WO2019114675A1

WO2019114675A1 - Aptamer and use thereof for recognizing and binding to cd171

Info

Publication number: WO2019114675A1
Application number: PCT/CN2018/120185
Authority: WO
Inventors: 上官棣华; 王林林; 邴涛; 张楠; 刘祥军
Original assignee: 中国科学院化学研究所
Priority date: 2017-12-12
Filing date: 2018-12-11
Publication date: 2019-06-20
Also published as: CN109913462A; CN109913462B

Abstract

Provided are an aptamer and a use thereof for recognizing and binding to CD171. The aptamer and a derivative thereof can be used in recognizing a tumor with a high expression of the L1 cell adhesion molecule protein or in preparing a kit, a molecular probe and a targeting medium for detecting a tumor with a high expression of the L1 cell adhesion molecule protein, and can be used in designing and preparing a nucleic acid probe for detecting the L1 cell adhesion molecule protein, and in neurite growth inhibition.

Description

A nucleic acid aptamer and its application in recognizing and binding CD171

Technical field

The invention belongs to the technical field of biochemical analysis, and particularly relates to a nucleic acid aptamer and its application in recognizing and binding CD171.

Background technique

L1 cell adhesion molecule (neuronal cell adhesion molecule L1 (L1CAM), also known as CD171) is a member of the L1 protein family. In 1984, Melitta Schachner first discovered the late stage of mouse neuronal mitosis. Identification: There are many kinds of cells expressing L1 cell adhesion molecules, not only neuronal cells, but also some non-neuronal cells. Cells that have been reported to express L1 cell adhesion molecules include immature oligodendrocytes and Schwann cells. Cells, B cells and monocytes, cerebellar granule cells and Purkinje cells, which are also expressed in various tumor cells such as melanoma and lung cancer cells. L1 cell adhesion molecule is a transmembrane protein, which is composed of extracellular regions. The transmembrane and intracellular regions are composed of three parts (200-220 kDa), and the extracellular domain is composed of five fibronectin type III domains linked to six immunoglobulin domains, which are connected to the intracellular structure via a transmembrane helix. Domain. Its main functions are cell migration, adhesion, neurite outgrowth, myelination and neuronal differentiation. In terms of cell adhesion, L1 cell adhesion molecules have a cell adhesion molecule The steady-state function of different cells, the bundle-like spontaneous contraction of neurites controls the adhesion between neurons and controls the growth of neurites. In cell migration, during the development of neurons, migration promotes the growth of nerve cells. Growth regulation, L1 cell adhesion molecules are present in developing neuronal cells, play an important role in guiding new neurons into the correct position, helping axon growth and connecting with other neurons, in addition, L1 cell adhesion Molecules are also involved in synaptic plasticity, an increase or decrease in synaptic plasticity, and play a role in post-traumatic synaptic regeneration. Some studies have demonstrated that malignant tumor cells are enhanced by overexpression of L1 cell adhesion molecules. The ability of cell migration, so L1 cell adhesion molecules play an important role in tumor growth, tumor invasion, melanoma, ovarian and colon cancer metastasis. L1 cell adhesion molecules promote homophilic interactions, ie on one of the cells The adhesion molecule interacts with the same molecule on another cell; the L1 cell adhesion molecule also has a heterophilic interaction, The adhesion molecule on one of the cells acts as a receptor that binds to a different molecule on another cell, and these interactions promote the regulation of cell adhesion and signal transduction. In addition, the L1 cell adhesion molecule is also involved in the nerve. The process of myelination, which mediates the growth of Schwann cells along axons, is involved in the proliferation of myelin in the nervous system (especially the progressive myelination of axons). It also has tumor resistance. The key role. L1 cell adhesion molecules often cause neurological syndrome, referred to as MASA syndrome, also known as CRASH syndrome, mainly corpus callosum dysplasia, developmental block, aphasia, spastic paraplegia and brain Water.

An aptamer is a single-stranded oligonucleotide consisting of 10 to 150 bases. It can recognize one or a certain type of ligand molecule with high binding force and high selectivity. Chemically synthesized antibody. The aptamer may be a DNA, RNA, peptide nucleic acid or other chemically modified nucleic acid; since the nucleic acid can form different three-dimensional structures by means of intermolecular interactions such as van der Waals force, hydrogen bonding, electrostatic interaction and hydrophobic interaction, such as hairpins and pseudo knots. , G-quadruplex and other structures, so the nucleic acid aptamer can achieve high affinity and high specific binding with the target substance. The technique for screening nucleic acid aptamers that efficiently and specifically bind to target substances is called Systematic Evolution of Ligands by EXponential enrichment (SELEX). Targets for screening aptamers for SELEX technology range from inorganic metal ions, small organic molecules, biomacromolecules, and viruses, bacteria, cells, and tissue sections. Hundreds of nucleic acid aptamers have been reported to date. However, there are no precedents for screening nucleic acid aptamers using subcellular structures such as neurites, intercellular junction structures, and organelles as targets.

Using SELEX technology, nucleic acid aptamers targeting complex targets such as living cells and tissues have similar recognition functions, but have the following advantages compared with monoclonal antibodies:

(1) screening in vitro without immunizing animals or cells;

(2) low toxicity or immunogenicity, good water solubility, high dose subcutaneous intravenous injection or lesion injection;

(3) It can be prepared by a large number of chemical synthesis, with small differences between batches;

(4) Easy structural modification, modification, labeling or immobilization to increase serum stability;

(5) Good stability, easy to store and transport;

(6) The molecular weight is small, generally 4-50KD.

Based on the above advantages, nucleic acid aptamers, as novel biomimetic recognition elements, have been widely used in many fields such as disease diagnosis and treatment, drug screening, molecular recognition and analysis.

Invention disclosure

It is an object of the invention to provide a nucleic acid aptamer.

The nucleic acid aptamer provided by the present invention is as follows A) or B):

A) a single-stranded DNA molecule as shown in SEQ ID NO:

B) removing the nucleotide sequence shown in A) from the 1st nucleotide of the 5' end, including 1-20 nucleotides of the first nucleotide residue at the 5' end, and removing the A) The nucleotide sequence shown includes 10-20 nucleotides from the first nucleotide of the 3' end including the first nucleotide residue at the 3' end, and the nucleic acid consisting of the remaining nucleotide residues is suitable. body.

In the above nucleic acid aptamer, the nucleic acid aptamer represented by B is any one of the following 1) to 7):

1) a single-stranded DNA molecule as shown in SEQ ID NO: 2;

2) a single-stranded DNA molecule as shown in SEQ ID NO:3;

3) a single-stranded DNA molecule as shown in SEQ ID NO: 4;

4) a single-stranded DNA molecule as shown in SEQ ID NO: 5;

5) a single-stranded DNA molecule as shown in SEQ ID NO:6;

6) a single-stranded DNA molecule as shown in SEQ ID NO:7;

7) A single-stranded DNA molecule as shown in SEQ ID NO: 8.

Another object of the present invention is to provide a derivative of the above nucleic acid aptamer.

The derivative of the above nucleic acid aptamer provided by the present invention is any one of the following (1) to (6):

(1) deleting or adding one or several nucleotides of the above aptamer to obtain a derivative of a nucleic acid aptamer having the same function as the aptamer of the nucleic acid;

(2) subjecting the above nucleic acid aptamer to nucleotide substitution or modification to obtain a derivative of a nucleic acid aptamer having the same function as the nucleic acid aptamer;

(3) modifying the skeleton of the above aptamer into a phosphorothioate skeleton to obtain a derivative of a nucleic acid aptamer having the same function as the nucleic acid aptamer;

(4) an RNA molecule encoded by the above aptamer, to obtain a derivative of a nucleic acid aptamer having the same function as the aptamer;

(5) a peptide nucleic acid encoded by the above acid aptamer, which gives a derivative of a nucleic acid aptamer having the same function as the nucleic acid aptamer;

(6) A derivative of a nucleic acid aptamer having the same function as the nucleic acid aptamer is obtained by indirectly or indirectly signaling a signal molecule and/or an active molecule and/or a functional group.

The above signal molecules are fluorescent dyes, fluorescent nanomaterials, radioisotopes, and the like;

The above active molecule is an oxidase or the like;

The above functional groups are biotin, digoxin, therapeutic substances, etc.

In the above derivatives, the modification is phosphorylation, methylation, amination, thiolation or isotization; the functional group is a fluorescent group, a biotin group, a radioactive substance, a therapeutic substance, digoxin , nanoluminescent material or enzyme labeling.

The above derivatives are all derivatives which can be obtained by those skilled in the art in combination with common knowledge in the art, using conventional means in the art, without laborious work.

