBS stock (Invitrogen) in deionized distilled Milli-Q water (Millipore)) was used to prepare CyFACS buffer (CyPBS containing 0.1% BSA, 2 mM EDTA and 0.05% sodium azide). The cells were then washed with CyFACS buffer and incubated with TruStain FcX (anti-mouse CD16/32, Biolegends) for 10 min at RT to block the Fc receptors. For cells surface marker staining, the

metal-tagged antibody cocktail was made in CyFACS buffer and added to the cells in the presence of TruStain FcX (BioLegend) and incubated on ice for 60 min. Following cell surface marker staining, the cells were washed twice with CyFACS buffer and fixed with 1.6% paraformaldehyde in CyPBS for 20 min at RT. The cells were then washed and stored overnight at 4°C in CyFACS buffer. The following day, the cells were pelleted at 800 x g for 5 min and permeabilized with eBioscience permeabilization buffer (Thermo Fisher Scientific) for 30 min at RT. The cells were then stained with intracellular staining metal-tagged antibody cocktail (made in eBioscience permeabilization buffer) at RT for 60 min. Following intracellular staining, the cells were washed once with permeabilization buffer and twice with

CyFACS buffer and stained with 62.5nM Cell-ID Intercalator Iridium- 191/193 (diluted in 1.6% paraformaldehyde in PBS from 500mM stock) at RT for 40 min or left at 4°C until ready for acquisition on CyTOF. CyTOF analysis of samples stained with metal-tagged antibodies: The samples were acquired using CyTOF Helios system (Fluidigm). The system was maintained and tuned according to the manufacturer’s instructions. In addition, internal vendor-set calibration was performed before acquiring samples. The fixed cells were washed twice with CyPBS and deionized distilled Milli-Q water and filtered through a 40 mM cell strainer. EQ Four Element Calibration Beads (Fluidigm) were added at the recommended concentration to the samples before acquisition on CyTOF. The samples were acquired on CyTOF at approximately 50-300 events/s. After acquisition, the instrument software applied a signal correction algorithm based on the calibration bead signal to correct for any temporal variation in detector sensitivity.

Table 2

CyTOF data analysis

Total events were gated to remove non-cellular events (negative for DNA intercalator), dead cells (uptake of cisplatin), and doublets (event length greater than 25).

A viSNE was performed using combined lymph node (-20,000 events/sample), spleen (-20,000 events/sample), and ear (between 262 and 1234 events/sample) samples using Cytobank (Kotecha et al, Curr Protoc Cytom Chapter 10, UnitlO 17,

doi: l0.l002/047H42956.cyl0l7s53 (2010)). All antibody channels were included in the viSNE analysis except for IL-l7f as it was suspected this marker was staining non- specifically (37 included markers). The viSNE run was performed with 2000 iterations, a perplexity of 30, and a theta of 0.5. A spanning-tree progression analysis of density- normalized events (SPADE) clustering algorithm was performed on the same events used in the viSNE analysis using the Cytobank platforml 1. As with the viSNE analysis, all antibody channels were included except for IL-l7f as it was suspected this marker was staining non-specifically (37 included markers). After some experimentation, it was found that 50 nodes with 100% event downsampling gave an adequate resolution of cellular subsets. SPADE nodes were manually bubbled based on defined phenotypic markers of major cellular populations (summarized in Fig. 8e). The B cell population was further sub divided into 5 subsets based on the expression of I-A/I-E, Cxcr5, Cd62L, Cd44, Cdl9, and Cd45R. Samples were compared based on the percentage of total cells from that sample contained within a bubble or individual node. Statistical analysis on the bubbled SPADE populations was performed using Prism 8.0 (GraphPad). P values were computed using unpaired Student t tests assuming homoscedasticity. P values were considered discoveries if they fell below an FDR of 10% using the two-stage step-up method of Benjamini, Krieger, and Yekutieli28.

