WO2019109053A1 - Methods for dosing and for modulation of genetically engineered cells - Google Patents

Methods for dosing and for modulation of genetically engineered cells Download PDF

Info

Publication number
WO2019109053A1
WO2019109053A1 PCT/US2018/063502 US2018063502W WO2019109053A1 WO 2019109053 A1 WO2019109053 A1 WO 2019109053A1 US 2018063502 W US2018063502 W US 2018063502W WO 2019109053 A1 WO2019109053 A1 WO 2019109053A1
Authority
WO
WIPO (PCT)
Prior art keywords
cells
subject
steroid
car
administered
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2018/063502
Other languages
English (en)
French (fr)
Inventor
Tina ALBERTSON
Mark D. Heipel
He Li
Claire L. Sutherland
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Juno Therapeutics Inc
Original Assignee
Juno Therapeutics Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Juno Therapeutics Inc filed Critical Juno Therapeutics Inc
Priority to US16/768,575 priority Critical patent/US20210198372A1/en
Priority to JP2020529479A priority patent/JP2021508317A/ja
Priority to EP18821900.0A priority patent/EP3716980A1/en
Priority to KR1020207018924A priority patent/KR20200116081A/ko
Priority to CN201880087684.XA priority patent/CN111989106A/zh
Publication of WO2019109053A1 publication Critical patent/WO2019109053A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/0005Vertebrate antigens
    • A61K39/0011Cancer antigens
    • A61K39/001102Receptors, cell surface antigens or cell surface determinants
    • A61K39/001111Immunoglobulin superfamily
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/56Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids
    • A61K31/57Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids substituted in position 17 beta by a chain of two carbon atoms, e.g. pregnane or progesterone
    • A61K31/573Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids substituted in position 17 beta by a chain of two carbon atoms, e.g. pregnane or progesterone substituted in position 21, e.g. cortisone, dexamethasone, prednisone or aldosterone
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/66Phosphorus compounds
    • A61K31/675Phosphorus compounds having nitrogen as a ring hetero atom, e.g. pyridoxal phosphate
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/395Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
    • A61K39/39533Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals
    • A61K39/39541Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals against normal tissues, cells
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/395Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
    • A61K39/39533Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals
    • A61K39/3955Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals against proteinaceous materials, e.g. enzymes, hormones, lymphokines
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/395Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
    • A61K39/39533Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals
    • A61K39/39558Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals against tumor tissues, cells, antigens
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/10Cellular immunotherapy characterised by the cell type used
    • A61K40/11T-cells, e.g. tumour infiltrating lymphocytes [TIL] or regulatory T [Treg] cells; Lymphokine-activated killer [LAK] cells
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/30Cellular immunotherapy characterised by the recombinant expression of specific molecules in the cells of the immune system
    • A61K40/31Chimeric antigen receptors [CAR]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/40Cellular immunotherapy characterised by antigens that are targeted or presented by cells of the immune system
    • A61K40/41Vertebrate antigens
    • A61K40/42Cancer antigens
    • A61K40/4202Receptors, cell surface antigens or cell surface determinants
    • A61K40/421Immunoglobulin superfamily
    • A61K40/4211CD19 or B4
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/0083Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the administration regime
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • A61P35/02Antineoplastic agents specific for leukemia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P39/00General protective or antinoxious agents
    • A61P39/02Antidotes
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70503Immunoglobulin superfamily
    • C07K14/7051T-cell receptor (TcR)-CD3 complex
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70503Immunoglobulin superfamily
    • C07K14/70521CD28, CD152
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70578NGF-receptor/TNF-receptor superfamily, e.g. CD27, CD30, CD40, CD95
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/71Receptors; Cell surface antigens; Cell surface determinants for growth factors; for growth regulators
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2803Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2866Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against receptors for cytokines, lymphokines, interferons
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6863Cytokines, i.e. immune system proteins modifying a biological response such as cell growth proliferation or differentiation, e.g. TNF, CNF, GM-CSF, lymphotoxin, MIF or their receptors
    • G01N33/6866Interferon
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/505Medicinal preparations containing antigens or antibodies comprising antibodies
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/51Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/515Animal cells
    • A61K2039/5156Animal cells expressing foreign proteins
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/51Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/515Animal cells
    • A61K2039/5158Antigen-pulsed cells, e.g. T-cells
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/545Medicinal preparations containing antigens or antibodies characterised by the dose, timing or administration schedule
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/55Medicinal preparations containing antigens or antibodies characterised by the host/recipient, e.g. newborn with maternal antibodies
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/80Vaccine for a specifically defined cancer
    • A61K2039/804Blood cells [leukemia, lymphoma]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2239/00Indexing codes associated with cellular immunotherapy of group A61K40/00
    • A61K2239/38Indexing codes associated with cellular immunotherapy of group A61K40/00 characterised by the dose, timing or administration schedule
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2239/00Indexing codes associated with cellular immunotherapy of group A61K40/00
    • A61K2239/46Indexing codes associated with cellular immunotherapy of group A61K40/00 characterised by the cancer treated
    • A61K2239/48Blood cells, e.g. leukemia or lymphoma
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2300/00Mixtures or combinations of active ingredients, wherein at least one active ingredient is fully defined in groups A61K31/00 - A61K41/00
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/60Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments
    • C07K2317/62Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments comprising only variable region components
    • C07K2317/622Single chain antibody (scFv)
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/01Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/03Fusion polypeptide containing a localisation/targetting motif containing a transmembrane segment
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/33Fusion polypeptide fusions for targeting to specific cell types, e.g. tissue specific targeting, targeting of a bacterial subspecies
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/40Fusion polypeptide containing a tag for immunodetection, or an epitope for immunisation
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/435Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
    • G01N2333/705Assays involving receptors, cell surface antigens or cell surface determinants
    • G01N2333/715Assays involving receptors, cell surface antigens or cell surface determinants for cytokines; for lymphokines; for interferons
    • G01N2333/7155Assays involving receptors, cell surface antigens or cell surface determinants for cytokines; for lymphokines; for interferons for interleukins [IL]

Definitions

  • the present disclosure relates in some aspect to methods of treatment, such as methods involving administering and/or determining dosing of, cell therapy, such as of cells engineered with a recombinant receptor, such as a T cell receptor (TCR) or chimeric antigen receptor (CAR).
  • the methods include determining a therapeutic range and/or window for dosing, for example, based on the estimated probabilities of risk of developing a toxicity and estimated probabilities of a treatment outcome or response, such as treatment, reduction nor amelioration of a sign or symptom thereof, or degree or durability thereof, following administration of the cell therapy or engineered cells.
  • the methods involve administering an agent capable of modulating the engineered cells. Also provided are methods of ameliorating and/or treating a toxicity.
  • T cells such as those expressing genetically engineered antigen receptors, such as chimeric antigen receptors (CARs).
  • CARs chimeric antigen receptors
  • available methods may not be entirely satisfactory.
  • additional strategies for immunotherapy and adoptive cell therapy e.g., strategies to enhance persistence, activity and/or proliferation of administered cells and responses and strategies for modulating T cell phenotype, activity and/or expansion.
  • Provided in some embodiments are methods, cells, compositions, articles of manufacture, and systems to address such needs.
  • a dose of engineered cells such as those engineered with a chimeric antigen receptor (CAR), and/or assessing and/or administering further agent(s) to subjects having been administered such engineered cells.
  • the dose administered is within a therapeutic range and/or window and/or is sufficient to achieve an overall or peak amount or number of engineered cells, e.g., CAR+ cells, in a sample or tissue or bodily fluid of the subject, such as in the blood of the subject, within a specified range, such as within a specified or determined therapeutic range, optionally within or over a certain period of time following administration.
  • the therapeutic range is determined based upon or relates to probabilities, such as estimated probabilities, e.g., probability of response and/or probability or risk of developing a sign or symptom of a toxicity, such as a severe and/or grade 3 or higher toxicity, such as neurotoxicity (NT), e.g., a grade 3 or higher toxicity.
  • probabilities such as estimated probabilities, e.g., probability of response and/or probability or risk of developing a sign or symptom of a toxicity, such as a severe and/or grade 3 or higher toxicity, such as neurotoxicity (NT), e.g., a grade 3 or higher toxicity.
  • NT neurotoxicity
  • the administering involves administration of a sub-optimal or reduced or low dose of cells which in some aspects is insufficient to be within or achieve or result within a therapeutic range and/or window and/or is insufficient to achieve an overall or peak amount or number of engineered cells, e.g., CAR+ cells, in a sample or tissue or bodily fluid of the subject, such as in the blood of the subject, within a specified range, such as within a specified or determined therapeutic range, optionally within or over a certain period of time following administration.
  • engineered cells e.g., CAR+ cells
  • provided methods further include administering a compound to the subject other than or in addition to the engineered cells
  • such agent may be an agent known or suspected of being capable of enhancing or increasing the likelihood, degree, rapidity, or level of expansion, persistence and/or exposure of the subject to the engineered cells, such as the CAR+ cells.
  • the agent(s) increases or promotes expansion of the cells in vivo, and/or is capable of resulting in levels, degree or rapidity of expansion, peak levels, AUC, or other measure of the cells in the subject, such as CAR+ cells, expansion is within the therapeutic range and/or window.
  • the therapeutic range in some aspects is determined based upon or relates to probabilities, such as estimated probabilities, e.g., probability of response and/or probability or risk of developing a sign or symptom of a toxicity, such as a severe and/or grade 3 or higher toxicity, such as neurotoxicity (NT), e.g., a grade 3 or higher toxicity.
  • probabilities such as estimated probabilities, e.g., probability of response and/or probability or risk of developing a sign or symptom of a toxicity, such as a severe and/or grade 3 or higher toxicity, such as neurotoxicity (NT), e.g., a grade 3 or higher toxicity.
  • NT neurotoxicity
  • the methods involve, e.g., subsequent to the administration, to the subject the cell therapy or engineered cells; monitoring levels of engineered or other cells in a sample of the subject such as a blood or blood-derived samples (such as peak CAR cells in the blood), optionally over time, for example, to assess whether the cells are within a therapeutic range and/or window.
  • the provided methods include an administration to the subject, such as administering a compound to enhance expansion or exposure to the engineered cells such as to enhance CAR+ cell expansion in vivo, e.g., such that the peak CAR+ expansion and/or levels and/or exposure and/or AUC is within the therapeutic or desired range.
  • the level of engineered, e.g., CAR+, cells in the sample is determined as the number of the cells, e.g., CAR+ cells, per microliter of the sample;
  • the peak level is the highest such measurement following, optionally over a specified period of time following, administration of the cells or cell therapy to the subject.
  • the therapeutic range is a range in which the estimated probability of a toxicity or toxic outcome or sign or symptom thereof, such as a severe toxicity and/or a neurotoxicity (NT) or CRS, is less than 20%, less than 15%, less than 10% or less than 5%; in some aspects, the probability is based on a probability curve, e.g., based on outcomes of subjects treated with or administered the cell therapy and/or cells engineered to express the recombinant receptor.
  • a toxicity or toxic outcome or sign or symptom thereof such as a severe toxicity and/or a neurotoxicity (NT) or CRS
  • the estimated probability of achieving a treatment response, effect, amelioration or treatment is greater than 20%, 25%, 30%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or more.
  • the toxicity is a neurotoxicity and/or is severe toxicity and/or is grade 3-5 neurotoxicity.
  • the response or indicator of response is a marrow response or an outcome measured in bone marrow of the subject.
  • the presence or absence of the marrow response is or is determined by flow cytometry and/or IgH sequencing and/or indicates or is a reduction or elimination of cells of the disease or condition in a sample of the subject, optionally an organ, tissue or fluid of the subject, such as a lymph node, bone marrow, tumor site, blood or other sample, of the subject.
  • the disease or condition is a cancer.
  • the cancer is selected from the group consisting of sarcomas, carcinomas, lymphomas, non-Hodgkin lymphomas (NHLs), diffuse large B cell lymphoma (DLBCL), leukemia, CLL, ALL, AML and myeloma.
  • the cancer is a pancreatic cancer, bladder cancer, colorectal cancer, breast cancer, prostate cancer, renal cancer, hepatocellular cancer, lung cancer, ovarian cancer, cervical cancer, pancreatic cancer, rectal cancer, thyroid cancer, uterine cancer, gastric cancer, esophageal cancer, head and neck cancer, melanoma, neuroendocrine cancers, CNS cancers, brain tumors, bone cancer, or soft tissue sarcoma.
  • the chimeric antigen receptor contains an extracellular antigen-recognition domain that specifically binds to the antigen and an extracellular antigen-recognition domain that specifically binds to the antigen and an extracellular antigen-recognition domain that specifically binds to the antigen and an extracellular antigen-recognition domain that specifically binds to the antigen and an extracellular antigen-recognition domain that specifically binds to the antigen and an extracellular antigen-recognition domain that specifically binds to the antigen and an extracellular antigen-recognition domain that specifically binds to the antigen and an extracellular antigen-recognition domain that specifically binds to the antigen and an extracellular antigen-recognition domain that specifically binds to the antigen and an extracellular antigen-recognition domain that specifically binds to the antigen and an extracellular antigen-recognition domain that specifically binds to the antigen and an extracellular antigen-recognition domain that specifically bind
  • the intracellular signaling domain comprising an ITAM.
  • the intracellular signaling domain contains an intracellular domain of a CD3-zeta (E ⁇ 3z) chain.
  • the chimeric antigen receptor (CAR) further comprises a costimulatory signaling region.
  • the costimulatory signaling region comprises a signaling domain of CD28 or 4-1BB.
  • the costimulatory domain is a domain of CD28.
  • the costimulatory domain is a domain of 4-1BB.
  • the CAR specifically recognizes or binds an antigen selected from among antigens expressed by B cells, ROR1, B cell maturation antigen (BCMA), Her2, Ll-CAM, CD19, CD20, CD22, mesothelin, CEA, and hepatitis B surface antigen, anti-folate receptor, CD23, CD24, CD30, CD33, CD38, CD44, EGFR, EGP-2, EGP-4, EPHa2, ErbB2, 3, or 4, erbB dimers, EGFR vIII, FBP, FCRL5, FCRH5, GPRC5D, fetal acethycholine e receptor, GD2, GD3, HMW-MAA, IL-22R-alpha, IL-l3R-alpha2, kdr, kappa light chain, Lewis Y, Ll-cell adhesion molecule, (Ll-CAM), Melanoma-associated antigen (MAGE)-Al,
  • B cells maturation antigen BCMA
  • the cells are T cells.
  • the T cells are CD4+ or CD8+.
  • kits for treatment including administering to a subject having a disease or condition, a dose of genetically engineered cells comprising T cells expressing a chimeric antigen receptor (CAR) for treating the disease or condition, after administering the dose of genetically engineered cells, monitoring CAR+ T cells in the blood of the subject to assess if the cells are within a therapeutic range, and if the genetically engineered cells are not within the therapeutic range, administering an agent to the subject capable of modulating, optionally increasing or decreasing, CAR+ T cell expansion or proliferation, in the subject, wherein the therapeutic range is: (i) based upon the range of peak CD3+ CAR+ T cells, or a CD8+CAR+ T cell subset thereof, in the blood among one or more subjects previously treated with the genetically engineered cells that is associated with an estimated probability of response of greater than or greater than about 65%, 70%, 75%, 80%, 85%, 90%, and an estimated probability of a toxicity of less than or about 30%; or (ii) peak
  • kits for treatment including monitoring, in the blood of a subject, the presence of genetically engineered cells containing T cells expressing a chimeric antigen receptor (CAR) to assess if the cells are within a therapeutic range, wherein the subject has been previously administered a dose of the genetically engineered cells for treating a disease or condition; and if the genetically engineered cells are not within the therapeutic range, administering an agent to the subject capable of modulating, optionally increasing or decreasing, CAR+ T cell expansion or proliferation, in the subject, wherein the therapeutic range is: (i) based upon the range of peak CD3+ CAR+ T cells, or a CD8+CAR+ T cell subset thereof, in the blood among one or more subjects previously treated with the genetically engineered cells that is associated with an estimated probability of response of greater than or greater than about 65%, 70%, 75%, 80%, 85%, 90%, and an estimated probability of a toxicity of less than or about 30%, 25%, 20%, 15%, 10%, 5%; or (ii)
  • an agent is administered to the subject that is capable of increasing CAR+ T cell expansion or proliferation. In some cases, the agent is capable of CAR-specific expansion.
  • the agent is an anti-idiotype antibody or antigen binding fragment thereof specific to the CAR, an immune checkpoint inhibitor, a modulator of a metabolic pathway, an adenosine receptor antagonist, a kinase inhibitor, an anti-TGFp antibody or an anti-TGFpR antibody or a cytokine.
  • an agent is administered to the subject that is capable of decreasing CAR+ T cell expansion or proliferation.
  • the agent is a steroid.
  • the steroid is a corticosteroid.
  • the steroid is dexamethasone or
  • the steroid is administered in an amount that is between or between about 1.0 mg and about 40 mg, between or between about 1.0 mg and about 20 mg, between or between about 2.0 mg and about 20 mg, between or between about 5.0 mg and about 25.0 mg, between or between about 10 mg and about 20 mg dexamethasone or equivalent thereof, each inclusive.
  • the steroid is administered in multiple doses over a period of at or more than 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 days or more or within a range defined by any of the foregoing. In some of any such embodiments, the steroid is administered once per day, twice per day, or three times or more per day.
  • the steroid is administered in an amount that is between or between about 1.0 mg and about 80 mg, between or between about 1.0 mg and about 60 mg, between or between about 1.0 mg and about 40 mg, between or between about 1.0 mg and about 20 mg, between or between about 1.0 mg and about 10 mg, between or between about 2.0 mg and about 80 mg, between or between about 2.0 mg and about 60 mg, between or between about 2.0 mg and about 40 mg, between or between about 2.0 mg and about 20 mg, between or between about 2.0 mg and about 10 mg, between or between about 5.0 mg and about 80 mg, between or between about 5.0 mg and about 60 mg, between or between about 5.0 mg and about 40 mg, between or between about 5.0 mg and about 20 mg, between or between about 5.0 mg and about 10 mg, between or between about 10 mg and about 80 mg, between or between about 10 mg and about 60 mg, between or between about 10 mg and about 40 mg, between or between about 10 mg and about 60 mg, between or between about 10 mg and about 40 mg, between or between about 10 mg and about 60 mg, between or
  • the subject is monitored for CAR+ T cells in the blood at a time that is at least 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 15 days, 16 days, 17 days, 18 days, 19 days, 20 days or 21 days after initiation of administration of the genetically engineered cells.
  • the subject is monitored for CAR+ T cells in the blood at a time that is between or between about 11 to 22 days, 12 to 18 days or 14 to 16 days, each inclusive, after initiation of administration of the genetically engineered cells.
  • the agent is administered at a time that is greater than or greater than about 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 15 days, 16 days, 17 days, 18 days, 19 days, 20 days or 21 days after initiation of administration of the genetically engineered cells. In some of any such embodiments, the agent is administered at a time that is between or between about 11 to 22 days, 12 to 18 days or 14 to 16 days, each inclusive, after initiation of administration of the genetically engineered cells.
  • a subject in which the level, amount or concentration of a volumetric measure of tumor burden or an inflammatory marker in a sample from the subject is at or above a threshold level, wherein the sample does not contain genetically engineered T cells expressing a chimeric antigen receptor (CAR) and/or is obtained from the subject prior to receiving administration of genetically engineered T cells expressing a CAR; and administering to the selected subject an agent that is capable of decreasing expansion or proliferation of genetically engineered T cells expressing a CAR.
  • CAR chimeric antigen receptor
  • a subject is administered an agent that is capable of decreasing expansion or proliferation of genetically engineered T cells expressing a chimeric antigen receptor (CAR) in a subject, wherein the subject is one in which the level, amount or concentration of a volumetric measure of tumor burden or an inflammatory marker in a sample from the subject is at or above a threshold level.
  • CAR chimeric antigen receptor
  • the sample does not comprise genetically engineered T cells expressing a CAR and/or is obtained from the subject prior to receiving administration of genetically engineered T cells expressing a CAR.
  • the agent is administered prior to or concurrently with initiation of administration of a dose of genetically engineered cells including T cells expressing a chimeric antigen receptor.
  • the method further includes
  • the subject has a disease or condition and the genetically engineered cells are for treating the disease of condition.
  • the selected subject prior to administering the agent, is at risk of developing a toxicity following administration of the genetically engineered cells.
  • the administration of the agent is sufficient to achieve peak CAR+ T cells in a therapeutic range in the subject, or in a majority of selected subjects so treated by the method or in greater than 75%, 80%, 85%, 90%, 95% of the selected subjects so treated by the method.
  • the therapeutic range is based upon the range of peak CD3+ CAR+
  • T cells or a CD8+CAR+ T cell subset thereof, in the blood among one or more subjects previously treated with the genetically engineered cells that is associated with an estimated probability of response of greater than or greater than about 65%, 70%, 75%, 80%, 85%, 90%, and an estimated probability of a toxicity of less than or about 30%, 25%, 20%, 15%, 10%, 5%; or peak CD3+CAR+ T cells in the blood, following administration of the genetically engineered cells, that is between or between about 10 cells per microliter and 500 cells per microliter; or peak CD8+CAR+ T cells in the blood, following administration of the genetically engineered cells, that is between or between about 2 cells per microliter and 200 cells per microliter.
  • the therapeutic range is: (i) based upon the number or level of CD3+CAR+ T cells in the blood, following administration of the genetically engineered cells, that is between or between about 10 cells per microliter and 500 cells per microliter; or (ii) based upon the number or level of CD8+CAR+ T cells in the blood, following administration of the genetically engineered cells, that is between or between about 2 cells per microliter and 200 cells per microliter.
  • a volumetric measure of tumor burden is measured and the volumetric measure is a sum of the products of diameters (SPD), longest tumor diameters (LD), sum of longest tumor diameters (SLD), tumor volume, necrosis volume, necrosis-tumor ratio (NTR), peritumoral edema (PTE), and edema-tumor ratio (ETR).
  • the volumetric measure is a sum of the products of diameter (SPD).
  • the volumetric measure is measured using computed tomography (CT), positron emission tomography (PET), and/or magnetic resonance imaging (MRI) of the subject.
  • CT computed tomography
  • PET positron emission tomography
  • MRI magnetic resonance imaging
  • an inflammatory marker in a sample from the subject is measured and the inflammatory marker is C-reactive protein (CRP), erythrocyte sedimentation rate (ESR), albumin, ferritin, b2 microglobulin (b2-M), lactate dehydrogenase (LDH), a cytokine or a chemokine.
  • CRP C-reactive protein
  • ESR erythrocyte sedimentation rate
  • b2-M microglobulin
  • LDH lactate dehydrogenase
  • the inflammatory marker is LDH.
  • the inflammatory marker is a cytokine or a chemokine that is IL-7, IL15, MIP-l alpha or TNF-alpha.
  • the cytokine or chemokine is associated with macrophage or monocyte activation.
  • the sample is or contains a blood sample, plasma sample, or serum sample.
  • the inflammatory marker is assessed using a colorimetric assay or an immunoassay.
  • the inflammatory marker is assessed using an immunoassay and the immunoassay is selected from enzyme-linked immunosorbent assay (ELISA), enzyme immunoassay (EIA), radioimmunoassay (RIA), surface plasmon resonance (SPR), Western Blot, Lateral flow assay,
  • the threshold value is a value that is within 25%, within 20%, within 15%, within 10%, or within 5% above the average value of the volumetric measure or inflammatory marker and/or is within a standard deviation above the average value of the volumetric measure or the inflammatory marker in a plurality of control subjects; is above the highest value of the volumetric measure or inflammatory marker, optionally within 50%, within 25%, within 20%, within 15%, within 10%, or within 5% above such highest fold change, measured in at least one subject from among a plurality of control subjects; and/or is above the highest value of the volumetric measure or inflammatory marker as measured among more than 75%, 80%, 85%, 90%, 95%, or 98% of subjects from a plurality of control subjects.
  • the plurality of control subjects are a group of subjects prior to receiving a dose of the genetically engineered cells, wherein each of the control subjects of the group exhibited a peak CAR+ T cells in the blood greater than the highest peak CAR+ T cells in the therapeutic range; each of the control subjects of the group went on to develop at toxicity, optionally a neurotoxicity or cytokine release syndrome (CRS), a grade 2 or grade 3 or higher neurotoxicity or a grade 3 or higher CRS, after receiving a dose of the engineered cells for treating the same disease or condition; each of the control subjects of the group did not develop a response, optionally a complete response (CR) or partial response (PR), following administration of the dose of genetically engineered cells; and/or each of the control subjects of the group did not develop a durable response, optionally for at or about or greater than or about 3 months or at or about or greater than or about 6 months, following
  • the volumetric measure is SPD and the threshold value is or is about 30 cm 2 ,is or is about 40 cm 2 , is or is about 50 cm 2 , is or is about 60 cm 2 , or is or is about 70 cm .
  • the inflammatory marker is LDH and the threshold value is or is about 300 units per liter, is or is about 400 units per liter, is or is about 500 units per liter or is or is about 600 units per liter.
  • the agent is a steroid.
  • the steroid is a corticosteroid.
  • the steroid is dexamethasone or
  • the steroid is administered in an amount that is between or between about 1.0 mg and about 40 mg, between or between about 1.0 mg and about 20 mg, between or between about 2.0 mg and about 20 mg, between or between about 5.0 mg and about 25.0 mg, between or between about 10 mg and about 20 mg dexamethasone or equivalent thereof, each inclusive.
  • the steroid is administered in multiple doses over a period of at or more than 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 days or more or within a range defined by any of the foregoing. In some of any such embodiments, the steroid is administered once per day, twice per day, or three times or more per day.
  • the steroid is administered in an amount that is between or between about 1.0 mg and about 80 mg, between or between about 1.0 mg and about 60 mg, between or between about 1.0 mg and about 40 mg, between or between about 1.0 mg and about 20 mg, between or between about 1.0 mg and about 10 mg, between or between about 2.0 mg and about 80 mg, between or between about 2.0 mg and about 60 mg, between or between about 2.0 mg and about 40 mg, between or between about 2.0 mg and about 20 mg, between or between about 2.0 mg and about 10 mg, between or between about 5.0 mg and about 80 mg, between or between about 5.0 mg and about 60 mg, between or between about 5.0 mg and about 40 mg, between or between about 5.0 mg and about 20 mg, between or between about 5.0 mg and about 10 mg, between or between about 10 mg and about 80 mg, between or between about 10 mg and about 60 mg, between or between about 10 mg and about 40 mg, between or between about 10 mg and about 60 mg, between or between about 10 mg and about 40 mg, between or between about 10 mg and about 60 mg, between or
  • the volumetric measure or inflammatory marker is measured in the subject within 1 day, 2 days, 3 days, 4 days, 6 days, 8 days, 12 days, 16 days, 20 days, 24 days, 28 days or more prior to initiation of administration of the genetically engineered cells.
  • the method includes administering to a subject having a disease or condition, a dose of genetically engineered cells including T cells expressing a chimeric antigen receptor (CAR), wherein the dose contains a number of the genetically engineered cells that is sufficient to achieve peak CAR+ cells in the blood within a determined therapeutic range in the subject, or in a majority of subjects so treated by the method or in greater than 75%, 80%, 85%, 90%, 95% of the subjects so treated by the method, wherein the therapeutic range is: (i) based upon the range of peak CD3+ CAR+ T cells, or a CD8+CAR+ T cell subset thereof, in the blood among one or more subjects previously treated with the genetically engineered cells that is associated with an estimated probability of response of greater than or greater than about 65%, 70%, 75%, 80%, 85%, 90%, and an estimated probability of a toxicity of less than or about 30%, 25%, 20%, 15%, 10%, 5%; or (ii)
  • the dose of genetically engineered cells contains from or from about 1 x 10 5 to 5 x 10 8 total CAR-expressing T cells, 1 x 10 6 to 2.5 x 10 8 total CAR-expressing T cells, 5 x 10 6 to 1 x 10 8 total CAR-expressing T cells, 1 x 10 7 to 2.5 x 10 8 total CAR-expressing T cells, 5 x 107 to 1 x 108 total CAR-expressing T cells, each inclusive.
  • the dose of genetically engineered cells contains at least or at least about 1 x 10 5 CAR-expressing cells, at least or at least about 2.5 x 10 5 CAR-expressing cells, at least or at least about 5 x 10 5 CAR-expressing cells, at least or at least about 1 x 10 6 CAR-expressing cells, at least or at least about 2.5 x 10 6 CAR-expressing cells, at least or at least about 5 x 10 6 CAR-expressing cells, at least or at least about 1 x 10 7 CAR-expressing cells, at least or at least about 2.5 x 10 CAR-expressing cells, at least or at least about 5 x 10 CAR- o
  • kits for dosing a subject including administering to a subject having a disease or condition, a sub-optimal dose of genetically engineered cells including T cells engineered with a chimeric antigen receptor (CAR), wherein the dose contains a number of the genetically engineered cells that is insufficient to achieve peak CAR+ cells in the blood within a determined therapeutic range in the subject, or in a majority of subjects so treated by the method or in greater than 75%, 80%, 85%, 90%, 95% of the subjects so treated by the method; and subsequent to administering the genetically engineered cells, administering an agent to enhance CAR+ cell expansion or proliferation in the subject to achieve peak CAR+ T cells in the blood within the therapeutic range, wherein the therapeutic range is: (i) based upon the range of peak CD3+ CAR+ T cells, or a CD8+CAR+ T cell subset thereof, in the blood among one or more subjects previously treated with the genetically engineered cells that is associated with an estimated probability of response of greater than or
  • CAR chimeric antigen
  • administration of the genetically engineered cells that is between or between about 10 cells per microliter and 500 cells per microliter; or (iii) peak CD8+CAR+ T cells in the blood, following administration of the genetically engineered cells, that is between or between about 2 cells per microliter and 200 cells per microliter.
  • the method after administering the dose of genetically engineered cells, includes monitoring the CAR+ T cells in the blood of the subject. In some of any such embodiments, following administration of the agent, the method achieves an increased frequency of peak CAR+ cells in the blood within a determined therapeutic range in the subject, compared to a method involving administration of the same dose of genetically engineered cells but without the agent; or peak CAR+ cells in the blood within a determined therapeutic range in the subject, or in a majority of subjects so treated by the method or in greater than 75%, 80%, 85%, 90%, 95% of the subjects so treated by the method.
  • the dose of genetically engineered cells is less than or less than about 1 x 10 7 CAR-expressing cells, less than or less than about 5 x 10 6 CAR- expressing cells, less than or less than about 2.5 x 10 6 CAR-expressing cells, less than or less than about 1 x 10 6 CAR-expressing cells, less than or less than about 5 x 10 5 CAR-expressing cells, less than or less than about 2.5 x 10 5 CAR-expressing cells, less than or less than about 1 x 10 5 CAR-expressing cells.
  • the agent is capable of increasing expansion of the CAR+ T cells, optionally CAR-specific expansion.
  • the agent is an anti idiotype antibody or antigen-binding fragment thereof specific to the CAR, an immune checkpoint inhibitor, a modulator of a metabolic pathway, an adenosine receptor antagonist, a kinase inhibitor, an anti-TGFp antibody or an anti-TGFpR antibody or a cytokine.
  • the method achieves an increase in the percentage of subjects achieving a durable response, optionally a complete response (CR) or objective response (OR) or a partial response (PR), optionally that is durable for at or greater than 3 months or at or greater than 6 months, compared to a method that does not contain administering the agent.
  • a durable response optionally a complete response (CR) or objective response (OR) or a partial response (PR), optionally that is durable for at or greater than 3 months or at or greater than 6 months, compared to a method that does not contain administering the agent.
  • the increase is greater than or greater than about 1.2-fold, 1.5-fold, 2-fold, 3-fold, 4-fold, 5-fold, lO-fold or more.
  • At least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40% or at least 50% of subjects treated according to the method achieve a complete response (CR) that is durable for at or greater than 3 months or at or greater than 6 months; and/or at least 25%, at least 30%, at least 40%, at least 50%, at least 60% or at least 70% of the subjects treated according to the method achieve objective response (OR) that is durable for at or greater than 3 months or at or greater than 6 months.
  • CR complete response
  • OR objective response
  • greater than or greater than about 50%, greater than or greater than about 60%, greater than or greater than about 70%, or greater than or greater than about 80% of the subjects treated according to the method do not exhibit a grade 3 or greater cytokine release syndrome (CRS) and/or do not exhibit a grade 2 or greater or grade 3 or greater neurotoxicity; or greater than or greater than about 40%, greater than or greater than about 50% or greater than or greater than about 55% of the subjects treated according to the method do not exhibit any neurotoxicity or CRS.
  • CRS cytokine release syndrome
  • peak CAR+ T cells is determined as the number of CAR+ T cells per microliter in the blood of the subject.
  • the therapeutic range is the range in which the estimated probability of toxicity is less than 20%, less than 15%, less than 10% or less than 5% and the estimated probability of achieving a response is greater than 65%, 70%, 75%, 80%, 85%, 90%, 95% or more.
  • the probability of toxicity is based on a toxicity selected from any neurotoxicity or cytokine release syndrome (CRS); severe toxicity or grade 3 or higher toxicity; severe CRS or a grade 3 or higher CRS; or severe neurotoxicity, grade 2 or higher neurotoxicity or grade 3 or higher neurotoxicity.
  • the probability of a toxicity is based on the probability of a severe toxicity or a grade 3 or higher toxicity. In some cases, the severe toxicity is grade 3-5 neurotoxicity.
  • the probability of response is based on a response that is a complete response (CR), an objective response (OR) or a partial response (PR), optionally wherein the response is durable, optionally durable for at or at least 3 months or at or at least 6 months.
  • the response is a marrow response as determined based on assessment of the presence of a malignant immunoglobulin heavy chain locus (IGH) ad/or an index clone in the bone marrow of the subject. In some cases, the malignant IGH and/or index clone is assessed by flow cytometry or IgH sequencing.
  • IGH immunoglobulin heavy chain locus
  • a method of assessing likelihood of a durable response including detecting, in a biological sample from a subject, peak levels of one or more inflammatory marker and/or peak levels of genetically engineered cells including T cells expressing a chimeric antigen receptor (CAR), wherein the subject has been previously administered a dose of the genetically engineered cells for treating a disease or condition; and comparing, individually, the peak levels to a threshold value, thereby determining a likelihood that a subject will achieve a durable response to the administration of the genetically engineered cells.
  • CAR chimeric antigen receptor
  • the subject is likely to achieve a durable response if the peak levels of the one or more inflammatory marker is below a threshold value and the subject is not likely to achieve a durable response if the peak levels of the one or more inflammatory marker is above a threshold value; or the subject is likely to achieve a durable response if the peak level of the genetically engineered cells is within a therapeutic range between a lower threshold value and an upper threshold value and the subject is not likely to achieve a durable response if the peak level of the genetically engineered cells is below the lower threshold value or is above the upper threshold value.
  • the subject is determined not likely to achieve a durable response, further including selecting a subject for treatment with a therapeutic agent or with an alternative therapeutic treatment other than the genetically engineered cells. In some aspects, if the subject is determined as not likely to achieve a durable response, further including administering a therapeutic agent or an alternative therapeutic treatment other than the genetically engineered cells.
  • a method of treatment including selecting a subject having received administration of genetically engineered cells including T cells expressing a chimeric antigen receptor (CAR) in which peak levels of one or more inflammatory markers in a sample from the subject is above a threshold value; and/or peak level of T cells including a chimeric antigen receptor (CAR) in a sample from the subject is below a lower threshold value or is above an upper threshold value; and administering to the subject a therapeutic agent or alternative therapeutic treatment other than the genetically engineered cells.
  • CAR chimeric antigen receptor
  • the response is a complete response (CR), objective response (OR) or partial response (PR).
  • the response is durable for at or greater than 3 months, 4 months, 5 months, or 6 months.
  • the peak levels are assessed and/or the sample is obtained from the subject at a time that is at least 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 15 days, 16 days, 17 days, 18 days, 19 days, 20 days or 21 days after initiation of administration of the genetically engineered cells. In some of any such embodiments, the peak levels are assessed and/or the sample is obtained from the subject at a time that is between or between about 11 to 22 days, 12 to 18 days or 14 to 16 days, each inclusive, after initiation of administration of the genetically engineered cells.
  • the peak level is a peak level of one or more inflammatory marker and the inflammatory marker is selected from C reactive protein (CRP), IL-2, IL-6, IL-10, IL-15, TNF-alpha, MIP-lalpha, MIP-lbeta, MCP-l, CXCL10 or CCL13.
  • CRP C reactive protein
  • IL-2 IL-2
  • IL-6 IL-6
  • IL-10 IL-15
  • TNF-alpha MIP-lalpha
  • MIP-lbeta MCP-l
  • CXCL10 or CCL13 C reactive protein
  • the peak level of one or more inflammatory marker is assessed and the threshold value is within 25%, within 20%, within 15%, within 10% or within 5% and/or is within a standard deviation of the median or mean of the peak level of the inflammatory marker as determined among a group of control subjects having received administration of the genetically engineered cells, wherein each of the subjects of the group did not achieve a durable response, optionally a CR and/or PR, optionally at or greater than 3 months or 6 months following administration of the genetically engineered cells.
  • the control subjects exhibited stable disease (SD) or progressive disease (PD) following administration of the genetically engineered cells, optionally at or greater than 3 months or 6 months following administration of the genetically engineered cells.
  • the peak level is a peak level of CAR+ T cells, or a CD8+ T cell subset thereof.
  • the lower threshold value and upper threshold value is the lower and upper end, respectively, of a therapeutic range of peak CD3+ CAR+ T cells, or a CD8+CAR+ T cell subset thereof, in the blood among one or more subjects previously treated with the genetically engineered cells that is associated with an estimated probability of response of greater than or greater than about 65%, 70%, 75%, 80%, 85%, 90% and an estimated probability of a toxicity of less than or about 30%, 25%, 20%, 15%, 10%, 5%.
  • the therapeutic range is the range in which the estimated probability of toxicity is less than 20%, less than 15%, less than 10% or less than 5% and the estimated probability of achieving a response is greater than 65%, 70%, 75%, 80%,
  • the probability of toxicity is based on a toxicity selected from any neurotoxicity or cytokine release syndrome (CRS); severe toxicity or grade 3 or higher toxicity; severe CRS or a grade 3 or higher CRS; or severe neurotoxicity, grade 2 or higher neurotoxicity or grade 3 or higher neurotoxicity.
  • the probability of response is based on a response that is a complete response (CR), an objective response (OR) or a partial response (PR), optionally wherein the response is durable, optionally durable for at or at least 3 months or at or at least 6 months.
  • peak CAR+ T cells is determined as the number of CAR+ T cells per microliter in the blood of the subject.
  • the upper threshold value is between or between about 300 cells per microliter and 1000 cells per microliter or 400 cells per microliter and 600 cells per microliter, or is about 300 cells per microliter, 400 cells per microliter, 500 cells per microliter, 600 cells per microliter, 700 cells per microliter, 800 cells per microliter, 900 cells per microliter or 1000 cells per microliter; or the lower threshold value is less than or less than about 10 cells per microliter, 9 cells per microliter, 8 cells per microliter, 7 cells per microliter, 6 cells per microliter, 5 cells per microliter, 4 cells per microliter, 3 cells per microliter, 2 cells per microliter or 1 cell per microliter.
  • the sample is a blood sample or plasma sample.
  • the method is carried out ex vivo.
  • the peak level of genetically engineered cells is above the upper threshold value and the therapeutic agent is an agent that is capable of decreasing CAR+ T cell expansion or proliferation.
  • the peak level of CAR+ T cells is below a lower threshold value and the therapeutic agent is an agent that is capable of decreasing CAR+ T cell expansion or proliferation.
  • the agent is a steroid.
  • the steroid is a corticosteroid.
  • the steroid is dexamethasone or methylprednisolone.
  • the steroid is administered in an amount that is between or between about 1.0 mg and about 40 mg, between or between about 1.0 mg and about 20 mg, between or between about 2.0 mg and about 20 mg, between or between about 5.0 mg and about 25.0 mg, between or between about 10 mg and about 20 mg dexamethasone or equivalent thereof, each inclusive.
  • the steroid is administered in multiple doses over a period of at or more than 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 days or more or within a range defined by any of the foregoing. In some of any such embodiments, the steroid is administered once per day, twice per day, or three times or more per day.