In the above derivative, the derivative of the nucleic acid aptamer is a nucleic acid aptamer obtained by labeling a fluorescein group or a cyanine dye group or a biotin group at the 5' end of the nucleic acid aptamer shown in SEQ ID NO: 8. derivative.

The use of the above nucleic acid aptamer or the above derivative in at least one of the following (B1) to (B19) is also within the scope of protection of the present invention:

(B1) identifying or assisting in identifying L1 cell adhesion molecule proteins;

(B2) binding or assisting in binding to the L1 cell adhesion molecule protein;

(B3) preparing a product for identifying or assisting in identifying an L1 cell adhesion molecule protein;

(B4) preparing a binding or auxiliary binding L1 cell adhesion molecule protein product;

(B5) detecting or assisting detecting whether the sample to be tested contains L1 cell adhesion molecule protein;

(B6) preparing a product for detecting or assisting detection of whether the sample to be tested contains L1 cell adhesion molecule protein;

(B7) detecting or assisting detecting the content of L1 cell adhesion molecule protein in the sample to be tested;

(B8) preparing a product for detecting or assisting in detecting the content of L1 cell adhesion molecule protein in the sample to be tested;

(B9) detecting or assisting in detecting tumor or tumor cells expressing L1 cell adhesion molecule protein;

(B10) preparing a product for detecting or assisting in detecting a tumor or tumor cell expressing an L1 cell adhesion molecule protein;

(B11) identifying or assisting in identifying tumor or tumor cells;

(B12) binding or assisting in binding to a tumor or tumor cell;

(B13) preparing a product that recognizes or assists in identifying a tumor or tumor cell;

(B14) preparing a product that binds or assists in binding to a tumor or tumor cell;

(B15) preparing a product that targets an L1 cell adhesion molecule protein;

(B16) inhibiting the growth of neurites of neuroblastoma cells;

(B17) preparing a product that inhibits the growth of neurites of neuroblastoma cells;

(B18) identifying the growth of neurites of neuroblastoma cells;

(B19) A product for identifying the growth of neurites of neuroblastoma cells.

In the above application, the sample to be tested is a cell; the cell is specifically a neuroblastoma cell, a human colon cancer cell, a human cervical cancer cell, a human breast cancer cell, a doxorubicin resistant human breast cancer cell or a liver cancer cell.

The above tumor is neuroblastoma, human colon cancer, human cervical cancer, human breast cancer, adriamycin-resistant human breast cancer or liver cancer.

In the above application, the tumor or tumor cell expressing the L1 cell adhesion molecule protein is a tumor or tumor cell (such as a human colon cancer cell or a human neuroblastoma cell) having a high expression of the L1 cell adhesion molecule protein.

In the above applications, the product is a kit or probe or a targeting substance or drug.

A third object of the present invention is to provide a product having the following functions.

The product provided by the invention has the following functions, wherein the active ingredient is the above nucleic acid aptamer or the above derivative;

The function is at least one of the following 1)-9):

1) identifying or assisting in the recognition of L1 cell adhesion molecule proteins;

2) binding or assisting in binding to L1 cell adhesion molecule proteins;

3) detecting or assisting detection of whether the sample to be tested contains L1 cell adhesion molecule protein;

4) detecting or assisting in detecting the content of L1 cell adhesion molecule protein in the sample to be tested;

5) detecting or assisting in detecting tumor or tumor cells expressing L1 cell adhesion molecule protein;

6) Identifying or assisting in identifying tumor or tumor cells;

7) binding or assisting in binding tumor or tumor cells;

8) a medicament for preparing a protein targeting a L1 cell adhesion molecule;

9) inhibiting the growth of neurites of neuroblastoma cells;

10) Identify the growth of neurites of neuroblastoma cells.

In the above, the product is a kit or probe or a targeting substance or a drug.

A third object of the present invention is to provide a method for detecting or assisting in detecting tumor or tumor cells expressing an L1 cell adhesion molecule protein.

The method provided by the present invention comprises the steps of: binding to the tumor cell to be tested with the above-mentioned nucleic acid aptamer or the above-mentioned derivative, and if capable of binding, the tumor cell to be tested is a tumor or tumor cell expressing the L1 cell adhesion molecule protein. If the binding is not possible, the tumor cell to be tested is not or a candidate tumor or tumor cell that does not express the L1 cell adhesion molecule protein.

A fourth object of the present invention is to provide a method for detecting or assisting in detecting the content of L1 cell adhesion molecule protein in a sample to be tested.

The method provided by the invention comprises the following steps:

1) combining the above nucleic acid aptamer or the above derivative with a sample to be tested or a different concentration of L1 cell adhesion molecule protein standard to obtain various binding products;

2) detecting the signal intensity of the various binding products by a nucleic acid aptamer-based ELISA method, and obtaining signal intensity of the sample to be tested and signal intensity of different concentrations of the L1 cell adhesion molecule protein standard;

3) using a different concentration of L1 cell adhesion molecule protein standard and its corresponding signal intensity as a standard curve;

Substituting the signal intensity of the sample to be tested into the standard curve to obtain the protein content of the L1 cell adhesion molecule in the sample to be tested.

In the present embodiment, the nucleic acid aptamer-based ELISA method employs an antibody anti-CD171, and the signal intensity is fluorescence intensity.

Other features and embodiments of the invention will be apparent from the description and appended claims.

DRAWINGS

Figure 1 is a graph showing the enrichment process of nucleic acid aptamers with the number of screening rounds in Example 1. The peak shape curve indicates the cell fluorescence distribution of the differentiated neuroblastoma cell SH-SY5Y; the blank cell as a control, the differentiated neuroblastoma cell SH-SY5Y and the fluorescein (FAM)-labeled nucleic acid library, the starting library, The combination of the first round, the third round, the fifth round and the sixth round.

2 is a confocal binding fluorescence of target cells (differentiated neuroblastoma cells D-SH-SY5Y) in the first round, the fourth round, the sixth round, and the eighth round of the screening-enriched library in Example 2.

3 is a nucleic acid aptamer ylQ3, a nucleic acid aptamer yly1, a nucleic acid aptamer yly2, a nucleic acid aptamer yly3, a nucleic acid aptamer yly4, a nucleic acid aptamer yly10, a nucleic acid aptamer yly11, and a nucleic acid aptamer yly12 in colon cancer cells. The binding dissociation constant of LoVo was determined.

4 is a flow cytometry experiment result of co-staining a plurality of tumor cells of L1 cell adhesion molecule protein antibody (anti-CD171) and nucleic acid aptamer yly12 in Example 5. A is a LoVo cell, B is a SH-SY5Y cell, and C is a PC-3 cell.

5 is a flow cytometry experiment of staining LoVo cells by L1 cell adhesion molecule protein antibody (anti-CD171) and nucleic acid aptamer yly12 after siRNA interferes with human colon cancer cell LoVo cells expressing L1 cell adhesion molecule protein in Example 6. result.

6 is a confocal binding fluorescence of the neuroblastoma cell D-SH-SY5Y in which the L1 cell adhesion molecule protein antibody (anti-CD171) and the aptamer yly12 co-stained target cells were differentiated in Example 7.

Figure 7 is a graph showing the confocal binding fluorescence of L1 cell adhesion molecule protein antibody (anti-CD171) and nucleic acid aptamer yly12 co-stained human colon cancer cell LoVo cells in Example 8.

Figure 8 is a fluorescent staining of human brain tissue sections of the nucleic acid aptamer yly12 and the control sequence of Example 9.

Figure 9 is a fluorescent staining of olfactory neuroblastoma tissue sections of the aptamer yly12 and the control sequence of Example 9.

Fig. 10 is a graph showing inhibition of neurite outgrowth of neuroblastoma cell SH-SY5Y by nucleic acid aptamer yly12 in Example 10.

Figure 11 is a diagram showing the detection of the L1CAM protein content in the sample by the nucleic acid aptamer yly12 of Example 11.

The best way to implement the invention

The experimental methods used in the following examples are conventional methods unless otherwise specified.

The materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

The nucleic acid sequences in the following examples were all synthesized by Shanghai Shenggong Bioengineering Co., Ltd.

The L1 cell adhesion molecule protein antibody (anti-CD171) in the following examples is a product of BD Biosciences, Inc., catalog number 554273.

The antibody isotype control (normal mouse IgG ₁ ) in the following examples is a product of ANTA CRUZ, Inc., catalog number sc-3877.

The rabbit anti-mouse IgG-PE in the following examples is a product of SANTA CRUZ, Inc., catalog number sc-358926.

The siRNA in the following examples is a product of Suzhou Gemma Gene Co., Ltd.

Binding buffer (pH = 7.4) in the following examples: containing 137 mM NaCl, 5 mM MgCl ₂ , 2.7 mM KCl, 2 mM KH ₂ PO ₄ , 10 mM Na ₂ HPO ₄ , 25 mM glucose, 1 μg/ml BSA, 0.1 μg/ M. salmon sperm DNA and 0.01% (v/v) Tween-80.