Flow cytometry

Tissue was harvested and cell suspensions prepared as above. Cells were resuspended in blocking reagent of 1% BSA (Fisher Bioreagents) and 1% Horse Serum (Coming) in PBS. Antibody master mixes were prepared using antibodies specific for IgG-PerCP (BioLegend, 405334), IgM-APC (BioLegend, 406509), PDCA-l-APC (BioLegend, 127016), Cdl lc-Pacific Blue (BioLegend, 117322), F4/80-Pacific Blue (BioLegend, 123124), and Ly-6G-PE (BioLegend, 127606) and added to each sample. Samples were incubated at RT in a dark environment for 45 min, washed with PBS, and resuspended in 4% paraformaldehyde in PBS (Affymetrix). Flow cytometry was performed with a BD LSR II (BD Biosciences) and analyzed using FlowJo software (Tree Star).

Detection of autoantibodies

Anti-double-stranded DNA antibodies were detected in serum using the Mouse anti-dsDNA IgG2a ELISA Kit (Alpha Diagnostic International) according to

manufacturer’s instructions. Autoimmune disease is common, can be deadly, and disproportionately affects women.

Results

The prevalence of systemic lupus erythematosus (SLE) is nine times higher among women than men, and many other autoimmune diseases show similar profound female skewing (Fish, E. N. Nat Rev Immunol 8, 737-744, doi: l0. l038/nri2394 (2008)).

However, the cause of this female bias is largely unknown. Previous work has focused primarily on the influence of sex hormones, yet the female bias is observed even prior to puberty and following menopause (Tedeschi et al., Clin Immunol 149, 211-218, doi: l0.l0l6/j.clim.20l3.03.003 (2013)), indicating alternative mechanisms at play. As most autoimmune diseases remain incurable, investigating the causes of autoimmunity is critical, and the drivers of female-biased autoimmunity are logical targets.

The conserved putative transcription factor VGLL3 (vestigial -like family member 3) is a regulator of sex-biased immune genes (Liang, Y. et al. Nat Immunol 18, 152-160, doi : 10.1038/ni.3643 (2017)). VGLL3 is more abundant in the epidermis of women than men and shows female-specific nuclear localization, consistent with a role in sex-biased transcriptional regulation. In cultured keratinocytes, VGLL3 operates in a hormone- independent fashion to promote full interferon (IFN) responses and expression of genes that are critically relevant to SLE. These include B cell activating factor

(BAFF TNI'Sl·^'! 3B). the target of the only currently approved biologic therapy for SLE. Intriguingly, men who have SLE show loss of sex-specific regulation of VGLL3, demonstrating upregulation and nuclear localization of VGLL3 in inflamed skin (Liang et al, supra). This indicates that VGLL3 may govern a key upstream transcriptional regulatory program promoting autoimmunity.

Human and murine VGLL3 share 87% sequence homology, including an identical putative DNA-binding domain (Fig. 10a). Similar to human women (Liang et al, supra), female mice show 2.8-fold higher Vgll3 expression than male mice in the skin (p=0.053) (Fig. 7b), supporting conserved sex biased dynamics.

To test for a causative role for cutaneous VGLL3 in promoting autoimmune disease, transgenic mice were generated using the bovine Keratin 5 ( K5 ) promoter to drive Vgll3 overexpression in the epidermis (Fig. 6a). Overexpression varied by founder line, with transgenic mice generally showing five- to fifty fold expression relative to WT, and no consistent variation by sex. Compared to wild type (WT), K5-Vgll3 transgenic mice showed increased epidermal Vgll3 staining, with conspicuous nuclear localization (Fig. 6), analogous to VGLL3 distribution in affected skin of patients with SLE2. Transgenic pups were indistinguishable from WT at birth. Within 6-12 weeks of life, they began developing progressive skin thickening and scaling prominently involving the face and ears, common sites for human discoid lupus erythematosus (DLE) lesions (Fig. 6c, Fig. 10c). No consistent phenotypic variation by sex was noted among transgenic littermates. Histologically, early skin lesions showed epidermal thickening and focal interface dermatitis, an inflammatory reaction pattern characteristic of cutaneous lupus (Fig. 6d,

Fig. 10d,e). TUNEL staining confirmed increased keratinocyte apoptosis (Fig. 6e), and subtle basement membrane thickening was evident on periodic acid-Schiff (PAS) staining (Fig. 6f). Direct immunofluorescence (IF) revealed IgG and C3 deposition at the dermo- epidermal junction (Fig. 6g), a diagnostic feature of lupus skin biopsies.