  • the steroid is administered in an amount that is between or between about 1.0 mg and about 80 mg, between or between about 1.0 mg and about 60 mg, between or between about 1.0 mg and about 40 mg, between or between about 1.0 mg and about 20 mg, between or between about 1.0 mg and about 10 mg, between or between about 2.0 mg and about 80 mg, between or between about 2.0 mg and about 60 mg, between or between about 2.0 mg and about 40 mg, between or between about 2.0 mg and about 20 mg, between or between about 2.0 mg and about 10 mg, between or between about 5.0 mg and about 80 mg, between or between about 5.0 mg and about 60 mg, between or between about 5.0 mg and about 40 mg, between or between about 5.0 mg and about 20 mg, between or between about 5.0 mg and about 10 mg, between or between about 10 mg and about 80 mg, between or between about 10 mg and about 60 mg, between or between about 10 mg and about 40 mg, between or between about 10 mg and about 60 mg, between or between about 10 mg and about 40 mg, between or between about 10 mg and about 60 mg, between or
  • the peak level of CAR+ T cells is above the upper threshold value and the therapeutic agent is an agent that is capable of increasing expansion of the CAR+ T cells, optionally CAR-specific expansion.
  • the agent is an anti-idiotype antibody or antigen binding fragment thereof specific to the CAR, an immune checkpoint inhibitor, a modulator of a metabolic pathway, an adenosine receptor antagonist, a kinase inhibitor, an anti-TGFp antibody or an anti-TGFpR antibody or a cytokine.
  • the disease or condition is a cancer.
  • the cancer is a B cell malignancy.
  • the cancer is selected from the group consisting of sarcomas, carcinomas, lymphomas, non-Hodgkin lymphomas (NHLs), diffuse large B cell lymphoma (DLBCL), leukemia, CLL, ALL, AML and myeloma.
  • the cancer is a pancreatic cancer, bladder cancer, colorectal cancer, breast cancer, prostate cancer, renal cancer, hepatocellular cancer, lung cancer, ovarian cancer, cervical cancer, pancreatic cancer, rectal cancer, thyroid cancer, uterine cancer, gastric cancer, esophageal cancer, head and neck cancer, melanoma, neuroendocrine cancers, CNS cancers, brain tumors, bone cancer, or soft tissue sarcoma.
  • the subject is a human.
  • the antigen is selected from among anb6 integrin (avb6 integrin), B cell maturation antigen (BCMA), B7-H3, B7-H6, carbonic anhydrase 9 (CA9, also known as CAIX or G250), a cancer-testis antigen, cancer/testis antigen 1B (CTAG, also known as NY-ESO-l and LAGE-2), carcinoembryonic antigen (CEA), a cyclin, cyclin A2, C-C Motif Chemokine Ligand 1 (CCL-l), CD19, CD20, CD22, CD23, CD24, CD30, CD33, CD38, CD44, CD44v6, CD44v7/8, CD123, CD138, CD171, epidermal growth factor protein (EGFR), type III epidermal growth factor receptor mutation (EGFR vIII), epithelial glycoprotein 2 (EPG- 2), epithelial glycoprotein 40 (EPG-40), ephr
  • the CAR specifically binds to an antigen associated with a disease or condition and/or expressed in cells associated with the disease or condition.
  • the antigen is selected from among 5T4, 8H9, avb6 integrin, B7- H6, B cell maturation antigen (BCMA), CA9, a cancer-testes antigen, carbonic anhydrase 9 (CAIX), CCL-l, CD19, CD20, CD22, CEA, hepatitis B surface antigen, CD23, CD24, CD30, CD33, CD38, CD44, CD44v6, CD44v7/8, CD123, CD138, CD171, carcinoembryonic antigen (CEA), CE7, a cyclin, cyclin A2, c-Met, dual antigen, EGFR, epithelial glycoprotein 2 (EPG-2), epithelial glycoprotein 40 (EPG-40), EPHa2, ephrinB2, erb-B
  • the chimeric antigen receptor contains an extracellular antigen-recognition domain that specifically binds to the antigen and an extracellular antigen-recognition domain that specifically binds to the antigen and an extracellular antigen-recognition domain that specifically binds to the antigen and an extracellular antigen-recognition domain that specifically binds to the antigen and an extracellular antigen-recognition domain that specifically binds to the antigen and an extracellular antigen-recognition domain that specifically binds to the antigen and an extracellular antigen-recognition domain that specifically binds to the antigen and an extracellular antigen-recognition domain that specifically binds to the antigen and an extracellular antigen-recognition domain that specifically binds to the antigen and an extracellular antigen-recognition domain that specifically binds to the antigen and an extracellular antigen-recognition domain that specifically binds to the antigen and an extracellular antigen-recognition domain that specifically bind
  • intracellular signaling domain containing an ITAM contains an intracellular domain of a CD3-zeta ⁇ 3z) chain.
  • the chimeric antigen receptor (CAR) further contains a costimulatory signaling region.
  • the costimulatory signaling region contains a signaling domain of CD28 or 4-1BB. In some of any such embodiments, the costimulatory domain is a domain of 4- 1BB.
  • the cells are T cells. In some cases, the T cells are CD4+ or CD8+. In some examples, the T cells are primary T cells obtained from a subject. In some of any such embodiments, the cells of the genetically engineered cells are autologous to the subject. In some of any such embodiments, the cells are allogeneic to the subject.
  • CAR chimeric antigen receptor
  • the instructions specify that if the genetically engineered cells are not within the therapeutic range, administering an agent to the subject capable of modulating, optionally increasing or decreasing, CAR+ T cell expansion or proliferation, in the subject.
  • the kit further contains the agent.
  • the instructions specify that if the peak number of CAR+ T cells in the blood of the subject is less than the lowest number of peak CAR+ T cells in the therapeutic range, an agent is administered to the subject that is capable of increasing CAR+ T cell expansion or proliferation. In some of any such embodiments, the agent is capable of CAR-specific expansion.
  • the agent is an anti-idiotype antibody or antigen binding fragment thereof specific to the CAR, an immune checkpoint inhibitor, a modulator of a metabolic pathway, an adenosine receptor antagonist, a kinase inhibitor, an anti-TGFp antibody or an anti-TGFpR antibody or a cytokine.
  • an agent is administered to the subject that is capable of decreasing CAR+ T cell expansion or proliferation.
  • the volumetric measure is a sum of the products of diameters (SPD), longest tumor diameters (LD), sum of longest tumor diameters (SLD), tumor volume, necrosis volume, necrosis-tumor ratio (NTR), peritumoral edema (PTE), and edema-tumor ratio (ETR).
  • SPD the products of diameters
  • LD longest tumor diameters
  • SLD sum of longest tumor diameters
  • NTR necrosis volume
  • NTR necrosis-tumor ratio
  • PTE peritumoral edema
  • EMR edema-tumor ratio
  • the volumetric measure is a sum of the products of diameter (SPD).
  • the inflammatory marker is C-reactive protein (CRP), erythrocyte sedimentation rate (ESR), albumin, ferritin, b2 microglobulin (b2-M), lactate dehydrogenase (LDH), a cytokine or a chemokine.
  • CRP C-reactive protein
  • ESR erythrocyte sedimentation rate
  • b2-M b2 microglobulin
  • LDH lactate dehydrogenase
  • cytokine a cytokine or a chemokine.
  • the inflammatory marker is LDH.
  • the agent is a steroid.
  • the steroid is a corticosteroid.
  • the steroid is dexamethasone or methylprednisolone.
  • the steroid is formulated for administration in an amount that is between or between about 1.0 mg and about 40 mg, between or between about 1.0 mg and about 20 mg, between or between about 2.0 mg and about 20 mg, between or between about 5.0 mg and about 25.0 mg, between or between about 10 mg and about 20 mg dexamethasone or equivalent thereof, each inclusive.
  • the CAR specifically binds to an antigen associated with a disease or condition and/or expressed in cells associated with the disease or condition.
  • the genetically engineered cells include T cells, optionally CD4+ or CD8+ T cells.
  • kits are also provided.
  • a treatment regimen for treating the toxicity involving administering, to a subject exhibiting a sign or symptom of a toxicity, a treatment regimen for treating the toxicity, said subject having been administered a dose of genetically engineered cells containing T cells expressing a recombinant receptor, wherein the treatment regimen is selected from: (a) if, within 72, 96 or 120 hours after receiving administration of the dose of genetically engineered cells, the subject exhibits a fever and/or one or more first physical signs or symptoms associated with a toxicity, optionally cytokine release syndrome (CRS), and/or one or more physical signs or symptoms associated with grade 1 CRS, administering (i) an agent capable of binding an interleukin-6 receptor (IL-6R), said agent administered no more than once every 24 hours, and (ii) one or more doses of a steroid, said steroid administered about every 12 to 24 hours; (b) if the subject exhibits one or more physical signs or symptoms associated with grade 2 CRS
  • Also provided in some aspects are methods of ameliorating a toxicity, involving administering, to a subject exhibiting a sign or symptom of a toxicity, a treatment regimen for treating the toxicity, said subject having been administered a dose of genetically engineered cells comprising T cells expressing a recombinant receptor, wherein the treatment regimen comprises: (a) if, within 72, 96 or 120 hours after receiving administration of the dose of genetically engineered cells, the subject exhibits a fever and/or one or more first physical signs or symptoms associated with a toxicity, optionally cytokine release syndrome (CRS), and/or one or more physical signs or symptoms associated with grade 1 CRS, administering (i) an agent capable of binding an interleukin-6 receptor (IL-6R) , said agent administered no more than once every 24 hours, and (ii) one or more doses of a steroid, said steroid administered about every 12 to 24 hours; (b) if the subject exhibits one or more physical signs or symptoms associated with grade 2 CRS
  • a treatment regimen for treating the toxicity involving administering, to a subject exhibiting a sign or symptom of a toxicity, a treatment regimen for treating the toxicity, said subject having been administered a dose of genetically engineered cells containing T cells expressing a recombinant receptor, wherein the treatment regimen is, if, within 72, 96 or 120 hours of administration of the dose of genetically engineered, the subject exhibits a fever and/or one or more first physical signs or symptoms associated with a toxicity, optionally cytokine release syndrome (CRS), and/or one or more physical signs or symptoms associated with grade 1 CRS, administering (i) an agent capable of binding an interleukin-6 receptor (IL-6R) and (ii) one or more doses of a steroid.
  • the agent capable of binding IL-6R is administered in one or more doses.
  • administering to a subject exhibiting one or more physical signs or symptom of a toxicity, one or more agent capable of reducing and/or ameliorating the one or more physical signs or symptoms associated with the toxicity, said subject having been administered a dose of genetically engineered cells comprising T cells expressing a recombinant receptor, wherein the one or more agent is administered in a treatment regimen comprising: (a) administering one or more agent if : (i) at or greater than 72 hours after receiving administration of the dose of genetically engineered cells, the subject exhibits a fever, and exhibits one or more physical signs or symptoms associated with the toxicity, optionally cytokine release syndrome (CRS), and/or exhibits a rapid progression of the physical signs or symptoms associated with the toxicity ; or (ii) within 48 or 72 hours after receiving administration of the dose of genetically engineered cells, the subject exhibits a fever and/or one or more physical signs or symptoms associated with grade 2 or higher CRS; (b) administering one or more agent if, within 24, 48 or 72
  • the one or more agent is selected from an agent capable of binding an interleukin- 6 receptor (IL-6R) or one or more steroid, optionally one or more doses of the one or more steroid.
  • IL-6R interleukin- 6 receptor
  • administering to a subject exhibiting one or more physical signs or symptom of a toxicity, one or more agent capable of reducing and/or ameliorating the one or more physical signs or symptoms associated with the toxicity, said subject having been administered a dose of genetically engineered cells comprising T cells expressing a recombinant receptor, wherein the one or more agent is administered in a treatment regimen comprising: (a) administering one or more agent if: (i) at or greater than 72 hours after receiving administration of the dose of genetically engineered cells, the subject exhibits one or more physical signs or symptoms associated with the toxicity, optionally neurotoxicity (NT); or (ii) within 48 or 72 hours after receiving administration of the dose of genetically engineered cells, the subject exhibits one or more physical signs or symptoms associated with the toxicity; (b) administering one or more agent if, within 24, 48 or 72 hours after administration of the one or more agent in (a), the subject does not exhibit an improvement of the one or more physical signs or symptoms associated with the toxicity and/or exhibits a progression of the
  • the agent capable of binding IL-6R and a dose of steroid is administered simultaneously, or a dose of the steroid is administered within about 1, 2, 3 or 4 hours of the dose of the agent capable of binding IL-6R. In some of any such embodiments, the dose of the agent capable of binding IL-6R and a dose of steroid is administered simultaneously, or a dose of the steroid is administered within about 1, 2, 3 or 4 hours of the dose of the agent capable of binding IL-6R. In some of any such embodiments, up to two doses of the agent is administered. In some of any such embodiments, the dose of the agent capable of binding IL-6R and a dose of steroid is administered simultaneously, or a dose of the steroid is administered within about 1, 2, 3 or 4 hours of the dose of the agent capable of binding IL-6R. In some of any such embodiments, the dose of the agent capable of binding IL-6R and a dose of steroid is administered simultaneously, or a dose of the steroid is administered within about 1, 2, 3 or 4 hours
  • the agent capable of binding IL-6R is administered no more than once every 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or more hours. In some of any such embodiments, up to two doses of the agent is administered.
  • the steroid is administered every 6, 9, 12, 15, 18, 21, 24, 36 or 48 hours, or a range defined by any two of the foregoing values.
  • the steroid is or contains a corticosteroid, which optionally is a
  • the steroid is selected from among cortisones, dexamethasones, hydrocortisones, methylprednisolones, prednisolones and prednisones. In some of any such embodiments, the steroid is or contains dexamethasone, prednisone or methylprednisolone. In certain embodiments, the steroid is dexamethasone or
  • the steroid is for administration at an equivalent dosage amount of from or from about 1.0 mg to at or about 40 mg, from or from about 1.0 mg to at or about 20 mg, from or from about 2.0 mg to at or about 20 mg, from or from about 5.0 mg to at or about 25.0 mg, or from or from about 10 mg to at or about 20 mg dexamethasone or equivalent thereof, each inclusive.
  • the steroid is administered at an equivalent dosage amount of between or between about 0.5 mg/kg and about 5 mg/kg, or about 1 mg/kg, 2 mg/kg, 3 mg/kg, 4 mg/kg or 5 mg/kg methylprednisolone or equivalent thereof, each inclusive.
  • multiple doses of the steroid is administered.
  • the steroid is administered for 2, 3, 4, 5 or more days.
  • the steroid is administered at an equivalent dosage amount of from or from about 10 mg to about 80 mg dexamethasone or equivalent thereof, per day or per 24 hours, or about 10 mg, 20 mg, 40 mg or 80 mg dexamethasone or equivalent thereof, per day or per 24 hours.
  • the steroid is administered in multiple doses over a period of at or more than 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 days or within a range defined by any of the foregoing. In some of any such embodiments, the steroid is administered for 2, 3,
  • the steroid is administered once per day, twice per day, or three times or more per day.
  • the steroid is administered at an equivalent dosage amount of between or between about 1.0 mg and about 80 mg, between or between about 1.0 mg and about 60 mg, between or between about 1.0 mg and about 40 mg, between or between about 1.0 mg and about 20 mg, between or between about 1.0 mg and about 10 mg, between or between about 2.0 mg and about 80 mg, between or between about 2.0 mg and about 60 mg, between or between about 2.0 mg and about 40 mg, between or between about 2.0 mg and about 20 mg, between or between about 2.0 mg and about 10 mg, between or between about 5.0 mg and about 80 mg, between or between about 5.0 mg and about 60 mg, between or between about 5.0 mg and about 40 mg, between or between about 5.0 mg and about 20 mg, between or between about 5.0 mg and about 10 mg, between or between about 10 mg and about 80 mg, between or between about 10 mg and about 60 mg, between or between about 10 mg and about 40 mg, between or between about 10 mg and about 60 mg, between or between about 10 mg and about 40 mg, between or between about 10 mg and about 60 mg, between
  • the multiple doses contain an initial dose of steroids of between about 1 and about 3 mg/kg, such as 2 mg/kg methylprednisolone or equivalent thereof, followed by subsequent doses of between about 1 and about 5 mg/kg, or about 1 mg/kg, 2 mg/kg, 3 mg/kg, 4 mg/kg or 5 mg/kg methylprednisolone or equivalent thereof, divided between 1, 2, 3, 4 or 5 times over a day or over 24 hours.
  • the high dose of steroid is dexamethasone at dosage amount of at or about 10 mg, 20 mg, 25 mg, 30 mg, 35 mg, 40 mg, 45 mg, 50 mg, 55 mg, 60 mg, 65 mg, 70 mg, 75 mg or 80 mg dexamethasone or equivalent thereof, or a range defined by any of the foregoing, each inclusive.
  • the steroid is formulated for intravenous or oral administration.
  • the agent capable of binding IL-6R is a recombinant anti-IL-6 receptor antibody or an antigen-binding fragment thereof is or contains an agent selected from among tocilizumab or sarilumab or an antigen-binding fragment thereof.
  • the recombinant anti-IL-6R antibody is or contains tocilizumab or an antigen-binding fragment thereof.
  • the anti-IL-6R antibody is for administration in a dosage amount of from or from about 1 mg/kg to 20 mg/kg, 2 mg/kg to 19 mg/kg, 4 mg/kg to 16 mg/kg, 6 mg/kg to 14 mg/kg or 8 mg/kg to 12 mg/kg, each inclusive, or the anti-IL-6R antibody is administered in a dosage amount of at least or at least about or about 1 mg/kg, 2 mg/kg, 4 mg/kg, 6 mg/kg, 8 mg/kg, 10 mg/kg, 12 mg/kg, 14 mg/kg,
  • the anti-IL-6R antibody is formulated for single dosage administration of an amount from or from about 30 mg to about 5000 mg, from about 50 mg to about 1000 mg, from about 50 mg to about 500 mg, from about 50 mg to about 200 mg, from about 50 mg to about 100 mg, from about 100 mg to about 1000 mg, from about 100 mg to about 500 mg, from about 100 mg to about 200 mg, from about 200 mg to about 1000 mg, from about 200 mg to about 500 mg, or from about 500 mg to about 1000 mg.
  • the anti-IL-6R antibody is formulated for intravenous administration.
  • the method further involves, if the subject exhibits one or more first physical signs or symptoms associated with the toxicity, optionally CRS, within 72 hours of administration of the dose of genetically engineered cells, if the physical signs or symptoms associated with the toxicity, optionally CRS, does not improve, if the physical signs or symptoms associated with the toxicity is severe or aggressive and/or if the grade of toxicity, optionally CRS, becomes more severe, administering an additional dose of steroids, optionally at a high dose.
  • the high dose of steroid is methylprednisolone at about 1 to about 4 mg/kg initial dose followed by about 1 to about 4 mg mg/kg/day divided 2, 3, 4, 5 or 6 times per day, or equivalents thereof.
  • the method further involves administering to the subject a dose of genetically engineered cells containing T cells expressing a recombinant receptor for treating a disease or condition prior to administering the treatment regimen.
  • the recombinant receptor is or contains a chimeric receptor and/or a recombinant antigen receptor.
  • the recombinant receptor is capable of binding to a target antigen that is associated with, specific to, and/or expressed on a cell or tissue of a disease, disorder or condition.
  • the disease, disorder or condition is an infectious disease or disorder, an autoimmune disease
  • the target antigen is a tumor antigen.
  • the target antigen is selected from among anb ⁇ integrin (avb6 integrin), B cell maturation antigen (BCMA), B7-H3, B7-H6, carbonic anhydrase 9 (CA9, also known as CAIX or G250), a cancer-testis antigen, cancer/testis antigen 1B (CTAG, also known as NY-ESO-l and LAGE-2), carcinoembryonic antigen (CEA), a cyclin, cyclin A2, C-C Motif Chemokine Ligand 1 (CCL-l), CD19, CD20, CD22, CD23, CD24, CD30, CD33, CD38, CD44, CD44v6, CD44v7/8, CD123, CD138, CD171, epidermal growth factor protein (EGFR), type III epidermal growth factor receptor mutation (EGFR vIII), epithelial
  • MART-l neural cell adhesion molecule
  • NCAM neural cell adhesion molecule
  • PRAME Preferentially expressed antigen of melanoma
  • PRAME progesterone receptor
  • PSCA prostate stem cell antigen
  • PSMA prostate specific membrane antigen
  • ROR1 Receptor Tyrosine Kinase Like Orphan Receptor 1
  • survivin Trophoblast glycoprotein (TPBG also known as 5T4)
  • TAG72 tumor-associated glycoprotein 72
  • VEGFR vascular endothelial growth factor receptor
  • VEGFR2 vascular endothelial growth factor receptor 2
  • WT-l Wilms Tumor 1
  • WT-l Wilms Tumor 1
  • the recombinant receptor is or contains a functional non-TCR antigen receptor or a TCR or antigen-binding fragment thereof.
  • the recombinant receptor is a chimeric antigen receptor (CAR).
  • the recombinant receptor contains an extracellular domain containing an antigen-binding domain.
  • the antigen-binding domain is or contains an antibody or an antibody fragment thereof, which optionally is a single chain fragment.
  • the fragment contains antibody variable regions joined by a flexible linker.
  • the fragment contains an scFv.
  • the recombinant receptor contains an intracellular signaling region.
  • the intracellular signaling region contains an intracellular signaling domain.
  • the intracellular signaling domain is or contains a primary signaling domain, a signaling domain that is capable of inducing a primary activation signal in a T cell, a signaling domain of a T cell receptor (TCR) component, and/or a signaling domain containing an immunoreceptor tyrosine-based activation motif (IT AM).
  • the intracellular signaling domain is or contains an intracellular signaling domain of a CD3 chain, optionally a CD3-zeta ⁇ 3z) chain, or a signaling portion thereof.
  • the recombinant receptor further contains a transmembrane domain disposed between the extracellular domain and the intracellular signaling region.
  • the intracellular signaling region further contains a costimulatory signaling domain.
  • the costimulatory signaling domain contains an intracellular signaling domain of a T cell costimulatory molecule or a signaling portion thereof.
  • the costimulatory signaling domain contains an intracellular signaling domain of a CD28, a 4-1BB or an ICOS or a signaling portion thereof.
  • the costimulatory signaling domain is between the transmembrane domain and the intracellular signaling domain.
  • the cells are T cells.
  • the T cells are CD4+ or CD8+.
  • the T cells are primary T cells obtained from a subject.
  • the cells of the genetically engineered cells are autologous to the subject.
  • the cells are allogeneic to the subject.
  • Also provided are methods of treatment comprising: (a) administering, to a subject having a disease or condition, a dose of genetically engineered cells comprising T cells expressing a chimeric antigen receptor (CAR) for treating the disease or condition; (b) after administering the dose of genetically engineered cells, monitoring CAR+ T cells in the blood of the subject to assess if the cells are within a therapeutic range, and (c) if the genetically engineered cells are not within the therapeutic range, administering to the subject an agent capable of modulating, optionally increasing or decreasing, CAR+ T cell expansion or proliferation, in the subject, wherein the therapeutic range is: (i) peak CD3+CAR+ T cells in the blood, following administration of the genetically engineered cells, that is between or between about 10 cells per microliter and 500 cells per microliter; or (ii) peak CD8+CAR+ T cells in the blood, following administration of the genetically engineered cells, that is between or between about 2 cells per microliter and 200 cells per microliter.
  • CAR chimeric
  • Also provided are method of treatment comprising: (a) monitoring, in the blood of a subject, the presence of genetically engineered cells comprising T cells expressing a chimeric antigen receptor (CAR) to assess if the cells are within a therapeutic range, wherein the subject has been previously administered a dose of the genetically engineered cells for treating a disease or condition; and (b) if the genetically engineered cells are not within the therapeutic range, administering to the subject an agent capable of modulating, optionally increasing or decreasing, CAR+ T cell expansion or proliferation, in the subject, wherein the therapeutic range is: (i) peak CD3+CAR+ T cells in the blood, following administration of the genetically engineered cells, that is between or between about 10 cells per microliter and 500 cells per microliter; or (ii) peak CD8+CAR+ T cells in the blood, following administration of the genetically engineered cells, that is between or between about 2 cells per microliter and 200 cells per microliter.
  • CAR chimeric antigen receptor
  • an agent that is capable of increasing CAR+ T cell expansion or proliferation is administered to the subject.
  • the agent is capable of increasing the CAR-specific expansion.
  • the agent is an anti-idiotype antibody or antigen binding fragment thereof specific to the CAR, an immune checkpoint inhibitor, a modulator of a metabolic pathway, an adenosine receptor antagonist, a kinase inhibitor, an anti-TGFp antibody or an anti-TGFpR antibody or a cytokine.
  • kits for treatment comprising: (a) administering, to a subject having a disease or condition, a dose of genetically engineered cells comprising T cells expressing a chimeric antigen receptor (CAR) for treating the disease or condition; (b) after administering the dose of genetically engineered cells, monitoring CAR+ T cells in the blood of the subject, and (c) administering to the subject an agent capable of decreasing, CAR+ T cell expansion or proliferation, in the subject if: (i) the amount of CD3+CAR+ T cells in the blood, following administration of the genetically engineered cells, is greater than at or about 500 cells per microliter; or (ii) the amount of CD8+CAR+ T cells in the blood, following administration of the genetically engineered cells, is greater than at or about 200 cells per microliter.
  • CAR chimeric antigen receptor
  • kits for treatment comprising: (a) monitoring, in the blood of a subject, the presence of genetically engineered cells comprising T cells expressing a chimeric antigen receptor (CAR), wherein the subject has been previously administered a dose of the genetically engineered cells for treating a disease or condition; and (b) administering to the subject an agent capable of decreasing, CAR+ T cell expansion or proliferation, in the subject if: (i) the amount of CD3+CAR+ T cells in the blood, following administration of the genetically engineered cells, is greater than at or about 500 cells per microliter; or (ii)the amount of CD8+CAR+ T cells in the blood, following administration of the genetically engineered cells, is greater than at or about 200 cells per microliter.
  • CAR chimeric antigen receptor
  • the agent is one or more steroid.
  • the steroid is dexamethasone or methylprednisolone.
  • the steroid is administered in an amount that is between or between about 1.0 mg and at or about 40 mg, between or between about 1.0 mg and at or about 20 mg, between or between about 2.0 mg and at or about 20 mg, between or between about 5.0 mg and at or about 25.0 mg, between or between about 10 mg and at or about 20 mg dexamethasone or equivalent thereof, each inclusive.
  • the steroid is administered in multiple doses over a period of at or more than 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 days or more or within a range defined by any of the foregoing.
  • the steroid is administered once per day, twice per day, or three times or more per day.
  • the steroid is administered in an amount that is between or between about 1.0 mg and at or about 80 mg, between or between about 1.0 mg and at or about 60 mg, between or between about 1.0 mg and at or about 40 mg, between or between about 1.0 mg and at or about 20 mg, between or between about 1.0 mg and at or about 10 mg, between or between about 2.0 mg and at or about 80 mg, between or between about 2.0 mg and at or about 60 mg, between or between about 2.0 mg and at or about 40 mg, between or between about 2.0 mg and at or about 20 mg, between or between about 2.0 mg and at or about 10 mg, between or between about 5.0 mg and at or about 80 mg, between or between about 5.0 mg and at or about 60 mg, between or between about 5.0 mg and at or about 40 mg, between or between about 5.0 mg and at or about 20 mg, between or between about 5.0 mg and at or about 10 mg, between or between about 10 mg and at or about 80 mg, between or between about 10 mg and at or about 60 mg, between or between about 5.0 mg and at or about 40
  • the subject is monitored for CAR+ T cells in the blood at a time that is at least 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 15 days, 16 days, 17 days, 18 days, 19 days, 20 days or 21 days after initiation of administration of the genetically engineered cells; or at a time that is between or between about 11 to 22 days, 12 to 18 days or 14 to 16 days, each inclusive, after initiation of administration of the genetically engineered cells.
  • the agent is administered at a time that is greater than or greater than about 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 15 days, 16 days, 17 days, 18 days, 19 days, 20 days or 21 days after initiation of administration of the genetically engineered cells; or at a time that is between or between at or about 11 to at or about 22 days, 12 to 18 days or 14 to 16 days, each inclusive, after initiation of administration of the genetically engineered cells.
  • FIG. 1 shows an estimated probability curve of response and an estimated
  • CD4+/truncated receptor-i- or CD8+/truncated receptor-i- CAR-T cells in the blood are CD4+/truncated receptor-i- or CD8+/truncated receptor-i- CAR-T cells in the blood.
  • FIG. 2A shows the number of CD3 + /CAR + T cells in peripheral blood measured at certain time points post-infusion for subjects grouped by best overall response.
  • FIGS. 2B-2D show CD3 + /CAR + T cell, CD4 + /CAR + T cell, and CD8 + /CAR + T cell levels in peripheral blood measured at certain time points post-infusion for subjects who achieved a response, grouped by continued response at 3 months.
  • FIG. 3 shows the percentage of subjects who experienced laboratory abnormalities and treatment-emergent adverse events (TEAEs) that occurred in >20% of subjects.
  • * One Grade 5 AE of multi-organ failure unrelated to study treatment and due to progression of lymphoma
  • One Grade 5 AE of diffuse alveolar damage, investigator assessed as related to fludarabine, cyclophosphamide, and CAR T cell therapy, occurred on day 23 in a subject who refused mechanical ventilation for progressive respiratory failure while neutropenic on growth factors and broad spectrum antibiotics and antifungals.
  • FIG. 4 is a Kaplan Meier curve depicting observed time to onset of CRS and neurotoxicity.
  • FIG. 5A and FIG. 5B depict the three month overall response rates (M3 ORR) at among subgroups of treated subjects in the full (FIG. 5A) and core (FIG. 5B) cohort of subjects.
  • FIG. 6A and FIG. 6B show the duration of response (CR/PR, CR or PR) and overall survival in the full (FIG. 6A) and core (FIG. 6B) cohort of subjects.
  • FIG. 7A shows the pharmacokinetics of the CAR + T cells in peripheral blood at various time points post-treatment at different dose levels.
  • FIG. 7B shows the pharmacokinetics of the CAR + T cells in peripheral blood at various time points post-treatment between
  • FIG. 7C shows the
  • FIG. 8 shows levels of analytes measured in the serum of subjects prior to
  • FIG. 9 shows a graph plotting progression-free time (months) and indicating best overall response and response durability, and individual clinical outcomes observed over time in individual subjects within a Full cohort and a Core cohort of NHL subjects treated with an anti- CD19 cell therapy containing CAR-T-expressing CD4+ and CD8+ T cells.
  • a Patients achieved BOR at month 1 except where otherwise noted;
  • b Complete resolution of CNS involvement by lymphoma observed in 2 patients;
  • c One patient re-expanded after biopsy upon disease progression.
  • qPCR quantitative polymerase chain reaction
  • FIG. 10B depicts the relative numbers of CD4 + and CD8 + CAR-expressing cells/pL in blood and bone marrow samples from 67 subjects that have been administered anti-CDl9 CAR-expressing cells, on day 11 + 3 days.
  • the line represents the line of unity and is not a regression line.
  • FIGS. 12A and 12B depict the median (iquartiles) area under the curve between days 0 and 28 (AUCo- 28 ; FIG. 12A) and maximum serum concentration (C max ; CAR + cells/pL blood; FIG. 12B) of CD3+, CD4+ and CD8+ CAR+ cells in subjects who have received CAR+ cells at DL1 or DL2.
  • FIGS. 13A-13D depict the median (iquartiles) number of CAR-expressing CD4+ and CD8+ CAR + cells/pL blood over time, in subjects that developed cytokine release syndrome (any CRS) compared to subjects that have not developed CRS (no CRS) (CD4+: FIG. 13A; CD8+: FIG. 13B) or in subjects that developed neurotoxicity (any NT) compared to subjects that have not developed NT (no NT) (CD4+: FIG. 13C; CD8+: FIG. 13D).
  • FIGS. 14A and 14B depict the number of peak CD3 + CAR + cells/pL (CD3+ C max ) in subjects grouped by subjects who had the best overall response (BOR) of CR, PR or PD, or a 3- month (M3) durable response of CR, PR or PD.
  • FIG. 15A depicts pre-lymphodepletion blood analyte levels in serum samples from subjects that exhibited high CAR+ cell expansion (CD3+ C max > 500) and subjects that exhibited low CAR+ cell expansion (CD3+ C max ⁇ 500).
  • FIG. 15B depicts the peak blood analyte levels in serum samples from subjects that exhibited high CAR+ cell expansion (CD3+ C max > 500) and subjects that exhibited low CAR+ cell expansion (CD3+ C max ⁇ 500).
  • FIG. 16 depicts a plot depicting pre-lymphodepletion sum of product dimensions (SPD; cm 2 ) against AUCo- 28 (cells*day/pL) of CD3+ CAR+ cells, for individual subjects administered DL1 or DL2 of CAR+ cells.
  • FIGS. 17A and 17B depict pre-lymphodepletion blood analyte levels in serum samples from subjects that developed cytokine release syndrome (CRS grade 1-4) compared to subjects that have not developed CRS (CRS grade 0) (FIG. 17A) or in subjects that developed neurotoxicity (NT grade 0) compared to subjects that have not developed NT (NT grade 1-4) (FIG. 17B).
  • the units were: Ferritin and D-dimer (pg/L); CRP (mg/L) and cytokines (pg/mL).
  • FIG. 18 depicts the assessment of pre-lymphodepletion patient parameter sum of product dimensions (SPD; cm ), indicative of tumor burden, and lactate dehydrogenase (LDH; U/L) level, in subjects that developed cytokine release syndrome (any CRS) compared to subjects that have not developed CRS (no CRS) or in subjects that developed neurotoxicity (any NT) compared to subjects that have not developed NT (no NT).
  • SPD product dimensions
  • LDH lactate dehydrogenase
  • FIG. 19A is a plot depicting pre-lymphodepletion SPD (cm ) against pre- lymphodepletion LDH (U/L) levels, in individuals that have developed neurotoxicity (Grade 1-4 NT) or subjects that have not developed NT (Grade 0 NT) (left panel), and in individuals that have developed CRS (Grade 1-4 CRS) or subjects that have not developed CRS (Grade 0 CRS) (right panel). Dotted lines represent levels of SPD (50 cm or higher) or LDH (500 U/L or higher) that is associated with higher rates of CRS or NT.
  • FIG. 19A is a plot depicting pre-lymphodepletion SPD (cm ) against pre- lymphodepletion LDH (U/L) levels, in individuals that have developed neurotoxicity (Grade 1-4 NT) or subjects that have not developed NT (Grade 0 NT) (left panel), and in individuals that have developed CRS (Grade 1-4 CRS) or subjects that have not developed CRS (Gra
  • FIG. 19B depicts the odds ratio estimates for developing CRS or NT based on the levels of SPD (50 cm or higher) or LDH (500 U/L or higher), with 95% confidence intervals (Cl).
  • FIG. 19C depicts the odds ratio estimates for developing CRS or NT based on the levels of SPD or LDH, including the odds ratio estimates for values lower than the threshold, with 95% confidence intervals (Cl).
  • FIG. 20 depicts pre-lymphodepletion tumor burden parameter (SPD) and blood analyte levels in for subjects that had a durable response at 3 months versus for subjects that did not have a response at 3 months.
  • the units were: Ferritin and D-dimer (pg/L); CRP and SAA-l (mg/L) and cytokines (pg/mL).
  • FIGS. 21A and 21B depict peak blood analyte levels in serum samples from subjects that developed cytokine release syndrome (any CRS) compared to subjects that have not developed CRS (no CRS) (FIG. 21A) or in subjects that developed neurotoxicity (any NT) compared to subjects that have not developed NT (no NT) (FIG. 21B).
  • the units were: CRP (mg/L), SAA-l (mg/L) and cytokines (pg/mL).
  • the units were: CRP (mg/L), SAA-l (mg/L) and cytokines (pg/mL).
  • FIGS. 23A-23C depict estimated probability curves for response, toxicity and durable response outcomes, based on the maximum serum concentration of CD3+ (FIG. 23A), CD4+ (FIG. 23B) or CD8+ (FIG. 23C) CAR-expressing cells (C max ; cells/pL blood).
  • FIG. 24 depicts month 3 objective response rates (ORR) among subgroups of treated subjects, with the 95% confidence interval.
  • FIGS. 25A and 25B depict the duration of response (DOR) for the full cohort (FIG. 25A) and the core cohort (FIG. 25B), and FIGS. 25C and 25D depict the overall survival for the full cohort (FIG. 25C) and the core cohort (FIG. 25D), , for subjects who achieved CR, PR, all subjects that showed a response, non-responders, and all treated subjects.
  • Median F/U was 6.3 months for duration of response.
  • FIG. 26 shows the percentage of subjects who experienced treatment-emergent adverse events (TEAEs) in the FULL DLBCL cohort occurring in >20% of patients. Data for 5 patients with MCL treated with conforming product at DL1 with at least 28 days of follow-up were not included.
  • b One grade 5 AE of septic shock unrelated to CAR+ T cell administration.
  • c One grade 5 AE of diffuse alveolar damage, investigator assessed as related to fludarabine, cyclophosphamide, and CAR+ T cells, occurred on day 23 in a patient who refused mechanical ventilation for progressive respiratory failure while neutropenic on growth factors and broad- spectrum antibiotics and antifungals.
  • d Laboratory anomalies.
  • FIG. 27 shows the percentage of subjects who developed CRS or neurotoxicity over time, in the full cohort.
  • FIG. 28 shows the percentage of subjects who experienced treatment-emergent adverse events (TEAEs) in the FULL DLBCL cohort occurring in >20% of the subject at a study time point described in Example 6. Data for 6 subjects with MCL treated with conforming product at DL1 with at least 28 days of follow-up were not included.
  • b One grade 5 AE of septic shock unrelated to CAR + T cell administration, occurred in the setting of disease progression.
  • c One grade 5 AE of diffuse alveolar damage, investigator assessed as related to fludarabine, cyclophosphamide, and CAR + T cells, occurred on day 23 in a patient who refused mechanical ventilation for progressive respiratory failure while neutropenic on growth factors and broad-spectrum antibiotics and antifungals.
  • d Laboratory anomalies.
  • FIGS. 30A and 30B depict the duration of response (DOR) for the full cohort (FIG. 30A) and the core cohort (FIG. 30B), and FIGS. 30C and 30D depict the overall survival for the full cohort (FIG. 30C) and the core cohort (FIG. 30D), for subjects who achieved CR, PR, all subjects that showed a response, non-responders, and all treated subjects.
  • NE not estimable.
  • FIG. 31 shows the CAR+ T cell concentration (cells/pL; left axis) and the daily dose of dexamethasone administration (daily IV dose, mg; right axis) in a subject who has been administered two doses of autologous engineered CAR+ T cells, at various time points after the administration of the second dose.
  • cell therapies such as those including engineered cells to subjects having or suspected of having a disease or condition, such as those specifically recognized by the cells of the therapy and/or those expressing antigens that are specifically bound or recognized by the cells.
  • the provided embodiments in some aspects relate to dosing a subject, e.g., administering a particular dose of the cell therapy to the subject, such as administering a dose that is or is suspected of being within a therapeutic dosage range and/or window, which generally is a range and/or window that achieves or is likely to achieve a desired level of the engineered cells in a sample, fluid, tissue, organ or location of the subject.
  • Adoptive cell therapies can be effective in the treatment of cancer and other diseases and disorders.
  • available approaches to adoptive cell therapy may not always be entirely satisfactory.
  • optimal response to therapy can depend on the ability of the administered cells to recognize and bind to a target, e.g., target antigen, to traffic, localize to and successfully enter appropriate sites within the subject, tumors, and environments thereof, to become activated, expand, to exert various effector functions, including cytotoxic killing and secretion of various factors such as cytokines, to persist, including long-term, to differentiate, transition or engage in reprogramming into certain phenotypic states (such as effector, long-lived memory, less-differentiated, and effector states), to provide effective and robust recall responses following clearance and re-exposure to target ligand or antigen, and avoid or reduce exhaustion, anergy, terminal differentiation, and/or differentiation into a suppressive state.
  • a target e.g., target antigen
  • the therapeutic effect of adoptive cell therapy may be limited by the development of toxicity in the subject to whom such cells are administered, which toxicity in some cases can be severe, at certain doses or exposure of administered cells.
  • a higher dose of such cells can increase the therapeutic effect, for example, by increasing exposure to the cells such as by promoting expansion and/or persistence, they may also result in an even greater risk of developing a toxicity or a more severe toxicity.
  • some of the administered cells can contain cells that expand or proliferate rapidly, which also may contribute to a risk of developing a toxicity or a more severe toxicity.
  • subjects with a higher disease burden also may be at a greater risk for developing a toxicity or a more severe toxicity.