Wash buffer (pH = 8.0) in the following examples: containing 137 mM NaCl, 5 mM MgCl ₂ , 2.7 mM KCl, 2 mM KH ₂ PO ₄ , 10 mM Na ₂ HPO ₄ and 25 mM glucose.

The siRNA lysate in the following examples: DEPC water.

The dicyclohexylcarbodiimide (DCC) in the following examples is a product of the Belling Company, catalog number: 36650; 4-dimethylaminopyridine (DMAP) is a product of the Belling Company, catalog number: 117147.

Example 1. Screening and preparation of nucleic acid aptamers

I. Culture of neuroblastoma cells and differentiated neuroblastoma cells

1. Culture of neuroblastoma cells

Neuroblastoma cells (SH-SY5Y) (purchased from Institute of Basic Medical Sciences, Beijing, China, catalog number: 3111C0001CCC000026)) with RPMI 1640 (containing 15% inactivated fetal bovine serum, 1% blue/streptococcus) Culture).

2. Culture of differentiated neuroblastoma cells

Differentiated neuroblastoma cells (D-SH-SY5Y) were cultured with RPMI 1640 (containing 10 μM retinoic acid A, RA) for three days, followed by RPMI 1640 (containing 10 μM retinoic acid A and 10 ng/ml brain-derived nerve growth factor). BDNF) was cultured for four days.

All of the above cells were routinely cultured in an incubator (37 ° C, 5% CO ₂ ) and subcultured every two days.

Second, the design of random nucleic acid library

A random library consisting of 20 fixed nucleotides and 45 nucleotides in between is designed as follows: 5'-AAGGAGCAGCGTGGAGGATA-N ₄₅ -TTAGGGTGTGTCGTCGTGGT-3'; wherein N ₄₅ represents 45 A, T, C or G Random nucleotide sequence.

Third, the screening of aptamers

1, library pretreatment

The 18 nmol random nucleic acid library (synthesized in step 2) was dissolved in binding buffer, denatured at 95 ° C for 5 min, cooled on ice for 10 min, and reconstituted at room temperature for 30 min to obtain a pre-treated ssDNA library.

2, screening

The initial library or the library after 2-7 rounds of screening was incubated with a dish of differentiated neuroblastoma cell D-SH-SY5Y at 4 ° C for a period of time (the incubation time was gradually reduced as the number of screening rounds increased). After washing the cells several times with the binding buffer, the cells were blown off with a pipette. The cells were centrifuged at 4000 RPM, and the supernatant solution was added to a new centrifuge tube. The supernatant was collected by centrifugation at 12000 RPM to obtain neurites, and 200 μL of water was added thereto. After heating at 95 ° C for 5 min, the ssDNA bound to the differentiated neuroblastoma cell D-SH-SY5Y neurite was eluted. The eluted ssDNA was then subjected to PCR amplification. The primers for PCR amplification are:

5'-FAM-AAGGAGCAGCGTGGAGGATA-3' (SEQ ID NO: 9);

5'-Biotin-ACCACGACGACACACCCTAA-3' (SEQ ID NO: 10).

PCR amplification procedure: 94 ° C for 3 min; 94 ° C for 30 s, 60 ° C for 30 s, 72 ° C for 30 s, 10 cycles; 72 ° C, 5 min.

A FAM-labeled single-stranded DNA (ssDNA) sequence was isolated from the PCR product using streptavidin agarose beads. The resulting ssDNA was desalted using a NAP-5 column (General Electric Medical Group, Sweden) and vacuum dried for the next round of screening.

In order to increase the affinity and specificity of the aptamer, the number of washings is gradually increased, the number of cells D-SH-SY5Y is decreased, and the number of cells of SH-SY5Y is increased in the screening process to increase the screening pressure. After eight rounds of screening, PCR amplification was performed by primers (5'-ACGCTCGGATGCCACTACAG-3' (sequence 11) and 5'-GTCACCAGCACGTCCATGAG-3' (sequence 12) using the screening product as a template, and the sixth round of PCR products were sequenced. . The final selected aptamer 1 (also known as the aptamer ylQ3) is as follows:

5'-AAGGAGCAGCGTGGAGGATAGGGGGTAGCTCGGTCGTGTTTTTGGGTTGTTTGGTGGGTCTTCTGTTAGGGTGTGTCGTCGTGGT-3' (SEQ ID NO: 1).

The enrichment process of the aptamer with the number of screening rounds is shown in Figure 1. The nucleotide sequence bound to the positive sieve cell D-SH-SY5Y is significantly enriched in the first round. The binding sequence was further enriched in the third, fifth and sixth rounds.

3. Optimization of nucleic acid aptamers

The aptamer obtained in step 2 is longer. After structural analysis, a series of truncated nucleic acid sequences are designed and synthesized, modified by fluorescent dyes, and then their binding ability to D-SH-SY5Y is selected, and the binding is selected. The most powerful sequence is used for further applications, and the optimized sequence is only 51-85 nucleotides in length.

The resulting truncated nucleic acid aptamer sequence is as follows:

Nucleic acid aptamer 2 (also known as nucleic acid aptamer yly1):

5'-AAGGAGCAGCGTGGAGGATAGGGGGTAGCTCGGTCGTGTTTTTGGGTTGTTTGGTGGGTCTTCTGTTAGGG-3' (SEQ ID NO: 2); Nucleic acid aptamer 2 is a nucleoside obtained by cleavage of aptamer 1 from the 3' end by 14 nucleotides and keeping the other sequences of aptamer 1 unchanged. Acid sequence.

Nucleic acid aptamer 3 (also known as nucleic acid aptamer yly2):

5'-TGGAGGATAGGGGGTAGCTCGGTTGTGTTTTGGGGTTGTTTGGTGGGTCTTCTGTTAGGGTGTGTCGTCGTGGT-3' (SEQ ID NO: 3); aptamer 3 is a nucleoside obtained by cleavage of aptamer 1 from the 5' end by 11 nucleotides and keeping the other sequences of aptamer 1 unchanged. Acid sequence.

Nucleic acid aptamer 4 (also known as nucleic acid aptamer yly3):

5'-TGGAGGATAGGGGGTAGCTCGGTCGTGTTTTTGGGTTGTTTGGTGGGTCTTCTGTTAGGG-3' (SEQ ID NO: 4); aptamer 4 is a nucleic acid aptamer 1 which cleaves 11 nucleotides from the 5' end, and cleaves 14 nucleotides from the 3' end, and maintains The nucleotide sequence of the other sequence of the aptamer 1 is unchanged.

Nucleic acid aptamer 5 (also known as nucleic acid aptamer yly4):

5'-TGGAGGATAGGGGGTAGCTCGGTCGTGTTTTTGGGTTGTTTGGTGGGTCTTCTGTTA-3' (SEQ ID NO: 5); aptamer 5 is a cleavage of 11 nucleotides from the 5' end of the aptamer 1 and 17 nucleotides from the 3' end, and remains The nucleotide sequence of the other sequence of the aptamer 1 is unchanged.

Nucleic acid aptamer 6 (also known as nucleic acid aptamer yly10):

5'-TGGAGGATAGGGGGTAGCTCGGTCGTGTTTTTGGGTTGTTTGGTGGGTCTTCTG-3' (SEQ ID NO: 6); aptamer 6 is a nucleic acid aptamer 1 which cleaves 11 nucleotides from the 5' end, and cleaves 20 nucleotides from the 3' end, and remains The nucleotide sequence of the other sequence of the aptamer 1 is unchanged.

Nucleic acid aptamer 7 (also known as nucleic acid aptamer yly11):

5'-AGGATAGGGGGTAGCTCGGTCGTGTTTTTGGGTTGTTTGGTGGGTCTTCTGTTA-3' (SEQ ID NO: 7); aptamer 7 is a nucleic acid aptamer 1 which cleaves 14 nucleotides from the 5' end, and cleaves 17 nucleotides from the 3' end, and remains The nucleotide sequence of the other sequence of the aptamer 1 is unchanged.

Nucleic acid aptamer 8 (also known as nucleic acid aptamer yly12):

5'-AGGATAGGGGGTAGCTCGGTCGTGTTTTTGGGTTGTTTGGTGGGTCTTCTG-3' (SEQ ID NO: 8); aptamer 8 is a nucleic acid aptamer 1 which cleaves 14 nucleotides from the 5' end, and cleaves 20 nucleotides from the 3' end, and maintains The nucleotide sequence of the other sequence of the aptamer 1 is unchanged.