To examine the transcriptional regulatory effects of Vgll3 that drive this lupus-like cutaneous phenotype, WT and robustly expressing transgenic mice were evaluated by quantitative reverse transcription polymerase chain reaction (qRT-PCR) for transcript levels of pro-inflammatory and lupus-related factors. Many were significantly elevated in transgenic mice (Fig. 7a, Fig. 11a), including Tnfsfl3b (BAFF), Si all. 117 (interleukin 7), Fas, and Ifnk (interferon kappa), the predominant type I IFN in cutaneous lupus (Sarkar,

M. K. et al, Ann Rheum Dis, doi: l0. H36/annrheumdis-20l8-2l3l97 (2018)). IF studies of key targets (Fig. 7b) corroborated the qRT-PCR findings. Thus, Vgll3 overexpression in the epidermis drives immunological dysregulation at the level of gene expression similar to that found in skin of women (Liang et al, supra).

For a broader examination of Vgll3 effects, RNA sequencing (RNA-seq) of normal appearing dorsal skin from WT and transgenic mice was performed to identify

differentially expressed genes (transgenic DEGs). Results largely affirmed the qPCR data (Fig. 9b). Of the 120 significantly enriched (False Discovery Rate (FDR)<l0%) functions/pathways for the transgenic DEGs, nearly half were related to immunological processes (Fig. 11c). These included multiple key pathways involved in SLE pathogenesis such as interferon responses. Literature-based network analysis of transgenic DEGs revealed additional nodes of autoimmune pathogenesis (Fig. 7c). comparing transgenic DEGs to the set of genes upregulated in human female skin relative to male (Liang et al., supra), significant overlap (p=0.032) was observed. To confirm a direct effect of Vgll3 overexpression in keratinocytes, keratinocytes from WT and transgenic mouse tails were culured and RNA-seq was performed. Genes differentially expressed in transgenic keratinocytes showed even more significant overlap with female-biased genes (p=4.0xl0- 7), indicating that Vgll3 is a prominent driver of sex-biased gene expression in keratinocytes.

The mouse skin RNA-seq results were compared to transcriptomic data from skin of cutaneous lupus patients (Liu et al, Arthritis Rheumatol 69, 1840-1849,

doi: l0.l002/art.40l66 (2017)). Genes dysregulated in lesional skin of patients with DLE or subacute cutaneous lupus erythematosus (SCLE) were overrepresented among transgenic DEGs (DLE, p=l.lxl0 ¹³; SCLE, p=5.0xl0 ⁹) and showed widespread upregulation in transgenic mice (Fig. 7d), revealing a shared pattern of gene dysregulation in skin of K5-Vgll3 transgenic mice and lupus patients. Together, these in vivo data demonstrate that Vgll3 overexpression in the epidermis is sufficient to drive a female- biased genetic signature deeply enriched for factors implicated in human autoimmune disease.

Immunohistochemistry of K5-Vgll3 transgenic skin revealed a mixed inflammatory infiltrate (Fig. 7e). T and B cells were increased, as were dendritic cells, which promote lymphocyte expansion, autoantibody production by B cells, and tissue damage in SLE (Teichmann, L. L. et al. Immunity 33, 967-978, doi: l0. l0l6/j.immuni.20l0.l l.025 (2010)). Flow cytometry corroborated these findings, demonstrating increased

plasmacytoid dendritic cells, as well as IgM+ and IgG+ cells, consistent with B cell expansion (Fig. 12). Neutrophils were also elevated, consistent with the neutrophilic inflammation noted on some lesional sections (Fig. 101) These results illustrate that epidermal overexpression of Vgll3 results in a cutaneous phenotype with gross, histologic, and inflammatory features of cutaneous lupus.