  • Certain available methods for dosing subjects cell therapy may not always be entirely satisfactory. Increasing a dose of cells or promoting expansion or proliferation of administered cells in the subject can be related to higher response rates, but also an increase in development of toxicity.
  • the provided methods offer advantages over available approaches in determining the dose of the cell therapy.
  • the provided methods permit administering a dose to a subject that is or is suspected of being within a therapeutic dosage range and/or window, which generally is a range and/or window that achieves or is likely to achieve a desired level of the engineered cells in the subject.
  • the provided methods permit dosing of cells that can achieve or can be associated with associated with a high or specified desired degree of likelihood of a treatment outcome such as a favorable outcome or response and/or a durable response or outcome, and also associated with a relatively low or minimized or desired degree of likelihood of risk of developing a toxic outcome or toxicity following administration to the subject of the cell therapy.
  • the provided methods also offer advantages over available approaches by permitting modulation, modification and/or alteration of the activity, function, proliferation and/or expansion of the cells in the cell therapy if the subject is determined to be not likely to achieve a response and/or a durable response, thereby optimizing the response without substantially increasing the risk of toxicity.
  • pharmacokinetic parameters, patient attributes, tumor burden and/or expression of biomarkers, such as inflammatory markers can be used to determine likelihood of response and/or any need for modulating, modifying or altering the therapy, to achieve greater response or more durable response, without substantially increasing the risk of toxicity.
  • the methods involve administering a treatment regimen to treat and/or ameliorate the toxicity.
  • the provided methods offer an advantage of permitting systematic management of toxicities that may be associated with immunotherapies and/or adoptive cell therapies.
  • the therapeutic dosage range and/or window achieves or is likely to achieve a desired level of the engineered cells, e.g., CAR T cells, that, in some aspects, is a peak level, which generally refers to the maximum number, concentration or percentage of the cells observed or measured in the relevant sample, fluid, tissue, organ or other location following treatment or within a certain period following treatment.
  • the level may be a number, concentration or percentage (such as number of the cells per weight or volume or area or total cell number) or exposure of the subject or tissue or organ or fluid or location to the cells, at a given time or over a period of time.
  • the level is an area under the curve (AUC) with respect to a plot of the number or percentage or other readout of the relevant cells in the tissue or sample or fluid or organ or other location, over a given period of time following treatment or administration of the cells or initiation thereof.
  • AUC area under the curve
  • the level is expressed as CAR+ cell concentration (e.g., CAR+ cells//microliter (pl)) in the blood, AUC of a curve of CAR+ cells/volume (e.g., CAR+ cells/microliter) over a period of time, maximum or peak CAR+ cells/volume (e.g., CAR+ cells/microliter) in the blood following treatment, or CAR+ cells/microliter of blood at day 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or 21, or week 1, 2, 3, 4, 5, 6, 7, 8, 9,
  • the desired level is within, or is a level within, a determined therapeutic range.
  • the level is expressed as copies of the nucleic acid sequence (e.g., transgene sequence) encoding the CAR or a nucleic acid sequence operably connected to the CAR-encoding sequences, per mass of DNA (e.g., copies/pg of DNA); AUC of the curve of copies/pg of DNA over time, maximum or peak copies/pg of DNA following treatment, or copies/pg of DNA at day 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or 21, or week 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 or more post-treatment or initiation thereof.
  • the desired level is within, or is a level within, a determined therapeutic range.
  • the therapeutic range is a therapeutic range and/or window associated with a high or specified desired degree of likelihood of a treatment outcome such as a favorable outcome or response and/or a durable response or outcome, and also associated with a relatively low or minimized or desired degree of likelihood of risk of developing a toxic outcome or toxicity following administration to the subject of the cell therapy, e.g., the engineered cells.
  • the toxicity or toxic outcome is cytokine release syndrome (CRS) or neurotoxicity (NT).
  • the toxicity or toxic outcome is any CRS or grade 1 or higher CRS or any neurotoxicity or grade 1 or higher neurotoxicity.
  • the toxicity or toxic outcome is severe CRS or grade 3 or higher CRS or severe neurotoxicity or grade 3 or higher neurotoxicity.
  • risk of toxicity is correlated to disease burden, dose of cells, expansion of cells, and the pharmacokinetic (PK) of the cells, e.g., cell exposure or peak cell concentration.
  • PK pharmacokinetic
  • a higher or greater dose of cells, exposure of cells or peak concentration of cells is required.
  • probability of durable response e.g., response that persists after a period of time from initiation of therapy, can increase with higher or greater dose of cells, exposure of cells or peak concentration of cells, up to a certain dose, exposure or concentration; then can decrease.
  • probability curves for toxicity e.g. CRS or neurotoxicity, severe CRS or severe neurotoxicty
  • response e.g. marrow response
  • durable response generated from a population of subjects treated with CAR+ T cells
  • a therapeutic range and/or window e.g. widest range between curves, at which a dose can be determined to maximize estimated probability of response or durable response and minimize estimated risk of toxicity.
  • probability curves can be used in methods to choose or to determine a dose of cells to administer to a subject.
  • probability curves can be used in methods to modify the dose of cells and/or to modulate the expansion and/or activity of cells, e.g., by administering an agent and/or intervention that affects cell expansion, activity and/or function.
  • the provided methods include administering to the subject a dose of cells engineered with a chimeric antigen receptor (CAR), wherein the dose is sufficient to achieve peak CAR+ cells/pl within a determined therapeutic range and/or an exposure (e.g., AUC) within a determined therapeutic range, wherein the therapeutic range is determined based upon the estimated probability of a response outcome (e.g. marrow response) and/or durable response, e.g., response at 3 months, and the estimated probability of a toxic outcome (e.g. grade 3-5 neurotoxicity).
  • CAR chimeric antigen receptor
  • the estimated probability is determined from a probability curve generated based on results or outcomes from a population of subjects, such as at least 10, 25, 50, 100, 150, 300, 400, 500 or more subjects.
  • the population of subjects is diseased subjects, such as subjects having a disease or condition, such as a tumor or cancer.
  • the population of subjects is or includes subjects that are likely to or are candidates or who are or have been receiving treatment with genetically engineered cells, e.g. CAR-T cells, for treating the disease or condition.
  • the subject has a sarcoma, a carcinoma or a lymphoma, optionally a non-Hodgkin lymphoma (NHL), diffuse large B cell lymphoma (DLBCL), leukemia, chronic lymphocytic leukemia (CLL) , acute lymphoblastic leukemia (ALL), acute myeloid leukemia (AML) and myeloma.
  • the subject has CLL.
  • a first probability curve is generated for risk of a toxic outcome (e.g., CRS or neurotoxicity, such as grade 3-5 neurotoxicity) and a second probability curve is generated for a response outcome (e.g. marrow response).
  • a first probability curve is generated for risk of a toxic outcome (e.g., CRS or neurotoxicity, such as grade 3-5 neurotoxicity) and a second probability curve is generated for durable response outcome.
  • the probability curves are transformed or provided as a Sigmoidal curve.
  • the estimated probability of toxicity e.g. CRS or
  • neurotoxicity such as grade 3-5 CRS or neurotoxicity
  • estimated probability of response e.g. marrow response
  • durable response e.g., response at 3 months
  • peak CAR+ cell concentration cells/pl
  • the CAR+ cells are or comprise T cells, e.g., are or comprise CD3+ T cells.
  • the T cells are CD4+ or CD8+ T cells.
  • the administered composition comprises CD4+ and CD8+ CAR+ T cells and the probability curves are generated separately for the CD4+ cells and for the CD8+ cells and/or for CD3+ cells.
  • the provided methods include a method of dosing a subject comprising administering to the subject a dose of cells engineered with a recombinant receptor, such as an antigen receptor, e.g. chimeric antigen receptor (CAR), wherein the dose is sufficient to achieve peak CAR+ cells/pl within a determined therapeutic range, wherein the therapeutic range is determined based upon the estimated probability of a response outcome (e.g. marrow response) and/or durable response (e.g., response at 3 months) and the estimated probability of a toxic outcome (e.g. CRS or neurotoxicity, such as grade 3-5 neurotoxicity).
  • a recombinant receptor such as an antigen receptor, e.g. chimeric antigen receptor (CAR)
  • CAR chimeric antigen receptor
  • the estimated probability of causing toxicity is less than 35%, less than 30%, less than 25%, less than 20%, less than 15%, less than 10% or less than 5% on the toxicity probability curve. In some embodiments, the estimated probability of achieving a response is greater than 65%, 70%, 75%, 80%, 85%, 90%, 95% or more. In some embodiments, the estimated probability of achieving a durable response, e.g., a response at 3 months, is greater than 65%, 70%, 75%, 80%, 85%, 90%, 95% or more. In some embodiments, the toxicity is CRS, such as any CRS, such as grade 1 or higher CRS, or neurotoxicity, such as any
  • the severe toxicity is severe CRS or grade 3 or higher CRS or severe neurotoxicity or grade 3 or higher neurotoxicity.
  • the response is a marrow response.
  • response is assessed using IgH deep sequencing.
  • the toxicity outcome is severe neurotoxicity or grade 3 or higher neurotoxicity, such as grade 3-5 neurotoxicity.
  • a method of dosing by administering, to a subject having a disease or condition (e.g. tumor or cancer), a dose of cells, and monitoring the subject post-infusion for peak CAR+ cells/pl, such as at one or more various time points, e.g.
  • a disease or condition e.g. tumor or cancer
  • monitoring the subject post-infusion for peak CAR+ cells/pl such as at one or more various time points, e.g.
  • the method can include determining or assessing the probability the peak CAR+ cells/pl are in the therapeutic range, such as determined form a toxicity probability curve and/or response probability curve and/or a durable response probability curve.
  • the method further involves administering a compound or agent to enhance or boost CAR+ cell expansion in vivo such that the peak CAR+ expansion is within the therapeutic range, such as determined by the provided methods and/or to reduce, inhibit, prevent and/or delay CAR+ T cell activity and/or expansion.
  • a method of dosing to a subject having a disease or condition (e.g. tumor or cancer), by administering to the subject a sub-optimal dose of cells, wherein the dose is insufficient to achieve peak CAR+ cells/pl within a determined therapeutic range.
  • the method further involves administering a compound or agent to enhance or boost CAR+ cell expansion in vivo such that the peak CAR+ expansion is within the therapeutic range, such as determined by the provided methods.
  • the method further involves administering to the subject a second dose of cells based on the response and toxicity probability curves for peak CD3+, CD4+ and/or CD8+ CAR+T cell concentration (cells/pl) and/or AUC, e.g., peak CD8+ CAR+ T cell concentrations.
  • the method further involves administering to the subject a tumor microenvironment (TME) targeting agent based on the response and toxicity probability curves for peak CD3+, CD4+ and/or CD8+ CAR+T cell concentrations (cells/pl) and/or AUC, e.g., peak CD8+ CAR+ T cell concentrations.
  • TEE tumor microenvironment
  • the method allows the selection of a dosing range that achieves a more durable response and/or remission.
  • methods that involve assessing, determining or monitoring pharmacokinetic parameters, such as maximum (peak) plasma concentration (C max ) and area under the curve (i.e. the area under the curve generated by plotting time versus plasma concentration of the therapeutic agent CAR+ T cells; AUC) of administered cells in the subject.
  • pharmacokinetic parameters such as maximum (peak) plasma concentration (C max ) and area under the curve (i.e. the area under the curve generated by plotting time versus plasma concentration of the therapeutic agent CAR+ T cells; AUC) of administered cells in the subject.
  • C max maximum plasma concentration
  • AUC area under the curve
  • assessments can be used to determine whether the administered cells are within a therapeutic range or window.
  • assessments can be used as an indicator to modulate, modify and/or alter therapy, e.g., by administering agents capable of modulating the expansion, proliferation and/or activity of the administered CAR+ T cells, administer additional and/or modified doses, and/or administer alternative therapy.
  • methods of administering a therapeutic agent accordingly can be used to monitor the progress of the therapy and/or to assess the effect of modulated therapy.
  • measurements can be used to assess the likelihood of a response or a durable response.
  • the assessment can be performed using a sample from the subject obtained prior to administration of the cell therapy or initiation thereof.
  • the assessment can be performed using a sample from the subject obtained after administration of the cell therapy or initiation thereof.
  • such assessments can be used to determine whether the administered cells are likely to be, or is likely to correlate with or associate with being, within a therapeutic range or window.
  • assessments can be used as an indicator to modulate, modify and/or alter therapy, e.g., by administering agents capable of modulating the expansion, proliferation and/or activity of the administered CAR+ T cells, administer additional and/or modified doses, and/or administer alternative therapy.
  • agents capable of modulating the expansion, proliferation and/or activity of the administered CAR+ T cells e.g., by administering agents capable of modulating the expansion, proliferation and/or activity of the administered CAR+ T cells, administer additional and/or modified doses, and/or administer alternative therapy.
  • assessments can be used to monitor the progress of the therapy and/or to assess the effect of modulated therapy. In some embodiments, such measurements can be used to assess the likelihood of a response or a durable response.
  • probability curves from a population of subjects as described are generated and correlated with the risk of toxic outcome (e.g. CRS or neurotoxicity, e.g., grade 2-5 CRS or grade 3-5 neurotoxicity) or response (e.g. marrow response), and/or durability of response (e.g., month 3 response).
  • the information regarding toxic outcome and response outcome as described above are combined and/or correlated with data collected regarding peak cell levels and/or concentrations, or exposure (e.g., AUC) in the subject.
  • the information about toxic outcome and response outcome are collected from a cohort of subjects, each correlated with cell level data (e.g ., peak number or concentration of CAR+ T cells), and independently assessed.
  • the toxic outcome data are collected and assessed with CAR+ cell numbers to construct a toxicity probability curve.
  • the response outcome data including data for durable response outcomes, are collected and assessed with CAR+ cell numbers to construct a response probability curve and/or a durable response probability curve.
  • the resulting toxicity and response and/or durable response probability curves can be jointly assessed, such as assessed in parallel or at around the same time or substantially the same time, to inform the dosing decisions or adaptive treatments of subjects.
  • toxic outcome and response outcome are used to construct an estimated probability curve of response and an estimated probability of developing toxicity based on the number, concentration and/or exposure of CAR+ T cells in the blood.
  • the estimated probability of achieving a response is greater than at or about 65%, greater than at or about 70%, greater than at or about 75%, greater than at or about 80%, greater than at or about 85%, greater than at or about 90%, greater than at or about 95% or more.
  • the estimated probability of achieving a durable response is greater than at or about 65%, greater than at or about 70%, greater than at or about 75%, greater than at or about 80%, greater than at or about 85%, greater than at or about 90%, greater than at or about 95% or more.
  • the estimated probability of causing or resulting in toxicity is less than at or about 35%, less than at or about 30%, less than at or about 25%, less than at or about 20%, less than at or about 15%, less than at or about 10% or less than at or about 5% on the toxicity probability curve.
  • the methods involve administering a sufficient number or dose of cells to achieve a peak CAR+ cell concentration in the subject that is within a
  • the methods involve administering a sufficient number or dose of cells to achieve a peak CAR+ cell concentration in a majority of subjects so treated by the method, or greater than or greater than at or about 50%, 60%, 70%, 75%, 80%, 85%, 90% or 95% or more, such as greater than 75% of the subjects so treated by the method, is within a determined target therapeutic range or window.
  • one or more therapeutic outcomes or events associated with toxicity (toxic outcome) and one or more therapeutic outcomes or events associated with efficacy (response outcome, including durable response outcome) of the therapeutic agent is assessed and dosing decisions are made in accord with the provided methods.
  • the information regarding toxic outcome and response outcome are combined and/or correlated with data collected regarding peak cell levels, concentrations and/or exposure in the subject.
  • the information about toxic outcome and response outcome are collected from a cohort of subjects, each correlated with cell level data, and independently assessed.
  • the toxic outcome data are collected and assessed to construct a toxicity probability curve and the response outcome data are collected and assessed to construct a response probability curve.
  • durable response outcome data e.g., durable response at 3, 6, 9 or 12 months
  • the toxicity and response probability curves can be jointly assessed, such as assessed in parallel or at around the same time or substantially the same time, to inform the dosing decisions or adaptive treatments of subjects.
  • the toxic outcome and response outcome are monitored at a time at which a toxicity outcome and a response outcome are present.
  • the particular time at which such outcome may be present will depend on the particular therapeutic agent and is known to a skilled artisan, such as a physician or clinician, or is within the level of such a skilled artisan to determine.
  • the time at which a toxic outcome or response outcome is assessed is within or within about a period of time in which a symptom of toxicity or efficacy is detectable in a subject or at such time in which an adverse outcome associated with non-response or toxicity is not detectable in the subject.
  • the time period is near or substantially near to when the toxic outcome and/or response outcome has peaked in the subject. In some embodiments, the time period includes time required for assessing durability of response, e.g., durable response at 3, 6, 9 or 12 months after first administration of the cells.
  • the toxic outcome or response outcome can be assessed in the subject at a time that is within or about within 120 days after initiation of the first dose of the therapeutic agent to the subject, within or within about 90 days after initiation of the first dose, within or within about 60 days after initiation of the first dose of the therapeutic agent or within or within about 30 days after initiation of the first dose to a subject.
  • the toxic outcome or response can be assessed in the subject within or within at or about 6 days, 12 days, 16 days, 20 days, 24 days, 28 days, 32 days, 36 days, 40 days, 44 days, 48 days, 52 days, 56 days, 60 days, 64 days, 68 days, 72 days, 76 days, 80 days, 84 days, 88 days, 92 days, 96 days or 100 days after initiation of the first dose to a subject.
  • the toxic outcome or response outcome is present or can be assessed or monitored at such time period where only a single dose of the therapeutic agent is administered.
  • administration of a given“dose” encompasses administration of the given amount or number of cells as a single composition and/or single uninterrupted administration, e.g., as a single injection or continuous infusion, and also encompasses administration of the given amount or number of cells as a split dose, provided in multiple individual compositions or infusions, over a specified period of time, which is no more than 3 days.
  • the first dose is a single or continuous administration of the specified number of cells, given or initiated at a single point in time.
  • the first dose is administered in multiple injections or infusions over a period of no more than three days, such as once a day for three days or for two days or by multiple infusions over a single day period.
  • split dose refers to a dose that is split so that it is administered over more than one day. This type of dosing is encompassed by the present methods and is considered to be a single dose.
  • first dose is used to describe the timing of a given dose, which, in some cases can be the only dose or can be followed by one or more repeat or additional doses. The term does not necessarily imply that the subject has never before received a dose of a therapeutic agent even that the subject has not before received a dose of the same or
  • the toxic outcome or response outcome is present and/or can be assessed or monitored at such time period that is after a first cycle of administration of the therapeutic agent, after a second cycle of administration of the therapeutic agent, after a third cycle of administration of the therapeutic agent, or after a fourth cycle of administration of the therapeutic agent.
  • a cycle of administration can be a repeated schedule of a dosing regimen that is repeated over successive administrations.
  • a schedule of administration can be daily, every other day, or once a week for one week, two weeks, three weeks or four weeks (e.g. 28 days).
  • the toxic outcome and response outcome can be assessed by monitoring one or more symptoms or events associated with a toxic outcome and one or more symptoms or events associated with a response outcome.
  • the disease or condition is a tumor or cancer.
  • a toxic outcome in a subject to administration of a therapeutic agent can be assessed or monitored.
  • the toxic outcome is or is associated with the presence of a toxic event, such as cytokine release syndrome (CRS), severe CRS (sCRS), macrophage activation syndrome, tumor lysis syndrome, fever of at least at or about 38 degrees Celsius for three or more days and a plasma level of C-reactive protein (CRP) of at least at or about 20 mg/dL, neurotoxicity (NT) and/or severe neurotoxicity (sNT).
  • CRS cytokine release syndrome
  • sCRS severe CRS
  • macrophage activation syndrome e.g., tumor lysis syndrome, fever of at least at or about 38 degrees Celsius for three or more days and a plasma level of C-reactive protein (CRP) of at least at or about 20 mg/dL, neurotoxicity (NT) and/or severe neurotoxicity (sNT).
  • CRP C-reactive protein
  • the toxic outcome is a sign, or symptom, particular signs, and symptoms and/or quantities or degrees thereof which presence or absence may specify a particular extent, severity or level of toxicity in a subject. It is within the level of a skilled artisan to specify or determine a particular sign, symptom and/or quantities or degrees thereof that are related to an undesired toxic outcome of a therapeutic agent (e.g. CAR- T cells).
  • a therapeutic agent e.g. CAR- T cells
  • the toxic outcome is an indicator associated with the toxic event.
  • the toxic outcome is the presence or absence of one or more biomarkers or the presence of absence of a level of one or more biomarkers.
  • the biomarker is a molecule present in the serum or other bodily fluid or tissue indicative of cytokine-release syndrome (CRS), severe CRS or CRS-related outcomes.
  • the biomarker is a molecule present in the serum or other bodily fluid or tissue indicative of neurotoxicity or severe neurotoxicity.
  • the subject exhibits toxicity or a toxic outcome if a toxic event, such as CRS-related outcomes, e.g. if a serum level of an indicator of CRS or other biochemical indicator of the toxicity is more than at or about 10 times, more than at or about 15 times, more than at or about 20 times, more than at or about 25 times, more than at or about 50 times, more than at or about 75 times, more than at or about 100 times, more than at or about 125 times, more than at or about 150 times, more than at or about 200 times, or more than at or about 250 times the baseline or pre-treatment level, such as the serum level of the indicator immediately prior to administration of the first dose of the therapeutic agent.
  • a toxic event such as CRS-related outcomes
  • the toxic outcome is or is associated with or indicative of cytokine release syndrome (CRS) or severe CRS (sCRS).
  • CRS cytokine release syndrome
  • sCRS severe CRS
  • CRS can occur in some cases following adoptive T cell therapy and administration to subjects of other biological products.
  • CRS is caused by an exaggerated systemic immune response mediated by, for example, T cells, B cells, NK cells, monocytes, and/or macrophages. Such cells may release a large amount of inflammatory mediators such as cytokines and chemokines. Cytokines may trigger an acute inflammatory response and/or induce endothelial organ damage, which may result in microvascular leakage, heart failure, or death. Severe, life-threatening CRS can lead to pulmonary infiltration and lung injury, renal failure, or disseminated intravascular coagulation. Other severe, life-threatening toxicities can include cardiac toxicity, respiratory distress, neurologic toxicity and/or hepatic failure.
  • fever especially high fever (> 38.5°C or > 101.3°F)
  • features or symptoms of CRS mimic infection.
  • infection is also considered in subjects presenting with CRS symptoms, and monitoring by cultures and empiric antibiotic therapy can be administered.
  • Other symptoms associated with CRS can include cardiac dysfunction, adult respiratory distress syndrome, renal and/or hepatic failure, coagulopathies, disseminated intravascular coagulation, and capillary leak syndrome.
  • CRS In the context of administering CAR-expressing cells, CRS typically occurs 6-20 days after infusion of cells that express a CAR. See Xu et ah, Cancer Letters 343 (2014) 172- 78. In some cases, CRS occurs less than 6 days or more than 20 days after CAR T cell infusion. The incidence and timing of CRS may be related to baseline cytokine levels or tumor burden at the time of infusion. Commonly, CRS involves elevated serum levels of interferon (IFN)-y, tumor necrosis factor (TNF)-a, and/or interleukin (IL)-2. Other cytokines that may be rapidly induced in CRS are IL- 1 b, IL-6, IL-8, and IL-10.
  • IFN interferon
  • TNF tumor necrosis factor
  • IL interleukin
  • Exemplary signs or symptoms associated with CRS include fever, rigors, chills, hypotension, dyspnea, acute respiratory distress syndrome (ARDS), encephalopathy, aspartate transaminase (AST)/alanine transaminase (ALT) elevation, renal failure, cardiac disorders, hypoxia, neurologic disturbances, and death.
  • Neurological complications include delirium, seizure-like activity, confusion, word-finding difficulty, aphasia, and/or becoming obtunded.
  • Other CRS-related signs or outcomes include fatigue, nausea, headache, seizure, tachycardia, myalgias, rash, acute vascular leak syndrome, liver function impairment, and renal failure.
  • CRS is associated with an increase in one or more factors such as serum-ferritin, d-dimer, aminotransferases, lactate dehydrogenase and triglycerides, or with
  • CRS cerebral spastic syndrome
  • ILR international normalized ratio
  • PTI prothrombin time
  • fibrinogen changes in cardiac and other organ function
  • ANC absolute neutrophil count
  • signs or symptoms associated with CRS include one or more of: persistent fever, e.g., fever of a specified temperature, e.g., greater than at or about 38 degrees Celsius, for two or more, e.g., three or more, e.g., four or more days or for at least three consecutive days; fever greater than at or about 38 degrees Celsius; elevation of cytokines (e.g.
  • IFNy or IL-6 IFNy or IL-6
  • at least one clinical sign of toxicity such as hypotension (e.g., as measured by at least one intravenous vasoactive pressor); hypoxia (e.g., plasma oxygen (P0 2 ) levels of less than at or about 90%); and/or one or more neurologic disorders (including mental status changes, obtundation, and seizures).
  • hypotension e.g., as measured by at least one intravenous vasoactive pressor
  • hypoxia e.g., plasma oxygen (P0 2 ) levels of less than at or about 90%
  • neurologic disorders including mental status changes, obtundation, and seizures.
  • NT neurotoxicity
  • Exemplary CRS -related outcomes include increased or high serum levels of one or more factors, including cytokines and chemokines and other factors associated with CRS.
  • Exemplary outcomes further include increases in synthesis or secretion of one or more of such factors.
  • Such synthesis or secretion can be by the T cell or a cell that interacts with the T cell, such as an innate immune cell or B cell.
  • one or more inflammatory markers e.g., cytokines or chemokines are monitored before, during, or after CAR treatment.
  • the one or more cytokines or chemokines include IFN-g, TNF-a, IL-2, IL- 1 b, IL-6, IL-7, IL-8, IL-10, IL- 12, sIL-2Ra, granulocyte macrophage colony stimulating factor (GM-CSF), or macrophage inflammatory protein (MIP).
  • IFN-g, TNF-a, and IL-6 are monitored.
  • the presence of one or more biomarkers is indicative of the grade of, severity or extent of a toxic event, such as CRS or neurotoxicity.
  • a toxic event such as CRS or neurotoxicity.
  • the toxic outcome is a particular grade, severity or extent of a toxic event, such as a particular grade, severity or extent of CRS or neurotoxicity.
  • the presence of a toxic event about a certain grade, severity or extent can be a dose-limiting toxicity.
  • the absence of a toxic event or the presence of a toxic event below a certain grade, severity or extent can indicate the absence of a dose-limiting toxicity.
  • a criteria reflective of CRS grade are those detailed in Table 2 below.
  • high-dose vasopressor therapy include those described in Table 3 below.
  • the toxic outcome is severe CRS. In some embodiments, the toxic outcome is the absence of severe CRS (e.g. moderate or mild CRS). In some embodiments, the toxic outcome is the absence of severe CRS (e.g. moderate or mild CRS). In some embodiments, the toxic outcome is the absence of severe CRS (e.g. moderate or mild CRS). In some embodiments, the toxic outcome is the absence of severe CRS (e.g. moderate or mild CRS). In some embodiments, the toxic outcome is severe CRS. In some embodiments, the absence of severe CRS (e.g. moderate or mild CRS). In some embodiments, the absence of severe CRS (e.g. moderate or mild CRS). In some embodiments, the absence of severe CRS (e.g. moderate or mild CRS). In some embodiments, the absence of severe CRS (e.g. moderate or mild CRS). In some embodiments, the absence of severe CRS (e.g. moderate or mild CRS).
  • severe CRS includes CRS with a grade of 3 or greater, such as set forth in Table 1 and Table 2. In some embodiments, severe CRS includes CRS with a grade of 2 or higher, such as grades 2, 3, 4 or 5 CRS.
  • the level of the toxic outcome e.g. the CRS-related outcome, e.g. the serum level of an indicator of CRS
  • the level of the toxic outcome is measured by ELISA.
  • fever and/or levels of C-reactive protein (CRP) can be measured.
  • subjects with a fever and a CRP > 15 mg/dL may be considered high-risk for developing severe CRS.
  • the CRS -associated serum factors or CRS-related outcomes include an increase in the level and/or concentration of inflammatory cytokines and/or chemokines, including Flt-3L, fracktalkine, granulocyte macrophage colony stimulating factor (GM-CSF), interleukin- 1 beta (IF- 1 b), IL-2, IL-5, IL-6, IL-7, IL-8, IL-10, IL-12, interferon gamma (IFN-g), macrophage inflammatory protein (MIP)-l, MIP-l, sIL-2Ra, or tumor necrosis factor alpha (TNFa).
  • the factor or outcome includes C reactive protein (CRP).
  • CRP In addition to being an early and easily measurable risk factor for CRS, CRP also is a marker for cell expansion. In some embodiments, subjects that are measured to have high levels of CRP, such as > 15 mg/dL, have CRS. In some embodiments, subjects that are measured to have high levels of CRP do not have CRS. In some embodiments, a measure of CRS includes a measure of CRP and another factor indicative of CRS.
  • the toxic outcome is or is associated with neurotoxicity.
  • signs or symptoms associated with a clinical risk of neurotoxicity include confusion, delirium, aphasia, expressive aphasia, obtundation, myoclonus, lethargy, altered mental status, convulsions, seizure-like activity, seizures (optionally as confirmed by electroencephalogram (EEG)), elevated levels of beta amyloid (Ab), elevated levels of glutamate, and elevated levels of oxygen radicals.
  • neurotoxicity is graded based on severity (e.g., using a Grade 1-5 scale (see, e.g., Guido Cavaletti & Paola Marmiroli Nature Reviews Neurology 6, 657-666 (December 2010); National Cancer Institute— Common Toxicity Criteria version 4.03 (NCI-CTCAE v4.03).
  • a subject is deemed to develop“severe neurotoxicity” in response to or secondary to administration of a cell therapy or dose of cells thereof, if, following administration, the subject displays symptoms that limit self-care (e.g. bathing, dressing and undressing, feeding, using the toilet, taking medications) from among: 1) symptoms of peripheral motor neuropathy, including
  • severe neurotoxicity includes neurotoxicity with a grade of 3 or greater, such as set forth in Table 4. In some embodiments, severe neurotoxicity includes neurotoxicity with a grade of 2 or higher, such as grades 2, 3, 4 or 5 neurotoxicity.
  • the toxic outcome is a dose-limiting toxicity. In some embodiments, the toxic outcome is the absence of a dose-limiting toxicity. In some
  • a dose-limiting toxicity is defined as any grade 3 or higher toxicity as assessed by any known or published guidelines for assessing the particular toxicity, such as any described above and including the National Cancer Institute (NCI) Common Terminology Criteria for Adverse Events (CTCAE) version 4.0.
  • NCI National Cancer Institute
  • CCAE Common Terminology Criteria for Adverse Events
  • a response outcome in a subject to administration of a therapeutic agent can be monitored or assessed.
  • the response outcome is no response.
  • the response outcome is a partial response (PR).
  • the response outcome is a complete response (CR).
  • response outcome is assessed by monitoring the disease burden in the subject. In some embodiments, the presence of no response, a partial response or a clinical or complete response can be assessed.
  • a partial response (PR) or complete response (CR) is one in which the therapeutic agent reduces or prevents the expansion or burden of the disease or condition in the subject.
  • PR partial response
  • CR complete response
  • the therapeutic agent reduces or prevents the expansion or burden of the disease or condition in the subject.
  • the disease or condition is a tumor
  • reduced disease burden exists or is present if there is a reduction in the tumor size, bulk, metastasis, percentage of blasts in the bone marrow or molecularly detectable cancer and/or an
  • the therapeutic agent e.g. CAR T cells.
  • the administration effectively treats the subject despite the subject having become resistant to another therapy.
  • at least 35%, at least 40% or at least 50% of subjects treated according to the method achieve complete response (CR); and/or at least 50%, at least 60% or at least 70% of the subjects treated according to the method achieve objective response rate (ORR).
  • ORR objective response rate
  • at least or about at least 50% of subjects, at least or about at least 60% of the subjects, at least or about at least 70% of the subjects, at least or about at least 80% of the subjects or at least or about at least 90% of the subjects treated according to the method achieve CR and/or achieve an objective response (OR).
  • criteria assessed for effective treatment includes overall response rate or objective response rate (ORR), complete response (CR), duration of response (DOR), progression-free survival (PFS), and/or overall survival (OS).
  • At least 40% or at least 50% of subjects treated according to the methods provided herein achieve complete remission (CR), exhibit progression-free survival (PFS) and/or overall survival (OS) of greater than at or about 3 months, 6 months or 12 months or greater than 13 months or approximately 14 months; on average, subjects treated according to the method exhibit a median PFS or OS of greater than at or about 6 months, 12 months, or 18 months; and/or the subject exhibits PFS or OS following therapy for at least at or about 6, 12, 18 or more months.
  • CR complete remission
  • PFS progression-free survival
  • OS overall survival
  • response rates in subjects are based on the Lugano criteria.
  • response assessment utilizes any of clinical, hematologic, and/or molecular methods.
  • response assessed using the Lugano criteria involves the use of positron emission tomography (PET)-computed tomography (CT) and/or CT as appropriate.
  • PET-CT evaluations may further comprise the use of fluorodeoxyglucose (FDG) for FDG-avid lymphomas.
  • a 5-point scale may be used.
  • the 5-point scale comprises the following criteria: 1, no uptake above background; 2, uptake ⁇ mediastinum; 3, uptake > mediastinum but ⁇ liver; 4, uptake moderately > liver; 5, uptake markedly higher than liver and/or new lesions; X, new areas of uptake unlikely to be related to lymphoma.
  • a complete response as described using the Lugano criteria involves a complete metabolic response and a complete radiologic response at various measureable sites.
  • these sites include lymph nodes and extralymphatic sites, wherein a CR is described as a score of 1, 2, or 3 with or without a residual mass on the 5-point scale, when PET- CT is used.
  • Waldeyer’s ring or extranodal sites with high physiologic uptake or with activation within spleen or marrow (e.g., with chemotherapy or myeloid colony- stimulating factors) uptake may be greater than normal mediastinum and/or liver.
  • a CR is described as no extralymphatic sites of disease and target nodes/nodal masses must regress to ⁇ 1.5 cm in longest transverse diameter of a lesion (LDi).
  • Further sites of assessment include the bone marrow wherein PET-CT-based assessment should indicate a lack of evidence of FDG- avid disease in marrow and a CT-based assessment should indicate a normal morphology, which if indeterminate should be IHC negative. Further sites may include assessment of organ enlargement, which should regress to normal.
  • nonmeasured lesions and new lesions are assessed, which in the case of CR should be absent (Cheson et al., (2014) JCO 32(27):3059-3067; Johnson et al., (2015) Radiology 2:323-338; Cheson, B.D. (2015) Chin Clin Oncol 4(l):5).
  • a partial response (PR) as described using the Lugano criteria involves a partial metabolic and/or radiological response at various measureable sites.
  • these sites include lymph nodes and extralymphatic sites, wherein a PR is described as a score of 4 or 5 with reduced uptake compared with baseline and residual mass(es) of any size, when PET-CT is used.
  • a PR is described as a score of 4 or 5 with reduced uptake compared with baseline and residual mass(es) of any size, when PET-CT is used.
  • findings can indicate responding disease.
  • At the end of treatment such findings can indicate residual disease.
  • response is assessed in the lymph nodes using CT, wherein a PR is described as >50% decrease in sum of product dimensions (SPD) of up to 6 target measureable nodes and extranodal sites.
  • SPD product dimensions
  • 5 mm x 5 mm is assigned as the default value; if the lesion is no longer visible, the value is 0 mm x 0 mm; for a node >5 mm x 5 mm, but smaller than normal, actual measurements are used for calculation.
  • Further sites of assessment include the bone marrow wherein PET-CT-based assessment should indicate residual uptake higher than uptake in normal marrow but reduced compared with baseline (diffuse uptake compatible with reactive changes from chemotherapy allowed).
  • consideration should be given to further evaluation with MRI or biopsy, or an interval scan.
  • further sites may include assessment of organ enlargement, where the spleen must have regressed by >50% in length beyond normal.
  • nonmeasured lesions and new lesions are assessed, which in the case of PR should be absent/normal, regressed, but no increase.
  • No response/stable disease (SD) or progressive disease (PD) can also be measured using PET-CT and/or CT based assessments.
  • progression-free survival is described as the length of time during and after the treatment of a disease, such as cancer, that a subject lives with the disease but it does not get worse.
  • objective response is described as a measurable response.
  • objective response rate is described as the proportion of patients who achieved CR or PR.
  • overall survival is described as the length of time from either the date of diagnosis or the start of treatment for a disease, such as cancer, that subjects diagnosed with the disease are still alive.
  • event-free survival is described as the length of time after treatment for a cancer ends that the subject remains free of certain complications or events that the treatment was intended to prevent or delay. These events may include the return of the cancer or the onset of certain symptoms, such as bone pain from cancer that has spread to the bone, or death.
  • the measure of duration of response includes the time from documentation of tumor response to disease progression.
  • the parameter for assessing response can include durable response, e.g., response that persists after a period of time from initiation of therapy and/or long-lasting positive response to therapy.
  • durable response is indicated by the response rate at approximately 1, 2, 3,
  • the response is durable for greater than 3 months or greater than 6 months.
  • durable response is response measured at month 3 after administration of therapy, e.g., a 3- month response.
  • durable response is response measured at month 6 after administration of therapy, e.g., a 6-month response.
  • the RECIST criteria is used to determine objective tumor response; in some aspects, in solid tumors. (Eisenhauer et al., European Journal of Cancer 45 (2009) 228- 247.) In some aspects, the RECIST criteria is used to determine objective tumor response for target lesions. In some respects, a complete response as determined using RECIST criteria is described as the disappearance of all target lesions and any pathological lymph nodes (whether target or non-target) must have reduction in short axis to ⁇ 10 mm. In other aspects, a partial response as determined using RECIST criteria is described as at least a 30% decrease in the sum of diameters of target lesions, taking as reference the baseline sum diameters.
  • progressive disease is described as at least a 20% increase in the sum of diameters of target lesions, taking as reference the smallest sum on study (this includes the baseline sum if that is the smallest on study). In addition to the relative increase of 20%, the sum must also
  • SD stable disease
  • the disease or condition is a tumor and a reduction in disease burden is a reduction in tumor size.
  • the disease burden reduction is indicated by a reduction in one or more factors, such as load or number of disease cells in the subject or fluid or organ or tissue thereof, the mass or volume of a tumor, or the degree or extent of metastases.
  • disease burden e.g. tumor burden
  • the burden of a disease or condition in the subject is detected, assessed, or measured.
  • Disease burden may be detected in some aspects by detecting the total number of disease or disease-associated cells, e.g., tumor cells, in the subject, or in an organ, tissue, or bodily fluid of the subject, such as blood or serum.
  • disease burden e.g. tumor burden
  • disease burden is assessed by measuring the mass of a solid tumor and/or the number or extent of metastases.
  • survival of the subject survival within a certain time period, extent of survival, presence or duration of event-free or symptom-free survival, or relapse-free survival, is assessed.
  • any symptom of the disease or condition is assessed.
  • the measure of disease or condition burden is specified.
  • disease burden can encompass a total number of cells of the disease in the subject or in an organ, tissue, or bodily fluid of the subject, such as the organ or tissue of the tumor or another location, e.g., which would indicate metastasis.
  • tumor cells may be detected and/or quantified in the blood or bone marrow in the context of certain hematological malignancies.
  • Disease burden can include, in some embodiments, the mass of a tumor, the number or extent of metastases and/or the percentage of blast cells present in the bone marrow.
  • a subject has leukemia.
  • the extent of disease burden can be determined by assessment of residual leukemia in blood or bone marrow.
  • response rates in subjects such as subjects with chronic
  • lymphocytic leukemia CLL
  • IWCLL Chronic Lymphocytic Leukemia
  • CR complete remission
  • PR partial remission
  • PD progressive disease
  • the subjects exhibits a CR or OR if, within 1 month of the administration of the dose of cells, lymph nodes in the subject are less than at or about 20 mm in size, less than at or about 10 mm in size or less than at or about 10 mm in size.
  • an index clone of the CLL is not detected in the bone marrow of the subject (or in the bone marrow of greater than 50%, 60%, 70%, 80%, 90% or more of the subjects treated according to the methods.
  • an index clone of the CLL is assessed by IgH deep sequencing.
  • the index clone is not detected at a time that is at or about or at least at or about 1, 2, 3, 4, 5, 6, 12, 18 or 24 months following the administration of the cells.
  • a response outcome exists if there is a reduction in the percent of blasts in the bone marrow compared to the percent of blasts in the bone marrow prior to treatment with the therapeutic agent.