According to the optimization results, the aptamer 6 has the strongest binding affinity and the highest fluorescence intensity, followed by the aptamer 5, and then the nucleic acid aptamer 7, the aptamer 8, and the nucleic acid are arranged in order from high to low. 1, aptamer 4, aptamer 3 and aptamer 2.

Example 2. Confocal imaging of enriched libraries and differentiated neuroblastoma cells

The first round, the fourth round, the sixth round, and the eighth round of the enriched library obtained in Example 1 were amplified by PCR amplification to prepare single-stranded DNA, and each single-stranded DNA was dissolved in a binding buffer (FAM labeling). DNA sequence), according to the UV absorption calibration concentration, heated at 95 ° C for 5 min, placed on ice for 10 min, and placed at room temperature for 30 min. The denatured-reconstituted DNA was diluted with binding buffer into a 200 nmol/L DNA solution (containing 1 μg/ml BSA, 0.1 μg/ml salmon sperm DNA), and added to the D-dimerized and cultured in a confocal dish. In SH-SY5Y cells, the cells were incubated on ice for 30 min, washed once with PBS, and observed under a microscope of 100 times under a confocal microscope.

It is apparent from Fig. 2 that the nucleic acid aptamers in the fourth, sixth and eighth rounds have a good binding to the differentiated SH-SY5Y cell neurites.

Example 3, Binding ability of nucleic acid aptamer to human colon cancer cell LoVo

The nucleic acid aptamer 1, the nucleic acid aptamer 2, the nucleic acid aptamer 3, the nucleic acid aptamer 4, the nucleic acid aptamer 5, the nucleic acid aptamer 6, the nucleic acid aptamer 7, and the nucleic acid aptamer 8 obtained in Example 1 were respectively at the 5' end. Labeling fluorescein (FAM) molecules, respectively, obtaining FAM-labeled nucleic acid aptamer 2, FAM-labeled nucleic acid aptamer 3, FAM-labeled nucleic acid aptamer 4, FAM-labeled nucleic acid aptamer 5, FAM-labeled nucleic acid aptamer 6, FAM-labeled nucleic acid aptamer 7 and FAM labeled nucleic acid aptamer 8 (synthesized by Shanghai Shenggong Company). Dissolve each single-stranded DNA (FAM-labeled nucleic acid aptamer) with binding buffer, and calibrate the concentration according to UV absorption, heat at 95 ° C for 5 min, place on ice for 10 min, and leave it at room temperature for 30 min to obtain denatured-re-renaturation DNA; Diluted into 0.1nmol/L, 0.25nmol/L, 0.5nmol/L, 1nmol/L, 2.5nmol/L, 5nmol/L, 10nmol/L, 50nmol/L, 100nmol/L and 200nmol/L concentration gradient. DNA solution (molecular probe solution).

Take a logarithmic growth phase colon cancer cell LoVo, digest it into monodisperse cell suspension with 0.2% EDTA and divide it into several parts. After incubating with the above molecular probe solution for 30 min on ice, wash the two with washing buffer. The fluorescence intensity on the cell surface was measured by a FACSCalibur flow cytometer from BD. The equilibrium dissociation constant of the aptamer of the nucleic acid was calculated by the formula Y=BmaxX(Kd+X) by plotting the average fluorescence intensity on the cell surface and the aptamer concentration of the nucleic acid.

The binding curves of nucleic acid aptamer 1, nucleic acid aptamer 2, nucleic acid aptamer 3, nucleic acid aptamer 4, nucleic acid aptamer 5, nucleic acid aptamer 6, nucleic acid aptamer 7 and nucleic acid aptamer 8 to colon cancer cell LoVo are shown in Fig. 3. Shown. In Fig. 3, the abscissa is the single-stranded DNA concentration (nmol/L), and the ordinate is the average fluorescence intensity after deducting the autofluorescence value of the cells. It is indicated that the nucleic acid aptamer 1, the nucleic acid aptamer 2, the nucleic acid aptamer 3, the nucleic acid aptamer 4, the nucleic acid aptamer 5, the nucleic acid aptamer 6, the nucleic acid aptamer 7 and the nucleic acid aptamer 8 all bind to the colon cancer cell LoVo.

The equilibrium dissociation constants of the above nucleic acid aptamers 1-8 are shown in Table 1. The results showed that the equilibrium dissociation constants of the aptamer 1, the aptamer 4, the aptamer 5, the aptamer 6, the aptamer 7 and the aptamer 8 were all in the nanomolar range, and the affinity was high.

Table 1. Equilibrium dissociation constants of aptamers 1-8

名称name	结合解离常数(nmol/L)Binding dissociation constant (nmol/L)
核酸适体1Nucleic acid aptamer 1	11.48±2.40911.48±2.409
核酸适体2Nucleic acid aptamer 2	159.6±82.12159.6±82.12
核酸适体3Nucleic acid aptamer 3	35.33±11.4135.33±11.41
核酸适体4Nucleic acid aptamer 4	18.36±5.10818.36±5.108
核酸适体5Nucleic acid aptamer 5	5.896±1.2105.896±1.210
核酸适体6Nucleic acid aptamer 6	3.964±1.0373.964±1.037
核酸适体7Nucleic acid aptamer 7	6.739±1.1086.739±1.108
核酸适体8Nucleic acid aptamer 8	6.968±2.4016.968±2.401

Example 4, nucleic acid aptamer 8 (also known as aptamer yly12) specifically recognizes and binds to L1 cell adhesion molecule protein by mass spectrometry identification

I. Preparation of isotopically labeled LoVo cells and aptamer 8 derivatives

1. Preparation of isotopically labeled LoVo cells

Heavy-duty isotope-labeled LoVo cells (Institute of Basic Medical Sciences (Beijing), the use of heavy isotopically labeled lysine ([ ¹³ C ₆ , ¹⁵ N ₂ ]-L-lysine) and heavy isotope-labeled refined ammonia Acid ([ ¹³ C ₆ ]-L-arginine) culture medium of RPMI 1640; light isotope-labeled Jurkat E6-1 cells using light isotopically labeled lysine ([ ¹² C ₆ , ¹⁴ N ₂ ] -L-lysine) and light isotopically labeled arginine ([ ¹² C ₆ ]-L-arginine) in PMI 1640 medium (Thermo Corporation, medium number: 89982). The cells were cultured for 6-7 passages and used.

2. Preparation of aptamer 8 derivatives of nucleic acid

(1) Biotinylated nucleic acid aptamer 8

The biotin-labeled nucleic acid aptamer 8 is obtained by coupling a biotin group at the 5' end of the aptamer 8 of the nucleic acid, and dissolving the biotin-labeled nucleic acid aptamer 8 in a binding buffer according to the ultraviolet absorption calibration concentration (100 nM). Heat at 95 ° C for 5 min, place on ice for 5 min, and leave at room temperature for 15 min.

(2) Biotin-labeled control nucleic acid sequence L45 (L45-Bio)

The biotin-labeled control nucleic acid sequence L45 (L45-Bio) was obtained by coupling a biotin group at the 5' end of the control nucleic acid sequence L45, and dissolving L45-Bio in binding buffer according to the ultraviolet absorption calibration concentration (100 nM). Heat at 95 ° C for 5 min, place on ice for 5 min, and leave at room temperature for 15 min. The nucleotide sequence of the control nucleic acid sequence L45: TTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN (sequence 13).

2. Mass spectrometry identification of aptamer 8 specifically recognizes and binds to L1 cell adhesion molecule protein

1. Extraction of nucleic acid aptamer 8 target protein

(1) Take 2×10 ⁸ exponential growth stages of heavy isotopically labeled LoVo cells and lightly isotopically labeled LoVo cells, washed with PBS, respectively, with biotinylated aptamer 8 (100 nM) and biotinylated The control nucleic acid sequence L45 (100 nM) was incubated for 30 minutes.

(2) Wash 2 times with PBS, add 1 mL of cell lysate, and incubate for 1 hour.

(3) The precipitate was removed by centrifugation at 2000 rpm, and the supernatant was collected, and streptavidin-modified agarose microspheres (GE, Cat. No. 17-5113-01) were added, and the target protein was extracted by incubating for 1 hour.

(4) Washing the streptavidin-modified agarose microspheres incubated with the above step (3) with PBS, washing 5 times, respectively obtaining the heavy isotopically labeled protein and the control nucleic acid extracted by the biotin-labeled nucleic acid aptamer 8. The light isotopically labeled protein extracted by the sequence L45, the light isotopically labeled protein extracted by the biotinylated nucleic acid aptamer 8, and the heavy isotopically labeled protein extracted by the control nucleic acid sequence L45.

2. Forward and reverse experiments

(1) Forward experiment: the heavy isotopically labeled protein extracted from the biotin-labeled nucleic acid aptamer 8 is mixed with the light isotopically labeled protein extracted from the control nucleic acid sequence L45 to obtain a heavy isotopes extracted from the biotin-labeled nucleic acid aptamer 8. A mixed system of light isotopically labeled proteins extracted from the labeled protein and the control nucleic acid sequence L45.