To further interrogate the inflammatory response in the K5-Vgll3 transgenic mouse, skin draining lymph nodes, spleen, and ear tissue from WT and transgenic mice were analyzed with mass cytometry (CyTOF) using a 37-marker panel (Fig. 13, Table 2). Transgenic mice showed significant lymphadenopathy and splenomegaly (Fig. 8a), features common in SLE and some lupus mouse models (Cohen, P. L. & Eisenberg, R. A. Annu Rev Immunol 9, 243-269, doi: lO. H46/annurev.iy.09.040191.001331 (1991);

Andrews, B. S. et al, J Exp Med 148, 1198-1215 (1978)). CyTOF data visualized using the dimensional reduction tool viSNE (Amir el, A. D. et al. Nat Biotechnol 31, 545-552, doi: l0.l038/nbt.2594 (2013)) showed expansion of B cell populations that was most prominent in skin-draining lymph nodes (Fig. 8b, Fig. 13). Key populations emerging from CyTOF are highlighted in a SPADE tree (Qiu, P. et al. Nat Biotechnol 29, 886-891, doi: l0.l038/nbt. l99l (2011)) (Fig. 8c-e, Fig. 14). B cells were significantly

overrepresented in transgenic lymph nodes (Q=6.2xl0 ⁴; blue circles in Fig. 8d) and spleen (Q=0.024). Together, these findings indicate that skin directed Vgll3

overexpression drives a systemic inflammatory response with B cell expansion.

Peripheral blood mononuclear cells (PBMCs) of patients with SLE show altered gene expression, with prominent dysregulation of genes in IFN and cytokine signaling pathways, likely contributing to systemic inflammation (Rai, R., et al, PLoS One 11, e0l663l2, doi: l0T37l/joumal.pone.0l663l2 (2016)). Evaluating gene expression in blood of WT versus K5-Vgll3 transgenic mice, a significantly higher effect size for genes whose human orthologs are dysregulated in blood of SLE patients (p=l.6xl0 ²²) was observed (Fig. 9a).

Finally, it was investigated whether the B cell expansion of the K5-Vgll3 mouse was associated with autoantibody production. Autoantibodies are integral to pathogenesis of SLE and associated with increased risk of progression from cutaneous to systemic lupus (Wieczorek et al, JAMA Dermatol 150, 291-296, dok lOTOOl/jamadermatol.2013.9026 (2014)). Commonly used SLE classification systems include their detection as a diagnostic criterion. By indirect IF of HEp-2 cells, antinuclear antibodies (AN As) were detected in serum of transgenic mice with developed phenotypes (Fig. 9b). A homogeneous pattern of nuclear staining was observed, which is commonly found in SLE patients. Anti-dsDNA antibodies, which are a specific marker for SLE and fluctuate with disease activity (ter Borg et al, Arthritis Rheum 33, 634-643 (1990)), were abundant in sera of transgenic mice (Fig. 9c). As anti-dsDNA antibodies are pathogenic to the kidney (Raz, E. et al. Am J Nephrol 9, 162-166, doi: 10.1159/000167957 (1989)), kidneys of transgenic mice were observed to have IgG and C3 deposition in glomeruli (Fig. 9d). Thus, epidermal Vgll3 overexpression stimulates development of lupus-specific anti-dsDNA autoantibodies that result in immune complex deposition in the kidney, the purported initiating event in development of lupus nephritis. Female sex alone carries a greater risk for developing SLE than any genetic or environmental risk factor identified to date (Voskuhl, R. Sex differences in autoimmune diseases. Biol Sex Differ 2, 1, doi: 10.1186/2042-6410-2-1 (2011)). Here, it is shown that skin-directed overexpression of Vgll3 is sufficient to drive the female-biased cutaneous genetic signature, causing an inflammatory skin phenotype with activation of type I IFN signaling that mimics cutaneous lupus. Although Vgll3 overexpression in our model is targeted to the skin, K5-Vgll3 transgenic mice develop systemic inflammation with B cell activation and autoantibody production that culminates in renal immune complex deposition analogous to that seen in lupus nephritis. Thus, overexpression of a single gene, is sufficient to trigger cutaneous autoimmune disease accompanied by a systemic autoimmune response with striking similarities to SLE.