  • reduction of disease burden exists if there is a decrease or reduction of at least or at least about 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or more in the number or percentage of blasts in the bone marrow compared to the number or percent of blasts in the bone marrow prior to treatment.
  • the subject exhibits a response if the subject does not exhibit morphologic disease (non-morphological disease) or does not exhibit substantial morphologic disease.
  • a subject exhibits morphologic disease if there are greater than or equal to 5% blasts in the bone marrow, for example, as detected by light microscopy.
  • a subject exhibits complete or clinical remission if there are less than 5% blasts in the bone marrow.
  • a subject has leukemia.
  • the extent of disease burden can be determined by assessment of residual leukemia in blood or bone marrow.
  • a subject exhibits morphologic disease if there are greater than or equal to 5% blasts in the bone marrow, for example, as detected by light microscopy, such as greater than or equal to 10% blasts in the bone marrow, greater than or equal to 20% blasts in the bone marrow, greater than or equal to 30% blasts in the bone marrow, greater than or equal to 40% blasts in the bone marrow or greater than or equal to 50% blasts in the bone marrow.
  • a subject exhibits complete or clinical remission if there are less than 5% blasts in the bone marrow.
  • a subject exhibits reduced or decreased disease burden if they exhibited morphological disease prior to treatment and exhibit complete remission (e.g., fewer than 5% blasts in bone marrow) with or without molecular disease (e.g., minimum residual disease (MRD) that is molecularly detectable, e.g., as detected by flow cytometry or quantitative PCR) after treatment.
  • molecular disease e.g., minimum residual disease (MRD) that is molecularly detectable, e.g., as detected by flow cytometry or quantitative PCR
  • a subject may exhibit complete remission, but a small proportion of morphologically undetectable (by light microscopy techniques) residual leukemic cells are present.
  • a subject is said to exhibit minimum residual disease (MRD) if the subject exhibits less than 5% blasts in the bone marrow and exhibits molecularly detectable cancer.
  • MRD minimum residual disease
  • molecularly detectable cancer can be assessed using any of a variety of molecular techniques that permit sensitive detection of a small number of cells.
  • such techniques include PCR assays, which can determine unique Ig/T-cell receptor gene rearrangements or fusion transcripts produced by chromosome translocations.
  • flow cytometry can be used to identify cancer cell based on leukemia- specific immunophenotypes.
  • molecular detection of cancer can detect as few as 1 leukemia or blast cell in 100,000 normal cells or 1 leukemia or blast cell in 10,000 normal cells.
  • a subject exhibits MRD that is molecularly detectable if at least or greater than 1 leukemia cell in 100,000 cells is detected, such as by PCR or flow cytometry.
  • the disease burden of a subject is molecularly undetectable or MRD , such that, in some cases, no leukemia cells are able to be detected in the subject using PCR or flow cytometry techniques.
  • an index clone of the leukemia is not detected in the bone marrow of the subject (or in the bone marrow of greater than 50%, 60%, 70%, 80%, 90% or more of the subjects treated according to the methods.
  • an index clone of the leukemia, e.g. CLL is assessed by IGH deep sequencing.
  • the index clone is not detected at a time that is at or about or at least at or about 1, 2, 3, 4, 5, 6, 12, 18 or 24 months following the administration of the cells.
  • MRD is detected by flow cytometry.
  • Flow cytometry can be used to monitor bone marrow and peripheral blood samples for cancer cells.
  • flow cytometry is used to detect or monitor the presence of cancer cells in bone marrow.
  • multiparameter immunological detection by flow cytometry is used to detect cancer cells (see for example, Coustan-Smith et al., (1998) Lancet 351:550-554).
  • multiparameter immunological detection by mass cytometry is used to detect cancer cells.
  • 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 45 or 50 parameters can be used to detect cancer cells.
  • the antigens used for detection are selected based on the cancer being detected (Foon and Todd (1986) Blood 68:1-31).
  • bone marrow is harvested by bone marrow aspirates or bone marrow biopsies, and lymphocytes are isolated for analysis.
  • Monoclonal and/or polyclonal antibodies conjugated to a fluorochrome e.g., fluorescein isothiocyanate (FITC), phycoerythrin, peridinin chlorophyll protein, or biotin
  • FITC fluorescein isothiocyanate
  • phycoerythrin e.g., phycoerythrin
  • peridinin chlorophyll protein e.g., a peroxisome
  • biotin e.g., FITC
  • TdT terminal deoxynucleotidyl transferase
  • Lymphoid cells can be identified and gated based on a light-scatter dot plot and then secondarily gated to identify cell populations expressing the immunophenotypic features of interest. Exemplary epitopes are set forth in Table 5 below. Other immunologic classification of leukemias and lymphomas are provided by Foon and Todd (Blood (1986) 68(1): 1-31). In some aspects, flow cytometric assessment of MRD can be achieved by quantifying live lymphocytes bearing one or more CLL immunophenotypes (e.g., low forward/side scatter; CD3 neg ; CD5 + ; CD14 neg ; CD19 + ; CD23 + ; CD45 + ; CD56 neg ).
  • CLL immunophenotypes e.g., low forward/side scatter; CD3 neg ; CD5 + ; CD14 neg ; CD19 + ; CD23 + ; CD45 + ; CD56 neg ).
  • deep sequencing of the immunoglobulin heavy chain (IGH) locus of harvested B cells can be used to detect minimal residual disease (MRD).
  • MRD minimal residual disease
  • Clonal presence of a particular IgG rearrangement can provide a marker to detect the presence of B cell malignancies, such as CLL or NHL and/or residual presence of malignant cells thereof.
  • cells such as a population containing or suspected of containing B cells are harvested and isolated from blood.
  • cells are harvested and isolated from bone marrow, e.g., from bone marrow aspirates or bone marrow biopsies and/or from other biological samples.
  • polymerase chain reaction (PCR) amplification of the complementarity determining region 3 (CDR3) is achieved using primers to highly conserved sequences within the V and J regions of the gene locus, which may be used to identify clonal populations of cells for purposes of assessing minimal residual disease.
  • Other methods for detecting clonal populations such as single cell sequencing approaches, including those providing information regarding number of cells of a particular lineage and/or expressing a particular variable chain such as variable heavy chain or binding site thereof, such as a clonal population, may be used.
  • the IGH DNA is amplified using a degenerate primers or primers recognizing regions of variable chains shared among different cell clones, such as those recognizing consensus V and degenerate consensus J region of the IGH sequence.
  • a degenerate primers or primers recognizing regions of variable chains shared among different cell clones, such as those recognizing consensus V and degenerate consensus J region of the IGH sequence.
  • An exemplary sequence of the V region is
  • ACACGGCCTCGTGTATTACTGT SEQ ID NO: 57.
  • An exemplary degenerate consensus sequence of the J region is ACCTGAGGAGACGGTGACC (SEQ ID NO:58).
  • the PCR product or sequencing result in some aspects is specific to the rearranged allele and serves as a clonal marker for MRD detection.
  • PCR products can be sequenced to yield patient- specific oligonucleotides constructed as probes for allele- specific PCR for sensitive detection of MRD following treatment of B-cell malignancies with CAR-T cell therapy, e.g. CD19 CAR- T cell therapy.
  • CAR-T cell therapy e.g. CD19 CAR- T cell therapy.
  • V region family- specific primers for the framework region 1 can be used instead.
  • PCR-detectable tumor cells such as cells of the B cell malignancy such as the NHL or CLL, such as detectable IGH sequences corresponding to the malignant or clonal IGH sequences, after treatment is associated with increased risk of relapse.
  • patients who are negative for malignant IGH sequences following treatment may be deemed to have increased likelihood of PFS or to enter into CR or durable CR or prolonged survival, compared to patients with persistent malignant IGH sequences.
  • prognostic and staging determinations are particularly relevant for treatments in which clearance of malignant cells is observed within a short period of time following administration of the therapy, e.g., in comparison to resolution of other clinical symptoms such as lymph node size or other staging criteria.
  • absence of detectable IGH or minimal residual disease in a sample such as the bone marrow may be a preferred readout for response or likelihood of response or durability thereof, as compared to other available staging or prognostic approaches.
  • results from MRD e.g., IGH deep sequencing information
  • results from MRD may inform further intervention or lack thereof.
  • the methods and other provided embodiments in some contexts provide that a subject deemed negative for malignant IGH may in some aspects be not further treated or not be further administered a dose of the therapy provided, or that the subject be administered a lower or reduced dose.
  • a subject exhibiting MRD via IGH deep sequencing be further treated, e.g., with the therapy initially administered at a similar or higher dose or with a further treatment.
  • the response outcome is the absence of a CR or the presence of a complete response in which the subject achieves or exhibits minimal residual disease or molecular detectable disease status. In some embodiments, the response outcome is the presence of a CR with molecularly detectable disease or the presence of a CR without molecularly detectable disease. In some embodiments, subjects are assessed for disease burden using methods as described herein, such as methods that assess blasts in bone marrow or molecular disease by flow cytometry or qPCR methods.
  • response is determined by complete remission or complete response (CR) and/or objective response (OR); and/or the subject exhibits CR, OR, lymph nodes of less than at or about 20 mm in size, within 1 month of the administration of the dose of cells; and/or an index clone of the disease or condition, such as the CLL or NHL, is not detected in the bone marrow of the subject (or in the bone marrow of greater than 50% of subjects treated according to the methods), optionally as assessed by IgH deep sequencing, optionally at a time that is at or about or at least at or about 1, 2, 3, 4, 5, 6, 12, 18, or 24 months following the administration of the cell dose.
  • CR complete remission or complete response
  • OR objective response
  • PK Pharmacokinetics
  • the method includes assessment of the exposure, number, concentration, persistence and proliferation of the T cells, e.g., T cells administered for the T cell based therapy.
  • the method includes assessment of the exposure, number or level of engineered T cells, e.g., T cells administered for the T cell based therapy, or subset thereof, such as CD3+ cells, CD4+ cells, CD8+ cells, CD3+ CAR+ cells, CD4+ CAR+ cells or CD8+ CAR+ cells.
  • the exposure, or prolonged expansion and/or persistence of the cells, and/or changes in cell phenotypes or functional activity of the cells, e.g., cells administered for immunotherapy, e.g. T cell therapy, in the methods provided herein can be measured by assessing the characteristics of the T cells in vitro or ex vivo.
  • such assays can be used to determine or confirm the function of the T cells used for the immunotherapy, e.g. T cell therapy, before or after administering the cell therapy provided herein.
  • the exposure, number, concentration, persistence and proliferation relate to pharmacokinetic parameters.
  • pharmacokinetics can be assessed by measuring such parameters as the maximum (peak) plasma concentration (C max ), the peak time ( i.e . when maximum plasma concentration (C max ) occurs; T max ), the minimum plasma concentration (i.e. the minimum plasma concentration between doses of a therapeutic agent, e.g., CAR+ T cells; C min ), the elimination half-life (Ti /2 ) and area under the curve (i.e. the area under the curve generated by plotting time versus plasma concentration of the therapeutic agent CAR+ T cells; AUC), following administration.
  • the concentration of a particular therapeutic agent, e.g., CAR+ T cells, in the plasma following administration can be measured using any method known in the art suitable for assessing concentrations of the therapeutic agents, e.g., CAR+ T cells, in samples of blood, or any methods described herein.
  • concentrations of the therapeutic agents e.g., CAR+ T cells
  • nucleic acid-based methods such as quantitative PCR (qPCR) or flow cytometry-based methods, or other assays, such as an immunoassay, ELISA, or chromatography/mass spectrometry-based assays can be used.
  • qPCR quantitative PCR
  • flow cytometry-based methods or other assays, such as an immunoassay, ELISA, or chromatography/mass spectrometry-based assays
  • PK pharmacokinetics
  • the determined pharmacokinetic parameters of the administered cells include maximum (peak) plasma concentrations (C max ), such as C max of CD3 + CAR + cells, CD4 + CAR + cells and or CD8 + CAR + T cells; the time point at which C max is achieved (T max ), such as the T max of CD3 + CAR + cells, CD4 + CAR + cells and or CD8 + CAR + T cells, and or area under the curve (AUC), such as the AUCo-28 , of CD3 + CAR + cells, CD4 + CAR + cells and or CD8 + CAR + T cells.
  • the pharmacokinetic parameter is peak CD3 + CAR + T cell concentration (C max CD3 + CAR + T cells), or CD8 + CAR + T cell
  • the pharmacokinetic parameter is AUC O -28, of CD3 + CAR + T cells, (AUCO-28 CD3 + CAR + T cells), or AUC 0-28 , of CD8 + CAR + T cells, (AUC O -28 CD8 + CAR + T cells),
  • “exposure” can refer to the body exposure of a therapeutic agent, e.g., CAR+ T cells in the plasma (blood or serum) after administration of the therapeutic agent over a certain period of time.
  • exposure can be set forth as the area under the therapeutic agent concentration-time curve (AUC) as determined by pharmacokinetic analysis after administration of a dose of the therapeutic agent, e.g., CAR+ T cells.
  • AUC is expressed in cells*days/pL, for cells administered in cell therapy, or in corresponding units thereof.
  • the AUC is measured as an average AUC in a patient population, such as a sample patient population, e.g., the average AUC from one or more patient(s).
  • systemic exposure refers to the area under the curve (AUC) within a certain period of time, e.g., from day 0 to day 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 21, 28 days or more, or week 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more, or month 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 18, 24, 48 or more.
  • the AUC is measured as an AUC from day 0 to day 28 (AUCo-2s) after administration of the therapeutic agent, e.g., CAR+ T cells, including all measured data and data extrapolated from measured pharmacokinetic (PK) parameters, such as an average AUC from a patient population, such as a sample patient population.
  • a therapeutic agent concentration-time curve is generated, using multiple measurements or assessment of parameters, e.g., cell concentrations, over time, e.g., measurements taken every 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 21 or 28 days or more.
  • the presence and/or amount of cells expressing the recombinant receptor e.g ., CAR-expressing cells administered for T cell based therapy
  • the recombinant receptor e.g ., CAR-expressing cells administered for T cell based therapy
  • nucleic acid-based methods such as quantitative PCR (qPCR) is used to assess the quantity of cells expressing the recombinant receptor (e.g., CAR-expressing cells administered for T cell based therapy) in the blood or serum or organ or tissue sample (e.g., disease site, e.g., tumor sample) of the subject.
  • qPCR quantitative PCR
  • persistence is quantified as copies of DNA or plasmid encoding the receptor, e.g., CAR, per microgram of DNA, or as the number of receptor-expressing, e.g., CAR-expressing, cells per microliter of the sample, e.g., of blood or serum, or per total number of peripheral blood mononuclear cells (PBMCs) or white blood cells or T cells per microliter of the sample.
  • the receptor e.g., CAR
  • PBMCs peripheral blood mononuclear cells
  • the primers or probe used for qPCR or other nucleic acid-based methods are specific for binding, recognizing and/or amplifying nucleic acids encoding the recombinant receptor, and/or other components or elements of the plasmid and/or vector, including regulatory elements, e.g., promoters, transcriptional and/or post-transcriptional regulatory elements or response elements, or markers, e.g., surrogate markers.
  • the primers can be specific for regulatory elements, such as the woodchuck hepatitis virus post-transcriptional regulatory element (WPRE).
  • WPRE woodchuck hepatitis virus post-transcriptional regulatory element
  • the presence and/or amount of cells expressing the recombinant receptor is expressed as copies of the nucleic acid sequence (e.g., transgene sequence) encoding the CAR or a nucleic acid sequence operably connected to the CAR- encoding sequences, per mass of DNA (e.g., copies/pg of DNA); AUC of the curve of copies/pg of DNA over time, maximum or peak copies/pg of DNA following treatment, or copies/pg of DNA at day 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or 21, or week 1, 2,
  • the cells are detected in the subject at or at least at 4, 14, 15, 27, or 28 days following the administration of the T cells, e.g., CAR-expressing T cells. In some aspects, the cells are detected at or at least at 2, 4, or 6 weeks following, or 3, 6, or 12, 18, or 24, or 30 or 36 months, or 1, 2, 3, 4, 5, or more years, following the administration of the T cells, e.g., CAR-expressing T cells.
  • the peak levels and/or AUC are assessed and/or the sample is obtained from the subject at a time that is at least 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 15 days, 16 days, 17 days, 18 days, 19 days, 20 days or 21 days after initiation of administration of the genetically engineered cells.
  • the peak levels and/or AUC are assessed and/or the sample is obtained from the subject at a time that is between or between about 11 to 22 days, 12 to 18 days or 14 to 16 days, each inclusive, after initiation of administration of the genetically engineered cells.
  • the exposure e.g., number or concentration of cells, e.g. T cells administered for T cell therapy, indicative of expansion and/or persistence, may be stated in terms of maximum numbers or concentration of the cells to which the subject is exposed, duration of detectable cells or cells above a certain number or percentage, area under the curve (AUC) for number or concentration of cells over time, and/or combinations thereof and indicators thereof.
  • AUC area under the curve
  • Such outcomes may be assessed using known methods, such as qPCR to detect copy number of nucleic acid encoding the recombinant receptor compared to total amount of nucleic acid or DNA in the particular sample, e.g., blood, serum, plasma or tissue, such as a tumor sample, and/or flow cytometric assays detecting cells expressing the receptor generally using antibodies specific for the receptors.
  • Cell-based assays may also be used to detect the number or percentage or concentration of functional cells, such as cells capable of binding to and/or neutralizing and/or inducing responses, e.g., cytotoxic responses, against cells of the disease or condition or expressing the antigen recognized by the receptor.
  • increased exposure of the subject to the cells includes increased expansion of the cells.
  • the receptor expressing cells e.g. CAR-expressing cells
  • expand in the subject following administration of the T cells e.g., CAR-expressing T cells.
  • cells expressing the receptor are detectable in the serum, plasma, blood or tissue, e.g., tumor sample, of the subject, e.g., by a specified method, such as qPCR or flow cytometry-based detection method, at least 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55,
  • a specified method such as qPCR or flow cytometry-based detection method
  • T cells e.g., CAR-expressing T cells
  • days following administration of the T cells, e.g., CAR-expressing T cells
  • days following administration of the T cells, e.g., CAR-expressing T cells
  • weeks following the administration of the T cells, e.g., CAR-expressing T cells.
  • such a number or concentration of cells is detectable in the subject for at least at or about 20 days, at least at or about 40 days, or at least at or about 60 days, or at least at or about 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 months, or at least 2 or 3 years, following administration of the T cells, e.g., CAR-expressing T cells.
  • T cells e.g., CAR-expressing T cells.
  • Such cell numbers may be as detected by flow cytometry-based or quantitative PCR-based methods and extrapolation to total cell numbers using known methods. See, e.g., Brentjens et al, Sci Transl Med.
  • the copy number of nucleic acid encoding the recombinant receptor is at least 0.01, at least 0.1, at least 1, or at least 10, at about 1 week, about 2 weeks, about 3 weeks, about 4 weeks, about 5 weeks, or at least about 6 weeks, or at least about 2, 3, 4, 5, 6, 7, 8. 9, 10, 11, or 12 months or at least 2 or 3 years following administration of the cells, e.g., CAR- expressing T cells.
  • the copy number of the vector expressing the receptor e.g.
  • CAR per microgram of genomic DNA is at least 100, at least 1000, at least 5000, or at least 10,000, or at least 15,000 or at least 20,000 at a time about 1 week, about 2 weeks, about 3 weeks, or at least about 4 weeks following administration of the T cells, e.g., CAR- expressing T cells or at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 months or at least 2 or 3 years following such administration.
  • the receptor e.g. CAR, expressed by the cells
  • qPCR quantitative PCR
  • flow cytometry flow cytometry in the subject, plasma, serum, blood, tissue and/or disease site thereof, e.g., tumor site, at a time that is at least at or about 3 months, at least at or about 6 months, at least at or about 12 months, at least at or about 1 year, at least at or about 2 years, at least at or about 3 years, or more than 3 years, following the administration of the cells, e.g., following the initiation of the administration of the T cells.
  • qPCR quantitative PCR
  • flow cytometry flow cytometry in the subject, plasma, serum, blood, tissue and/or disease site thereof, e.g., tumor site, at a time that is at least at or about 3 months, at least at or about 6 months, at least at or about 12 months, at least at or about 1 year, at least at or about 2 years, at least at or about 3 years, or more than 3 years, following the administration of the
  • the area under the curve (AUC) for concentration of receptor- (e.g., CAR-) expressing cells in a fluid, plasma, serum, blood, tissue, organ and/or disease site, e.g. tumor site, of the subject over time following the administration of the T cells, e.g., CAR-expressing T cells, is measured.
  • AUC area under the curve
  • the methods involve detecting, in a biological sample from a subject, peak levels of one or more inflammatory marker and/or peak levels of genetically engineered cells comprising T cells expressing a chimeric antigen receptor (CAR), wherein the subject has been previously administered a dose of the genetically engineered cells for treating a disease or condition.
  • the methods involve comparing, individually, the peak levels to a threshold value, thereby determining a likelihood that a subject will achieve a durable response to the administration of the genetically engineered cells.
  • the subject is likely to achieve a response or a durable response if the peak levels of the one or more inflammatory marker is below a threshold value and the subject is not likely to achieve a durable response if the peak levels of the one or more inflammatory marker is above a threshold value.
  • the subject is likely to achieve a durable response if the peak level of the genetically engineered cells is within a therapeutic range between a lower threshold value and an upper threshold value and the subject is not likely to achieve a durable response if the peak level of the genetically engineered cells is below the lower threshold value or is above the upper threshold value.
  • the methods include administering an immunotherapy and/or a cell therapy.
  • the methods involve administration of genetically engineered cells, e.g., cells engineered to express a recombinant receptor such as a chimeric antigen receptor (CAR).
  • methods of administering any of the engineered cells or compositions containing engineered cells to a subject such as a subject that has a disease or disorder.
  • uses of the engineered cells or compositions containing engineered cells for the manufacture of a medicament for the treatment of a disease or disorder are also provided.
  • the engineered cells or compositions containing engineered cells for use in treatment of a disease or disorder, or for administration to a subject having a disease or disorder.
  • the engineered cells expressing a recombinant receptor, such as a chimeric antigen receptor (CAR), or compositions comprising the same are useful in a variety of therapeutic, diagnostic and prophylactic indications.
  • the engineered cells or compositions comprising the engineered cells are useful in treating a variety of diseases and disorders in a subject.
  • Such methods and uses include therapeutic methods and uses, for example, involving administration of the engineered cells, or compositions containing the same, to a subject having a disease, condition, or disorder, such as a tumor or cancer.
  • the engineered cells or compositions comprising the same are administered in an effective amount to effect treatment of the disease or disorder.
  • Uses include uses of the engineered cells or compositions in such methods and treatments, and in the preparation of a medicament in order to carry out such therapeutic methods.
  • the methods are carried out by administering the engineered cells, or compositions comprising the same, to the subject having or suspected of having the disease or condition.
  • the methods thereby treat the disease or condition or disorder in the subject.
  • the methods include administering a dose of cells, e.g., CAR+ expressing cells, to a subject such that the cells are within a target therapeutic range or window.
  • a dose of cells e.g., CAR+ expressing cells
  • whether the cells in the subject is within a target therapeutic range or window can be determined or assessed by monitoring parameters, e.g., pharmacokinetic parameters, such as peak cell concentration (C max ).
  • the provided methods also include a method of determining a dose of a subject, or a method of dosing a subject, based on an assessment of the parameters, e.g., pharmacokinetic parameters, such as peak cell concentration (C max ), patient attributes and/or biomarkers.
  • a dose of cells expressing a recombinant receptor are administered to a subject to treat or prevent diseases, conditions, and disorders, including cancers.
  • the cells, populations, and compositions are administered to a subject or patient having the particular disease or condition to be treated, e.g., via adoptive cell therapy, such as adoptive T cell therapy.
  • adoptive cell therapy such as adoptive T cell therapy.
  • cells and compositions such as engineered compositions and end-of-production compositions following incubation and/or other processing steps, are administered to a subject, such as a subject having or at risk for the disease or condition.
  • the methods thereby treat, e.g., ameliorate one or more symptom of, the disease or condition, such as by lessening tumor burden in a cancer expressing an antigen recognized by an engineered T cell.
  • the disease or condition that is treated can be any in which expression of an antigen is associated with and/or involved in the etiology of a disease condition or disorder, e.g. causes, exacerbates or otherwise is involved in such disease, condition, or disorder.
  • exemplary diseases and conditions can include diseases or conditions associated with malignancy or transformation of cells (e.g. cancer), autoimmune or inflammatory disease, or an infectious disease, e.g. caused by a bacterial, viral or other pathogen.
  • Exemplary antigens which include antigens associated with various diseases and conditions that can be treated, are described above.
  • the chimeric antigen receptor or transgenic TCR specifically binds to an antigen associated with the disease or condition.
  • tumors including solid tumors, hematologic malignancies, and melanomas, and including localized and metastatic tumors, infectious diseases, such as infection with a virus or other pathogen, e.g., HIV, HCV, HBV, CMV, and parasitic disease, and autoimmune and inflammatory diseases.
  • infectious diseases such as infection with a virus or other pathogen, e.g., HIV, HCV, HBV, CMV, and parasitic disease
  • autoimmune and inflammatory diseases e.g., rhematologic malignancies, and melanomas.
  • infectious diseases such as infection with a virus or other pathogen, e.g., HIV, HCV, HBV, CMV, and parasitic disease.
  • the disease or condition is a tumor, cancer, malignancy, neoplasm, or other proliferative disease or disorder.
  • diseases include but are not limited to leukemia, lymphoma, e.g., chronic lymphocytic leukemia (CLL), acute-lymphoblastic leukemia (ALL), non-Hodgkin’s lymphoma, acute myeloid leukemia, multiple myeloma, refractory follicular lymphoma, mantle cell lymphoma, indolent B cell lymphoma, B cell malignancies, cancers of the colon, lung, liver, breast, prostate, ovarian, skin, melanoma, bone, and brain cancer, ovarian cancer, epithelial cancers, renal cell carcinoma, pancreatic adenocarcinoma, Hodgkin
  • lymphoma lymphoma, cervical carcinoma, colorectal cancer, glioblastoma, neuroblastoma, Ewing sarcoma, medulloblastoma, osteosarcoma, synovial sarcoma, and/or mesothelioma.
  • the subject has acute-lymphoblastic leukemia (ALL). In some embodiments, the subject has a B-cell malignancy. In some embodiments, the subject has a non-Hodgkin’s lymphoma.
  • ALL acute-lymphoblastic leukemia
  • B-cell malignancy In some embodiments, the subject has a non-Hodgkin’s lymphoma.
  • the disease or condition is an infectious disease or condition, such as, but not limited to, viral, retroviral, bacterial, and protozoal infections,
  • CMV Cytomegalovirus
  • EBV Epstein-Barr virus
  • adenovirus BK polyomavirus
  • the disease or condition is an autoimmune or
  • inflammatory disease or condition such as arthritis, e.g., rheumatoid arthritis (RA), Type I diabetes, systemic lupus erythematosus (SLE), inflammatory bowel disease, psoriasis, scleroderma, autoimmune thyroid disease, Grave’s disease, Crohn’s disease, multiple sclerosis, asthma, and/or a disease or condition associated with transplant.
  • arthritis e.g., rheumatoid arthritis (RA), Type I diabetes, systemic lupus erythematosus (SLE), inflammatory bowel disease, psoriasis, scleroderma, autoimmune thyroid disease, Grave’s disease, Crohn’s disease, multiple sclerosis, asthma, and/or a disease or condition associated with transplant.
  • RA rheumatoid arthritis
  • SLE systemic lupus erythematosus
  • bowel disease e.g., psoriasis,
  • the antigen associated with the disease or disorder is selected from the group consisting of anb ⁇ integrin (avb6 integrin), B cell maturation antigen (BCMA), B7-H3, B7-H6, carbonic anhydrase 9 (CA9, also known as CAIX or G250), a cancer-testis antigen, cancer/testis antigen 1B (CTAG, also known as NY-ESO-l and LAGE-2),
  • CEA carcinoembryonic antigen
  • CCL-l C-C Motif Chemokine Ligand 1
  • HMW-MAA Human high molecular weight-melanoma-associated antigen
  • HLA-A1 Human leukocyte antigen Al
  • HLA-A2 Human leukocyte antigen A2
  • IL-22Ra IL-22 receptor alpha
  • IL-13 receptor alpha 2 IL-l3Ra2
  • kdr kinase insert domain receptor
  • Ll-CAM Leucine Rich Repeat Containing 8 Family Member A
  • Tyrosinase related protein 1 (TRP1, also known as TYRP1 or gp75), Tyrosinase related protein 2 (TRP2, also known as dopachrome tautomerase, dopachrome delta-isomerase or DCT), vascular endothelial growth factor receptor (VEGFR), vascular endothelial growth factor receptor 2 (VEGFR2), Wilms Tumor 1 (WT-l), a pathogen-specific or pathogen-expressed antigen, or an antigen associated with a universal tag, and/or biotinylated molecules, and/or molecules expressed by HIV, HCV, HBV or other pathogens.
  • TRP1 Tyrosinase related protein 1
  • TRP2 also known as dopachrome tautomerase, dopachrome delta-isomerase or DCT
  • VEGFR vascular endothelial growth factor receptor
  • VEGFR2 vascular endothelial growth factor receptor 2
  • WT-l Wilms Tumor 1
  • Antigens targeted by the receptors in some embodiments include antigens associated with a B cell malignancy, such as any of a number of known B cell marker.
  • the antigen is or includes CD20, CD19, CD22, ROR1, CD45, CD21, CD5, CD33, Igkappa, Iglambda, CD79a, CD79b or CD30.
  • the antigen is or includes a pathogen-specific or pathogen-expressed antigen.
  • the antigen is a viral antigen (such as a viral antigen from HIV, HCV, HBV, etc.), bacterial antigens, and/or parasitic antigens.
  • the antigen associated with the disease or disorder is selected from the group consisting of orphan tyrosine kinase receptor ROR1, Her2, Ll-CAM, CD19, CD20, CD22, mesothelin, CEA, and hepatitis B surface antigen, anti-folate receptor, CD23, CD24, CD30, CD33, CD38, CD44, EGFR, EGP-2, EGP-4, 0EPHa2, ErbB2, 3, or 4, FBP, fetal acethycholine e receptor, GD2, GD3, HMW-MAA, IL-22R-alpha, IL-l3R-alpha2, kdr, kappa light chain, Lewis Y, Ll-cell adhesion molecule, MAGE-A1, mesothelin, MUC1, MUC16, PSCA, NKG2D Ligands, NY-ESO-l, MART-l, gplOO, oncofetal antigen
  • the cell therapy e.g., adoptive T cell therapy
  • the cell therapy is carried out by autologous transfer, in which the cells are isolated and/or otherwise prepared from the subject who is to receive the cell therapy, or from a sample derived from such a subject.
  • the cells are derived from a subject, e.g., patient, in need of a treatment and the cells, following isolation and processing are administered to the same subject.
  • the cell therapy e.g., adoptive T cell therapy
  • the cell therapy is carried out by allogeneic transfer, in which the cells are isolated and/or otherwise prepared from a subject other than a subject who is to receive or who ultimately receives the cell therapy, e.g., a first subject.
  • the cells then are administered to a different subject, e.g., a second subject, of the same species.
  • a different subject e.g., a second subject
  • the first and second subjects are genetically identical.
  • the first and second subjects are genetically similar.
  • the second subject expresses the same HLA class or supertype as the first subject.
  • the cells can be administered by any suitable means, for example, by bolus infusion, by injection, e.g., intravenous or subcutaneous injections, intraocular injection, periocular injection, subretinal injection, intravitreal injection, trans-septal injection, subscleral injection, intrachoroidal injection, intracameral injection, subconjectval injection, subconjuntival injection, sub-Tenon’s injection, retrobulbar injection, peribulbar injection, or posterior juxtascleral delivery.
  • injection e.g., intravenous or subcutaneous injections, intraocular injection, periocular injection, subretinal injection, intravitreal injection, trans-septal injection, subscleral injection, intrachoroidal injection, intracameral injection, subconjectval injection, subconjuntival injection, sub-Tenon’s injection, retrobulbar injection, peribulbar injection, or posterior juxtascleral delivery.
  • injection e.g., intravenous or subcutaneous injection
  • Parenteral infusions include intramuscular, intravenous, intraarterial, intraperitoneal, or subcutaneous administration.
  • a given dose is administered by a single bolus administration of the cells. In some embodiments, it is administered by multiple bolus administrations of the cells, for example, over a period of no more than 3 days, or by continuous infusion administration of the cells.
  • the appropriate dosage may depend on the type of disease to be treated, the type of cells or recombinant receptors, the severity and course of the disease, whether the cells are administered for preventive or therapeutic purposes, previous therapy, the subject’s clinical history and response to the cells, and the discretion of the attending physician.
  • the compositions and cells are in some embodiments suitably administered to the subject at one time or over a series of treatments.
  • the cells are administered as part of a combination treatment, such as simultaneously with or sequentially with, in any order, another therapeutic intervention, such as an antibody or engineered cell or receptor or agent, such as a cytotoxic or therapeutic agent.
  • the cells in some embodiments are co-administered with one or more additional therapeutic agents or in connection with another therapeutic intervention, either simultaneously or sequentially in any order.
  • the cells are co-administered with another therapy sufficiently close in time such that the cell populations enhance the effect of one or more additional therapeutic agents, or vice versa.
  • the cells are administered prior to the one or more additional therapeutic agents.
  • the cells are administered after the one or more additional therapeutic agents.
  • the one or more additional agents include a cytokine, such as IL-2, for example, to enhance persistence.
  • the methods comprise administration of a chemotherapeutic agent.
  • the methods comprise administration of a chemotherapeutic agent, e.g., a conditioning chemotherapeutic agent, for example, to reduce tumor burden prior to the administration.
  • a chemotherapeutic agent e.g., a conditioning chemotherapeutic agent, for example, to reduce tumor burden prior to the administration.
  • Preconditioning subjects with immunodepleting e.g., lymphodepleting
  • ACT adoptive cell therapy
  • the methods include administering a preconditioning agent, such as a lymphodepleting or chemotherapeutic agent, such as cyclophosphamide, fludarabine, or combinations thereof, to a subject prior to the initiation of the cell therapy.
  • a preconditioning agent such as a lymphodepleting or chemotherapeutic agent, such as cyclophosphamide, fludarabine, or combinations thereof.
  • the subject may be administered a preconditioning agent at least 2 days prior, such as at least 3, 4, 5, 6, or 7 days prior, to the initiation of the cell therapy.
  • the subject is administered a preconditioning agent no more than 7 days prior, such as no more than 6, 5, 4, 3, or 2 days prior, to the initiation of the cell therapy.
  • the subject is preconditioned with cyclophosphamide at a dose between at or about 20 mg/kg and at or about 100 mg/kg, such as between at or about 40 mg/kg and at or about 80 mg/kg. In some aspects, the subject is preconditioned with or with at or about 60 mg/kg of cyclophosphamide.
  • the cyclophosphamide can be administered in a single dose or can be administered in a plurality of doses, such as given daily, every other day or every three days. In some embodiments, the cyclophosphamide is
  • the subject is administered fludarabine at a dose between or between about 1 mg/m 2 and 100 mg/m 2 , such as between at or about 10 mg/m 2 and at or about 75 mg/m 2 , at or about 15 mg/m 2 and at or about 50 mg/m 2 , at or about 20 mg/m 2 and at or about 30 mg/m 2 , or at or about 24 mg/m 2 and at or about 26 mg/m .
  • the subject is administered 25 mg/m of fludarabine.
  • the fludarabine can be administered in a single dose or can be administered in a plurality of doses, such as given daily, every other day or every three days. In some embodiments, fludarabine is administered daily, such as for 1-5 days, for example, for 3 to 5 days.
  • the lymphodepleting agent comprises a combination of agents, such as a combination of cyclophosphamide and fludarabine.
  • the combination of agents may include cyclophosphamide at any dose or administration schedule, such as those described above, and fludarabine at any dose or administration schedule, such as those described above.
  • the subject is administered 60 mg/kg ( ⁇ 2 g/m ) of cyclophosphamide and 3 to 5 doses of 25 mg/m fludarabine prior to the first or subsequent dose.
  • the biological activity of the engineered cell populations in some embodiments is measured, e.g., by any of a number of known methods.
  • Parameters to assess include specific binding of an engineered or natural T cell or other immune cell to antigen, in vivo, e.g., by imaging, or ex vivo, e.g., by ELISA or flow cytometry.
  • the ability of the engineered cells to destroy target cells can be measured using any suitable method known in the art, such as cytotoxicity assays described in, for example, Kochenderfer et ah, J. Immunotherapy, 32(7): 689-702 (2009), and Herman et al. J.
  • the biological activity of the cells is measured by assaying expression and/or secretion of one or more cytokines, such as CDl07a, IFNy, IL-2, and TNF.
  • the biological activity is measured by assessing clinical outcome, such as reduction in tumor burden or load.
  • the engineered cells are further modified in any number of ways, such that their therapeutic or prophylactic efficacy is increased.
  • the engineered CAR or TCR expressed by the population can be conjugated either directly or indirectly through a linker to a targeting moiety.
  • the practice of conjugating compounds, e.g., the CAR or TCR, to targeting moieties is known in the art. See, for instance, Wadwa et ah, J. Drug Targeting 3: 1 1 1 (1995), and U.S. Patent 5,087,616.
  • the subject is administered a dose that achieves or is likely to achieve the therapeutic range and/or window of CAR+ T cells.
  • the method in some embodiments, is administered a dose that achieves or is likely to achieve the therapeutic range and/or window of CAR+ T cells.
  • the method involves administering a dose of cells in an amount that is or is likely to achieve a peak CAR+ cell number in the blood within a range in which the peak CAR+ cell numbers have less than a certain estimated probability of causing toxicity.
  • the method in some embodiments, involves administering a dose of cells in an amount that is or is likely to achieve a peak CAR+ cell number in the blood within a range in which the peak CAR+ cell numbers have more than a certain estimated probability of causing response or durable response.
  • the amount of cells is an amount effective to treat the disease or condition, such as therapeutically effective or prophylactic ally effective amount.
  • the estimated probability of achieving a response is greater than at or about 65%, greater than at or about 70%, greater than at or about 75%, greater than at or about 80%, greater than at or about 85%, greater than at or about 90%, greater than at or about 95% or more. In some cases, the estimated probability of causing toxicity is less than at or about 35%, less than at or about 30%, less than at or about 25%, less than at or about 20%, less than at or about 15%, less than at or about 10% or less than at or about 5% on the toxicity probability curve. In some embodiments, the dose of cells is both above the desired estimated probability of achieving a response and below the desired estimated probability of causing toxicity.
  • the amount or dose of cells that is administered is based upon assessment of parameters, e.g., pharmacokinetic parameters, and estimated probability of response and/or toxicity, e.g., as described in Section II.
  • the methods involve administering a sufficient number or dose of cells to achieve a peak CAR+ cell concentration in the subject that is within a
  • the methods involve administering a sufficient number or dose of cells to achieve a peak CAR+ cell concentration in a majority of subjects so treated by the method, or greater than or greater than at or about 50%, 60%, 70%, 75%, 80%, 85%, 90% or 95% or more, such as greater than 75% of the subjects so treated by the method, is within a determined target therapeutic range or window.
  • the therapeutic window or range is determined as described above, e.g., in Section II.
  • the therapeutic range is based upon the range of peak CD3+ CAR+ T cells, or a CD8+CAR+ T cell subset thereof, in the blood among one or more subjects previously treated with the genetically engineered cells that is associated with an estimated probability of response of greater than or greater than about 65%, 70%, 75%, 80%, 85%, 90%, 95% or more, and an estimated probability of a toxicity of less than or less than about 30%, 25%, 20%, 15%, 10%, 5% or less.
  • the therapeutic window or range is determined based on specific range of numbers and/or concentrations of cells, e.g., CD3+, CD4+ or CD8+ T cells.
  • an exemplary peak CD3+CAR+ T cell concentration in the blood that can achieve a therapeutic window is or includes between at or approximately 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 20, 30, 40, 50 CD3+ CAR+ T cells per microliter in the blood and at or
  • an exemplary peak CD8+CAR+ T cell concentration in the blood that can achieve a therapeutic window is or includes between at or approximately 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 20, 30, 40, 50 CD8+ CAR+ T cells per microliter in the blood and at or approximately 200, 300, 400, 500, 600, 700 or 750 CD8+ CAR+ T cells per microliter in the blood.