(2) Reverse experiment: the light isotopically labeled protein extracted from the biotin-labeled nucleic acid aptamer 8 is mixed with the heavy isotopically labeled protein extracted from the control nucleic acid sequence L45 to obtain a light isotope extracted from the biotin-labeled nucleic acid aptamer 8. A mixed system of heavy isotopically labeled proteins extracted from the labeled protein and the control nucleic acid sequence L45.

3. Enzymatic hydrolysis and LC-MS identification of proteins

(1) DTT reduction: a light isotope-labeled protein extracted from a biotin-labeled nucleic acid aptamer 8 and a light isotope-labeled mixed system extracted from a control nucleic acid sequence L45, a light isotope label extracted from a biotin-labeled nucleic acid aptamer 8 The protein and the control nucleic acid sequence L45 were extracted from a heavy isotopically labeled mixed system by adding 200 μL of 20 mM dithiothreitol (DTT) and reacting at 56 ° C for 45 min.

(2) IAA alkylation: The product of the step (1) was centrifuged, the supernatant was discarded (DTT was removed), and 200 μL of 55 mM iodoacetamide (IAA) was added to the precipitate, and the reaction was carried out at 37 ° C for 30 min in the dark.

(3) Centrifuge the product of step (2), discard the supernatant (removal of IAA), add 5 μg of mass spectrometry to trypsin (Promega, catalog number: V5111), and digest overnight at 37 °C to obtain enzyme digestion. Peptide.

(4) The digested polypeptide was concentrated in vacuo, 100 ul of water was added, and desalted using a Ziptip C ₁₈ microcolumn. Place the -20 ° C refrigerator before mass spectrometry.

(5) The product of the step (4) was analyzed and identified using an LTQ-Orbitrap Velos mass spectrometer (Thermo Fisher Scientific, San Jose, CA) to obtain the original mass spectrometry data.

(6) Data search analysis

The original mass spectral data obtained in the step (5) was searched in the IPI protein database (version number: 3.68) using the MaxQuant search engine (version number: 1.3.0.5). Some parameters of the database search are as follows: the immobilization modification is an alkylation modification on cysteine, the variable modification is an oxidative modification on methionine, and the N-terminal acetylation modification of the protein. Two missed cut sites were allowed, the parent ion tolerance was 20 ppm, and the MS/MS fragment ion mass error was 0.5 Da. For the identification of candidate proteins, 2 or more unique peptides were identified with a posterior standard error (PEP) of less than 10 ^-5 . Candidate proteins need to be identified simultaneously in both forward and reverse experiments.

The results showed that: SILAC (stable isotope labeling technique) experiments identified 166 proteins, nucleic acid aptamer 8 and random control nucleic acid sequence L45 extracted protein abundance ratio greater than 2 only L1 cell adhesion molecule protein, the remaining 165 protein abundance The ratio is less than 2. It is indicated that the aptamer 8 can specifically recognize and bind to the L1 cell adhesion molecule protein.

Example 5, aptamer 8 and L1 cell adhesion molecule protein antibody (anti-CD171) co-stained cell line

1. Pretreatment of cell strain and preparation of aptamer 8 derivative

1. Pretreatment of cell strain

Cell origin: human colon cancer cells (LoVo, catalog number: 3111C0001CCC000164), human neuroblastoma cells (SH-SY5Y, catalog number: 3111C0001CCC000026), human prostate cancer cells (PC-3, catalog number: 3111C0001CCC000115) The above cells were purchased from the Institute of Basic Medical Sciences of the Chinese Academy of Medical Sciences (Beijing).

Take one of the following cells in the log phase: human colon cancer cells (LoVo), human neuroblastoma cells (SH-SY5Y), human prostate cancer cells (PC-3), digested with 0.2% EDTA into monodisperse After the cell suspension, it was washed twice with washing buffer and divided into several portions, each of which had a number of cells of 5 × 10 ⁴ .

2. Preparation of aptamer 8 derivatives of nucleic acid

(1) Cyanine dye (Cy5)-labeled nucleic acid aptamer 8

The cyanine dye (Cy5)-labeled nucleic acid aptamer 8 is obtained by coupling a cyanine dye (Cy5) group at the 5' end of the aptamer 8 and dissolving the cyanine dye (Cy5)-labeled nucleic acid in a binding buffer. Body 8, according to the UV absorption calibration concentration (20 μM), heat denaturation at 95 ° C for 5 min, placed on ice for 10 min, and left at room temperature for 30 min.

(2) Cyanine dye (Cy5)-labeled control sequence

The cyanine dye (Cy5)-labeled control sequence was obtained by coupling a cyanine dye (Cy5) group at the 5' end of the control sequence, and dissolving the cyanine dye (Cy5)-labeled control sequence in binding buffer according to UV absorption. After calibration concentration (20 μM), heat denaturation at 95 ° C for 5 min, place on ice for 10 min, and leave at room temperature for 30 min. Nucleotide sequence of the control sequence: AGAGCAGCGTGGAGGATAGTTGGGGTTTGGCAAGTATTGTGTGCGCTGTTC (SEQ ID NO: 14).

Second, the specific detection of aptamer 8

In order to compare the specific responsiveness of the aptamer 8 and the monoclonal antibody to the cell surface L1 cell adhesion molecule protein, the three cells pretreated in the above step 1 were treated as follows, and three replicates were set for each treatment:

Treatment 1: 1:3 cells were randomly divided into 5×10 ⁴ cells in the binding buffer, then the cyanine dye (Cy5)-labeled nucleic acid aptamer 8 (final concentration 200 nmol/L) and L1 cell adhesion were added. Molecular protein antibody (anti-CD171, dilution factor 1:50).

Treatment 2: 3 cells, 5×10 ⁴ cells per plant were dispersed in the binding buffer, then the cyanine dye (Cy5)-labeled control sequence (final concentration was 200 nmol/L) and isotype control (IgG ₁ , Dilute to the same concentration as the L1 cell adhesion molecule protein antibody.

The mixture obtained in Treatment 1 and Treatment 2 was incubated on ice for 30 min, washed twice with washing buffer, and then added with phycoerythrin-modified secondary antibody, incubated on ice for 30 min, washed twice with washing buffer and then used. BD's FACSCalibur flow cytometer collects fluorescence intensity data for the second and fourth channels as the fluorescence intensity at the cell surface.

The results of flow cytometry are shown in Figure 4. In the flow cytometry, the abscissa indicates the fluorescence intensity of the fourth channel of the flow cytometer, that is, the fluorescence intensity of the dye molecule Cy5 modified by the nucleic acid molecule; the ordinate indicates the fluorescence intensity of the second channel of the flow cytometer, That is, the fluorescence intensity of the phycoerythrin to which the antibody (anti-CD171) or the isotype control binds. The cross-quadrant gate was set according to the fluorescence intensity of the fourth channel and the fluorescence intensity of the antibody isotype control in the second channel according to the control sequence of each cell, and 95% of the cells in the treatment 2 were in the following Q4 region.

According to the result, the cross quadrant set in the scatter plot divides the coordinate area into four regions:

In the upper left corner, the second channel has a large fluorescence intensity and the fourth channel has a small fluorescence intensity, that is, the antibody is positive, and the nucleic acid aptamer is negative, which is recorded as the Q1 region;

In the upper right corner, the second channel has a large fluorescence intensity and the fourth channel has a large fluorescence intensity, that is, the antibody is positive, and the nucleic acid aptamer is positive, which is recorded as the Q2 region;

In the lower right corner, the second channel has a small fluorescence intensity and the fourth channel has a large fluorescence intensity, that is, the antibody is negative and the nucleic acid aptamer is positive, which is recorded as the Q3 region;

In the lower left corner, the second channel has a small fluorescence intensity and the fourth channel has a small fluorescence intensity, that is, the antibody is negative and the nucleic acid aptamer is negative, which is recorded as the Q4 region.

The percentage of cells whose fluorescence intensity exceeds the fluorescence intensity of the treatment 2 after the cell binds to the aptamer or antibody of the nucleic acid is used as a measure of the binding ability of the aptamer or the antibody to the cell (-: <15%; +: 15-30%; ++: 30-65%; +++: 65-85%; ++++: >85%). As shown in Table 2, the aptamer 8 binds to each cell.

Table 2. Flow cytometry results of incubation of nucleic acid aptamers with different cells

(-: <15%; +: 15-30%; ++: 30-65%; +++: 65-85%; ++++: >85%)

As can be seen from Figure 4, the number of cells in the human colon cancer cells (LoVo, panel A) and human neuroblastoma cells (SH-SY5Y, panel B) in the antibody-positive and aptamer-positive Q2 regions was greater than 80%. The number of cells in human prostate cancer cells (PC-3, panel C) in the antibody-negative and aptamer-negative Q4 regions was greater than 80%. It indicated that the expression level of L1 cell adhesion molecule protein on PC-3 cell membrane surface was low.