A growing body of evidence indicates that in autoimmune disease pathogenesis, the initial break in self tolerance - the inciting“first hit” - occurs at epithelial surfaces. In patients with SLE, clearance of apoptotic cells is impaired (Kuhn, A. et al. Arthritis Rheum 54, 939-950, doi: l0. l002/art.2l658 (2006)). Insults such as ultraviolet light, which induces immunological activation and apoptosis of keratinocytes, cause release of endogenous nuclear antigens. Presence of these autoantigens results in elaboration of cytokines and immune cell recruitment, and cytotoxic inflammation perpetuates their release. Cutaneous inflammation may therefore prime or exacerbate anti-nuclear antigen- focused autoimmunity. There are sparse data supporting that treatment of cutaneous lupus may prevent progression to SLE (James, J. A. et al. Lupus 16, 401-409,

doi: l0.1177/0961203307078579 (2007)). The results herein demonstrate that cutaneous disease may be sufficient to trigger a break in self-tolerance with evolution of systemic autoimmune disease.

The significant overlap of Vgll3 targets with genes dysregulated in female skin indicates that the transgenic mouse phenotype represents a fully developed autoimmune disease of which female-biased autoimmunity is the forme fruste. In conclusion, this work establishes VGLL3 as a master orchestrator of sex-biased autoimmunity.

All publications, patents, patent applications and accession numbers mentioned in the above specification are herein incorporated by reference in their entirety. Although the disclosure has been described in connection with specific embodiments, it should be understood that the disclosure as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications and variations of the described compositions and methods of the disclosure will be apparent to those of ordinary skill in the art and are intended to be within the scope of the following claims.

Claims

CLAIMS We claim:

1. A non-human transgenic animal comprising a genome that overespresses vestigial- like family member 3 (VGLL3) in at least one tissue or cell type.

2. The transgenic animal of claim 1, wherein said animal is selected from the group consisting of a mouse, a rat, a dog, and a rabbit.

3. The transgenic animal of claim 1 or 2, wherein said animal is a mouse.

4. The transgenic animal of any one of claims 1 to 3, wherein said tissue is skin.

5. The transgenic animal of any one of claims 1 to 4, wherein said animal displays symptoms of lupus.

6. The transgenic animal of claim 5, wherein said lupus is cutaneous lupus.

7. The transgenic animal of any one of claims 1 to 3, wherein said cell type is endothelial cells.

8. The transgenic animal of claim 7, wherein said animal displays symptoms of sclerodema and/or pulmonary hypertension.

9. The transgenic animal of any one of claims 1 to 3, wherein said cell type is selected from the group consisting of B-cells, T-cells, and dendritic cells.

10. The transgenic animal of claim 9, wherein said animal displays symptoms of autoimmune disease mediated by autoantibodies.

11. The transgenic animal of any one of claims 1 to 10, wherein said VGLL3 is present as a conditional transgene.

12. The transgenic animal of any one of claims 1 to 10, wherein said VGLL3 is under the control of a consistutive or inducible promoter.

13. A cell or cell line derived from the transgenic animal of any one of claims 1 to 12.

14. The cell or cell line of claim 13, wherein said cell line is a primary cell line or immortalized cell line.

15. A method of screening an intervention for a disease or condition, comprising:

a) contacting the transgenic animal of any one of claims 1 to 12 or the cell or cell line of claims 13 or 14 with a candidate intervention; and

b) determining the effect of said intervention on a disease or condition in said transgenic animal.

w

16. The method of claim 15, wherein said intervention is selected from the group consisting of a drug, a lifestyle change, an alternative medicine therapy, and a combination thereof.

17. The method of claim 15 or 16, wherein said disease is an autoimmune disease.

18. The method of claim 17, wherein said lupus is cutaneous lupus.

19. The use of the transgenic animal of any one of claims 1 to 12 to screen for an intervention for a disease or condition.

20. A non-human transgenic animal comprising a genome that overespresses vestigial- like family member 3 (VGLL3) in at least one tissue or cell type, wherein said animal exhibits abherent gene expression relative to an animal that does not overexpress said VGLL3.

21. The animal of claim 20, wherein said abherent gene expression is female sex-biased expression.

22. The animal of claims 20 or 21, wherein said abherent gene expression is overexpression of one or more of Tnfsfl3b, Ifnk, and Cxcll3.