  • the target therapeutic range or window is a peak CD3+CAR+ T cell concentration of between at or about 10 cells per microliter and at or about 500 cells per microliter in the blood following administration. In some embodiments, the target therapeutic range or window is a peak CD8+CAR+ T cell concentration of between at or about 2 cells per microliter and at or about 200 cells per microliter in the blood following administration.
  • kits for dosing a subject that involves administering, to a subject having a disease or condition, a dose of genetically engineered cells comprising T cells expressing a chimeric antigen receptor (CAR), wherein the dose comprises a number of the genetically engineered cells that is sufficient to achieve peak CAR+ cells in the blood within a determined therapeutic range in the subject, or in a majority of subjects so treated by the method or in greater than 75% of the subjects so treated by the method, wherein the therapeutic range is: (i) based upon the range of peak CD3+ CAR+ T cells, or a CD8+CAR+ T cell subset thereof, in the blood among one or more subjects previously treated with the genetically engineered cells that is associated with an estimated probability of response of greater than or greater than about 65% and an estimated probability of a toxicity of less than or less than about 30%; or (ii) peak CD3+CAR+ T cells in the blood, following administration of the genetically engineered cells, that is between at or about
  • CAR chimeric antigen receptor
  • kits for dosing a subject that involves (a) administering, to a subject having a disease or condition, a sub-optimal dose of genetically engineered cells comprising T cells engineered with a chimeric antigen receptor (CAR), wherein the dose comprises a number of the genetically engineered cells that is insufficient to achieve peak CAR+ cells in the blood within a determined therapeutic range in the subject, or in a majority of subjects so treated by the method or in greater than 75% of the subjects so treated by the method, ; and (b)subsequent to administering the genetically engineered cells, administering an agent to enhance CAR+ cell expansion or proliferation in the subject to achieve peak CAR+
  • CAR chimeric antigen receptor
  • the therapeutic range is: (i) based upon the range of peak CD3+ CAR+ T cells, or a CD8+CAR+ T cell subset thereof, in the blood among one or more subjects previously treated with the genetically engineered cells that is associated with an estimated probability of response of greater than or greater than about 65% and an estimated probability of a toxicity of less than or about 30%; or (ii) peak CD3+CAR+ T cells in the blood, following administration of the genetically engineered cells, that is between at or about 10 cells per microliter and at or about 500 cells per microliter; or (iii) peak
  • CD8+CAR+ T cells in the blood following administration of the genetically engineered cells, that is between at or about 2 cells per microliter and at or about 200 cells per microliter.
  • the subject is administered a dose that can achieve the target therapeutic range or window.
  • the dose is less than or less than about 1 x 10 CAR-expressing cells, less than or less than about 5 x 10 6 CAR-expressing cells, less than or less than about 2.5 x 10 6 CAR-expressing cells, less than or less than about 1 x 10 6 CAR-expressing cells, less than or less than about 5 x 10 5 CAR-expressing cells, less than or less than about 2.5 x 10 5 CAR- expressing cells, less than or less than about 1 x 10 5 CAR-expressing cells.
  • administration of a given“dose” encompasses administration of the given amount or number of cells as a single composition and/or single uninterrupted administration, e.g., as a single injection or continuous infusion, and also encompasses administration of the given amount or number of cells as a split dose, provided in multiple individual compositions or infusions, over a specified period of time, which is no more than 3 days.
  • the dose is a single or continuous administration of the specified number of cells, given or initiated at a single point in time.
  • the dose is administered in multiple injections or infusions over a period of no more than three days, such as once a day for three days or for two days or by multiple infusions over a single day period.
  • the cells of the dose are administered in a single
  • the cells of the dose are administered in a plurality of compositions, collectively containing the cells of the first dose.
  • split dose refers to a dose that is split so that it is administered over more than one day. This type of dosing is encompassed by the present methods and is considered to be a single dose.
  • the dose in some aspects may be administered as a split dose.
  • the dose may be administered to the subject over 2 days or over 3 days.
  • Exemplary methods for split dosing include administering 25% of the dose on the first day and administering the remaining 75% of the dose on the second day.
  • 33% of the first dose may be administered on the first day and the remaining 67% administered on the second day.
  • 10% of the dose is administered on the first day, 30% of the dose is administered on the second day, and 60% of the dose is administered on the third day.
  • the split dose is not spread over more than 3 days.
  • cells of the dose may be administered by administration of a plurality of compositions or solutions, such as a first and a second, optionally more, each containing some cells of the dose.
  • the plurality of compositions, each containing a different population and/or sub-types of cells are administered separately or independently, optionally within a certain period of time.
  • the populations or sub- types of cells can include CD8 + and CD4 + T cells, respectively, and/or CD8+- and CD4+- enriched populations, respectively, e.g., CD4+ and/or CD8+ T cells each individually including cells genetically engineered to express the recombinant receptor.
  • the administration of the dose comprises administration of a first composition comprising a dose of CD8+ T cells or a dose of CD4+ T cells and administration of a second composition comprising the other of the dose of CD4+ T cells and the CD8+ T cells.
  • the administration of the composition or dose involves administration of the cell compositions separately.
  • the separate administrations are carried out simultaneously, or sequentially, in any order.
  • the dose comprises a first composition and a second composition, and the first composition and second composition are administered 0 to 12 hours apart, 0 to 6 hours apart or 0 to 2 hours apart.
  • the initiation of administration of the first composition and the initiation of administration of the second composition are carried out no more than 2 hours, no more than 1 hour, or no more than 30 minutes apart, no more than 15 minutes, no more than 10 minutes or no more than 5 minutes apart.
  • the initiation and/or completion of administration of the first composition and the completion and/or initiation of administration of the second composition are carried out no more than 2 hours, no more than 1 hour, or no more than 30 minutes apart, no more than 15 minutes, no more than 10 minutes or no more than 5 minutes apart.
  • the first composition e.g., first composition of the dose
  • the first composition comprises CD4+ T cells.
  • the first composition e.g., first composition of the dose
  • the first composition is administered prior to the second composition.
  • the dose or composition of cells includes a defined or target ratio of CD4+ cells expressing a recombinant receptor to CD8+ cells expressing a recombinant receptor and/or of CD4+ cells to CD8+ cells, which ratio optionally is approximately 1:1 or is between at or approximately 1:3 and at or approximately 3:1, such as approximately 1:1.
  • the administration of a composition or dose with the target or desired ratio of different cell populations such as CD4+:CD8+ ratio or CAR+CD4+:CAR+CD8+ ratio, e.g.,
  • 1:1) involves the administration of a cell composition containing one of the populations and then administration of a separate cell composition comprising the other of the populations, where the administration is at or approximately at the target or desired ratio.
  • one or more consecutive or subsequent dose of cells can be administered to the subject.
  • the consecutive or subsequent dose of cells is administered greater than or greater than about 7 days, 14 days, 21 days, 28 days or 35 days after initiation of administration of the first dose of cells.
  • the consecutive or subsequent dose of cells can be more than, approximately the same as, or less than the first dose.
  • administration of the T cell therapy such as administration of the first and/or second dose of cells, can be repeated.
  • a dose of cells is administered to subjects in accord with the provided methods.
  • the size or timing of the doses is determined as a function of the particular disease or condition in the subject. It is within the level of a skilled artisan to empirically determine the size or timing of the doses for a particular disease. Dosages may vary depending on attributes particular to the disease or disorder and/or patient and/or other treatments.
  • the time between the administration of the first dose and the administration of the consecutive dose is at or about 9 to at or about 35 days, at or about 14 to at or about 28 days, or at or about 15 to at or about 27 days. In some embodiments, the
  • administration of the consecutive dose is at a time point more than at or about 14 days after and less than at or about 28 days after the administration of the first dose. In some aspects, the time between the first and consecutive dose is at or about 21 days.
  • an additional dose or doses e.g. consecutive doses, are administered following administration of the consecutive dose. In some aspects, the additional consecutive dose or doses are
  • the additional dose is administered less than at or about 14 days following the prior dose, for example, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13 days after the prior dose.
  • no dose is administered less than at or about 14 days following the prior dose and/or no dose is administered more than at or about 28 days after the prior dose.
  • the dose of cells e.g., recombinant receptor-expressing cells
  • comprises two doses e.g., a double dose
  • a first dose of the T cells and a consecutive dose of the T cells, wherein one or both of the first dose and the second dose comprises administration of the split dose of T cells.
  • the cells, or individual populations of sub-types of cells are administered to the subject at a range of at or about 0.1 million to at or about 100 billion cells and/or that amount of cells per kilogram of body weight of the subject, such as, e.g., 0.1 million to at or about 50 billion cells (e.g., at or about 5 million cells, at or about 25 million cells, at or about 500 million cells, at or about 1 billion cells, at or about 5 billion cells, at or about 20 billion cells, at or about 30 billion cells, at or about 40 billion cells, or a range defined by any two of the foregoing values), 1 million to at or about 50 billion cells (e.g., at or about 5 million cells, at or about 25 million cells, at or about 500 million cells, at or about 1 billion cells, at or about 5 billion cells, at or about 20 billion cells, at or about 30 billion cells, at or about 40 billion cells, or a range defined by any two of the foregoing values), such as at or about 10 million to at or about
  • Dosages may vary depending on attributes particular to the disease or disorder and/or patient and/or other treatments. In some embodiments, such values refer to numbers of recombinant receptor-expressing cells; in other embodiments, they refer to number of T cells or PBMCs or total cells administered.
  • the cell therapy comprises administration of a dose comprising a number of cells that is at least or at least about or is or is about 0.1 x 10 6 cells/kg body weight of the subject, 0.2 x 10 6 cells/kg, 0.3 x 10 6 cells/kg, 0.4 x 10 6 cells/kg, 0.5 x 10 6 cells/kg, 1 x 10 6 cell/kg, 2.0 x 10 6 cells/kg, 3 x 10 6 cells/kg or 5 x 10 6 cells/kg.
  • the cell therapy comprises administration of a dose comprising a number of cells is between at or about 0.1 x 10 6 cells/kg body weight of the subject and at or about 1.0 x 10 7 cells/kg, between at or about 0.5 x 10 6 cells/kg and at or about 5 x 10 6 cells/kg, between at or about 0.5 x 10 6 cells/kg and at or about 3 x 10 6 cells/kg, between at or about 0.5 x 10 6 cells/kg and at or about 2 x 10 6 cells/kg, between at or about 0.5 x 10 6 cells/kg and at or about 1 x 10 6 cell/kg, between at or about 1.0 x 10 6 cells/kg body weight of the subject and at or about 5 x 10 6 cells/kg, between at or about 1.0 x 10 6 cells/kg and at or about 3 x 10 6 cells/kg, between at or about 1.0 x 10 6 cells/kg and at or about 2 x 10 6 cells/kg, between at or about 2.0 x 10 6 cells
  • the dose of cells comprises between at or about 2 x 10 5 of the cells/kg and at or about 2 x 10 6 of the cells/kg, such as between at or about 4 x 10 5 of the cells/kg and at or about 1 x 10 6 of the cells/kg or between at or about 6 x 10 5 of the cells/kg and at or about 8 x 10 5 of the cells/kg.
  • the dose of cells comprises no more than 2 x 10 5 of the cells (e.g.
  • antigen-expressing such as CAR-expressing cells
  • CAR-expressing cells per kilogram body weight of the subject (cells/kg), such as no more than at or about 3 x 10 5 cells/kg, no more than at or about 4 x 10 5 cells/kg, no more than at or about 5 x 10 5 cells/kg, no more than at or about 6 x 10 5 cells/kg, no more than at or about 7 x 10 5 cells/kg, no more than at or about 8 x 10 5 cells/kg, nor more than at or about 9 x 10 5 cells/kg, no more than at or about 1 x 10 6 cells/kg, or no more than at or about 2 x 10 6 cells/kg.
  • the dose of cells comprises at least or at least about or at or about 2 x 10 5 of the cells (e.g. antigen-expressing, such as CAR- expressing cells) per kilogram body weight of the subject (cells/kg), such as at least or at least about or at or about 3 x 10 5 cells/kg, at least or at least about or at or about 4 x 10 5 cells/kg, at least or at least about or at or about 5 x 10 5 cells/kg, at least or at least about or at or about 6 x 10 5 cells/kg, at least or at least about or at or about 7 x 10 5 cells/kg, at least or at least about or at or about 8 x 10 5 cells/kg, at least or at least about or at or about 9 x 10 5 cells/kg, at least or at least about or at or about 1 x 10 6 cells/kg, or at least or at least about or at or about 2 x 10 6 cells/kg.
  • the cells e.g. antigen-expressing, such as CAR- expressing cells
  • the cells are administered at a desired dosage, which in some aspects includes a desired dose or number of cells or cell type(s) and/or a desired ratio of cell types.
  • the dosage of cells in some embodiments is based on a total number of cells (or number per kg body weight) and a desired ratio of the individual populations or sub-types, such as the CD4+ to CD8+ ratio.
  • the dosage of cells is based on a desired total number (or number per kg of body weight) of cells in the individual populations or of individual cell types.
  • the dosage is based on a combination of such features, such as a desired number of total cells, desired ratio, and desired total number of cells in the individual populations.
  • the populations or sub-types of cells are administered at or within a tolerated difference of a desired dose of total cells, such as a desired dose of T cells.
  • a desired dose is a desired number of cells or a desired number of cells per unit of body weight of the subject to whom the cells are
  • the desired dose is at or above a minimum number of cells or minimum number of cells per unit of body weight.
  • the individual populations or sub-types are present at or near a desired output ratio (such as CD4 + to CD8 + ratio), e.g., within a certain tolerated difference or error of such a ratio.
  • the cells are administered at or within a tolerated difference of a desired dose of one or more of the individual populations or sub-types of cells, such as a desired dose of CD4+ cells and/or a desired dose of CD8+ cells.
  • the desired dose is a desired number of cells of the sub-type or population, or a desired number of such cells per unit of body weight of the subject to whom the cells are administered, e.g., cells/kg.
  • the desired dose is at or above a minimum number of cells of the population or sub- type, or minimum number of cells of the population or sub-type per unit of body weight.
  • the dosage is based on a desired fixed dose of total cells and a desired ratio, and/or based on a desired fixed dose of one or more, e.g., each, of the individual sub-types or sub-populations.
  • the dosage is based on a desired fixed or minimum dose of T cells and a desired ratio of CD4 + to CD8 + cells, and/or is based on a desired fixed or minimum dose of CD4 + and/or CD8 + cells.
  • the cells are administered at or within a tolerated range of a desired output ratio of multiple cell populations or sub-types, such as CD4+ and CD8+ cells or sub-types.
  • the desired ratio can be a specific ratio or can be a range of ratios for example, in some embodiments, the desired ratio (e.g., ratio of CD4 + to CD8 + cells) is between at or about 5:1 and at or about 5:1 (or greater than about 1:5 and less than about 5:1), or between at or about 1:3 and at or about 3:1 (or greater than about 1:3 and less than about 3:1), such as between at or about 2:1 and at or about 1:5 (or greater than about 1:5 and less than about 2:1, such as at or about 5:1, 4.5:1, 4:1, 3.5:1, 3: 1, 2.5:1, 2:1, 1.9:1, 1.8:1, 1.7:1, 1.6:1, 1.5:1,
  • the tolerated difference is within about 1%, about 2%, about 3%, about 4% about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50% of the desired ratio, including any value in between these ranges.
  • the numbers and/or concentrations of cells refer to the number of recombinant receptor (e.g ., CAR)-expressing cells. In other embodiments, the numbers and/or concentrations of cells refer to the number or concentration of all cells, T cells, or peripheral blood mononuclear cells (PBMCs) administered.
  • recombinant receptor e.g ., CAR
  • PBMCs peripheral blood mononuclear cells
  • the dose includes
  • PBMCs peripheral blood mononuclear cells
  • the dose includes more than at or about 1 x 10 6 total recombinant receptor (e.g., CAR)-expressing cells, T cells, or peripheral blood mononuclear cells (PBMCs) and fewer than at or about 2 x 10 9 total recombinant receptor (e.g., CAR)- expressing cells, T cells, or peripheral blood mononuclear cells (PBMCs), e.g., in the range of at or about 2.5 x 10 to at or about 1.2 x 10 such cells, such as at or about 2.5 x 10 , 5 x 10 , 1 x 10 8 , 1.5 x 10 8 , 3 x 10 8 , 4.5 x 10 8 , 8 x l0 8 ,or 1.2 x 10 9 total such cells, or the range between any two of the foregoing values.
  • CAR total recombinant receptor
  • PBMCs peripheral blood mononuclear cells
  • PBMCs peripheral blood mononuclear cells
  • the dose of genetically engineered cells comprises from at or about 1 x 105 to at or about 5 x 108 total CAR-expressing T cells, from at or about 1 x 105 to at or about 2.5 x 10 8 total CAR-expressing T cells, from at or about 1 x 105 to at or about 1 x 108 total CAR-expressing T cells, from at or about 1 x 105 to at or about 5 x 107 total CAR- expressing T cells, from at or about 1 x 105 to at or about 2.5 x 107 total CAR-expressing T cells, from at or about 1 x 10 to at or about 1 x 10 total CAR-expressing T cells, from at or about 1 x 10 5 to at or about 5 x 10 6 total CAR-expressing T cells, from at or about 1 x 10 5 to at or about 2.5 x 10 6 total CAR-expressing T cells, from at or about 1 x 10 5 to at or about 1 x 10 6 total CAR-expressing T cells, from at or about 1 x 10 5 to at or
  • CAR-expressing T cells from at or about 1 x 107 to at or about 1 x 108 total CAR-expressing T cells, from at or about 1 x 107 to at or about 5 x 107 total CAR-expressing T cells, from at or about 1 x 107 to at or about 2.5 x 107 total CAR-expressing T cells, from at or about 2.5 x
  • CAR-expressing T cells from at or about 2.5 x 107 to at or about 5 x 107 total CAR-expressing
  • T cells from at or about 5 x 107 to at or about 5 x 108 total CAR-expressing T cells, from at or about 5 x 107 to at or about 2.5 x 108 total CAR-expressing T cells, from at or about 5 x 107 to at or about 1 x 10 8 total CAR-expressing T cells, from at or about 1 x 108 to at or about 5 x 108 total CAR-expressing T cells, from at or about 1 x 108 to at or about 2.5 x 108 total CAR- expressing T cells, from at or about or 2.5 x 10 to at or about 5 x 10 total CAR-expressing T cells.
  • the dose of genetically engineered cells comprises at least or at least about 1 x 10 5 CAR-expressing cells, at least or at least about 2.5 x 10 5 CAR-expressing cells, at least or at least about 5 x 10 5 CAR-expressing cells, at least or at least about 1 x 10 6 CAR-expressing cells, at least or at least about 2.5 x 10 6 CAR-expressing cells, at least or at least about 5 x 10 6 CAR-expressing cells, at least or at least about 1 x 10 7 CAR-expressing cells, at least or at least about 2.5 x 10 CAR-expressing cells, at least or at least about 5 x 10 CAR- expressing cells, at least or at least about 1 x 10 CAR-expressing cells, at least or at least about
  • 1.5 x 108 CAR-expressing cells at least or at least about 2.5 x 108 CAR-expressing cells, at least or at least about 3 x 10 8 CAR-expressing cells, at least or at least about 4.5 x 108 CAR- expressing cells, or at least or at least about 5 x 10 CAR-expressing cells.
  • the cell therapy comprises administration of a dose comprising a number of cell from or from about 1 x 105 to or to about 5 x 108 total recombinant receptor-expressing cells, total T cells, or total peripheral blood mononuclear cells (PBMCs), from or from about 5 x 10 to or to about 1 x 10 total recombinant receptor-expressing cells, total T cells, or total peripheral blood mononuclear cells (PBMCs) or from or from about 1 x 10 6 to or to about 1 x 10 total recombinant receptor-expressing cells, total T cells, or total peripheral blood mononuclear cells (PBMCs), each inclusive.
  • PBMCs peripheral blood mononuclear cells
  • the cell therapy comprises administration of a dose of cells comprising a number of cells at least or at least about 1 x 10 5 total recombinant receptor-expressing cells, total T cells, or total peripheral blood mononuclear cells (PBMCs), such at least or at least 1 x 10 6 , at least or at least about 1 x 10 , at least or at least about 1 x 10 of such cells.
  • the number is with reference to the total number of CD3+ or CD8+, in some cases also recombinant receptor expressing (e.g. CAR+) cells.
  • the cell therapy comprises administration of a dose comprising a number of cell from or from about 1 x 10 to 5 x 10 CD3+ or CD8+ total T cells or CD3+ or CD8+ recombinant receptor-expressing cells, from or from about 5 x 10 5 to 1 x 10 CD3+ or CD8+ total T cells or CD3+ or CD8+ recombinant receptor-expressing cells, or from or from about 1 x 10 6 to 1 x 10 7 CD3+ or CD8+ total T cells or CD3+ or
  • the cell therapy comprises administration of a dose comprising a number of cell from or from about 1 x 10 5 to 5 x 10 8 total CD3+/CAR+ or CD8+/CAR+ cells, from or from about 5 x 10 5 to 1 x 10 7 total CD3+/CAR+ or CD8+/CAR+ cells, or from or from about 1 x 10 6 to 1 x 10 7 total
  • CD3+/CAR+ or CD8+/CAR+ cells each inclusive.
  • the T cells of the dose include CD4+ T cells, CD8+ T cells or CD4+ and CD8+ T cells.
  • the CD8+ T cells of the dose includes between at or about 1 x 10 6 and at or about 5 x 10 8 total recombinant receptor (e.g., CAR)-expressing CD8+cells, e.g., in the range of from at or about 5 x 10 to at or about 1 x 10 such cells, such as 1 x 10 , 2.5 x 10 7 , 5 x 10 7 , 7.5 x 10 7 , 1 x 10 8 , 1.5 x 10 8 , 3 x 10 8 , 4.5 x 10 8 , or 5 x 10 8 total such cells, or the range between any two of the foregoing values.
  • the patient is
  • the dose of cells comprises the administration of from or from about 1 x 10 to or to about0.75 x 10 total recombinant receptor-expressing CD8+ T cells, from or from about 1 x 10 to or to about 5 x 10 total recombinant receptor-expressing
  • CD8+ T cells from or from about 1 x 107 to or to about 0.25 x 108 total recombinant receptor- expressing CD8+ T cells, each inclusive.
  • the dose of cells comprises the administration of at or about 1 x 10 7 , 2.5 x 10 7 , 5 x 10 7 , 7.5 x 10 7 , 1 x 10 8 , 1.5 x 10 8 , 2.5 x 10 8 , 3 x 10 , 4.5 x 10 , or 5 x 10 total recombinant receptor-expressing CD8+ T cells.
  • the dose of cells e.g., recombinant receptor-expressing T cells
  • the size of the dose is determined based on one or more criteria such as response of the subject to prior treatment, e.g. chemotherapy, disease burden in the subject, such as tumor load, bulk, size, or degree, extent, or type of metastasis, stage, and/or likelihood or incidence of the subject developing toxic outcomes, e.g., CRS, macrophage activation syndrome, tumor lysis syndrome, neurotoxicity, and/or a host immune response against the cells and/or recombinant receptors being administered.
  • a host immune response against the cells and/or recombinant receptors being administered e.g., CRS, macrophage activation syndrome, tumor lysis syndrome, neurotoxicity, and/or a host immune response against the cells and/or recombinant receptors being administered.
  • the methods include administering an immunotherapy and/or a cell therapy.
  • the methods involve administration of genetically engineered cells, e.g., cells engineered to express a recombinant receptor such as a chimeric antigen receptor (CAR).
  • the methods include administering a dose of cells, e.g., CAR+ expressing cells, to a subject such that the cells are within a target therapeutic range or window.
  • the methods also involve monitoring parameters such as numbers or level e.g., pharmacokinetic parameters, such as peak cell concentration (C max ), to determine whether the cells in the subject is within the therapeutic range or window.
  • the treatment can be modified, e.g., by administering additional doses, altering subsequent or additional doses, and/or by administering an agent that can modulate CAR+ T cell expansion, proliferation and/or activity.
  • the provided methods also include a method of determining a dose of a subject, or a method of dosing a subject, based on an assessment of the parameters such as numbers or level, e.g., pharmacokinetic parameters, such as peak cell concentration (C max ), patient attributes and/or biomarkers.
  • a therapy e.g., a cell therapy such as a T cell therapy with recombinant receptor-expressing cells.
  • the cell therapy is modulated by administering to the subject receiving cell therapy an agent to the subject capable of modulating CAR+ T cell expansion, proliferation, expansion, survival, activity and/or function,, e.g., increases or decreases CAR+ T cell expansion, proliferation, survival and/or activity.
  • the agent is administered after assessment of pharmacokinetic parameters, e.g., number, level or peak CAR+ T cell concentration, exposure (e.g., AUC) and/or cell level or concentration.
  • pharmacokinetic parameters e.g., number, level or peak CAR+ T cell concentration, exposure (e.g., AUC) and/or cell level or concentration.
  • the agent is administered after assessment of other parameters, such as patient attributes, factors, characteristics and/or expression of biomarkers, that is associated with and/or correlated with pharmacokinetic parameters, response, durable response and/or development of toxicity.
  • the method involves administering, to a subject having a disease or condition, a dose of genetically engineered cells comprising T cells expressing a recombinant receptor, such as a chimeric antigen receptor (CAR) for treating the disease or condition.
  • the method involves after administering the dose of genetically engineered cells, monitoring pharmacokinetic parameters, e.g., CAR+ T cells, in the blood of the subject to assess if the cells are within a therapeutic range or window.
  • the method involves administering an agent to the subject capable of modulating, optionally increasing or decreasing, CAR+ T cell expansion, proliferation and/or activity, in the subject if the genetically engineered cells are not within the therapeutic range.
  • methods of treatment that involves monitoring, in the blood of a subject, the presence of genetically engineered cells comprising T cells expressing a chimeric antigen receptor (CAR) to assess if the cells are within a therapeutic range, wherein the subject has been previously administered a dose of the genetically engineered cells for treating a disease or condition.
  • the methods also involve administering an agent capable of modulating, optionally increasing or decreasing, CAR+ T cell expansion, proliferation and/or activity, in the subject if the genetically engineered cells are not within the therapeutic range.
  • the number, level or peak number of CAR+ T cells in the blood of the subject is less than the lowest number of number, level or peak CAR+ T cells in the therapeutic range, an agent is administered to the subject that is capable of increasing CAR+ T cell expansion or proliferation. In some aspects, if the number, level or peak number of CAR+
  • T cells in the blood of the subject is greater than the highest number of number, level or peak CAR+ T cells in the therapeutic range, an agent is administered to the subject that is capable of decreasing CAR+ T cell expansion or proliferation.
  • the methods involves assessing the level, amount or concentration of a parameter, such as a volumetric measure of tumor burden or an inflammatory marker, in a sample from the subject is at or above a threshold level.
  • the sample does not comprise genetically engineered T cells expressing a chimeric antigen receptor (CAR) and/or is obtained from the subject prior to receiving administration of genetically engineered T cells expressing a CAR.
  • a subject is selected for administration of an agent capable of decreasing expansion or proliferation of genetically engineered T cells expressing a CAR.
  • the agent capable of decreasing expansion or proliferation of genetically engineered T cells expressing a CAR is administered to the subject.
  • chimeric antigen receptor CAR
  • methods of modulating activity of engineered cells that involves administering to a subject an agent capable of decreasing expansion or proliferation of genetically engineered T cells expressing a chimeric antigen receptor (CAR) in a subject, wherein the subject is one in which the level, amount or
  • concentration of a parameter e.g., a volumetric measure of tumor burden or an inflammatory marker in a sample from the subject is at or above a threshold level.
  • the provided methods involve administration of a genetically engineered cell, e.g., a T cell engineered to express a recombinant receptor, e.g., CAR.
  • a genetically engineered cell e.g., a T cell engineered to express a recombinant receptor, e.g., CAR.
  • an agent capable of modulating, e.g., increasing or decreasing, CAR+ T cell expansion, proliferation and/or activity is administered prior to or concurrently with initiation of administration of a dose of genetically engineered cells comprising T cells expressing a chimeric antigen receptor.
  • the selected subject prior to administering the agent, is at risk of developing a toxicity following administration of the genetically engineered cells.
  • the administration of the agent is sufficient to achieve number, level or peak CAR+ T cells in a therapeutic range or window in the subject. In some embodiments, the administration of the agent is sufficient to achieve number, level or peak CAR+ T cell concentrations, in the blood in a majority of subjects so treated by the method, or greater than or greater than about 50%, 60%, 70%, 75%, 80%, 85%, 90% or 95% or more, such as greater than or greater than about 75% of the subjects so treated by the method, is within a determined target therapeutic range or window.
  • the methods involve administering, to a subject having a disease or condition, a sub-optimal dose of genetically engineered cells comprising T cells engineered with a chimeric antigen receptor (CAR), wherein the dose comprises a number of the genetically engineered cells that is insufficient to achieve number, level or peak CAR+ cells in the blood within a determined therapeutic range in the subject, or in a majority of subjects so treated by the method or in greater than 75% of the subjects so treated by the method.
  • CAR chimeric antigen receptor
  • the methods involve administering an agent to enhance CAR+ cell expansion or proliferation in the subject to achieve number, level or peak CAR+ T cells in the blood within the therapeutic range or window, subsequent to administering the genetically engineered cells.
  • the dose of genetically engineered cells is less than or less than about 1 x 10 CAR-expressing cells, less than or less than about 5 x 10 6 CAR-expressing cells, less than or less than about 2.5 x 10 6 CAR-expressing cells, less than or less than about 1 x 10 6 CAR-expressing cells, less than or less than about 5 x 10 5 CAR-expressing cells, less than or less than about 2.5 x 10 5 CAR- expressing cells, less than or less than about 1 x 10 5 CAR-expressing cells.
  • the method achieves an increased frequency of number, level or peak CAR+ cells in the blood within a determined therapeutic range in the subject, compared to a method involving administration of the same dose of genetically engineered cells but without the agent; or number, level or peak CAR+ cells in the blood within a determined therapeutic range in the subject, or in a majority of subjects so treated by the method or in greater than 75% of the subjects so treated by the method.
  • the therapeutic range or window is determined as described herein, e.g., in Section II or elsewhere.
  • the therapeutic range is based upon the range of number, level or peak CD3+ CAR+ T cells, or a CD8+CAR+ T cell subset thereof, in the blood among one or more subjects previously treated with the genetically engineered cells that is associated with an estimated probability of response of greater than or greater than about 65%, 70%, 75%, 80%, 85%, 90%, 95% or more, and an estimated probability of a toxicity of less than or less than about 30%, 25%, 20%, 15%, 10%, 5% or less.
  • the therapeutic window or range is determined based on specific range of numbers and/or concentrations of cells, e.g., CD3+, CD4+ or CD8+ T cells.
  • an exemplary number, level or peak CD3+CAR+ T cell concentration in the blood that can achieve a therat or apeutic window is or includes between at or approximately 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 20, 30, 40, 50 CD3+ CAR+ T cells per microliter in the blood and at or approximately 200, 300, 400, 500, 600, 700 or 750, CD3+ CAR+ T cells per microliter in the blood.
  • an exemplary number, level or peak CD8+CAR+ T cell concentration in the blood that can achieve a therat or apeutic window is or includes between at or approximately 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 20, 30, 40, 50 CD8+ CAR+ T cells per microliter in the blood and at or approximately 200, 300, 400, 500, 600, 700 or 750, CD8+ CAR+ T cells per microliter in the blood.
  • the methods also involve monitoring the CAR+ T cells in the blood of the subject after administering the dose of genetically engineered cells.
  • the subject is monitored for CAR+ T cells in the blood at a time that is at least 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 15 days, 16 days, 17 days, 18 days, 19 days, 20 days or 21 days after initiation of administration of the genetically engineered cells.
  • the subject is monitored for CAR+ T cells in the blood at a time that is between or between about 11 to 22 days, 12 to 18 days or 14 to 16 days, each inclusive, after initiation of administration of the genetically engineered cells.
  • the methods involve detecting, in a biological sample from a subject, peak levels of one or more inflammatory marker and/or peak levels of genetically engineered cells comprising T cells expressing a chimeric antigen receptor (CAR), wherein the subject has been previously administered a dose of the genetically engineered cells for treating a disease or condition.
  • the methods involve comparing, individually, the peak levels to a threshold value, thereby determining a likelihood that a subject will achieve a durable response to the administration of the genetically engineered cells.
  • the subject is likely to achieve a response or a durable response if the peak levels of the one or more inflammatory marker is below a threshold value and the subject is not likely to achieve a durable response if the peak levels of the one or more inflammatory marker are above a threshold value.
  • the subject is likely to achieve a durable response if the peak level of the genetically engineered cells is within a therapeutic range between a lower threshold value and an upper threshold value and the subject is not likely to achieve a durable response if the peak level of the genetically engineered cells is below the lower threshold value or is above the upper threshold value.
  • the threshold value is a value that: is within 25%, within 20%, within 15%, within 10%, or within 5% above the average value of the volumetric measure or inflammatory marker and/or is within a standard deviation above the average value of the volumetric measure or the inflammatory marker in a plurality of control subjects. In some embodiments, the threshold value is a value that: is above the highest value of the volumetric measure or inflammatory marker, optionally within 50%, within 25%, within 20%, within 15%, within 10%, or within 5% above such highest fold change, measured in at least one subject from among a plurality of control subjects.
  • the threshold value is a value that: is above the highest value of the volumetric measure or inflammatory marker as measured among more than 75%, 80%, 85%, 90%, or 95%, or 98% of subjects from a plurality of control subjects.
  • the plurality of control subjects are a group of subjects prior to receiving a dose of the genetically engineered cells, wherein: each of the control subjects of the group exhibited a peak CAR+ T cells in the blood greater than the highest peak CAR+ T cells in the therapeutic range; each of the control subjects of the group went on to develop at toxicity, optionally a neurotoxicity or cytokine release syndrome (CRS), a grade 2 or grade 3 or higher neurotoxicity or a grade 3 or higher CRS, after receiving a dose of the engineered cells for treating the same disease or condition; each of the control subjects of the group did not develop a response, optionally a complete response (CR) or partial response (PR), following
  • the methods also involve administering an agent or an alternative therapy, based on the assessment of the likelihood of achieving a response or a durable response.
  • the subject is selected for treatment with a therapeutic agent or with an alternative therapeutic treatment other than the genetically engineered cells.
  • a therapeutic agent or an alternative therapeutic treatment other than the genetically engineered cells is administered to the subject.
  • the methods involve selecting a subject having received administration of genetically engineered cells comprising T cells expressing a chimeric antigen receptor (CAR) in which: peak levels of one or more inflammatory markers in a sample from the subject is above a threshold value; and/or peak level of T cells comprising a chimeric antigen receptor (CAR) in a sample from the subject is below a lower threshold value or is above an upper threshold value.
  • CAR chimeric antigen receptor
  • the response is a complete response (CR), objective response (OR) or partial response (PR). In some embodiments, the response is durable for at or greater than 3 months, 4 months, 5 months, or 6 months.
  • the peak levels are assessed and/or the sample is obtained from the subject at a time that is at least 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 15 days, 16 days, 17 days, 18 days, 19 days, 20 days or 21 days after initiation of administration of the genetically engineered cells. In some embodiments, the peak levels are assessed and/or the sample is obtained from the subject at a time that is between or between about 11 to 22 days, 12 to 18 days or 14 to 16 days, each inclusive, after initiation of administration of the genetically engineered cells.
  • the peak level is or includes the peak level of one or more inflammatory markers, e.g., C reactive protein (CRP), IL-2, IL-6, IL-10, IL-15, TNF-alpha, MIP-lalpha, MIP-lbeta, MCP-l, CXCL10 or CCL13.
  • CRP C reactive protein
  • the peak level of one or more inflammatory marker is assessed and the threshold value is within 25%, within 20%, within 15%, within 10% or within 5% and/or is within a standard deviation of the median or mean of the peak level of the inflammatory marker as determined among a group of control subjects having received administration of the genetically engineered cells, wherein each of the subjects of the group did not achieve a durable response, optionally a CR and/or PR, optionally at or greater than 3 months or 6 months following administration of the genetically engineered cells.
  • the control subjects exhibited stable disease (SD) or progressive disease (PD) following administration of the genetically engineered cells, optionally at or greater than 3 months or 6 months following administration of the genetically engineered cells.
  • the peak level is a peak level of CAR+ T cells, or a CD8+ T cell subset thereof.
  • the lower threshold value and upper threshold value is the lower and upper end, respectively, of a therapeutic range of peak CD3+ CAR+ T cells, or a CD8+CAR+ T cell subset thereof, in the blood among one or more subjects previously treated with the genetically engineered cells that is associated with an estimated probability of response of greater than or greater than about 65% and an estimated probability of a toxicity of less than or about 30%.
  • the therapeutic range is the range in which the estimated probability of toxicity is less than at or about 20%, less than at or about 15%, less than at or about 10% or less than at or about 5% and the estimated probability of achieving a response is greater than at or about 65%, greater than at or about 70%, greater than at or about 75%, greater than at or about 80%, greater than at or about 85%, greater than at or about 90%, greater than at or about 95% or more.
  • the probability of response is based on a response that is a complete response (CR), an objective response (OR) or a partial response (PR), optionally wherein the response is durable, optionally durable for at or at least 3 months or at or at least 6 months.
  • CR complete response
  • OR objective response
  • PR partial response
  • number, level or peak CAR+ T cells is determined as the number of CAR+ T cells per microliter in the blood of the subject.
  • the upper threshold value is between at or about 300 cells per microliter and at or about 1000 cells per microliter, or between at or about 400 cells per microliter and at or about 600 cells per microliter, or is at or about 300 cells per microliter, 400 cells per microliter, 500 cells per microliter, 600 cells per microliter, 700 cells per microliter, 800 cells per microliter, 900 cells per microliter or 1000 cells per microliter; or the lower threshold value is less than or less than about 10 cells per microliter, 9 cells per microliter, 8 cells per microliter, 7 cells per microliter, 6 cells per microliter, 5 cells per microliter, 4 cells per microliter, 3 cells per microliter, 2 cells per microliter or 1 cell per microliter.
  • the method achieves an increase in the percentage of subjects achieving a durable response, optionally a complete response (CR) or objective response (OR) or a partial response (PR), optionally that is durable for at or greater than 3 months or at or greater than 6 months, compared to a method that does not comprise administering the agent.
  • a durable response optionally a complete response (CR) or objective response (OR) or a partial response (PR)
  • PR partial response
  • the increase is greater than or greater than about 1.2-fold, 1.5-fold, 2-fold, 3-fold, 4-fold, 5-fold,
  • At least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40% or at least 50% of subjects treated according to the method achieve a complete response (CR) that is durable for at or greater than 3 months or at or greater than 6 months; and/or at least 25%, at least 30%, at least 40%, at least 50%, at least 60% or at least 70% of the subjects treated according to the method achieve objective response (OR) that is durable for at or greater than 3 months or at or greater than 6 months.
  • CR complete response
  • OR objective response
  • greater than or greater than about 50%, greater than or greater than about 60%, greater than or greater than about 70%, or greater than or greater than about 80% of the subjects treated according to the method do not exhibit a grade 3 or greater cytokine release syndrome (CRS) and/or do not exhibit a grade 2 or greater or grade 3 or greater neurotoxicity; or greater than or greater than about 40%, greater than or greater than about 50% or greater than or greater than about 55% of the subjects treated according to the method do not exhibit any neurotoxicity or CRS.
  • CRS cytokine release syndrome
  • the parameters are assessed prior to administration of the therapy, e.g., cell therapy.
  • the parameters such as attributes, factors, characteristic of the patient and/or the disease or condition, and/or expression of biomarkers, are assessed after administration of the therapy, e.g., cell therapy.
  • the parameters include levels or measurements, e.g., peak levels, of attributes, factors, characteristic of the patient and/or the disease or condition, and/or expression of biomarkers, that can be assessed after administration of the therapy, e.g., cell therapy.
  • the parameter is a parameter related to tumor burden, e.g., a measurement of tumor burden.
  • the methods also involve further monitoring the subject for possible symptoms of toxicity based on the risk of toxicity determined by assessment of the presence or absence of the biomarker and/or comparison of the biomarkers to a reference value or threshold level of the biomarker.
  • the parameter is SPD and in some cases, development of toxicity, e.g., CRS or NT, is correlated with the SPD value that is above a threshold value.
  • the volumetric measure is SPD, and the threshold value is or is about 30 cm ,is or is about 40 cm , is or is about 50 cm , is or is about 60 cm , or is or is about 70 cm .
  • the volumetric measure is SPD and the threshold value is or is about 30 cm , is or is about 40 cm , is or is about 50 cm , is or is about 60 cm , or is or is about 70 cm .