The above results indicate that the aptamer 8 and the monoclonal antibody have the same responsiveness to the L1 cell adhesion molecule protein on the surface of the cell membrane, and both have high response to the cell expression of the L1 cell adhesion molecule protein, and adhere to the L1 cell. Cells with low expression of molecular proteins were unresponsive. Moreover, the nucleic acid aptamer of the present invention has a lower synthesis cost and a shorter cycle than the antibody.

Example 6. Nucleic acid aptamer and L1 cell adhesion molecule protein antibody detection siRNA interferes with the expression level of L1 cell adhesion molecule protein in LoVo cells

1. Preparation of aptamer 8 derivatives and LoVo cells after interference with siRNA

1. Preparation of aptamer 8 derivatives

(1) Fluorescein (6-FAM)-labeled nucleic acid aptamer 8

Fluorescein (6-FAM)-labeled nucleic acid aptamer 8 was obtained by coupling a fluorescein (6-FAM) group at the 5' end of aptamer 8 and was lysed with a binding buffer to fluorescein (6-FAM). The aptamer 8 of nucleic acid was denatured at 95 ° C for 5 min according to the UV absorption calibration concentration (20 μM), placed on ice for 10 min, and left at room temperature for 30 min.

(2) Fluorescein (6-FAM)-labeled control sequence

The fluorescein (6-FAM)-tagged control sequence was obtained by coupling a fluorescein (6-FAM) group at the 5' end of the control sequence, and the fluorescein (6-FAM)-labeled control sequence was solubilized with binding buffer. According to the UV absorption calibration concentration (20 μM), it was denatured by heating at 95 ° C for 5 min, placed on ice for 10 min, and left at room temperature for 30 min. The nucleotide sequence of the control sequence: AGAGCAGCGTGGAGGATAGTTGGGGTTTGGCAAGTATTGTGTGCGCTGTTC.

2. Preparation of LoVo cells after siRNA interference

(1) Preparation of transfection reagent

L1 cell adhesion molecule protein siRNA (L1CAM, sense strand: 5'-GCUACUCUGGAGAGGACUATT-3' (sequence 15); antisense strand: 5'-UAGUCCUCUCCAGAGUAGCTT-3' (sequence 16)) and siRNA negative control sequence (NC, The sense strand: 5'-UUCUCCGAACGUGUCACGUTT-3' (sequence 17); the antisense strand: 5'-ACGUGACACGUUCGGAGAATT-3' (sequence 18)) were synthesized in Suzhou Jima Gene Co., Ltd. According to the method provided by the manufacturer of the lipofection reagent kit, the liposome transfection reagent was used as the carrier of the siRNA sequence and the siRNA negative control sequence, and the siL1CAM sequence and the NC sequence were all dissolved in DEPC water to prepare 20 μM mother liquor, respectively. Transfection reagents containing siRNA sequences (L1CAM) and transfection reagents for control RNA sequences (NC) can be used for transfection. Liposomal transfection kit (

RNAiMAX Transfection Reagents are products of Thermo Fisher Scientific.

(2) Acquisition of LoVo cells after siRNA interference

LoVo cells were evenly plated in 6-well plates, containing about 1 x 10 ⁵ cells in 2 mL of medium (RPMI 1640 medium, Gibco) per well, and grown overnight after treatment as follows:

Add 250 ul of transfection reagent containing control RNA sequence (NC) to one or 2 ml of fresh medium;

250 μl of transfection reagent containing siRNA sequence (L1CAM) was added to 2 ml of fresh medium.

Three wells were repeated for each treatment, and the cells in the six-well plate were further cultured in the incubator for 48 hours to obtain LoVo cells after interference with siRNA and LoVo cells after interference with control RNA. The cells in the six-well plate were then digested with 0.2% EDTA into a monodisperse cell suspension, washed twice with wash buffer, and the cells were dispersed in binding buffer, and the cells in each well were divided into four portions.

2. Detection of L1 cell adhesion molecule protein expression in LoVo cells after siRNA interference

After the above step 1, the four cell suspensions of each well of the six-well plate were treated as follows:

Treatment 1. The fluorescein (6-FAM)-labeled control sequence was added to the cell suspension (final concentration was 200 nmol/L);

Treatment 2, adding fluorescein (6-FAM)-labeled nucleic acid aptamer 8 (final concentration of 200 nmol/L) to the cell suspension;

Treatment 3. Add an isotype control (IgG ₁ , diluted to a concentration consistent with the concentration of the L1 cell adhesion molecule protein antibody) in the cell suspension;

Treatment 4, L1 cell adhesion molecule protein antibody (anti-CD171, dilution factor 1:50) in the cell suspension.

The mixture of treatment one and treatment two was incubated on ice for 30 min, washed twice with washing buffer; the cells were resuspended in washing buffer, and the first channel fluorescence intensity data was collected by BD FACSCalibur flow cytometry as cell surface. The fluorescence intensity. The mixture of treatment three and treatment four was incubated on ice for 30 min, washed twice with washing buffer, and then added with phycoerythrin-modified secondary antibody, incubated on ice for 30 min, washed twice with washing buffer; washed cells Resuspended in wash buffer, BD FACSCalibur flow cytometry was used to collect fluorescence intensity data for the second channel as the fluorescence intensity on the cell surface.

The results of flow cytometry experiments are shown in Figure 5. As can be seen from Figure 5, aptamer 8 (panel A) reduced binding of siRNA to LoVo cells; L1 cell adhesion molecule protein antibody (anti-CD171, panel B) also reduced binding of siRNA to LoVo cells. The above results indicate that the aptamer 8 and the L1 cell adhesion molecule protein antibody have the same responsiveness to the expression of the L1 cell adhesion molecule protein on the cell membrane surface, and can be used instead of the L1 cell adhesion molecule protein antibody (Fig. C). Compared with the antibody, the nucleic acid aptamer of the invention has lower synthesis cost and shorter cycle; when the cell surface L1 cell adhesion molecule protein is detected, the operation is simpler, faster, and reproducible.

Example 7, aptamer yly12 and L1 cell adhesion molecule protein antibody co-stained target cells (D-SH-SY5Y)

The AF647-labeled nucleic acid aptamer yly12 was co-stained with a PE-labeled L1 cell adhesion molecule protein antibody (D-SH-SY5Y), and the aptamer yly12 (AF647-labeled DNA sequence) was solubilized in a binding buffer according to ultraviolet absorption. After calibrating the concentration, it was heated at 95 ° C for 5 min, placed on ice for 10 min, and left at room temperature for 30 min. The denatured-reconstituted DNA was diluted with binding buffer to a 200 nmol/L DNA solution (containing 1 μg/ml BSA, 0.1 μg/ml salmon sperm DNA, and a 1:100 dilution of the L1 cell adhesion molecule protein antibody containing PE direct label). ), D-SH-SY5Y cells which had been differentiated and cultured in a confocal culture dish were added, incubated on ice for 30 min, washed once with PBS, and observed under a microscope at a magnification of 100 times. As shown in Fig. 6, it has a good co-dyeing superposition effect, and the co-dyeing coefficient is 0.8243.

The above results further prove that the target (binding protein) of the nucleic acid aptamer in the present application is the L1 cell adhesion molecule, which proves the correctness of the mass spectrometry identification result.

Example 8. Nucleic acid aptamer yly12 and L1 cell adhesion molecule protein antibody co-stained LoVo cells

The AF647-labeled nucleic acid aptamer yly12 was co-stained with a PE-labeled L1 cell adhesion molecule protein antibody to express the protein (LoVo), and the binding aptamer was used to dissolve the aptamer yly12 (AF647-labeled DNA sequence) according to ultraviolet absorption. After calibrating the concentration, it was heated at 95 ° C for 5 min, placed on ice for 10 min, and left at room temperature for 30 min. The denatured-reconstituted DNA was diluted with binding buffer to a 200 nmol/L DNA solution (containing 1 μg/ml BSA, 0.1 μg/ml salmon sperm DNA, and a 1:100 dilution of the L1 cell adhesion molecule protein antibody containing PE direct label). ), added to LoVo cells that had been cultured for 24 hours in a confocal culture dish, incubated on ice for 30 min, washed once with PBS, and observed under a confocal microscope at 100 times magnification. As shown in Figure 7, it has a perfect co-dyeing effect with a co-dye coefficient of 0.8846.

Example 9, aptamer 8 and fluorescent staining of brain tissue sections and olfactory neuroblastoma sections

The morphogens 8 labeled with fluorescein (6-FAM) were used to stain brain tissue sections and olfactory neuroblastoma sections for detection and diagnosis of L1 cell adhesion molecule proteins.

1. Preparation of aptamer 8 derivatives and pretreatment of brain tissue sections and olfactory neuroblastoma tissue sections

1. Preparation of aptamer 8 derivatives

(1) Fluorescein (6-FAM)-labeled nucleic acid aptamer 8

(2) Fluorescein (6-FAM)-labeled control sequence

2. Pretreatment of tissue sections

The normal brain tissue (derived from the 55-year-old woman's venous brain tissue); olfactory neuroblastoma tissue (derived from the 17-year-old boy's olfactory neuroblastoma) as experimental materials, the following steps are processed:

(1) Tissue section dewaxing hydration

1) Baking sheet: the tissue section is baked in an oven at 60 ° C for 60 min;

2) immediately placed in the first cylinder of xylene for 15min, and then placed in the second cylinder of xylene for 15min;

3) placed in absolute ethanol for 10 min, 95% ethanol for 10 min, 90% ethanol for 10 min, 85% ethanol for 10 min, 70% ethanol for 10 min;

4) Rinse the tap water for 5 min (in a slow-flowing water basin), rinse it with distilled water, and obtain a dewaxed hydrated tissue section.

(2) section staining antigen repair

The antigen is repaired by microwave heat repair. The specific steps are as follows: Take appropriate amount of TE buffer (EDTA 0.292g and Tris-base 6.05g dissolved in 1000mL distilled water, pH=8.0), and put the dewaxed hydrated tissue section into the repair solution. In the container of (TE buffer), the microwave is heated to boiling, and the heating is stopped to lower the temperature of the liquid in the container, and the temperature is maintained between 95 ° C and 98 ° C for 15 min. The container was taken out, naturally cooled to room temperature, and the sections were taken out, rinsed with distilled water, and then immersed in a washing buffer for 5 min × 3 times (to ensure the first soaking of the newly prepared washing buffer), and the repaired tissue sections were obtained.

Second, the aptamer incubation step

1. The repaired tissue section of step 2 is first incubated with a binding buffer solution containing 20% FBS and 1 mg/ml salmon sperm DNA for 60 min at room temperature;

2, and then incubated with 200 μL of 250nM fluorescein (6-FAM) labeled aptamer 8 binding buffer solution for 60min at room temperature, the control sequence staining method is the same, the blank is not stained;

3. Wash three times with washing buffer;

4. Dry, anti-quenching seals were mounted and observed by laser confocal scanning microscopy.

The results of microscopic observation of normal brain tissue sections are shown in Fig. 8. As can be seen from Fig. 8, the nucleic acid aptamer 8 can bind to normal brain tissue sections, and the control sequence can hardly bind to normal brain tissue sections. It is indicated that aptamer 8 has good recognition and detection ability for neurites in normal brain tissue.

The microscopic observation of the olfactory neuroblastoma tissue section is shown in Fig. 9. As can be seen from Fig. 9, the aptamer 8 can bind to the olfactory neuroblastoma tissue section, and the control sequence can hardly be associated with the olfactory neuroblastoma. Tissue section bonding. It shows that aptamer 8 has good recognition and detection ability for olfactory neuroblastoma.

The above results indicate that the nucleic acid aptamer of the present invention can well recognize tissue sections expressing the L1 cell adhesion molecule protein.

Example 10, aptamer yly12 inhibits neurite outgrowth of neuroblastoma cells

In a 12-well cell culture plate, 5 × 10 ⁴ SH-SY5Y cells were seeded per well. The normal medium (RPMI1640 containing 15% inactivated FBS) was cultured for 24 hours, and replaced with serum-free RPMI1640 (containing differentiation reagent RA, BDNF) medium. After culture for 24 hours, RPMI1640 medium containing differentiation reagent was discarded, and washed once with PBS, 12 The well plates are divided into four groups: A, B, C and D. Each group has two duplicate wells, as shown in Figure 10. Group A is blank (ie serum-free RPMI1640 medium), and group B is serum-free RPMI1640 medium (including 1 μM yl2, as a control sequence, did not bind to SH-SY5Y cells, the sequence was 5'-ACACACCCAACGCAAAGCCACCTAAGCCAACCTATTAGGGTGTG-3' (sequence 19), and group C was serum-free RPMI1640 medium (containing 1 μM sg8c as a control sequence, and SH- SY5Y cells were bound, the sequence was 5'-TCTAACTGCTGCGCCGCCGGGAAAATACTGTACGGTTAGA-3' (sequence 20), and the D group was serum-free RPMI1640 medium (containing 1 μM yly12). Lines 1, 2, 3, and 4 represent 1, 2, 4, and 7 days of culture, respectively, and it is apparent from the figure that neurite growth in the yly12-containing aptamer group is significantly inhibited.

Further, using the NeuronJ function in the IamgeJ software, the average length of the neurites was calculated and calculated. As shown in Figure A, it can be seen that the average length of the neurites of the experimental group containing the aptamer yly12 was much lower than that of the blank control group. , negative control sequence yl2 experimental group and positive control sequence sg8c experimental group. Figure B shows the distribution of neurite length in different culture systems. It can be seen that the neurite length distribution of the experimental group containing the aptamer yly12 is more uniform and shorter than the blank control experimental group, the negative control sequence yl2 experimental group and positive. Control sequence sg8c experimental group. Taken together, the aptamer yly12 has a good growth inhibitory effect on the neurite growth model of neuroblastoma cell SH-SY5Y.

Example 11, nucleic acid aptamer yly12 for detection of L1CAM protein content in samples

(1) Preparation of magnetic nanoparticles conjugated to nucleic acid aptamer yly12:

Take 1 μL of streptavidin-modified 200 nm magnetic nanoparticles (purchased from Xiamen Purui Maige Biotechnology Co., Ltd.) at a concentration of 10 mg/mL and 10 μL of 1 μM biotin-labeled yly12 nucleic acid aptamer in 1 mL PBST buffer. The cells were incubated at room temperature for 30 min, magnetically separated for 1 min, washed twice with PBST buffer, and the precipitate was collected to obtain nucleic acid aptamer magnetic nanoparticles.

(2) Nucleic acid aptamer magnetic nanoparticles are incubated with the sample to be tested:

Contains different concentrations of L1CAM solution (0, 6ng/mL, 12.5ng/mL, 25ng/mL, 50ng/mL; L1CAM protein is L1 cell adhesion molecule protein, purchased from Beijing Yiqiao Shenzhou Technology Co., Ltd., the solvent of the solution is Binding buffer solution and sample to be tested (Lovo cell culture supernatant) were mixed with 10 uL of magnetic nanoparticles of conjugated nucleic acid aptamer yly12 (total volume 200 μL), incubated at room temperature for 30 min, magnetic separation for 1 min, PBST buffer Wash twice and collect the precipitate.

(3) Then, 0.5 μL of anti-CD171 (BD Biosciences, catalog number 554273) and 100 μL of PBST were separately added, mixed, incubated at room temperature for 30 min, magnetically separated for 1 min, washed twice with binding buffer, and the precipitate was collected.

(4) 0.5 μL of goat anti-mouse IgG-HRP (SANTA CRUZ) and 100 μL of binding buffer were added, mixed, incubated at room temperature for 30 min, magnetically separated for 1 min, washed twice with binding buffer, and the precipitate was collected.

(5) H ₂ O ₂ (50 μM) and 200 μL of Ampliflu Red (10 μM, Sigma) were added, mixed, and incubated at room temperature for 20 min.

(6) Excitation was carried out at 560 nm with a microplate reader (SpectraMax M5), and the emission value was measured at 595 nm. Draw a standard curve to obtain the concentration of the sample to be tested.

As shown in Fig. 11, the standard curve of different concentrations of L1CAM and fluorescence intensity (y=1395+889.8*x, R ² =0.98) was obtained, and the fluorescence intensity of the sample to be tested was 24000, which was brought into the above standard curve to obtain the test. The concentration of the sample was approximately 25.4 ng/mL. Taken together, the aptamer yly12 can be used for the detection of L1CAM protein.

Industrial application

Compared with the prior art, the invention has the advantages that the nucleic acid aptamer obtained by screening has high affinity; no immunogenicity; can be chemically synthesized in vitro, has small molecular weight, can modify and replace different parts, and the sequence Stable, easy to store; easy to mark (secondary antibody that does not require labeling), etc. When the L1 cell adhesion molecule protein is detected by the nucleic acid aptamer of the invention, the operation is simpler and faster, and the synthesis cost of the nucleic acid aptamer of the invention is lower than the preparation cost of the antibody, the cycle is short, and the reproducibility is good.