  • the parameter is LDH and in some cases, development of toxicity, e.g., CRS or NT, is correlated with the LDH value that is above a threshold value.
  • the inflammatory marker is LDH and the threshold value is or is about 300 units per liter, is or is about 400 units per liter, is or is about 500 units per liter or is or is about 600 units per liter.
  • the provided embodiments involve administering an agent capable of modulating CAR+ T cell expansion, proliferation, and/or activity to the subject, based on assessment of pharmacokinetic (PK) parameters.
  • the pharmacokinetic parameters include any of those described herein, e.g., in Section II.C.
  • the pharmacokinetic parameters include maximum (peak) plasma concentration (C max ), the peak time ( i.e . when maximum plasma concentration (C max ) occurs; T max ), the minimum plasma concentration (i.e. the minimum plasma concentration between doses of a therapeutic agent, e.g., CAR+ T cells; C min ), the elimination half-life (Ti /2 ) and area under the curve (i.e. the area under the curve generated by plotting time versus plasma concentration of the therapeutic agent CAR+ T cells; AUC), following administration.
  • the subject can be administered an agent capable of modulating CAR+ T cell expansion,
  • the therapeutic range and/or window is any described herein and/or is associated with any pharmacokinetic parameters described herein.
  • a pharmacokinetic parameter e.g., peak number of CAR+ T cells in the blood of the subject
  • the lowest number of the pharmacokinetic parameter e.g., peak number of CAR+ T cells in the blood of the subject in the therapeutic range
  • a pharmacokinetic parameter e.g., peak number of CAR+ T cells in the blood of the subject
  • the highest number of the pharmacokinetic parameter e.g., peak number of CAR+ T cells in the blood of the subject in the therapeutic range
  • the agent is administered after assessment of pharmacokinetic parameters, e.g., peak CAR+ T cell concentration, exposure (e.g., AUC) and/or cell level or concentration.
  • pharmacokinetic parameters e.g., peak CAR+ T cell concentration, exposure (e.g., AUC) and/or cell level or concentration.
  • the provided embodiments involve assessing and/or monitoring pharmacokinetic parameters, e.g., number or concentration of CAR+ T cells in the blood.
  • the methods involve monitoring CAR+ T cell numbers and/or concentration in the blood of the subject to assess if the cells are within a therapeutic range and/or window.
  • the methods involve administering an agent to the subject capable of modulating CAR+ T cell expansion, optionally increasing or decreasing CAR+ T cell expansion, in the subject, if the subjects are not within the therapeutic range.
  • the therapeutic range and/or window is determined and/or based upon any criteria based on the assessment of the parameters described herein.
  • the therapeutic range and/or window is based upon the range of peak CD3+
  • CAR+ T cells or a CD8+CAR+ T cell subset thereof, in the blood among one or more subjects previously treated with the genetically engineered cells that is associated with an estimated probability of response of greater than or greater than about 65% and an estimated probability of a toxicity of less than or about 30%; or peak CD3+CAR+ T cells in the blood, following administration of the genetically engineered cells, that is between at or about 10 cells per microliter and at or about 500 cells per microliter; or peak CD8+CAR+ T cells in the blood, following administration of the genetically engineered cells, that is between at or about 2 cells per microliter and at or about 200 cells per microliter.
  • the provided embodiments involve assessing parameters, such as attributes, factors, characteristic of the patient and/or the disease or condition, and/or expression of biomarkers.
  • the assessed parameters are associated with and/or correlated with pharmacokinetic parameters, response, durable response and/or development of toxicity.
  • the parameters include patient factors or patient attributes.
  • the parameters include attributes, factors, characteristic of the disease or condition.
  • the parameters are assessed prior to treatment, e.g., prior to administration of the cell therapy.
  • the parameters are assessed after treatment, e.g., after administration of one or more doses of the cell therapy.
  • the parameter is or includes pharmacokinetic parameters, e.g., maximum (peak) plasma concentration (C max ), the peak time (i.e. when maximum plasma concentration (C max ) occurs; T max ), the minimum plasma concentration (i.e. the minimum plasma concentration between doses of a therapeutic agent, e.g., CAR+ T cells; C min ), the elimination half-life (Ti /2 ) and area under the curve (i.e. the area under the curve generated by plotting time versus plasma concentration of the therapeutic agent CAR+ T cells; AUC; such as AUCo is) ⁇
  • pharmacokinetic parameters e.g., maximum (peak) plasma concentration (C max ), the peak time (i.e. when maximum plasma concentration (C max ) occurs; T max ), the minimum plasma concentration (i.e. the minimum plasma concentration between doses of a therapeutic agent, e.g., CAR+ T cells; C min ), the elimination half-life (Ti /2 ) and area under the curve (i.e. the
  • the parameter is or includes one or more factors indicative of the state of the patient and/or the disease or condition of the patient.
  • the parameter is indicative of tumor burden.
  • the factor indicative of tumor burden is a volumetric measure of tumor(s).
  • the volumetric measure is a measure of the lesion(s), such as the tumor size, tumor diameter, tumor volume, tumor mass, tumor load or bulk, tumor-related edema, tumor-related necrosis, and/or number or extent of metastases.
  • the volumetric measure of tumor is a bidimensional measure.
  • the area of lesion(s) are calculated as the product of the longest diameter and the longest perpendicular diameter of all measurable tumors.
  • the volumetric measure of tumor is a unidimensional measure.
  • the size of measurable lesions is assessed as the longest diameter.
  • the sum of the products of diameters (SPD), longest tumor diameters (LD), sum of longest tumor diameters (SLD), necrosis, tumor volume, necrosis volume, necrosis-tumor ratio (NTR), peritumoral edema (PTE), and edema-tumor ratio (ETR) is measured.
  • Exemplary methods for measuring and assessing tumor burden include those described in, e.g., Carceller et al., Pediatr Blood Cancer. (2016) 63(8): 1400-1406 and
  • the volumetric is a sum of the products of diameters (SPD) measured by determining the sum of the products of the largest perpendicular diameters of all measurable tumors.
  • the tumor or lesion are measured in one dimension with the longest diameter (LD) and/or by determining the sum of longest tumor diameters (SLD) of all measurable lesions.
  • the volumetric measure of tumor is a volumetric quantification of tumor necrosis, such as necrosis volume and/or necrosis-tumor ratio (NTR), see Monsky et al., Anticancer Res. (2012) 32(11): 4951-4961.
  • the volumetric measure of tumor is a volumetric quantification of tumor-related edema, such as peritumoral edema (PTE) and/or edema- tumor ratio (ETR).
  • measuring can be performed using imaging techniques such as computed tomography (CT), positron emission tomography (PET), and/or magnetic resonance imaging (MRI) of the subject.
  • CT computed tomography
  • PET positron emission tomography
  • MRI magnetic resonance imaging
  • the volumetric measure is SPD and in some cases, development of toxicity, e.g., CRS or NT, is correlated with the SPD value that is above a threshold value.
  • the volumetric measure is SPD, and the threshold value is or is about 30 cm , is or is about 40 cm , is or is about 50 cm , is or is about 60 cm , or is or is about 70 cm .
  • the volumetric measure is SPD and the threshold value is or is about 30 cm , is or is about 40 cm , is or is about 50 cm , is or is about 60 cm , or is or is about 70 cm 2 .
  • the volumetric measure of tumor is determined at a screening session, such as a routine assessment or blood draw to confirm and/or identify the condition or disease in the subject.
  • the parameter e.g., measurements of tumor burden
  • the parameter, including pharmacokinetic parameters is associated with response and/or durable response, and/or a risk for developing toxicity, e.g., CRS or neurotoxicity (NT).
  • the parameter is or includes at least one or a panel of biomarkers.
  • expression and/or presence of the biomarker is associated with and/or correlated with pharmacokinetic parameters, response, durable response and/or development of toxicity.
  • the parameter is compared to a particular reference value, e.g., those associated with response and/or durable response, and/or a risk for developing toxicity, e.g., CRS or neurotoxicity (NT).
  • the methods also involve administering an agent capable of modulating CAR+ T cell expansion, proliferation, and/or activity, to the subject, based on the assessment of patient factors and/or biomarkers.
  • the presence or absence of one or a panel of biomarkers and/or concentration, amount, level or activity associated with one or a panel of biomarkers can be assessed.
  • the parameters can be compared to a particular reference value, such as a threshold level, e.g., those associated with a risk for developing toxicity or those associated with a particular response, such as OR, CR or PR, or durable response, such as a response that is durable for 3 months, 6 months, 9 months 12 months or more, after the initial response.
  • the methods also involve selecting subjects for treatment with a cell therapy based on the assessment of the presence or absence of the biomarker and/or comparison of the biomarkers to a reference value or threshold level of the biomarker. In some embodiments, the methods also involve administering an agent or a therapy that can treat, prevent, delay and/or attenuate development of the toxicity, e.g., based on the assessment of the presence or absence of the biomarker and/or comparison of the biomarkers to a reference value or threshold level of the biomarker.
  • the embodiments involve obtaining a biological sample for detecting the parameter and/or assessing the presence of and/or or detecting the parameter.
  • the biological sample is obtained generally within 4 hours to 12 months of administration of the cell therapy, or a first administration or dose thereof, or after the initiation of any of the foregoing, such as generally within or within at or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 21, 28, 30, 60 or 90 or more days, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more weeks, or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 18, 24, 48 or more months, after
  • the parameter is assessed or measured in a subject prior to administration of the cell therapy or soon after administration of the cell therapy, or a first administration or dose thereof, or after the initiation of any of the foregoing , such as generally within 4 hours to 3 days of administration of the cell therapy, or a first administration or dose thereof, or after the initiation of any of the foregoing, such as generally within at or about 1 day, 2 days or 3 days after administration of the cell therapy, or a first administration or dose thereof, or after the initiation of any of the foregoing.
  • the parameter is assessed or measured.
  • the parameter is assessed generally within 4 hours to 12 months of administration of the cell therapy, or a first administration or dose thereof, or after the initiation of any of the foregoing, such as generally within or within at or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 21, 28, 30, 60 or 90 or more days, 2, 3, 4, 5, 6, 7, 8, 9, 10,
  • the parameter e.g., patient factor and/or biomarker
  • the parameter including pharmacokinetic parameters, is associated with response and/or durable response, and/or a risk for developing toxicity, e.g., CRS or neurotoxicity (NT).
  • the parameter is a biomarker.
  • the parameter is or includes the expression of the biomarker and/or the number, concentration, and/or percentage of cells that express a particular biomarker.
  • the parameter includes biomarkers or each biomarker in a panel that comprises a plurality of biomarkers.
  • the biomarker is or comprises a cytokine and/or other serum or blood factor, such as any as described herein.
  • the biomarker or each biomarker in a panel is a cytokine, which, in some cases, can be a chemokine.
  • the biomarkers or each biomarker in a panel comprises a soluble receptor.
  • the biomarkers or each biomarker in a panel comprises a soluble serum protein. Exemplary biomarkers or panel of biomarkers is described herein.
  • a biological sample e.g., blood sample or tissue sample from the subject
  • a biological sample can be obtained for detecting the presence or absence of a biomarker, such as for detecting or measuring a parameter (e.g. concentration, amount, level or activity) of the biomarker and/or assessing the presence of a biomarker, for analysis, correlation and/or detection of particular outcomes and/or toxicities.
  • a parameter e.g. concentration, amount, level or activity
  • certain physiological or biological parameters associated with a biomarker including expression of biomarkers and/or clinical and laboratory parameters, can be assessed, from a biological sample, e.g., blood, from subjects before or after administration of the cell therapy.
  • expression biomarkers and/or clinical and laboratory parameters can be assessed from a biological sample, e.g., blood, from subjects before administration of the cell therapy (pre-treatment).
  • expression biomarkers or analytes and/or clinical and laboratory parameters can be assessed from a biological sample, e.g., blood, from subjects after administration of the cell therapy (post-treatment).
  • the concentration, amount, level or activity of biomarkers and/or clinical and laboratory parameters can be assessed at one or more time points before or after administration of the cell therapy.
  • the peak concentration, amount, level or activity of biomarkers and/or clinical and laboratory parameters during a specified period of time can also be determined.
  • a biomarker in some cases, also called an analyte
  • parameters associated with a biomarker or an analyte is an objectively measurable characteristic or a molecule expressed by or in a biological sample, including cells, that can be indicative of or associated with a particular state or phenomenon, such as a biological process, a therapeutic outcome, a cell phenotype or a diseased state.
  • a biomarker or parameters associated with a biomarker can be measured or detected. For example, the presence or absence of expression of a biomarker, can be detected.
  • the parameters such as concentration, amount, level or activity of the biomarker can be measured or detected.
  • the presence, absence, expression, concentration, amount, level and/or activity of the biomarker can be associated with, correlated to, indicative of and/or predictive of particular states, such as particular therapeutic outcomes or state of the subject.
  • the presence, absence, expression, concentration, amount, level and/or activity of the biomarker can be used to assess the likelihood of a particular outcome or state, such as a particular therapeutic outcome, including response outcome or toxicity outcome.
  • exemplary biomarkers include cytokines, cell surface molecules, chemokines, receptors, soluble receptors, soluble serum proteins and/or degradation products.
  • biomarkers can also include particular attributes, factors, characteristic of the patient and/or the disease or condition or factors indicative of the state of the patient and/or the disease or condition of the patient (including disease burden), and/or clinical or laboratory parameters.
  • the parameter is or includes levels and/or concentrations of a blood analyte. In some embodiments, the parameter is or includes levels and/or concentrations of an inflammatory marker. In some embodiments, the blood analyte and/or inflammatory marker is or includes levels and/or concentrations of interleukin-7 (IL-7), IL-15, macrophage inflammatory protein (MIP-la).
  • IL-7 interleukin-7
  • MIP-la macrophage inflammatory protein
  • the blood analyte and/or inflammatory marker is or includes levels and/or concentrations of IL-6, IL-10, IL-16, interferon gamma (IFN- g), tumor necrosis factor alpha (TNF-a), MIP-la, MIR-Ib, Monocyte chemoattractant protein-l (MCP-l), and C-X-C motif chemokine 10 (CXCL10).
  • IFN- g interferon gamma
  • TNF-a tumor necrosis factor alpha
  • MIP-la tumor necrosis factor alpha
  • MIP-la MIR-Ib
  • MCP-l Monocyte chemoattractant protein-l
  • CXCL10 C-X-C motif chemokine 10
  • the blood analyte and/or inflammatory marker is or includes levels and/or concentrations of ferritin, C-reactive protein (CRP), D-dimer (fibrin degradation product), IL-6, IL-10, IL-15, IL-16, TNF-a, MIP-la, and MIR-1b.
  • the blood analyte and/or inflammatory marker is or includes levels and/or concentrations of LDH, Ferritin, CRP, IL-6, IL-8, IL-10, TNF-a, IFN- a2, MCP-l and/or MP b.
  • the blood analyte and/or inflammatory marker is or includes levels and/or concentrations of CRP, Serum Amyloid Al (SAA-l), IL-2, IL-6, IL- 10, IL-15, TNF-a, MIP-la, MIR-Ib, MCP-l, CXCL10 and C-C Motif Chemokine Ligand 13 (CCL13).
  • the blood analyte and/or inflammatory marker is or includes levels and/or concentrations of LDH, ferritin, CRP, D-dimer, SAA-l, IL-6, IL-10, IL-15, IL-16, TNF-a, IFN-g and/or MIP-la.
  • an inflammatory marker is or includes the level or presence of C-reactive protein (CRP), erythrocyte sedimentation rate (ESR), albumin, ferritin, b2
  • CRP C-reactive protein
  • ESR erythrocyte sedimentation rate
  • albumin albumin
  • ferritin ferritin
  • microglobulin b2-M
  • lactate dehydrogenase LDH
  • the inflammatory marker is assessed using an immune assay.
  • an enzyme-linked immunosorbent assay ELISA
  • enzyme immunoassay EIA
  • radioimmunoassay RIA
  • SPR surface plasmon resonance
  • the reagent is a soluble protein that binds the inflammatory marker.
  • the reagent is a protein that binds C-reactive protein (CRP), erythrocyte sedimentation rate (ESR), albumin, ferritin, b2 microglobulin (b2-M), or lactate dehydrogenase (LDH).
  • the biomarker e.g., inflammatory marker is or includes C- reactive protein (CRP).
  • CRP C- reactive protein
  • CRP is assessed using an in vitro enzyme-linked immunosorbent assay to obtain a quantitative measurement of human CRP from a sample such as serum, plasma, or blood.
  • CRP is detected using a human Enzyme- Linked Immunosorbent Assay (ELISA).
  • ELISA human Enzyme- Linked Immunosorbent Assay
  • the biomarker, e.g. inflammatory marker is or includes erythrocyte sedimentation rate (ESR).
  • ESR is assessed by measuring the distance (in millimeters per hour) that red cells have fallen after separating from the plasma in a vertical pipette or tube.
  • the biomarker is or includes albumin.
  • albumin is assessed using a colorimetric test or an in vitro enzyme-linked immunosorbent assay.
  • albumin is detected using a human Enzyme- Linked Immunosorbent Assay (ELISA).
  • ELISA Enzyme- Linked Immunosorbent Assay
  • the biomarker, e.g., inflammatory marker is or includes ferritin or b2 microglobulin.
  • ferritin or b2 microglobulin is assessed using an immunoassay or detected using an ELISA.
  • the biomarker, e.g., inflammatory marker is or includes lactate dehydrogenase (LDH), and LDH is assessed using a colorimetric test or an in vitro enzyme-linked
  • the one or more biomarkers include two or more biomarkers, e.g., cytokines, such as inflammatory cytokines, and/or patient attributes, e.g., tumor burden and/or expression of inflammatory markers.
  • the two or more biomarkers are measured simultaneously from the same sample. In other aspects, the two or more biomarkers are measured or sequentially from the same sample or from different samples from the subject.
  • the level, amount, concentration or other parameter of the biomarker or the panel of biomarkers are indicative of pharmacokinetic parameters of the cells, e.g., maximum (peak) plasma concentration (C max ), the peak time (i.e. when maximum plasma concentration (C max ) occurs; T max ), the minimum plasma concentration (i.e. the minimum plasma concentration between doses of a therapeutic agent, e.g., CAR+ T cells; C min ), the elimination half-life (Ti /2 ) and area under the curve (i.e.
  • the level, amount, concentration of the biomarker or the panel of biomarkers are indicative of the risk of developing a toxicity, e.g., neurotoxicity, such as severe neurotoxicity and/or CRS, such as sCRS. In some embodiments, the level, amount,
  • concentration of the biomarker or the panel of biomarkers are indicative of, correlate with and/or associate with the likelihood and/or probability of response, e.g., objective response (OR), complete response (CR) or partial response (PR), or durable response, e.g., 3-month response.
  • OR objective response
  • CR complete response
  • PR partial response
  • durable response e.g., 3-month response.
  • the parameter is or includes levels, concentrations and/or numbers pf C-reactive protein (CRP), erythrocyte sedimentation rate (ESR), albumin, ferritin, b2 microglobulin (b2-M), lactate dehydrogenase (LDH) and/or is an inflammatory cytokine.
  • the inflammatory marker is LDH.
  • the level, concentration and/or number of LDH is a surrogate for disease burden, e.g., for tumors or cancers, and may be useful for potential neurotoxicity risk assessment and/or risk-adapted dosing or adjustment of treatment of certain subjects.
  • LDH levels may be assessed alone and/or in combination with another pre-treatment parameter, such as another measure or indicator of disease burden, such as a volumetric tumor measurement such as sum of product dimensions (SPD) or other CT-based or MRI-based volumetric measurement of disease burden, such as any described herein.
  • another pre-treatment parameter such as another measure or indicator of disease burden, such as a volumetric tumor measurement such as sum of product dimensions (SPD) or other CT-based or MRI-based volumetric measurement of disease burden, such as any described herein.
  • another pre-treatment parameter such as another measure or indicator of disease burden, such as a volumetric tumor measurement such as sum of product dimensions (SPD) or other CT-based or MRI-based volumetric measurement of disease burden, such as any described herein.
  • one or more parameters indicative of disease burden are assessed, and in some contexts may indicate the presence, absence or degree of risk of developing neurotoxicity following the T cell therapy.
  • the one or more parameters include LDH and/or a volumetric tumor measurement.
  • the parameter is SPD and
  • the parameter is a patient attribute, factor and/or
  • the parameter is a pre-treatment measurement, e.g., a baseline measurement, a pre-infusion measurement and/or a pre-lymphodepletion measurement.
  • the parameter is assessed before treatment, e.g., before administration of the cell therapy, or a first administration or dose thereof, or after the initiation of any of the foregoing and/or lymphodepletion prior to cell therapy. In some embodiments, the parameter is assessed prior to lymphodepletion.
  • the parameter is assessed prior to administration of the cell therapy (e.g., pre-infusion), e.g., obtained up to 2 days, up to 7 days, up to 14 days, up to 21 days, up to 28 days, up to 35 days or up to 40 days prior to initiation of the administration of the engineered cells.
  • the reagents can be used prior to the administration of the cell therapy or after the administration of cell therapy, for diagnostic purposes, to assess parameters such as a patient attribute, factor and/or characteristics.
  • the pre-treatment measurement is or includes the level and/or concentration of C-reactive protein (CRP), D-dimer (fibrin degradation product), Ferritin, IFN- a2, IFN-g, IL-6, IL-7, IL-8, IL-10, IL-15, IL-16, lactate dehydrogenase (LDH), macrophage inflammatory protein (MIR-Ia), MIR-Ib, MCP-l, SAA-l and/or TNF-a.
  • CRP C-reactive protein
  • D-dimer fibrin degradation product
  • Ferritin IFN- a2
  • IFN-g IFN-g
  • IL-6 interleukin-6
  • IL-7 interleukin-8
  • IL-10 interleukin
  • IL-15 interleukin-15
  • IL-16 lactate dehydrogenase
  • LDH lactate dehydrogenase
  • MIR-Ia macrophage inflammatory protein
  • MIR-Ib macrophage inflammatory
  • higher or lower pre-treatment measurement of one or more of the parameters is correlated to and/or is associated with higher or lower pharmacokinetic parameters, e.g., C max or AUC, of CAR+ T cells and/or higher or lower rate and/or incidence of toxicity, e.g., CRS or NT, such as severe CRS or severe NT.
  • higher or lower pre-treatment measurement of one or more of the parameters is correlated to and/or is associated with higher or lower response, e.g., ORR including CR and PR, and/or higher or lower durability of response, e.g., 3-month response.
  • higher pre-treatment measurement of one or more of the parameters is correlated to and/or is associated with higher pharmacokinetic parameters, e.g., C max or AUC, of CAR+ T cells and/or higher rate and/or incidence of toxicity, e.g., CRS or NT, such as severe CRS or severe NT.
  • the parameter is or includes a post-treatment measurement, e.g., a peak or maximum measurement after administration of the therapy, e.g., cell therapy, and/or a post-infusion measurement and/or measurement after administration of the cell therapy, or a first administration or dose thereof, or after the initiation of any of the foregoing.
  • a post-treatment measurement e.g., a peak or maximum measurement after administration of the therapy, e.g., cell therapy, and/or a post-infusion measurement and/or measurement after administration of the cell therapy, or a first administration or dose thereof, or after the initiation of any of the foregoing.
  • the peak measurement is or includes the peak or maximum value within a period of time after a certain amount of time after administration of the cell therapy and/or initiation thereof, such as within or within at or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 21, 28, 30, 60 or 90 or more days, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more weeks, or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 18, 24, 48 or more months, after administration of the cell therapy, or a first administration or dose thereof, or after the initiation of any of the foregoing.
  • the parameter is or includes peak level and/or concentration of inflammatory markers, including cytokines or chemokines.
  • lower peak measurements of one or more of the parameters is correlated to and/or is associated with higher pharmacokinetic parameters, e.g., C max or AUC, of CAR+ T cells and/or higher rate and/or incidence of toxicity, e.g., CRS or NT, such as severe CRS or severe NT.
  • C max or AUC pharmacokinetic parameters
  • CRS or NT such as severe CRS or severe NT.
  • lower pre-treatment measurement of one or more of the parameters is correlated to and/or is associated with response, e.g., ORR including CR and PR, and/or lower durability of response, e.g., 3-month response.
  • response e.g., ORR including CR and PR
  • lower durability of response e.g., 3-month response.
  • the parameter is or includes peak level and/or concentration of inflammatory markers, including cytokines or chemokines.
  • the parameter is or includes peak level and/or concentration of biomarkers, including C-C Motif Chemokine Ligand 13 (CCL13), C-reactive protein (CRP), C-X-C motif chemokine 10
  • CXCL10 interferon gamma
  • Lympho toxin- alpha LT-a
  • Monocyte chemoattractant protein- 1 MCP-l
  • macrophage inflammatory protein 1 alpha MIR-Ia
  • MIR-Ib MIR-Ib
  • Serum Amyloid Al SAA-l
  • TGF-b Transforming growth factor beta
  • TNF-a tumor necrosis factor alpha
  • higher peak levels and/or concentrations of one or more of the parameters is correlated to and/or is associated with higher rate and/or incidence of toxicity, e.g., CRS or NT, such as severe CRS or severe NT.
  • lower peak levels and/or concentrations is correlated to and/or is associated with higher response, e.g., ORR including CR and PR, and/or higher durability of response, e.g., 3-month response.
  • the biomarkers include those associated with increased pharmacokinetic (PK) parameters of the cell, e.g., increased maximum serum concentration of cell (C max ) or increased exposure (e.g., area under the curve (AUC)).
  • PK pharmacokinetic
  • C max maximum serum concentration of cell
  • AUC area under the curve
  • the biomarkers (e.g. analytes), including parameters thereof, include IL-7, IL-15, MIP-la and TNF-a.
  • the biomarkers include those associated with a response outcome, and/or a durable response.
  • the biomarkers e.g., analytes
  • analytes including parameters thereof, include LDH, ferritin, CRP, D-dimer, Serum Amyloid Al (SAA-l), IL-6, IL-10, IL-15, IL-16, TNF-a, IFN-g, MIP-la and C-X-C motif chemokine 10 (CXCL10).
  • the threshold value is a value that: is within 25%, within 20%, within 15%, within 10%, or within 5% above the average value of the volumetric measure or inflammatory marker and/or is within a standard deviation above the average value of the volumetric measure or the inflammatory marker in a plurality of control subjects. In some embodiments, the threshold value is a value that: is above the highest value of the volumetric measure or inflammatory marker, optionally within 50%, within 25%, within 20%, within 15%, within 10%, or within 5% above such highest fold change, measured in at least one subject from among a plurality of control subjects.
  • the threshold value is a value that: is above the highest value of the volumetric measure or inflammatory marker as measured among more than 75%, 80%, 85%, 90%, or 95%, or 98% of subjects from a plurality of control subjects.
  • the plurality of control subjects are a group of subjects prior to receiving a dose of the genetically engineered cells, wherein: each of the control subjects of the group exhibited a peak CAR+ T cells in the blood greater than the highest peak CAR+ T cells in the therapeutic range; each of the control subjects of the group went on to develop at toxicity, optionally a neurotoxicity or cytokine release syndrome (CRS), a grade 2 or grade 3 or higher neurotoxicity or a grade 3 or higher CRS, after receiving a dose of the engineered cells for treating the same disease or condition; each of the control subjects of the group did not develop a response, optionally a complete response (CR) or partial response (PR), following administration of the dose of genetically engineered cells; and/or each of the control subjects of
  • the parameters can be assessed for particular subjects or in particular samples, and can be compared to a threshold value (also referred to in some cases as threshold level). In some aspects, such comparison can be used to calculate or assess the likelihood for response or risk of toxicity to a therapy, such as a cell therapy.
  • a threshold value also referred to in some cases as threshold level.
  • such comparison can be used to calculate or assess the likelihood for response or risk of toxicity to a therapy, such as a cell therapy.
  • parameters, such as attributes, factors, characteristic of the patient and/or the disease or condition, and/or expression of biomarkers, that are above or below a certain threshold value can be associated with, correlated with, predictive of or indicative of particular outcomes of a therapy, such as a response outcome or a toxicity outcome.
  • exemplary threshold values can be determined based on the mean or median values and values within a range or standard deviation of the mean or median values of the level, amount or concentration of the biomarker in a biological sample obtained from a group of subjects prior to receiving a cell therapy, wherein each of the subjects of the group went on to exhibit a particular outcome, such as a particular therapeutic outcome, including either exhibiting a response or not exhibiting a response; or either developing a toxicity or not developing a toxicity.
  • the biomarker is associated with, correlated to, indicative of and/or predictive of a particular outcome, such as a particular response outcome, such as an objective response (OR) a complete response (CR) or a partial response (PR), or durable response, such as an OR or CR or a PR that is durable at 3, 6, 9 months or more.
  • a particular response outcome such as an objective response (OR) a complete response (CR) or a partial response (PR), or durable response, such as an OR or CR or a PR that is durable at 3, 6, 9 months or more.
  • lower or reduced levels or increased levels of one or more of such biomarkers can be associated with the a response, such as an OR, CR or PR, or any response outcomes described herein, e.g., in Section II.B, optionally a durable response, such as a response that is durable for at least 3 months, 6 months or more.
  • the biomarker is associated with, correlated to, indicative of and/or predictive of a particular outcome, such as a particular response or durable response outcome, in a subject that has been administered a cell therapy, such as with a composition containing genetically engineered cells.
  • a cell therapy such as with a composition containing genetically engineered cells.
  • the presence, expression, level, amount or concentration of one or more biomarker in a biological sample obtained from a subject prior to the administration of cell therapy can be associated with, correlated to, indicative of and/or predictive of a particular outcome, such as a particular response or durable response outcome.
  • presence, expression, level, amount or concentration of particular biomarkers can be correlated to a particular response or durable response outcome.
  • the response outcome can be any response outcomes described herein, e.g., in Section II.B.
  • the methods include comparing, individually, the level, amount or concentration of the biomarker in the sample to a threshold value, thereby
  • the methods include selecting a subject who is likely to respond to treatment based on the results of determining a likelihood that a subject will achieve a response to the cell therapy by comparing, individually, the level, amount or concentration of the biomarker in the sample to a threshold value. In some embodiments, the methods also include administering the cell therapy to the subject selected for treatment. In some embodiments, if the subject is determined as not likely to achieve a response or a durable response, further comprising administering an additional therapeutic agent to the subject.
  • the biomarkers include those associated with a response outcome, and/or a durable response.
  • the biomarkers including parameters thereof, include LDH, ferritin, CRP, D-dimer, Serum Amyloid Al (SAA-l), IL-6, IL-10, IL-15, IL-16, TNF-a, IFN-g, MIP-la and C-X-C motif chemokine 10 (CXCL10).
  • exemplary biomarkers or biomarkers that can be assessed or analyzed with respect to assessment of likelihood of response after administration of a cell therapy include one or more biomarker selected from ferritin, LDH, CXCL10, G-CSF, and IL- 10.
  • the subject is likely to achieve a response if the level, amount or concentration of the one or more of the biomarker is below a threshold value and the subject is not likely to achieve a response if the level, amount or concentration of the one or more of the biomarker is above a threshold value.
  • the response is or comprises objective response.
  • the objective response is or comprises complete response (CR) or partial response (PR).
  • CR complete response
  • PR partial response
  • reduced levels of ferritin, LDH, CXCL10, G-CSF, and IL-10, in a biological sample from a subject obtained prior to administration of a cell therapy (pre-treatment) can be associated with achieving objective response, including complete response (CR) or partial response (PR).
  • the threshold value is within 25%, within 20%, within 15%, within 10% or within 5% and/or is within a standard deviation below the median or mean level, amount or concentration of ferritin, LDH, CXCL10, G-CSF, or IL-10 in a biological sample obtained from a group of subjects prior to receiving a cell therapy, wherein each of the subjects of the group went on to achieve a response after administration of a recombinant-receptor- expressing therapeutic cell composition for treating the same disease or condition.
  • the threshold value is within 25%, within 20%, within 15%, within 10% or within 5% and/or is within a standard deviation above the median or mean level, amount or
  • a biological sample obtained from a group of subjects prior to receiving a cell therapy wherein each of the subjects of the group went on to exhibit stable disease (SD) and/or progressive disease (PD) after administration of a recombinant-receptor-expressing therapeutic cell composition for treating the same disease or condition.
  • SD stable disease
  • PD progressive disease
  • exemplary biomarkers or biomarkers that can be assessed or analyzed with respect to assessment of likelihood of durable response after administration of a cell therapy include one or more biomarker selected from LDH, ferritin, CRP, D-dimer, SAA-l, IL-6, IL-10, IL-15, IL-16, TNF-a, IFN-g, MIP-la, CXCL-10, IL-8, MCP-l and MP b.
  • the subject is likely to achieve a durable response if the level, amount or concentration of the one or more of the biomarker is below a threshold value and the subject is not likely to achieve a durable response if the level, amount or concentration of the one or more of the biomarker is above a threshold value.
  • the durable response is or comprises a complete response (CR) or partial response (PR) that is durable for at or greater than 3 months, 4 months, 5 months, or 6 months. In some embodiments, the durable response is or comprises a CR or PR that is durable for at least 3 months.
  • reduced levels of LDH, ferritin, CRP, D-dimer, SAA-l, IL-6, IL-10, IL-15, IL-16, TNF-a, IFN-g, MIP-la, CXCL-10, IL-8, MCP-l and MIR-Ib, in a biological sample from a subject obtained prior to administration of a cell therapy (pre treatment), can be associated with achieving durable response, such as a CR or PR that is durable for at least 3 months.
  • the threshold value is within 25%, within 20%, within 15%, within 10% or within 5% and/or is within a standard deviation below the median or mean level, amount or concentration of LDH, ferritin, CRP, D-dimer, SAA-l, IL-6, IL-10, IL-15, IL-16, TNF-a, IFN-g, MIP-la, CXCL-10, IL-8, MCP-l or MIR-1b in a biological sample obtained from a group of subjects prior to receiving a cell therapy, wherein each of the subjects of the group went on to achieve a durable response after administration of a recombinant-receptor- expressing therapeutic cell composition for treating the same disease or condition.
  • the threshold value is within 25%, within 20%, within 15%, within 10% or within 5% and/or is within a standard deviation above the median or mean level, amount or concentration of LDH, ferritin, CRP, D-dimer, SAA-l, IL-6, IL-10, IL-15, IL-16, TNF-a, IFN-g, MIP-la, CXCL-10, IL-8, MCP-l or MIR-1b in a biological sample obtained from a group of subjects prior to receiving a cell therapy, wherein each of the subjects of the group did not achieve a durable response after administration of a recombinant-receptor- expressing therapeutic cell composition for treating the same disease or condition.
  • the response is durable response, such as a CR or PR that is durable for at least 3 months.
  • the threshold value for LDH is at or at about or below or below about 600 U/L, 500 U/L, 400 U/L, 300 U/L or 200 U/L.
  • exemplary threshold value for ferritin is at or at about or below or below about 1000 pg/L, 900 pg/L, 800 pg/L, 700 pg/L, 600 pg/L, 500 pg/L, 400 pg/L, 300 pg/L or 200 pg/L.
  • exemplary threshold value for CRP is at or at about or below or below about 20 mg/L, 19 mg/L, 18 mg/L, 17 mg/L, 16 mg/L, 15 mg/L, 14 mg/L, 13 mg/L, 12 mg/L, 11 mg/L, 10 mg/L, 9 mg/L, 8 mg/L, 7 mg/L, 6 mg/L or 5 mg/L.
  • exemplary threshold value for D-dimer is at or at about or below or below about 1000 pg/L, 900 pg/L, 800 pg/L, 700 pg/L, 600 pg/L, 500 pg/L, 400 pg/L, 300 pg/L or 200 pg/L.
  • exemplary threshold value for SAA-l is at or at about or below or below about 100 mg/L, 90 mg/L, 80 mg/L, 70 mg/L, 60 mg/L, 50 mg/L, 40 mg/L, 30 mg/L or 20 mg/L.
  • exemplary threshold value for IL-6 is at or at about or below or below about 6 pg/mL, 5 pg/mL, 4 pg/mL, 3 pg/mL or 2 pg/mL.
  • exemplary threshold value for IL-10 is at or at about or below or below about 2 pg/mL, 1 pg/mL, 0.9 pg/mL, 0.8 pg/mL, 0.7 pg/mL, 0.6 pg/mL or 0.5 pg/mL.
  • exemplary threshold value for IL-15 is at or at about or below or below about 7 pg/mL, 6 pg/mL, 5 pg/mL, 4 pg/mL or 3 pg/mL.
  • exemplary threshold value for IL-16 is at or at about or below or below about 1000 pg/mL, 900 pg/mL, 800 pg/mL, 700 pg/mL or 600 pg/mL.
  • exemplary threshold value for TNF-a is at or at about or below or below about 10 pg/mL, 9 pg/mL, 8 pg/mL, 7 pg/mL or 6 pg/mL.
  • exemplary threshold value for IFN-g is at or at about or below or below about 30 pg/mL, 20 pg/mL, 10 pg/mL, 9 pg/mL, 8 pg/mL or 7 pg/mL;
  • exemplary threshold value for MIP-la is at or at about or below or below about 40 pg/mL, 30 pg/mL or 20 pg/mL; and/or
  • exemplary threshold value for CXCL-10 is at or at about or below or below about 1500 pg/mL, 1000 pg/mL, 900 pg/mL, 800 pg/mL, 700 pg/mL, 600 pg/mL or 500 pg/mL.
  • exemplary biomarkers or biomarkers that can be assessed or analyzed with respect to assessment of likelihood of durable response after administration of a cell therapy include one or more biomarker selected from ferritin, CRP, LDH, CXCL10, IL-8, IL-10, IL-15, MCP-l, MIR-1b and TNF-a.
  • the subject is likely to achieve a durable response if the level, amount or concentration of the one or more of the biomarker is below a threshold value and the subject is not likely to achieve a durable response if the level, amount or concentration of the one or more of the biomarker is above a threshold value.
  • the durable response is or comprises a complete response (CR) or partial response (PR) that is durable for at or greater than 3 months, 4 months, 5 months, or 6 months. In some embodiments, the durable response is or comprises a CR or PR that is durable for at least 3 months.
  • reduced levels of ferritin, CRP, LDH, CXCL10, IL-8, IL-10, IL-15, MCP-l, MIR-1b and TNF-a in a biological sample from a subject obtained prior to administration of a cell therapy (pre-treatment), can be associated with achieving durable response, such as a CR or PR that is durable for at least 3 months.
  • the threshold value is within 25%, within 20%, within 15%, within 10% or within 5% and/or is within a standard deviation below the median or mean level, amount or concentration of ferritin, CRP, LDH, CXCL10, IL-8, IL-10, IL-15, MCP-l, MIR-1b or TNF-a in a biological sample obtained from a group of subjects prior to receiving a cell therapy, wherein each of the subjects of the group went on to achieve a durable response after administration of a recombinant-receptor-expressing therapeutic cell composition for treating the same disease or condition.
  • the threshold value is within 25%, within 20%, within 15%, within 10% or within 5% and/or is within a standard deviation above the median or mean level, amount or concentration of ferritin, CRP, LDH, CXCL10, IL-8, IL-10, IL-15, MCP-l, MIR-1b or TNF-a in a biological sample obtained from a group of subjects prior to receiving a cell therapy, wherein each of the subjects of the group did not achieve a durable response after administration of a recombinant-receptor-expressing therapeutic cell composition for treating the same disease or condition.
  • exemplary biomarkers or biomarkers that can be assessed or analyzed with respect to assessment of likelihood of durable response after administration of a cell therapy include one or more biomarker selected from hemoglobin and albumin.
  • the subject is likely to achieve a durable response if the level, amount or concentration of the one or more of the biomarker is above a threshold value and the subject is not likely to achieve a durable response if the level, amount or concentration of the one or more of the biomarker is below a threshold value.
  • the durable response is or comprises a complete response (CR) or partial response (PR) that is durable for at or greater than 3 months, 4 months, 5 months, or 6 months.
  • the durable response is or comprises a CR or PR that is durable for at least 3 months.
  • elevated levels of hemoglobin and albumin, in a biological sample from a subject obtained prior to administration of a cell therapy (pre-treatment) can be associated with achieving durable response, such as a CR or PR that is durable for at least 3 months.
  • the threshold value is within 25%, within 20%, within 15%, within 10% or within 5% and/or is within a standard deviation above the median or mean level, amount or concentration of hemoglobin or albumin in a biological sample obtained from a group of subjects prior to receiving a cell therapy, wherein each of the subjects of the group went on to achieve a durable response after administration of a recombinant-receptor-expressing therapeutic cell composition for treating the same disease or condition.
  • the threshold value is within 25%, within 20%, within 15%, within 10% or within 5% and/or is within a standard deviation below the median or mean level, amount or concentration of hemoglobin or albumin in a biological sample obtained from a group of subjects prior to receiving a cell therapy, wherein each of the subjects of the group did not achieve a durable response after administration of a recombinant-receptor-expressing therapeutic cell composition for treating the same disease or condition.
  • the biomarker is associated with, correlated to, indicative of and/or predictive of a particular outcome, such as development of a toxicity, in a subject that has been administered a cell therapy, such as with a composition containing genetically engineered cells.
  • a cell therapy such as with a composition containing genetically engineered cells.
  • the presence, expression, level, amount or concentration of one or more biomarker in a biological sample obtained from a subject prior to the administration of cell therapy can be associated with, correlated to, indicative of and/or predictive of a particular outcome, such as development of a toxicity, such as any toxicity outcomes described herein, e.g., in Section II.A.
  • the toxicity is a toxicity potentially associated with cell therapy, such as any described herein, for example, in Section II.A.
  • the toxicity is neurotoxicity (NT) or cytokine release syndrome (CRS).
  • the toxicity is a severe NT or severe CRS.
  • the toxicity is grade 2 or higher NT or grade 2 or higher CRS.
  • the toxicity is grade 3 or higher NT or grade 3 or higher CRS.
  • the methods include comparing, individually, the level, amount or concentration of the biomarker in the sample to a threshold value, thereby
  • the methods include identifying a subject who has a risk of developing a toxicity after administration of a cell therapy based by comparing, individually, the level, amount or concentration of the biomarker in the sample to a threshold value. In some embodiments, the methods also include following or based on the results of the assessment, administering to the subject the cell therapy, and, optionally, an agent or other treatment capable of treating, preventing, delaying, reducing or attenuating the development or risk of development of a toxicity. In some embodiments, the methods also involve monitoring the subject for symptoms of toxicity if the subject is administered a cell therapy and is identified as having a risk of developing a toxicity.
  • one or more of the following steps can be performed can be administered to the subject: (a) (1) an agent or other treatment capable of treating, preventing, delaying, reducing or attenuating the development or risk of development of a toxicity and (2) the cell therapy, wherein administration of the agent is to be administered (i) prior to, (ii) within one, two, or three days of, (iii) concurrently with and/or (iv) at first fever following, the initiation of administration of the cell therapy to the subject; and/or (b) administering to the subject a cell therapy at a reduced dose or at a dose that is not associated with risk of developing toxicity or severe toxicity, or is not associated with a risk of developing a toxicity or severe toxicity in a majority of subjects, and/or a majority of subjects having a disease or condition that the subject has or is suspected of having, following administration of the cell therapy; and/or (c) administering to the subject: (a) (1) an agent or other treatment capable of treating, preventing, delaying, reducing or at
  • biomarkers or biomarkers, including parameters thereof, that can be assessed include Lactate dehydrogenase (LDH), ferritin, C-reactive protein (CRP), Interleukin-6 (IL-6), IL-7, IL-8, IL-10, IL-15, IL-16, tumor necrosis factor alpha (TNF-a), interferon alpha 2 (IFN-a2), monocyte chemoattractant protein-l (MCP-l), macrophage inflammatory protein 1 alpha (MIP-la), macrophage inflammatory protein 1 beta (MIR-1b), Eotaxin, Granulocyte-colony stimulating factor (G-CSF), IL-l receptor alpha (IL-lRa), IL- 1 b, IFN-y-Inducible Protein 10 (IP- 10), perforin, and D-dimer (fibrin degradation product).
  • LDH Lactate dehydrogenase
  • CRP C-reactive protein
  • IL-6 Interleukin-6
  • IL-7 inter
  • the biomarkers, including parameters thereof include LDH, ferritin, CRP, IL-6, IL-8, IL-10, TNF-a, IFN-a2, MCP-l and MIR-1b. In some embodiments, the biomarkers, including parameters thereof, include ferritin, CRP, D-dimer, IL-6, IL-15, TNF-a and MIP-la.
  • the biomarkers include ferritin, CRP, IL- 10, IL-15, IL-16, TNF-a, or MP b.
  • elevated levels or increased levels of one or more of such biomarkers can be associated with the development of neurotoxicity, e.g. severe neurotoxicity or grade 3 or higher or grade 4 or 5 neurotoxicity.
  • elevated levels or increased levels of one or more of such biomarkers can be associated with the development of neurotoxicity, e.g. severe neurotoxicity or grade 3 or higher or grade 4 or 5 neurotoxicity.
  • exemplary biomarkers or biomarkers that can be assessed or analyzed with respect to assessment of the risk of developing a toxicity after administration of a cell therapy include one or more biomarker selected from LDH, Ferritin, C-reactive protein (CRP), IL-6, IL-8, IL-10, TNF-a, IFN-a2, MCP-l and MIR-1b.
  • biomarker selected from LDH, Ferritin, C-reactive protein (CRP), IL-6, IL-8, IL-10, TNF-a, IFN-a2, MCP-l and MIR-1b.
  • the subject has a risk of developing a toxicity if the level, amount or concentration of the one or more of the biomarker is above a threshold value and the subject has a low risk of developing a toxicity if the level, amount or concentration of the one or more of the biomarker is below a threshold value.
  • the toxicity is neurotoxicity.
  • elevated levels of LDH, Ferritin, C-reactive protein (CRP), IL- 6, IL-8, IL-10, TNF-a, IFN-a2, MCP-l and MIR-Ib, in a biological sample from a subject obtained prior to administration of a cell therapy (pre-treatment), can be associated with a higher risk of developing a neurotoxicity.
  • the threshold value is within 25%, within 20%, within 15%, within 30% or within 5% and/or is within a standard deviation above the median or mean level, amount or concentration of LDH, Ferritin, C-reactive protein (CRP), IL-6, IL-8, IL-10, TNF-a, IFN-a2, MCP-l or MIR-1b in a biological sample obtained from a group of subjects prior to receiving a cell therapy, wherein each of the subjects of the group went on not develop any toxicity after receiving a recombinant-receptor-expressing therapeutic cell composition for treating the same disease or condition.
  • CRP C-reactive protein
  • IL-6 C-reactive protein
  • IL-8 C-reactive protein
  • IL-10 TNF-a
  • IFN-a2 IFN-a2
  • MCP-l or MIR-1b MIR-1b
  • the threshold value is within 25%, within 20%, within 15%, within 30% or within 5% and/or is within a standard deviation below the median or mean level, amount or concentration of LDH, Ferritin, C-reactive protein (CRP), IL-6, IL-8, IL-10, TNF-a, IFN-a2, MCP-l or MIR-1b in a biological sample obtained from a group of subjects prior to receiving a cell therapy, wherein each of the subjects of the group went on to develop a toxicity after receiving a recombinant-receptor-expressing therapeutic cell composition for treating the same disease or condition.
  • CRP C-reactive protein
  • IL-6 C-reactive protein
  • IL-8 C-reactive protein
  • IL-10 TNF-a
  • IFN-a2 IFN-a2
  • MCP-l or MIR-1b MIR-1b
  • the toxicity is neurotoxicity.
  • exemplary threshold value for LDH is at or at about or above or above about 300 U/L, 400 U/L, 500 U/L, 600 U/L or 700 U/L.
  • exemplary threshold value for Ferritin is at or at about or above or above about 500 ng/mL, 600 ng/mL, 700 ng/mL, 800 ng/mL, 900 ng/mL, 1000 ng/mL or 1500 ng/mL.
  • exemplary threshold value for CRP is at or at about or above or above about 20 mg/L, 30 mg/L, 40 mg/L, 50 mg/L, 60 mg/L, 70 mg/L or 80 mg/L.
  • exemplary threshold value for IL-6 is at or at about or above or above about 5 pg/mL, 6 pg/mL, 7 pg/mL, 8 pg/mL, 9 pg/mL, 10 pg/mL, 20 pg/mL or 30 pg/mL.
  • exemplary threshold value for IL-8 is at or at about or above or above about 8 pg/mL, 9 pg/mL, 10 pg/mL, 20 pg/mL or 30 pg/mL.
  • exemplary threshold value for IL-10 is at or at about or above or above about 20 pg/mL, 30 pg/mL, 40 pg/mL, 50 pg/mL, 60 pg/mL or 70 pg/mL.
  • exemplary threshold value for TNF-a is at or at about or above or above about 20 pg/mL or 30 pg/mL.
  • exemplary threshold value for IFN-a2 is at or at about or above or above about 40 pg/mL, 50 pg/mL, 60 pg/mL, 70 pg/mL or 80 pg/mL.
  • exemplary threshold value for MCP-l is at or at about or above or above about 200 pg/mL or 300 pg/mL.
  • exemplary threshold value for MIR-1b is at or at about or above or above about 40 pg/mL, 50 pg/mL, 60 pg/mL, 70 pg/mL or 80 pg/mL.
  • exemplary biomarkers or biomarkers that can be assessed or analyzed with respect to assessment of the risk of developing a toxicity after administration of a cell therapy include one or more biomarker selected from IL-8, IL-10 and CXCL10.
  • the subject has a risk of developing a toxicity if the level, amount or concentration of the one or more of the biomarker is above a threshold value and the subject has a low risk of developing a toxicity if the level, amount or concentration of the one or more of the biomarker is below a threshold value.
  • the toxicity is neurotoxicity.
  • the toxicity is severe neurotoxicity or a grade 3 or higher neurotoxicity.
  • elevated levels of IL-8, IL- 10 and CXCL10, in a biological sample from a subject obtained prior to administration of a cell therapy (pre-treatment) can be associated with a higher risk of developing a neurotoxicity, or a severe neurotoxicity or a grade 3 or higher neurotoxicity.
  • the threshold value is within 25%, within 20%, within 15%, within 30% or within 5% and/or is within a standard deviation above the median or mean level, amount or concentration of IL-8, IL-10 or CXCL10 in a biological sample obtained from a group of subjects prior to receiving a cell therapy, wherein each of the subjects of the group went on not develop any toxicity after receiving a recombinant-receptor-expressing therapeutic cell composition for treating the same disease or condition.
  • the threshold value is within 25%, within 20%, within 15%, within 30% or within 5% and/or is within a standard deviation below the median or mean level, amount or concentration of IL-8, IL-10 or CXCL10 in a biological sample obtained from a group of subjects prior to receiving a cell therapy, wherein each of the subjects of the group went on to develop a toxicity after receiving a recombinant-receptor-expressing therapeutic cell composition for treating the same disease or condition.
  • exemplary biomarkers or biomarkers or a volumetric measure of tumor burden that can be assessed or analyzed with respect to assessment of the risk of developing a toxicity after administration of a cell therapy include one or more biomarker or volumetric measure of tumor burden selected from a sum of the products of diameters (SPD), LDH, Ferritin, C-reactive protein (CRP), D-dimer (fibrin degradation product), IL-6, IL-10, IL- 15, IL-16 TNF-a, MIP-la and MIR-1b.
  • the subject has a risk of developing a toxicity if the level, amount or concentration of the one or more of the biomarker or the volumetric measure of tumor burden is above a threshold value and the subject has a low risk of developing a toxicity if the level, amount or concentration of the one or more of the biomarker or the volumetric measure of tumor burden is below a threshold value.
  • the toxicity is neurotoxicity.
  • elevated levels or measure of a sum of the products of diameters (SPD), LDH, Ferritin, C-reactive protein (CRP), D-dimer (fibrin degradation product), IL-6, IL-10, IL-15, IL-16 TNF-a, MIP-la and MPMb, in a biological sample from a subject obtained prior to administration of a cell therapy (pre-treatment), can be associated with a higher risk of developing a neurotoxicity (NT) or a cytokine release syndrome (CRS).
  • the one or more biomarker or volumetric measure of tumor burden selected from LDH, SPD, IL-10, IL-15, IL-16, TNF-a and MIR-Ib, and the toxicity is neurotoxicity
  • the one or more biomarker or volumetric measure of tumor burden selected from LDH, SPD, CRP, d-dimer, IL-6, IL-15, TNF-a and MIP-la, and the toxicity is CRS.
  • elevated levels or measure of LDH, SPD, IL-10, IL-15, IL-16, TNF-a and MIR-Ib, in a biological sample from a subject obtained prior to administration of a cell therapy can be associated with a higher risk of developing a neurotoxicity (NT).
  • elevated levels or measure of LDH, SPD, CRP, d-dimer, IL-6, IL-15, TNF-a and MIP-la, in a biological sample from a subject obtained prior to administration of a cell therapy (pre-treatment) can be associated with a higher risk of developing a cytokine release syndrome (CRS).
  • CRS cytokine release syndrome
  • the threshold value is within 25%, within 20%, within 15%, within 32% or within 5% and/or is within a standard deviation above the median or mean level, amount or concentration of LDH, Ferritin, C-reactive protein (CRP), D-dimer (fibrin
  • IL-6 IL-6
  • IL-10 IL-15
  • IL-16 TNF-a MIP-la or MIR-Ib
  • SPD median or mean volumetric measure of tumor burden of a sum of the products of diameters
  • the threshold value is within 25%, within 20%, within 15%, within 32% or within 5% and/or is within a standard deviation below the median or mean level, amount or concentration of LDH, Ferritin, C-reactive protein (CRP), D-dimer (fibrin
  • IL-6 IL-6
  • IL-10 IL-15
  • IL-16 TNF-a MIP-la or MIR-Ib
  • SPD median or mean volumetric measure of tumor burden of a sum of the products of diameters
  • the toxicity is neurotoxicity and exemplary threshold value for LDH is at or at about or above or above about 300 U/L, 400 U/L, 500 U/L or 600 U/L.
  • the toxicity is neurotoxicity and exemplary threshold value for SPD is at or at about or above or above about 30 cm 2 , 40 cm 2 , 50 cm 2 , 60 cm 2 , 70 cm 2 , 80 cm 2 or 90cm 2 .
  • the toxicity is neurotoxicity and exemplary threshold value for IL-10 is at or at about or above or above about 0.8 pg/mL, 0.9 pg/mL, 1 pg/mL, 2 pg/mL, 3 pg/mL or 4 pg/mL.
  • the toxicity is neurotoxicity and exemplary threshold value for IL-15 is at or at about or above or above about 3 pg/mL, 4 pg/mL, 5 pg/mL, 6 pg/mL or 7 pg/mL.
  • the toxicity is neurotoxicity and exemplary threshold value for IL-16 is at or at about or above or above about 600 pg/mL, 700 pg/mL, 800 pg/mL, 900 pg/mL or 1000 pg/mL.
  • the toxicity is neurotoxicity and exemplary threshold value for TNF-a is at or at about or above or above about 6 pg/mL, 7 pg/mL, 8 pg/mL, 9 pg/mL or 10 pg/mL.
  • the toxicity is neurotoxicity and exemplary threshold value for MIR-1b is at or at about or above or above about 70 pg/mL, 80 pg/mL, 90 pg/mL or 100 pg/mL.
  • the toxicity is CRS and exemplary threshold value for LDH is at or at about or above or above about 300 U/L, 400 U/L, 500 U/L or 600 U/L.
  • the toxicity is CRS the and threshold value for SPD is at or at about or above or above about 20 cm 2 , 30 cm 2 , 40 cm 2 or 50 cm 2.
  • the toxicity is CRS and exemplary threshold value for ferritin is at or at about or above or above about 300 ng/mL, 400 ng/mL, 500 ng/mL, 600 ng/mL, 700 ng/mL, 800 ng/mL, 900 ng/mL or 1000 ng/mL.
  • the toxicity is CRS and exemplary threshold value for CRP is at or at about or above or above about 20 mg/L, 30 mg/L or 40 mg/L.
  • the toxicity is CRS and exemplary threshold value for d-dimer is at or at about or above or above about 300 pg/mL, 400 pg/mL, 500 pg/mL, 600 pg/mL, 700 pg/mL, 800 pg/mL, 900 pg/mL or 1000 pg/mL.
  • the toxicity is CRS and exemplary threshold value for IL-6 is at or at about or above or above about 2 pg/mL, 3 pg/mL, 4 pg/mL, 5 pg/mL, 6 pg/mL, 7 pg/mL, 8 pg/mL or 9 pg/mL.
  • the toxicity is CRS and exemplary threshold value for IL-15 is at or at about or above or above about 3 pg/mL, 4 pg/mL, 5 pg/mL, 6 pg/mL, 7 pg/mL, 8 pg/mL, 9 pg/mL or 10 pg/mL.
  • the toxicity is CRS and exemplary threshold value for TNF-a is at or at about or above or above about 7 pg/mL, 8 pg/mL, 9 pg/mL, 10 pg/mL or 15 pg/mL.
  • the toxicity is CRS and exemplary threshold value for MIP-la is at or at about or above or above about 20 pg/mL, 30 pg/mL or 40 pg/mL.
  • the parameter is LDH and in some cases, development of toxicity, e.g., CRS or NT, is correlated with the LDH value that is above a threshold value.
  • the inflammatory marker is LDH and the threshold value is or is about 300 units per liter, is or is about 400 units per liter, is or is about 500 units per liter or is or is about 600 units per liter.
  • the parameter or biomarker is LDH. In some embodiments, the biomarker is LDH and the threshold value is or is about 500 U/L or higher. In some embodiments, the parameter or biomarker is SPD. In some embodiments, the parameter is SPD, 2
  • biomarker or parameters are SPD and LDH
  • the threshold values are SPD of at or about 50 cm or higher and LDH of at or about 500 U/L or higher.
  • the biomarkers or parameters are associated with increased risk of developing CRS or NT.
  • a measurement of the parameter or marker that is above the threshold value e.g., SPD of at or about 50 cm or higher and LDH of at or about 500 U/L or higher, are associated with an approximately 2-, 3-, 4-, 5-, 6-, 7-, 8-, 9-, lO-fold or more increased risk of developing CRS or NT, such as any grade CRS or NT.
  • a measurement of the parameter or marker that is below the threshold value e.g., SPD of lower than at or about 500 cm and LDH of lower than at or about 500 U/L, are associated with an approximately 2-, 3-, 4-, 5-, 6-, 7-, 8-, 9-, lO-fold or more decreased risk of developing CRS or NT, such as any grade CRS or NT.
  • the volumetric measure is SPD and the threshold level is or is about 30 cm 2 , is or is about 40 cm 2 , is or is about 50 cm 2 , is or is about 60 cm 2 , or is or is about
  • the volumetric measure is SPD and the threshold level is or is about 50 cm .
  • the biomarker is LDH and the threshold level is or is about 300 units per liter (U/L), is or is about 400 U/L, is or is about 500 U/L or is or is about 600 U/L. In some embodiments, the biomarker is LDH and the threshold level is or is about 500 U/L.
  • a subject is determined to be at risk of developing toxicity (e.g. neurotoxicity, such as severe neurotoxicity or grade 3 or higher neurotoxicity, e.g. grade 4 or 5 neurotoxicity and/or CRS, such as severe CRS or grade 3 or higher CRS) by a comparison of the parameter (e.g. concentration, amount, level or activity) of the biomarker (e.g. analyte) or, individually, each of the biomarkers to a reference value, such as threshold level, of the corresponding parameter for the biomarker or each biomarker.
  • toxicity e.g. neurotoxicity, such as severe neurotoxicity or grade 3 or higher neurotoxicity, e.g. grade 4 or 5 neurotoxicity and/or CRS, such as severe CRS or grade 3 or higher CRS
  • the parameter e.g. concentration, amount, level or activity
  • the biomarker e.g. analyte
  • a reference value such as threshold level
  • the comparison indicates whether the subject is or is not at risk for developing toxicity, e.g., neurotoxicity such as severe neurotoxicity or grade 3 or higher neurotoxicity, e.g. grade 4 or 5 neurotoxicity and/or CRS, such as severe CRS or grade 3 or higher CRS, and/or indicates a degree of risk for developing said toxicity.
  • the reference value is one that is a threshold level or cut-off at which there is a good predictive value (e.g. accuracy, sensitivity and/or specificity) that such toxicity will occur or is likely to occur either alone or in combination with one or more biomarkers in the panel. In some cases, such reference value, e.g.
  • threshold level can be or is predetermined or known prior to performing the method, such as from a plurality of subjects previously treated with a cell therapy and assessed for the correlation of the parameter of the biomarker or, individually, each of the biomarkers in a panel to the presence of a toxic outcome (e.g . the presence of neurotoxicity such as severe neurotoxicity or grade 3 or higher neurotoxicity, e.g. grade 4 or 5 neurotoxicity and/or CRS, such as severe CRS or grade 3 or higher CRS).
  • a toxic outcome e.g . the presence of neurotoxicity such as severe neurotoxicity or grade 3 or higher neurotoxicity, e.g. grade 4 or 5 neurotoxicity and/or CRS, such as severe CRS or grade 3 or higher CRS.
  • a parameter of a biomarker e.g. LDH, ferritin, CRP, IL-6, IL- 8, IL-10, TNF-a, IFN-a2, MCP-l and MP b
  • the reference value e.g. threshold level
  • a parameter of a biomarker that is equal to or lower than the reference value, e.g. threshold level, of the corresponding parameter is associated with a negative prediction of a risk of toxicity (alone or in conjunction with assessment of the other biomarkers in the panel).
  • the threshold level is determined based on the level, amount, concentration or other measure of the biomarker (e.g. analyte) in the sample positive for the biomarker. In some aspects, the threshold level is within 25%, within 20%, within 15%, within 10% or within 5% of the average level, amount or concentration or measure, and/or is within a standard deviation of the average level, amount or concentration or measure, of the biomarker or parameter in a biological sample obtained from a group of subjects prior to receiving a recombinant receptor-expressing therapeutic cell composition, wherein each of the subjects of the group went on to develop a toxicity, e.g. neurotoxicity such as severe neurotoxicity or grade 3 or higher neurotoxicity, e.g. grade 4 or 5 neurotoxicity and/or CRS, such as severe CRS or grade 3 or higher CRS, after receiving a recombinant-receptor-expressing therapeutic cell composition for treating the same disease or condition.
  • a toxicity e.g. neurotoxicity such as severe neurotoxicity or grade 3 or higher neurotoxicity,
  • the biomarker correlates to and/or is predictive of the risk of developing severe neurotoxicity, such as severe neurotoxicity or grade 3 or higher neurotoxicity, e.g. grade 4 or 5 neurotoxicity and/or severe CRS or grade 3 or higher CRS.
  • the threshold level is within 25%, within 20%, within 15%, within 10% or within 5% of the average level, amount or concentration or measure, and/or is within a standard deviation of the average level, amount or concentration or measure, of the biomarker or parameter in a biological sample obtained from a group of subjects prior to receiving a recombinant receptor-expressing therapeutic cell composition, wherein each of the subjects of the group went on to develop severe neurotoxicity or grade 3 or higher neurotoxicity, e.g. grade 4 or 5 neurotoxicity and/or severe CRS or grade 3 or higher CRS, after receiving a recombinant-receptor-expressing therapeutic cell composition for treating the same disease or condition.
  • severe neurotoxicity or grade 3 or higher neurotoxicity e.g. grade 4 or 5 neurotoxicity and/or severe CRS or grade 3 or higher CRS
  • CRS perpendicular diameters
  • LDH high serum lactate dehydrogenase
  • high pre-administration levels of inflammatory markers such as ferritin and C-reactive protein (CRP) can be also associated with CRS.
  • peak levels of IL-6, IFN-g, ferritin, and CRP can be associated with any grade or Grade 3 or higher neurotoxicity.
  • subjects with B-cell acute lymphoblastic leukemia (ALL) and high burden of disease may be at an elevated risk of developing CRS.
  • severe neurotoxicity can be associated with higher disease burden at the time of adoptive cell therapy.
  • protein levels in the cerebrospinal fluid can be elevated in patients with neurotoxicity, compared with baseline measurements
  • other organ dysfunction hepatic and renal
  • hypoxemia hepatic and renal
  • cytokine-mediated endothelial activation can be associated with coagulopathy, capillary leak, and blood-brain barrier disruption allowing transit of high concentrations of systemic cytokines into the CSF.
  • the parameter e.g., patient factor, biomarker, inflammatory marker and/or cytokine
  • the parameter is detected using one or more reagent(s) capable of detecting or that is specific for the parameter.
  • kits and articles of manufacture for detection or assessment of the parameters and/or for modulating the therapy, e.g., cell therapy.
  • instructions are also provided for using the reagent to assay a biological sample from a subject that is a candidate for treatment, optionally with a cell therapy, said cell therapy optionally including a dose or composition of genetically engineered cells expressing a recombinant receptor.
  • CTL13 C-reactive protein
  • CXCL10 C-X-C motif chemokine 10
  • D-dimer ferritin
  • IFN-a2 interleukin -2
  • IL-10 interleukin -2
  • IL-15 interleukin-15
  • IL-16 interleukin-6
  • IL-7 interleukin-8
  • IFN-g interleukin -2
  • LH lactate dehydrogenase
  • MIR-Ia macrophage inflammatory protein
  • MIR-Ib Monocyte chemoattractant protein-l
  • SAA-l Serum Amyloid Al
  • TNF-a tumor necrosis factor alpha
  • CRP C-reactive protein
  • ESR erythrocyte sedimentation rate
  • b2-M b2 microglobulin
  • LDH lactate dehydrogenase
  • measuring the value of the one or more parameters comprises contacting a reagent capable of directly or indirectly detecting the analyte with the biological sample and determining the presence or absence, level, amount or concentration of the analyte in the biological sample.
  • the one or more parameters is C-C Motif Chemokine Ligand 13 (CCL13), C-reactive protein (CRP), C-X-C motif chemokine 10 (CXCL10), D-dimer (fibrin degradation product), ferritin, IFN-a2, interleukin -2 (IL-2), IL-10, IL-15, IL-16, IL-6, IL-7, IL-8, interferon gamma (IFN-g), lactate dehydrogenase (LDH), macrophage inflammatory protein (MIR-Ia), MIR-Ib, Monocyte chemoattractant protein-l (MCP-l), SAA-l, Serum Amyloid Al (SAA-l), tumor necrosis factor alpha (TNF-a), is detected and assessed.
  • CCL13 C-reactive protein
  • CXCL10 C-X-C motif chemokine 10
  • D-dimer ferritin
  • IFN-a2 interleukin -2
  • CRP C-reactive protein
  • ESR erythrocyte sedimentation rate
  • b2-M b2 microglobulin
  • LDH lactate dehydrogenase
  • the one or more parameters, e.g., biomarkers is or includes LDH.
  • the reagent is a binding molecule that specifically binds to the biomarker.
  • the reagent is an antibody or an antigen-binding fragment thereof.
  • the reagent is or includes a substrate or binding partner of the biomarker.
  • the presence, absence or level, amount, concentration and/or other measure of LDH is detected or determined in a sample.
  • Various methods of detecting or determining LDH are known. For example, an assay which measures LDH conversion of lactate to pyruvate through NAD+ reduction to NADH can be used to detect LDH in the sample.
  • the sample is contacted with lactate in the presence of coenzyme NAD which, as a measure of LDH in the sample, results in NADH that is then oxidized in the presence of an electron transfer agent.
  • the NADH interacts with a probe or dye precursor that is detectable by measuring absorption in a visible light range.
  • diaphorase uses the NADH to reduce tetrazolium salt (INT) to a red formazan product and the product is measured. Therefore, in some embodiments, the amount of colored product formed is directly proportional to the LDH activity in the sample.
  • INT tetrazolium salt
  • the patient attributes, factors and/or biomarkers is assessed using an immune assay.
  • an enzyme-linked immunosorbent assay ELISA
  • enzyme immunoassay EIA
  • radioimmunoassay RIA
  • SPR surface plasmon resonance
  • iPCR immunohistochemistry
  • protein array or immuno-PCR iPCR
  • using the articles of manufacture include detecting patient attributes, factors and/or biomarkers indicative of tumor burden.
  • the assaying or assessing of an patient attributes, factors and/or biomarkers is using flow cytometry.
  • the reagent is a soluble protein that binds the patient attributes, factors and/or biomarkers.
  • the reagent is a protein that binds C-reactive protein (CRP), erythrocyte sedimentation rate (ESR), albumin, ferritin, b2 microglobulin (b2-M), or lactate dehydrogenase (LDH).
  • CRP C-reactive protein
  • ESR erythrocyte sedimentation rate
  • b2-M b2 microglobulin
  • LDH lactate dehydrogenase
  • C-reactive protein is assessed using an in vitro enzyme-linked immunosorbent assay to obtain a quantitative measurement of human CRP from a sample such as serum, plasma, or blood.
  • CRP is detected using a human Enzyme- Linked Immunosorbent Assay (ELISA).
  • ELISA Enzyme- Linked Immunosorbent Assay
  • ESR erythrocyte sedimentation rate
  • albumin is assessed using a colorimetric test or an in vitro enzyme-linked immunosorbent assay.
  • albumin is detected using a human Enzyme- Linked Immunosorbent Assay (ELISA).
  • ELISA Enzyme- Linked Immunosorbent Assay
  • ferritin or b2 microglobulin is assessed using an immunoassay or detected using an ELISA.
  • lactate dehydrogenase (LDH) is assessed using a colorimetric test or an in vitro enzyme-linked immunosorbent assay.
  • antibody herein is used in the broadest sense and includes polyclonal and monoclonal antibodies, including intact antibodies and functional (antigen-binding) antibody fragments, including fragment antigen binding (Fab) fragments, F(ab’) 2 fragments, Fab’ fragments, Fv fragments, recombinant IgG (rlgG) fragments, single chain antibody fragments, including single chain variable fragments (scFv), and single domain antibodies (e.g., sdAb, sdFv, nanobody) fragments.
  • Fab fragment antigen binding
  • rlgG recombinant IgG
  • scFv single chain variable fragments
  • single domain antibodies e.g., sdAb, sdFv, nanobody
  • the term encompasses genetically engineered and/or otherwise modified forms of immunoglobulins, such as intrabodies, peptibodies, chimeric antibodies, fully human antibodies, humanized antibodies, and heteroconjugate antibodies, multispecific, e.g., bispecific, antibodies, diabodies, triabodies, and tetrabodies, tandem di-scFv, tandem tri-scFv.
  • the term“antibody” should be understood to encompass functional antibody fragments thereof.
  • the term also encompasses intact or full-length antibodies, including antibodies of any class or sub-class, including IgG and sub-classes thereof, IgM, IgE, IgA, and IgD.
  • an“antibody fragment” refers to a molecule other than an intact antibody that comprises a portion of an intact antibody that binds the antigen to which the intact antibody binds.
  • antibody fragments include but are not limited to Fv, Fab, Fab’, Fab’-SH, F(ab’) 2 ; diabodies; linear antibodies; single-chain antibody molecules ( e.g . scFv); and multispecific antibodies formed from antibody fragments.
  • the antibodies are single-chain antibody fragments comprising a variable heavy chain region and/or a variable light chain region, such as scFvs.
  • Single-domain antibodies are antibody fragments comprising all or a portion of the heavy chain variable domain or all or a portion of the light chain variable domain of an antibody.
  • a single-domain antibody is a human single-domain antibody.
  • Antibody fragments can be made by various techniques, including but not limited to proteolytic digestion of an intact antibody as well as production by recombinant host cells.
  • the antibodies are recombinantly produced fragments, such as fragments comprising arrangements that do not occur naturally, such as those with two or more antibody regions or chains joined by synthetic linkers, e.g., peptide linkers, and/or that are may not be produced by enzyme digestion of a naturally-occurring intact antibody.
  • the antibody fragments are scFvs.
  • A“humanized” antibody is an antibody in which all or substantially all CDR amino acid residues are derived from non-human CDRs and all or substantially all FR amino acid residues are derived from human FRs.
  • a humanized antibody optionally may include at least a portion of an antibody constant region derived from a human antibody.
  • A“humanized form” of a non-human antibody refers to a variant of the non-human antibody that has undergone humanization, typically to reduce immunogenicity to humans, while retaining the specificity and affinity of the parental non-human antibody.
  • some FR residues in a humanized antibody are substituted with corresponding residues from a non-human antibody (e.g., the antibody from which the CDR residues are derived), e.g., to restore or improve antibody specificity or affinity.
  • a non-human antibody e.g., the antibody from which the CDR residues are derived
  • A“human antibody” is an antibody with an amino acid sequence corresponding to that of an antibody produced by a human or a human cell, or non-human source that utilizes human antibody repertoires or other human antibody-encoding sequences, including human antibody libraries.
  • the term excludes humanized forms of non-human antibodies comprising non-human antigen-binding regions, such as those in which all or substantially all CDRs are non-human.
  • Human antibodies may be prepared by administering an immunogen to a transgenic animal that has been modified to produce intact human antibodies or intact antibodies with human variable regions in response to antigenic challenge. Such animals typically contain all or a portion of the human immunoglobulin loci, which replace the endogenous immunoglobulin loci, or which are present extrachromosomally or integrated randomly into the animal’s chromosomes. In such transgenic animals, the endogenous immunoglobulin loci have generally been inactivated. Human antibodies also may be derived from human antibody libraries, including phage display and cell-free libraries, containing antibody-encoding sequences derived from a human repertoire.
  • monoclonal antibodies including monoclonal antibody fragments.
  • the term“monoclonal antibody” as used herein refers to an antibody obtained from or within a population of substantially homogeneous antibodies, i.e., the individual antibodies comprising the population are identical, except for possible variants containing naturally occurring mutations or arising during production of a monoclonal antibody preparation, such variants generally being present in minor amounts.
  • polyclonal antibody preparations which typically include different antibodies directed against different epitopes
  • each monoclonal antibody of a monoclonal antibody preparation is directed against a single epitope on an antigen.
  • the term is not to be construed as requiring production of the antibody by any particular method.
  • a monoclonal antibody may be made by a variety of techniques, including but not limited to generation from a hybridoma, recombinant DNA methods, phage-display and other antibody display methods.
  • antibody immunoconjugates comprising an antibody against biomarker attached to a label, which can generate a detectable signal, indirectly or directly. These antibody immunoconjugates can be used for research or diagnostic applications.
  • the label is preferably capable of producing, either directly or indirectly, a detectable signal.
  • the label may be radio-opaque or a radioisotope, such as 3 H, 14 C, 32 P, 35 S, 123 I, 125 I, 131 I; a fluorescent (fluorophore) or chemiluminescent (chromophore) compound, such as fluorescein isothiocyanate, rhodamine or luciferin; an enzyme, such as alkaline phosphatase, b-galactosidase or horseradish peroxidase; an imaging agent; or a metal ion.
  • a radioisotope such as 3 H, 14 C, 32 P, 35 S, 123 I, 125 I, 131 I
  • a fluorescent (fluorophore) or chemiluminescent (chromophore) compound such as fluorescein isothiocyanate, rhodamine or luciferin
  • an enzyme such as alkaline phosphatase, b-galactosidase or horse
  • the label is a radioactive atom for scintigraphic studies, for example 99 Tc or 123 I, or a spin label for nuclear magnetic resonance (NMR) imaging (also known as magnetic resonance imaging, MRI), such as zirconium-89, iodine-l23, iodine-l3l, indium-l l l, fluorine-l9, carbon-l3, nitrogen-l5, oxygen- 17, gadolinium, manganese or iron.
  • NMR nuclear magnetic resonance
  • Zirconium-89 may be complexed to various metal chelating agents and conjugated to antibodies, e.g., for PET imaging (WO 2011/056983).
  • the antibody immunoconjugate is detectable indirectly.
  • a secondary antibody that is specific for the antibody against the marker expressed on a population of myeloid cells immunoconjugate and contains a detectable label can be used to detect the antibody immunoconjugate.
  • antibodies capable of detecting or that is specific the patient attributes, factors and/or biomarkers provided herein may be identified, screened for, or characterized for their physical/chemical properties and/or biological activities by various known assays.
  • the antibody is tested for its antigen binding activity, e.g., by known methods such as an immunoassay, ELISA, Western blotting, and/or flow cytometric assays, including cell-based binding assays.
  • the, one or more patient attributes, factors and/or biomarkers is assessed from a biological sample.
  • the biological sample is a bodily fluid or a tissue.
  • the biological sample e.g., bodily fluid, is or contains whole blood, serum or plasma.
  • two or more samples are obtained, collected, or taken from the subject prior to administration of the therapy.
  • the sample is a biological sample.
  • the sample is a blood sample, plasma sample, or serum sample.
  • the sample is a tissue sample.
  • the sample is a biopsy.
  • the sample is obtained from the subject at a screening session, such as a routine assessment or blood draw to confirm and/or identify the condition or disease in the subject.
  • the biological sample is an apheresis or leukaphresis sample.
  • the or absence and/or a parameter of one or more biomarkers is assessed or the biological sample is obtained after administration of the cell therapy.
  • the reagents can be used prior to the administration of the cell therapy or after the administration of cell therapy, for diagnostic purposes, to identify subjects and/or to assess treatment outcomes and/or toxicities.
  • the biological sample is obtained from the subject prior to administration of the cell therapy (e.g., pre-infusion), e.g., obtained up to 2 days, up to 7 days, up to 14 days, up to 21 days, up to 28 days, up to 35 days or up to 40 days prior to initiation of the administration of the engineered cells.
  • the cell therapy e.g., pre-infusion
  • one or more patient attributes, factors and/or biomarkers are measured, assessed, and/or determined in one or more samples obtained at two or more time points to determine a fold change in the factor indicative of disease burden.
  • the sample is a biological sample that is taken, collected, and/or obtained from a subject.
  • the subject has a disease or condition and/or is suspected of having a disease or condition.
  • subject has received, will receive, or is a candidate to receive a therapy.
  • the therapy is an administration of a cell therapy.
  • the therapy is an immunotherapy.
  • the cell therapy treats and/or is capable of treating the disease or condition.
  • the therapy is a cell therapy that contains one or more engineered cells.
  • the engineered cells express a recombinant receptor.
  • the recombinant receptor is a CAR.
  • the sample is taken, collected, and/or obtained from a subject who has been, who will be, or is a candidate to be administered a therapy.
  • the sample is taken, collected, and/or obtained prior to treatment or administration with the therapy, e.g., the cell therapy.
  • the sample does not comprise genetically engineered T cells expressing a chimeric antigen receptor (CAR) and/or is obtained from the subject prior to receiving administration of genetically engineered T cells expressing a CAR.
  • CAR chimeric antigen receptor
  • the sample is taken, collected, and/or obtained from a subject who has been, who will be, or is a candidate to be administered a therapy.
  • the sample is taken, collected, and/or obtained prior to treatment or administration with the therapy, e.g., the cell therapy.
  • the sample can be assessed for one or more patient attributes, factors and/or biomarkers that is associated with and/or correlate to toxicity or risk of toxicity.
  • Exemplary patient attributes, factors and/or biomarkers associated with and/or correlated with a risk of developing toxicity and/or response that may be detected in a sample collected or obtained from a subject prior to receiving an immunotherapy include C-reactive protein (CRP), erythrocyte sedimentation rate (ESR), albumin, ferritin, b2 microglobulin (b2-M), or lactate dehydrogenase (LDH).
  • CRP C-reactive protein
  • ESR erythrocyte sedimentation rate
  • b2-M b2 microglobulin
  • LDH lactate dehydrogenase
  • the patient attributes, factors and/or biomarkers associated with and/or correlated with a risk of developing toxicity and/or response that may be detected in a sample collected or obtained from a subject prior to or after receiving an immunotherapy include C-C Motif Chemokine Ligand 13 (CCL13), C-reactive protein (CRP), C-X-C motif chemokine 10 (CXCL10), D-dimer (fibrin degradation product), ferritin, IFN-a2, interleukin-2 (IL-2), IL- 10, IL-15, IL-16, IL-6, IL-7, IL-8, interferon gamma (IFN-g), lactate dehydrogenase (LDH), macrophage inflammatory protein (MIR-Ia), MIR-Ib, Monocyte chemoattractant protein-l (MCP-l), SAA-l, Serum Amyloid Al (SAA-l), tumor necrosis factor alpha (TNF-a).
  • CCL13 C-reactive protein
  • the provided methods relate to identifying subjects, prior to receiving an immunotherapy, such as a cell therapy (e.g. CAR-T cells), who may achieve pharmacokinetic parameters within a therapeutic window or range.
  • an immunotherapy such as a cell therapy (e.g. CAR-T cells)
  • the provided methods relate to identifying subjects, prior to or after receiving an immunotherapy or cell therapy, for modulating the immunotherapy or cell therapy, e.g., by administration of agent to the subject capable of modulating, optionally increasing or decreasing, CAR+ T cell expansion,
  • the methods can be used to determine if the subject should be closely monitored following the administration of the immunotherapy, is a candidate for outpatient therapy or should receive treatment of the therapy in a hospital setting and/or is a candidate for receiving an agent capable of modulating CAR+ T cell expansion and/or proliferation and/or an intervention of preventing, treating or ameliorating a risk of a toxicity.