Claims

A nucleic acid aptamer, as follows A) or B):

A) a single-stranded DNA molecule as shown in SEQ ID NO:

B) removing the nucleotide sequence shown in A) from the 1st nucleotide of the 5' end, including 1-20 nucleotides of the first nucleotide residue at the 5' end, and removing the A) The nucleotide sequence shown includes 10-20 nucleotides from the first nucleotide of the 3' end including the first nucleotide residue at the 3' end, and the nucleic acid consisting of the remaining nucleotide residues is suitable. body.
The nucleic acid aptamer according to claim 1, wherein:

The nucleic acid aptamer shown by B is any one of the following 1) to 7):

1) a single-stranded DNA molecule as shown in SEQ ID NO: 2;

2) a single-stranded DNA molecule as shown in SEQ ID NO:3;

3) a single-stranded DNA molecule as shown in SEQ ID NO: 4;

4) a single-stranded DNA molecule as shown in SEQ ID NO: 5;

5) a single-stranded DNA molecule as shown in SEQ ID NO:6;

6) a single-stranded DNA molecule as shown in SEQ ID NO:7;

7) A single-stranded DNA molecule as shown in SEQ ID NO: 8.
The derivative of the nucleic acid aptamer according to claim 1 or 2, wherein the derivative of the nucleic acid aptamer is any one of the following (1) to (6):

(1) Deleting or adding one or several nucleotides to the nucleic acid aptamer of claim 1 or 2 to obtain a derivative of a nucleic acid aptamer having the function of recognizing or assisting recognition of an L1 cell adhesion molecule protein with the nucleic acid aptamer Object

(2) subjecting the nucleic acid aptamer of claim 1 or 2 to nucleotide substitution or modification to obtain a derivative of the nucleic acid aptamer having the function of recognizing or assisting recognition of the L1 cell adhesion molecule protein with the nucleic acid aptamer;

(3) modifying the skeleton of the nucleic acid aptamer according to claim 1 or 2 into a phosphorothioate skeleton, and obtaining a derivative of the nucleic acid aptamer having the function of recognizing or assisting recognition of the L1 cell adhesion molecule protein with the nucleic acid aptamer ;

(4) an RNA molecule encoded by the nucleic acid aptamer according to claim 1 or 2, which is a derivative of a nucleic acid aptamer having a function of recognizing or assisting recognition of an L1 cell adhesion molecule protein with the nucleic acid aptamer;

(5) a peptide nucleic acid encoded by the acid aptamer according to claim 1 or 2, which gives a derivative of the nucleic acid aptamer having the function of recognizing or assisting recognition of the L1 cell adhesion molecule protein with the nucleic acid aptamer;

(6) The end-point or intermediate-inducing signal molecule and/or active molecule and/or functional group of the nucleic acid aptamer according to claim 1 or 2, which has the function of recognizing or assisting recognition of L1 cell adhesion with the aptamer. A derivative of a nucleic acid aptamer that functions as a molecular protein.
The derivative according to claim 3, characterized in that:

The modification is phosphorylation, methylation, amination, thiolation or isotope; the functional group is a fluorophore, a biotin group, a radioactive substance, a therapeutic substance, digoxin, a nano luminescent material or Enzyme labeling.
Use of the nucleic acid aptamer of claim 1 or 2 or the derivative of claim 3 or 4 in at least one of the following (B1) to (B19):

(B1) identifying or assisting in identifying L1 cell adhesion molecule proteins;

(B2) binding or assisting in binding to the L1 cell adhesion molecule protein;

(B3) preparing a product for identifying or assisting in identifying an L1 cell adhesion molecule protein;

(B4) preparing a binding or auxiliary binding L1 cell adhesion molecule protein product;

(B5) detecting or assisting detecting whether the sample to be tested contains L1 cell adhesion molecule protein;

(B6) preparing a product for detecting or assisting detection of whether the sample to be tested contains L1 cell adhesion molecule protein;

(B7) detecting or assisting detecting the content of L1 cell adhesion molecule protein in the sample to be tested;

(B8) preparing a product for detecting or assisting in detecting the content of L1 cell adhesion molecule protein in the sample to be tested;

(B9) detecting or assisting in detecting tumor or tumor cells expressing L1 cell adhesion molecule protein;

(B10) preparing a product for detecting or assisting in detecting a tumor or tumor cell expressing an L1 cell adhesion molecule protein;

(B11) identifying or assisting in identifying tumor or tumor cells;

(B12) binding or assisting in binding to a tumor or tumor cell;

(B13) preparing a product that recognizes or assists in identifying a tumor or tumor cell;

(B14) preparing a product that binds or assists in binding to a tumor or tumor cell;

(B15) preparing a product that targets an L1 cell adhesion molecule protein;

(B16) inhibiting the growth of neurites of neuroblastoma cells;

(B17) preparing a product that inhibits the growth of neurites of neuroblastoma cells;

(B18) identifying the growth of neurites of neuroblastoma cells;

(B19) A product for identifying the growth of neurites of neuroblastoma cells.
The use according to claim 5, wherein the sample to be tested is a cell;

Or the tumor is a tumor expressing an L1 cell adhesion molecule protein;

Or the tumor or tumor cell expressing the L1 cell adhesion molecule protein is a tumor or tumor cell with high expression of the L1 cell adhesion molecule protein.
The application of claim 6 wherein:

The tumor expressing the L1 cell adhesion molecule protein is neuroblastoma, human colon cancer, human cervical cancer, human breast cancer, adriamycin-resistant human breast cancer or liver cancer;

The tumor cells expressing the L1 cell adhesion molecule protein are neuroblastoma cells, human colon cancer cells, human cervical cancer cells, human breast cancer cells, adriamycin-resistant human breast cancer cells or liver cancer cells.
The use according to any of claims 5-7, characterized in that the product is a kit or probe or a targeting substance or a medicament.
A product having the following functions, the active ingredient of the nucleic acid aptamer of claim 1 or 2 or the derivative of claim 3 or 4;

The function is at least one of the following 1)-9):

1) identifying or assisting in the recognition of L1 cell adhesion molecule proteins;

2) binding or assisting in binding to L1 cell adhesion molecule proteins;

3) detecting or assisting detection of whether the sample to be tested contains L1 cell adhesion molecule protein;

4) detecting or assisting in detecting the content of L1 cell adhesion molecule protein in the sample to be tested;

5) detecting or assisting in detecting tumor or tumor cells expressing L1 cell adhesion molecule protein;

6) Identifying or assisting in identifying tumor or tumor cells;

7) binding or assisting in binding tumor or tumor cells;

8) inhibiting the growth of neurites of neuroblastoma cells;

9) Identify the growth of neurites of neuroblastoma cells.
The product according to claim 9, wherein the sample to be tested is a cell.

Or the tumor is a tumor expressing an L1 cell adhesion molecule protein;

Or the tumor or tumor cell expressing the L1 cell adhesion molecule protein is a tumor or tumor cell with high expression of the L1 cell adhesion molecule protein.
The product of claim 10 wherein:

The tumor expressing the L1 cell adhesion molecule protein is neuroblastoma, human colon cancer, human cervical cancer, human breast cancer, adriamycin-resistant human breast cancer or liver cancer;

The tumor cells expressing the L1 cell adhesion molecule protein are neuroblastoma cells, human colon cancer cells, human cervical cancer cells, human breast cancer cells, adriamycin-resistant human breast cancer cells or liver cancer cells.
A product according to any one of claims 9-11, wherein the product is a kit or probe or a targeting substance or drug.
A method for detecting or assisting in detecting a tumor or tumor cell expressing an L1 cell adhesion molecule protein, comprising the steps of: using the nucleic acid aptamer of claim 1 or 2 or the derivative of claim 3 or 4 and a tumor to be tested Cell binding, if capable of binding, the tumor cell to be tested is a tumor or tumor cell expressing an L1 cell adhesion molecule protein; if not, the tumor cell to be tested is not or candidate is not expressed L1 cell adhesion A tumor or tumor cell of a molecular protein.
A method for detecting or assisting in detecting the content of L1 cell adhesion molecule protein in a sample to be tested comprises the following steps:

1) combining the nucleic acid aptamer of claim 1 or 2 or the derivative of claim 3 or 4 with a sample to be tested or a different concentration of L1 cell adhesion molecule protein standard to obtain various binding products;

2) detecting the signal intensity of the various binding products by a nucleic acid aptamer-based ELISA method, and obtaining signal intensity of the sample to be tested and signal intensity of different concentrations of the L1 cell adhesion molecule protein standard;

3) using a different concentration of L1 cell adhesion molecule protein standard and its corresponding signal intensity as a standard curve;

Substituting the signal intensity of the sample to be tested into the standard curve to obtain the protein content of the L1 cell adhesion molecule in the sample to be tested.