  • the sample is taken, collected, and/or obtained from a subject that has or is suspected of having a condition or disease.
  • the subject has or is suspected of having a cancer or proliferative disease.
  • the subject has a disease or condition, or is suspected of having a disease or condition, that is associated with an antigen and/or is associated with diseased cells that express the antigen.
  • the disease or condition e.g., a cancer or proliferative disorder
  • avb6 integrin B cell maturation antigen
  • BCMA B7-H3, B7-H6, carbonic anhydrase 9
  • CA9 also known as CAIX or G250
  • CAG cancer/testis antigen 1B
  • CEA carcinoembryonic antigen
  • CSPG4 C-C Motif Chemokine Ligand 1 (CCL-l)
  • Antigens targeted by the receptors include antigens associated with a B cell malignancy, such as any of a number of known B cell marker.
  • the antigen is or includes CD20, CD19, CD22, ROR1, CD45, CD21, CD5, CD33, Igkappa, Iglambda, CD79a, CD79b or CD30.
  • the subject has a disease or condition, or is suspected of having a disease or condition, that is associated with CD19 and/or is associated with diseased cells that express CD19.
  • the sample is taken, collected, and/or obtained from a subject that has or is suspected of having a cancer or proliferative disease that is a B cell malignancy or hematological malignancy.
  • the cancer or proliferative disease is a myeloma, e.g., a multiple myeloma (MM), a lymphoma or a leukemia, lymphoblastic leukemia (ALL), non-Hodgkin’s lymphoma (NHL), chronic lymphocytic leukemia (CLL), a diffuse large B-cell lymphoma (DLBCL), and/or acute myeloid leukemia (AML).
  • the cancer or proliferative disorder is ALL.
  • the subject has, or is suspected of having ALL.
  • the ALL is adult ALL.
  • the ALL is pediatric ALL.
  • kits for modulating the expansion, proliferation and/or activity of the administered cells e.g., CAR+ T cells, based on assessment and/or determination of the parameters, e.g., pharmacokinetic parameters and/or other parameters such as patient attributes and/or expression of a biomarker.
  • the method involves administering agents that modulate, such as increase or decrease, the expansion, proliferation and/or activity of the administered cells, e.g., CAR+ T cells, depending on the determination of the parameters.
  • an agent is administered if the genetically engineered cells are not within the therapeutic range based on assessment of the parameters, e.g., pharmacokinetic parameters, such as maximum or peak CAR+ cell
  • the agent is an agent that increases, augments or boosts the proliferation and/or expansion of the CAR+ T cells. In some embodiments, the agent is an agent that decreases, reduces, and/or dampens the proliferation and/or expansion of the CAR+ T cells.
  • the agent can be administered sequentially, intermittently, or at the same time as or in the same composition as the therapy, such as cells for adoptive cell therapy.
  • the agent is administered before, simultaneously with, intermittently with, during, during the course of or after administration of the cells, e.g., cells expressing a recombinant receptor, e.g. CAR.
  • such agents include agents that modulate the cell expansion and/or activity of the administered cells, e.g., immune cells, such as T cells.
  • such agents include agents that reduce or decrease the expansion and/or proliferation of the cell expansion and/or activity of the administered cells, e.g., immune cells, such as T cells.
  • the agent is administered at a time that is greater than or greater than at or about 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 15 days, 16 days, 17 days, 18 days, 19 days, 20 days or 21 days after initiation of administration of the genetically engineered cells. In some embodiments, the agent is administered at a time that is between or between about 11 to 22 days, 12 to 18 days or 14 to 16 days, each inclusive, after initiation of administration of the genetically engineered cells.
  • the agent is administered at a time as described herein and in accord with the provided methods, and/or with the provided articles of manufacture or compositions. In some embodiments, the agent is administered at a time that is within, such as less than or no more than, 3, 4, 5, 6, 7, 8, 9 or 10 days after initiation of the immunotherapy and/or cell therapy. In some embodiments, the agent is administered within or within about 1 day, 2 days or 3 days after initiation of administration of the immunotherapy and/or cell therapy.
  • the agent can be administered sequentially, intermittently, or at the same time as or in the same composition as the immunotherapy and/or cell therapy, e.g., cells for adoptive cell therapy, or initiation thereof.
  • the agent is administered prior to, simultaneously with, during and/or subsequent to initiation of administration of the cell therapy, and/or during the course of the cell therapy.
  • the agent is administered from or from about 0 to 96 hours, 0 to 72 hours, 0 to 48 hours, 0 to 24 hours, 0 to 12 hours or 0 to 6 hours or 0 to 2 hours prior to initiation of the T cell therapy; or the agent is administered no more than 96 hours, 72 hours, 48 hours, 24 hours, 12 hours, 6 hours, 2 hours or 1 hour prior to initiation of the T cell therapy.
  • the method involves administering to the subject a therapeutically effective amount of the agent at a time prior to administration of the cell therapy, e.g., adoptive cell therapy.
  • the agent is administered about 24 hours or less prior to the administration of the cells for cell therapy.
  • the agent is administered at about 24, 22, 20, 18, 16, 14, 12, 10, 8, 6, 4 or 2 hours or less prior to the administration of the cells or initiation thereof.
  • the agent is administered simultaneously or near simultaneous with the cell therapy or initiation thereof, e.g., with about 1, 2, 3 or 4 hours of initiation of the cell therapy.
  • the agent can be administered greater than at or about 1 hour,
  • the agent may be administered no later than 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 18 hours, 24 hours, 36 hours, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days or 10 days or more following administration of the cell therapy or initiation thereof.
  • the agent may be administered no later than 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 18 hours, 24 hours, 36 hours, 2 days, 3 days, 4 days, or 5 days or more following administration of the cell therapy or initiation thereof.
  • the agent can be administered between at or about 1 hour and at or about 5 days or at or about 4 hours and at or about 5 days following administration of cell therapy, such as between at or about 1 hour and at or about 5 days, at or about 4 hours and at or about 4 days, at or about 8 hours and at or about 3 days, at or about 1 day and at or about 3 days, at or about 2 days and at or about 3 days, or at or about 1 day and at or about 2 days following administration of cell therapy or initiation thereof.
  • the agent is administered at or about 1 day, at or about 2 days, or at or about 3 days following the administration of cell therapy or initiation thereof.
  • the subject is treated with the agent within 3 days, within 2 days or within 1 day after administration of the cell therapy or initiation thereof.
  • the agent can be administered greater than at or about 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 18 hours, 24 hours, 36 hours, 2 days, 3 days, 4 days, or 5 days or more following administration of the cell therapy or initiation thereof.
  • the agent may be administered no later than at or about 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 18 hours, 24 hours, 36 hours, 2 days, 3 days, 4 days, or 5 days or more following administration of the cell therapy or initiation thereof.
  • the agent or therapy or intervention is administered alone or is administered as part of a composition or formulation, such as a pharmaceutical composition or formulation, as described herein.
  • a composition or formulation such as a pharmaceutical composition or formulation, as described herein.
  • the agent alone or as part of a pharmaceutical composition can be administered intravenously or orally, or by any other acceptable known route of administration or as described herein.
  • the methods include methods involving the combined administration, e.g. simultaneous or sequential administration, with a drug or agent capable of augmenting, boosting or enhancing the expansion, proliferation, survival, potency and/or efficacy of the administered cells, e.g., recombinant receptor expressing cells.
  • a drug or agent capable of augmenting, boosting or enhancing the expansion, proliferation, survival, potency and/or efficacy of the administered cells, e.g., recombinant receptor expressing cells.
  • such agent is administered to achieve a peak CAR+ T cell expansion in the therapeutic range.
  • the dose of administered cells is sub-optimal and the combined administration of the agent boosts or augments expansion to achieve peak CAR+ T cells in the blood in the therapeutic range.
  • the method includes administering a dose of cells and monitoring the peak CAR+ T cells in the blood to ensure that the therapeutic range is maintained or achieved and, if it is not, administering an agent or compound to boost or augment the therapeutic dose.
  • low or limited expansion of cells e.g., at low pharmacokinetic parameters such as low maximum CAR+ T cell concentration (C max ), tumor suppression effect may be limited.
  • the agent is administered before, during, during the course of or after administration of the cells, e.g., cells expressing a recombinant receptor, e.g. CAR.
  • such agents include agents that specifically augment, boost or enhance the expansion, proliferation, survival, potency and/or efficacy of the engineered cells by virtue of specifically modulating the transgene, e.g., transgene encoding a recombinant receptor.
  • such agents include agents that modulate the cell expansion and/or activity of the administered cells, e.g., immune cells, such as T cells.
  • the administered cell e.g., cells engineered to express a recombinant receptor
  • the administered cell are modified to augment, boost or enhance the expansion, proliferation, survival, potency and/or efficacy of the administered cells.
  • the administered cell e.g., cells engineered to express a recombinant receptor
  • the agent minimize the effects of inhibitory factors that suppress the proliferation, expansion and/or survival of the engineered cells in vivo.
  • the additional agent is a small molecule, a peptide, a polypeptide, an antibody or antigen-binding fragment thereof, an antibody mimetic, an aptamer or a nucleic acid molecule (e.g. siRNA), a lipid, a polysaccharide or any combination thereof.
  • the additional agent is an inhibitor or an activator of a particular factor, molecule, receptor, function and/or enzyme.
  • the additional agent is an agonist or an antagonist of a particular factor, molecule, receptor, function and/or enzyme.
  • the additional agent is an analog or a derivative of one or more factors and/or metabolites.
  • the additional agent is a protein or polypeptide.
  • the additional agent is a cell, e.g., an engineered cell, such as an additional dose of the same engineered cell that was administered and/or a different engineered cell.
  • the agent is capable of transgene- specific expansion.
  • exemplary methods or agents for transgene-specific expansion include endogenous antigen exposure, vaccination, anti-idiotype antibodies or antigen-binding fragment thereof and/or regulatable recombinant receptor.
  • methods for transgene-specific expansion include vaccination methods.
  • the agent is a peptide vaccine or a cell-based vaccine, e.g. cells engineered to express a particular antigen recognized by the recombinant receptor (see, e.g., WO 2016/069647, WO 2011/066048, US 2016/0304624, US Pat. No.
  • the methods for transgene- specific expansion include administering anti-idiotype antibodies.
  • Anti-idiotype antibodies including antigen-binding fragments thereof, specifically recognizes, is specifically targeted to, and/or specifically binds to an idiotope of an antibody or an antigen binding fragment thereof, e.g., the antigen-binding domain of a recombinant receptor such as a chimeric antigen receptor (CAR).
  • An idiotope is any single antigenic determinant or epitope within the variable portion of an antibody.
  • the anti-idiotype antibodies or antigen-binding fragments thereof are agonists and/or exhibit specific activity to stimulate cells expressing a particular antibody including conjugates or recombinant receptors containing the same or an antigen-binding fragment thereof (see, e.g., U.S. Pat. Publication Nos. US 2016/0096902; US 2016/0068601; US 2014/0322183; US 2015/0175711; US 2015/283178; U.S. Pat. No. 9,102,760; Jena et al.
  • the methods include modulating the expansion of the engineered cells, for example, by inhibiting negative regulator of proliferation, expansion and/or activation of administered cells, e.g., engineered immune cells.
  • administered cells e.g., engineered immune cells.
  • environment in the body of the subject administered cells expressing the recombinant receptor can encounter an environment that represses or suppresses the growth, proliferation, expansion and/or survival of the cells, e.g. immunosuppressive environment.
  • immunosuppressive environments can contain immunosuppressive cytokines, regulatory modulators and co-inhibitory receptors.
  • an additional agent can be used to modulate the expansion of the administered cells, e.g., overcome suppressive environments.
  • the additional agent includes an immunomodulatory agent, immune checkpoint inhibitor, modulators of metabolic pathways, adenosine pathway or adenosine receptor antagonist or agonist and modulators of signaling pathways, e.g., kinase inhibitors.
  • the additional agent is an immunomodulatory agent, such as an immune checkpoint inhibitor.
  • the additional agent increases, enhances or augments the expansion and/or proliferation of the administered cells and thereby increases, enhances or augments the immune response by blocking an immune checkpoint protein (i.e., immune checkpoint inhibitor).
  • the additional agent is an agent that enhances the activity of the engineered cell, e.g., a recombinant receptor-expressing cell, is a molecule that inhibits an immune inhibitory molecule or an immune checkpoint molecule.
  • immune inhibitory molecules examples include PD-l, PD-L1, CTLA4, TEVI3, CEACAM (e.g., CEACAM-l, CEACAM-3 and/or CEACAM-5), LAG3, VISTA, BTLA, TIGIT, LAIR1, CD160, 2B4 and TGFpR.
  • the immune checkpoint inhibitor can be an antibody directed against an immune checkpoint protein, such as an antibody directed against cytotoxic T-lymphocyte antigen 4 (CTLA4 or CD 152), programmed cell death protein 1 (PD-l), or programmed cell death protein 1 ligand 1 (PD-L1) (see, e.g., Pardoll, Nat Rev Cancer. 2012 Mar. 22; l2(4):252-264).
  • Immune checkpoint inhibitors include any agent that blocks or inhibits in a statistically significant manner, the inhibitory pathways of the immune system. Such inhibitors may include small molecule inhibitors or may include antibodies, or antigen binding fragments thereof, that bind to and block or inhibit immune checkpoint receptors, ligands and/or receptor- ligand interaction. In some embodiments, modulation, enhancement and/or stimulation of particular receptors can overcome immune checkpoint pathway components.
  • Illustrative immune checkpoint molecules that may be targeted for blocking, inhibition, modulation, enhancement and/or stimulation include, but are not limited to, PD-l (CD279), PD-L1 (CD274, B7-H1), PDL2 (CD273, B7-DC), CTLA-4, LAG-3 (CD223), TIM-3, 4-1BB (CD137), 4-1BBL (CD137L), GITR (TNFRSF18, AITR), CD40, 0X40 (CD134, TNFRSF4), CXCR2, tumor associated antigens (TAA), B7-H3, B7-H4, BTLA, HVEM, GAL9, B7H3, B7H4, VISTA, KIR, 2B4 (belongs to the CD2 family of molecules and is expressed on all NK, gd, and memory CD8+ (ab) T cells), CD160 (also referred to as BY55), CGEN-15049, CEACAM (e.g.,
  • CEACAM-l, CEACAM-3 and/or CEACAM-5 TIGIT, LAIR1, CD160, 2B4, CD80, CD86, B7-H3 (CD276), B7-H4 (VTCN1), HVEM (TNFRSF14 or CD270), KIR, A2aR, MHC class I, MHC class II, GAL9, adenosine, and a transforming growth factor receptor (TGFR; e.g., TGFR beta).
  • Immune checkpoint inhibitors include antibodies, or antigen binding fragments thereof, or other binding proteins, that bind to and block or inhibit and/or enhance or stimulate the activity of one or more of any of the said molecules.
  • Exemplary immune checkpoint inhibitors include Tremelimumab (CTLA-4 blocking antibody, also known as ticilimumab, CP-675,206), anti-OX40, PD-L1 monoclonal antibody (Anti-B7-Hl; MEDI4736), MK-3475 (PD-l blocker), nivolumab (anti-PD-l antibody), CT-011 (anti-PD-l antibody), BY55 monoclonal antibody, AMP224 (anti-PD-Ll antibody), BMS- 936559 (anti-PD-Ll antibody), MPLDL3280A (anti-PD-Ll antibody), MSB0010718C (anti- PD-Ll antibody) and ipilimumab (anti-CTLA-4 antibody, also known as Yervoy®, MDX-010 and MDX-101).
  • CTLA-4 blocking antibody also known as ticilimumab, CP-675,206
  • Anti-OX40 PD-L1 monoclonal antibody
  • immunomodulatory antibodies include, but are not limited to, Daclizumab (Zenapax), Bevacizumab (Avastin ®), Basiliximab, Ipilimumab, Nivolumab, pembrolizumab, MPDL3280A, Pidilizumab (CT-011), MK-3475, BMS-936559, MPDL3280A (Atezolizumab), tremelimumab, IMP321, BMS-986016, LAG525, urelumab, PL-05082566, TRX518, MK-4166, dacetuzumab (SGN-40), lucatumumab (HCD122), SEA-CD40, CP-870, CP-893, MEDI6469, MEDI6383, MOXR0916, AMP-224, MSB0010718C (Avelumab), MEDI4736, PDR001, rHIgMl2B7, Ulocuplum
  • immunomodulators include, e.g., afutuzumab (available from Roche®); pegfilgrastim
  • CC4047 CC4047
  • IRX-2 mixture of human cytokines including interleukin 1, interleukin 2, and interferon .gamma., CAS 951209-71-5, available from IRX Therapeutics.
  • the agent includes a molecule that decreases the regulatory T cell (Treg) population.
  • Treg regulatory T cell
  • Methods that decrease the number of (e.g., deplete) Treg cells are known in the art and include, e.g., CD25 depletion, cyclophosphamide administration, and modulating Glucocorticoid-induced TNLR family related gene (GITR) function.
  • GITR is a member of the TNLR superfamily that is upregulated on activated T cells, which enhances the immune system.
  • the agent includes a molecule targeting GITR and/or modulating GITR functions, such as a GITR agonist and/or a GITR antibody that depletes regulatory T cells (Tregs).
  • the agent includes cyclophosphamide.
  • the GITR binding molecule and/or molecule modulating GITR function is administered prior to the engineered cells, e.g., CAR-expressing cells.
  • the GITR agonist can be administered prior to apheresis of the cells.
  • cyclophosphamide is administered to the subject prior to administration (e.g., infusion or re-infusion) of the engineered cells, e.g., CAR-expressing cells or prior to apheresis of the cells.
  • cyclophosphamide and an anti-GITR antibody are administered to the subject prior to administration (e.g., infusion or re-infusion) of the engineered cells, e.g., CAR-expressing cells or prior to apheresis of the cells.
  • the agent is a GITR agonist.
  • GITR agonists include, e.g., GITR fusion proteins and anti-GITR antibodies (e.g., bivalent anti-GITR antibodies) such as, e.g., a GITR fusion protein described in U.S. Patent No. 6,111,090,
  • An exemplary anti-GITR antibody is TRX518.
  • the agent is a structural or functional analog or derivative of thalidomide and/or an inhibitor of E3 ubiquitin ligase. In some embodiments, the
  • immunomodulatory agent binds to cereblon (CRBN).
  • CRBN cereblon
  • immunomodulatory agent binds to the CRBN E3 ubiquitin-ligase complex.
  • the immunomodulatory agent binds to CRBN and the CRBN E3 ubiquitin-ligase complex. In some embodiments, the immunomodulatory agent up-regulates the protein or gene expression of CRBN. In some aspects, CRBN is the substrate adaptor for the CRL4 CRBN E3 ubiquitin ligase, and modulates the specificity of the enzyme. In some embodiments, binding to CRB or the CRBN E3 ubiquitin ligase complex inhibits E3 ubiquitin ligase activity.
  • the immunomodulatory agent induces the ubiqutination of KZF1 (Ikaros) and IKZF3 (Aiolos) and/or induces degradation of IKZF1 (Ikaros) and IKZF3 (Aiolos).
  • the immunomodulatory agent induces the ubiquitination of casein kinase 1A1 (CKla) by the CRL4 E3 ubiquitin ligase.
  • the ubiquitination of CKla results in CKla degradation.
  • the agent is an inhibitor of the Ikaros (IKZF1) transcription factor.
  • the agent enhances ubiquitination of Ikaros.
  • the agent enhances the degradation of Ikaros.
  • the agent down-regulates the protein or gene expression of Ikaros.
  • administration of the agent causes a decrease in Ikaros protein levels.
  • the agent is an inhibitor of the Aiolos (IKZF3) transcription factor. In some embodiments, the agent enhances ubiquitination of Aiolos. In some embodiments,
  • the agent enhances the degradation of Aiolos. In some embodiments, the agent down-regulates the protein or gene expression of Aiolos. In some embodiments, administration of the agent causes a decrease in Aiolos protein levels.
  • the agent is thalidomide (2-(2,6-dioxopiperidin-3-yl)-lH- isoindole- l,3(2H)-dione) or an analog or derivative of thalidomide.
  • a thalidomide derivative includes structural variants of thalidomide that have a similar biological activity.
  • Exemplary thalidomide derivatives include, but are not limited to lenalidomide (REVLIMMUNOMODULATORY COMPOUNDTM; Celgene Corporation), pomalidomide (also known as ACTIMMUNOMODULATORY COMPOUNDTM or POMALYSTTM (Celgene Corporation)), CC-1088, CDC-501, and CDC- 801, and the compounds disclosed in U.S. Pat. Nos. 5,712,291; 7,320,991; and 8,716,315; U.S. Appl. No. 2016/0313300; and PCT Pub. Nos. WO 2002/068414 and WO 2008/154252.
  • the agent is l-oxo- and 1,3 dioxo-2-(2,6-dioxopiperldin-3-yl) isoindolines substituted with amino in the benzo ring as described in U.S. Pat. No. 5,635,517 which is incorporated herein by reference.
  • the agent is a compound that belongs to a class of isoindole- immunomodulatory compounds disclosed in U.S. Pat. No. 7,091,353, U.S. Patent Publication No. 2003/0045552, and International Application No. PCT/USOI/50401 (International
  • the agent is [2-(2,6-dioxo-piperidin-3-yl)-l,3-dioxo-2,3- dihydro-lH-isoindol-4-ylmethyl] -amide; (2-(2,6-dioxo-piperidin-3-yl)-l,3-dioxo-2,3-dihydro- lH-isoindol-4-ylmethyl)-carbamic acid tert-butyl ester; 4-(aminomethyl)-2-(2,6-dioxo(3- piperidyl))-isoindoline-l,3-dione; N-(2-(2,6-dioxo-piperidin-3-yl)- l,3-dioxo-2, 3-dihydro- 1H- isoindol-4-
  • the agent is lenalidomide, pomalidomide, avadomide, a stereoisomer of lenalidomide, pomalidomide, avadomide or a pharmaceutically acceptable salt, solvate, hydrate, co-crystal, clathrate, or polymorph thereof.
  • the immunomodulatory compound is lenalidomide, a stereoisomer of lenalidomide or a
  • the immunomodulatory compound is lenalidomide, or ((RS)-3-(4-Amino-l- oxo- 1 ,3 -dihydro-2H-isoindol-2-yl)piperidine-2,6-dione) .
  • the methods include contacting the cells expressing the recombinant receptor with an agent that inhibits inhibitory cell surface receptors, e.g.,
  • TGFpR transforming growth factor beta receptor
  • administered cells e.g., recombinant receptor expressing cells, can be engineered to resist the effects of
  • the additional agent is an anti-TGFp antibody or an anti-TGFpR antibody (see, e.g., WO 2011/109789).
  • the additional agent modulates the metabolism, signaling and/or transport of immunosuppressive factors, e.g., adenosine.
  • the additional agent is an inhibitor of extracellular adenosine or adenosine receptor, or an agent that causes a reduction or a decrease of extracellular adenosine levels, such as an agent that prevents the formation of, degrades, renders inactive, and/or decreases extracellular adenosine.
  • the additional agent is an adenosine receptor antagonist such as the A2a, A2b and/or A3 receptor.
  • the antagonist is a peptide, or a pepidomimetic, that binds the adenosine receptor but does not trigger a Gl protein dependent intracellular pathway.
  • adenosine receptor antagonists are described in U.S. Pat. Nos. 5,565,566; 5,545,627, 5,981,524; 5,861,405; 6,066,642; 6,326,390; 5,670,501; 6,117,998; 6,232,297; 5,786,360;
  • the agent is an A2 receptor (A2R) antagonist, such as an A2a antagonist.
  • A2R antagonists include KW6002 (istradefyline), SCH58261, caffeine, paraxanthine, 3,7-dimethyl-l-propargylxanthine (DMPX), 8-(m-chlorostyryl) caffeine (CSC), MSX-2, MSX-3, MSX-4, CGS-15943, ZM-241385, SCH-442416, preladenant, vipadenant (BII014), V2006, ST-1535, SYN-115, PSB-1115, ZM241365, FSPTP, and an inhibitory nucleic acid targeting A2R expression, e.g., siRNA or shRNA, or any antibodies or antigen-binding fragment thereof that targets an A2R.
  • the agent is an A2R antagonist described in, e.g., Ohta et al., Proc Natl Acad Sci U S A (2006) 103:13132-13137; Jin et al., Cancer Res. (2010) 70(6):2245-2255; Leone et al., Computational and Structural Biotechnology Journal (2015) 13:265-272; Beavis et al., Proc Natl Acad Sci U S A (2013) 110:14711-14716; and Pinna, A., Expert Opin Investig Drugs (2009) 18:1619-1631; Sitkovsky et al., Cancer Immunol Res (2014) 2(7):598-605; US 8,080,554; US 8,716,301; US 20140056922;
  • the methods include administering additional agents that are immuno stimulatory.
  • the additional agent can generally promote the proliferation, expansion, survival, potency and/or efficacy of immune cells.
  • the additional agent can specifically promote administered cells, e.g., recombinant receptor-expressing cells.
  • the additional agent is a cytokine.
  • the additional agent is a ligand.
  • the additional agent is an immuno stimulatory ligand, e.g., CD40L.
  • the additional agent is a cytokine, e.g., IL-2, IL-3, IL-6, IL-l l, IL-7, IL-12, IL-15, IL-21, granulocyte macrophage colony stimulating factor (GM-CSF), alpha, beta or gamma interferon (IFN) and erythropoietin (EPO).
  • the agent is a cytokine.
  • the immunomodulatory agent is a cytokine or is an agent that induces increased expression of a cytokine in the tumor microenvironment. Cytokines have important functions related to T cell expansion, differentiation, survival, and homeostasis.
  • Cytokines that can be administered to the subject receiving the cells and/or compositions provided herein include one or more of IL-2, IL-4, IL-7, IL-9, IL-15, IL-18, and IL-21.
  • the cytokine administered is IL-7, IL-15, or IL-21, or a combination thereof.
  • administration of the cytokine to the subject that has sub-optimal response to the administration of the engineered cells, e.g., CAR-expressing cells improves potency and/or efficacy and/or anti-tumor activity of the administered cells, e.g., CAR-expressing cells.
  • the agent is an inhibitor of hypoxia inducible factor 1 alpha (HIF-la) signaling.
  • HIF-la hypoxia inducible factor 1 alpha
  • exemplary inhibitors of HIF-la include digoxin, acriflavine, sirtuin-7 and ganetespib.
  • the agent includes a protein tyrosine phosphatase inhibitor, e.g., a protein tyrosine phosphatase inhibitor described herein.
  • the protein tyrosine phosphatase inhibitor is an SHP-l inhibitor, e.g., an SHP-l inhibitor described herein, such as, e.g., sodium stibogluconate.
  • the protein tyrosine phosphatase inhibitor is an SHP-2 inhibitor, e.g., an SHP-2 inhibitor described herein.
  • the method results in at least a 2-fold, at least a 4-fold, at least a 10- fold, or at least a 20-fold increase in copies of nucleic acid encoding the recombinant receptor, e.g., CAR, per microgram of DNA, e.g., in the serum, plasma, blood or tissue, e.g., tumor sample, of the subject (from old section, move to method of modulation section)
  • the recombinant receptor e.g., CAR
  • the method results in high in vivo proliferation of the administered cells, for example, as measured by flow cytometry.
  • high peak proportions of the cells are detected.
  • at a peak or maximum level or concentration following the administration of the T cells, e.g., CAR-expressing T cells, in the blood or disease-site of the subject or white blood cell fraction thereof, e.g., PBMC fraction or T cell fraction at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, or at least about 90% of the cells express the recombinant receptor, e.g., the CAR.
  • the method results in a maximum concentration, in the blood or serum or other bodily fluid or organ or tissue of the subject, of at least 100, 500, 1000, 1500, 2000, 5000, 10,000 or 15,000 copies of or nucleic acid encoding the receptor, e.g., the CAR, per microgram of DNA, or at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, or 0.9 receptor-expressing, e.g., CAR-expressing cells per total number of peripheral blood mononuclear cells (PBMCs), total number of mononuclear cells, total number of T cells, or total number of microliters of the blood or serum or other bodily fluid or organ or tissue of the subject.
  • PBMCs peripheral blood mononuclear cells
  • the cells expressing the receptor are detected as at least 10, 20, 30, 40, 50, or 60% of total PBMCs in the blood of the subject, and/or at such a level for at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 24, 36, 48, or 52 weeks following the T cells, e.g., CAR-expressing T cells or for 1, 2, 3, 4, or 5, or more years following such administration.
  • the provided methods and articles of manufacture can be used in connection with, or involve or include, one or more agents or treatments capable of modulating, e.g., increasing or decreasing, CAR+ T cell expansion, proliferation, and/or activity.
  • the agent is capable of reducing, decreasing, and/or dampening CAR+ T cell expansion and/or proliferation.
  • expansion and/or proliferation of CAR+ T cells above a certain threshold value, or high expression of certain biomarkers, such as inflammatory markers can be associated with a reduced response and/or reduced durable response.
  • the administered cells in the subject are determined to have very high or excessive expansion, or if the subject is determined to express biomarkers associated with very high expansion or excessive expansion, the subject may be determined not likely to achieve response and/or durable response.
  • very high expansion or excessive expansion is also associated with high tumor burden and inflammatory cytokine production.
  • an agent that can reduce, decrease and/or dampen CAR+ T cell expansion and/or proliferation can be administered to such subjects.
  • optimal efficacy of an administered cell therapy can depend on the ability of the administered cells to become activated, expand, to exert various effector functions, to persist, including long-term, to differentiate, transition or engage in reprogramming into certain phenotypic states (such as long-lived memory, less-differentiated, and effector states), to avoid or reduce immunosuppressive conditions in the local
  • microenvironment of a disease to provide effective and robust recall responses following clearance and re-exposure to target ligand or antigen, and avoid or reduce exhaustion, anergy, peripheral tolerance, terminal differentiation, and/or differentiation into a suppressive state.
  • excessive or very high expansion or proliferation of the administered T cells may result in exhaustion, anergy, peripheral tolerance, terminal differentiation, and/or differentiation into a suppressive state.
  • an agent that can reduce, decrease and/or dampen CAR+ T cell expansion and/or proliferation can prevent or reduce such exhaustion or differentiation.
  • the administration of the agent is capable of reducing, decreasing, and/or dampening CAR+ T cell expansion and/or proliferation, such as a steroid, can result in reduced expansion of the administered CAR+ T cells.
  • administration of the agent can result in changes in parameters, e.g., reduced volumetric measures, e.g., SPD, or expression of inflammatory markers, e.g., LDH.
  • the agent capable of reducing, decreasing, and/or dampening CAR+ T cell expansion and/or proliferation is a steroid, is an antagonist or inhibitor of a cytokine receptor, such as IL-6 receptor, CD 122 receptor (IL-2Rbeta receptor), or CCR2, or is an inhibitor of a cytokine, such as IL-6, MCP-l, IL-10, IFN-g, IL-8, or IL-18.
  • the agent is an agonist of a cytokine receptor and/or cytokine, such as TGF-b.
  • the agent e.g., agonist, antagonist or inhibitor, is an antibody or antigen binding fragment, a small molecule, a protein or peptide, or a nucleic acid.
  • the agent capable of reducing, decreasing, and/or dampening CAR+ T cell expansion and/or proliferation is a steroid, e.g., corticosteroid.
  • Corticosteroids typically include glucocorticoids and mineralocorticoids.
  • glucocorticoids include synthetic and non-synthetic glucocorticoids.
  • glucocorticoids include, but are not limited to: alclomethasones, algestones, beclomethasones (e.g. beclomethasone dipropionate), betamethasones (e.g. betamethasone 17- valerate, betamethasone sodium acetate, betamethasone sodium phosphate, betamethasone valerate), budesonides, clobetasols (e.g.
  • clobetasol propionate clobetasones
  • clocortolones e.g. clocortolone pivalate
  • cloprednols corticosterones
  • cortisones cortisones
  • hydrocortisones e.g.
  • hydrocortisone acetate hydrocortisone acetate
  • cortivazols deflazacorts
  • desonides desoximethasones
  • dexamethasones e.g. dexamethasone 2l-phosphate, dexamethasone acetate, dexamethasone sodium phosphate
  • diflorasones e.g. diflorasone diacetate
  • diflucortolones difluprednates
  • flunoxolones fluazacorts
  • flucloronides fludrocortisones
  • flumethasones e.g. flumethasone pivalate
  • flunisolides e.g.
  • fluocinolone acetonide fluocinonides, fluocortins, fluocortolones, fluorometholones (e.g. fluorometholone acetate), fluperolones (e.g., fluperolone acetate), fluprednidenes, fluprednisolones,
  • flurandrenolides e.g. fluticasone propionate
  • formocortals e.g. fluticasone propionate
  • halcinonides e.g. fluticasone propionate
  • halobetasols e.g. fluticasone propionate
  • halometasones e.g. halopredones
  • hydrocortamates e.g. hydrocortisones
  • prednisolone 25-diethylaminoacetate prednisolone sodium phosphate, prednisolone 21 -hemisuccinate, prednisolone acetate; prednisolone farnesylate, prednisolone hemisuccinate, prednisolone-21 (beta-D-glucuronide), prednisolone metasulphobenzoate, prednisolone steaglate, prednisolone tebutate, prednisolone tetrahydrophthalate), prednisones, prednivals, prednylidenes, rimexolones, tixocortols, triamcinolones (e.g.
  • the steroid is administered prior to, concurrently with and/or after administration of an immunotherapy and/or cell therapy, such as cell therapy with an engineered cell composition as described herein.
  • the steroid is administered after administration of the immunotherapy and/or cell therapy, or a first administration or dose thereof, or after the initiation of any of the foregoing.
  • the steroid is administered within at or about at or about 12, 18, 24, 36 or 48 hours, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 days or more, or 2, 3, 4, 5, 6, 7, 8, 9, 10 weeks or more, after administration of the immunotherapy and/or cell therapy, or a first administration or dose thereof, or after the initiation of any of the foregoing.
  • the steroid is administered within at or about 12, 24, 36 or 48 hours, or within at or about 2, 3, or 4 days after administration of the immunotherapy and/or cell therapy, or a first administration or dose thereof, or after the initiation of any of the foregoing.
  • the steroid e.g., corticosteroid
  • the steroid is administered in multiple doses over a period of time.
  • the steroid e.g., corticosteroid
  • the steroid e.g., corticosteroid
  • the steroid can be administered over a period of more than at or about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 days or more, or more than at or about 2, 3, 4, 5, 6, 7, 8, 9, 10 weeks or more, or within at or about a range defined by any of the foregoing.
  • the steroid e.g., corticosteroid
  • the steroid e.g., corticosteroid
  • the steroid can be administered in multiple or repeat doses over a total duration of about 6, 12, 18, 24 hours or more, or 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 days or more, or 2, 3, 4, 5, 6, 7, 8, 9, 10 weeks or more, or within at or about a range defined by any of the foregoing.
  • the steroid, e.g., corticosteroid can be administered one per day, twice per day, or three times or more per day.
  • the steroid, e.g., corticosteroid can be administered at least or at least about every 1, 2, 3, 4, 5,
  • the steroid e.g., glucocorticoid
  • the steroid e.g., corticosteroid or glucocorticoid
  • the corticosteroid can be administered one per day, twice per day, or three times or four times or more per day. In some embodiments, the corticosteroid can be administered at least or at least about every 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 18, 24, 36, 48 hours or more, or within at or about a range defined by any of the foregoing.
  • the steroid is dexamethasone, and the dexamethasone is administered in multiple doses over a period of time.
  • the dexamethasone can be administered over a period of more than at or about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 days or more, or more than at or about 2, 3, 4, 5, 6, 7, 8, 9, 10 weeks or more, or within at or about a range defined by any of the foregoing.
  • the dexamethasone can be administered in multiple or repeat doses over a total duration of about 6, 12, 18, 24 hours or more, or 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 days or more, or 2, 3, 4, 5, 6, 7, 8, 9, 10 weeks or more, or within at or about a range defined by any of the foregoing.
  • the dexamethasone can be administered one per day, twice per day, or three times or more per day.
  • the dexamethasone is administered daily, for up to 2, 3, 4, 5, 6, 7, 8, 9,
  • the steroid e.g., dexamethasone
  • the steroid is first administered after initiation of the an immunotherapy and/or cell therapy, and subsequently administered in multiple doses over a period of time.
  • the initial administration of the steroid, e.g., dexamethasone is within at or about 12, 18, 24, 36 or 48 hours, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 days or more, or 2, 3, 4, 5, 6, 7, 8, 9, 10 weeks or more, after administration of the immunotherapy and/or cell therapy, or a first administration or dose thereof, or after the initiation of any of the foregoing.
  • the steroid e.g., dexamethasone
  • the steroid is first administered within at or about 12, 24, 36 or 48 hours, or within at or about 2, 3, or 4 days after administration of the immunotherapy and/or cell therapy, or a first administration or dose thereof, or after the initiation of any of the foregoing.
  • the administration of the steroid, e.g., dexamethasone is subsequently administered over a period of more than at or about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 days or more, or more than at or about 2, 3, 4, 5, 6, 7, 8, 9, 10 weeks or more, or within at or about a range defined by any of the foregoing.
  • the steroid e.g., dexamethasone
  • the steroid can be administered beginning at within at or about 12, 24, 36 or 48 hours, or within at or about 2, 3, or 4 days after the initial administration of the cell therapy, and administered in multiple or repeat doses until about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 days or more, or 2, 3, 4, 5, 6, 7, 8, 9, 10 weeks or more after the initial administration of the cell therapy.
  • the steroid, e.g., dexamethasone is can be administered one per day, twice per day, or three times or more per day, during the period of administration. In some
  • the steroid e.g., dexamethasone
  • the steroid can be administered, beginning at day 1, 2, 3, 4, or 5 after the initial administration of the cell therapy, and ending at days 6, 7, 8, 9, 10, 11, 12, 13, 14 days or week 2, 3 or 4 after the initial administration of the cell therapy.
  • the glucocorticoid is selected from among cortisones,
  • dexamethasones hydrocortisones, methylprednisolones, prednisolones and prednisones.
  • the glucocorticoid is dexamethasone.
  • the agent is a corticosteroid and is administered in an amount that is therapeutically effective to reduce, decrease and/or dampen CAR+ T cell expansion and/or proliferation.
  • indicators of improvement or successful treatment include determination of pharmacokinetic parameters, e.g., any described herein, such as peak CAR+ T cell concentration and/or AUC.
  • the corticosteroid is provided in a therapeutically effective dose.
  • Therapeutically effective concentration can be determined empirically by testing in known in vitro or in vivo (e.g. animal model) systems.
  • animal models can be employed to help identify optimal dosage ranges.
  • the precise dosage, which can be determined empirically, can depend on the particular therapeutic preparation, the regime and dosing schedule, the route of administration and the seriousness of the disease.
  • the corticosteroid can be administered in any amount that is effective reduce, decrease and/or dampen CAR+ T cell expansion and/or proliferation.
  • the corticosteroid e.g., glucocorticoid
  • the corticosteroid such as a glucocorticoid is administered at an amount between at or about 0.4 and at or about 20 mg, for example, at or about 0.4 mg, 0.5 mg, 0.6 mg, 0.7 mg, 0.75 mg, 0.8 mg, 0.9 mg, 1 mg, 2 mg, 3 mg, 4 mg, 5 mg, 6 mg, 7 mg, 8 mg, 9 mg, 10 mg, 11 mg, 12 mg, 13 mg, 14 mg, 15 mg, 16 mg, 17 mg, 18 mg, 19 mg or 20 mg per dose (or equivalents thereof), to an average adult human subject.
  • the corticosteroid such as a glucocorticoid is administered at an amount between at or about 0.4 and at or about 20 mg, for example, at or about 0.4 mg, 0.5 mg, 0.6 mg, 0.7 mg, 0.75 mg, 0.8 mg, 0.9 mg, 1 mg, 2 mg, 3 mg, 4 mg, 5 mg, 6 mg, 7 mg, 8 mg, 9 mg, 10 mg, 11 mg, 12 mg, 13 mg
  • corticosteroid such as a glucocorticoid is administered at an amount between at or about 10 and at or about 80 mg, for example, at or about 10 mg, 15 mg, 20 mg, 25 mg, 30 mg, 35 mg, 40 mg, 45 mg, 50 mg, 55 mg, 60 mg, 65 mg, 70 mg, 75 mg or 80 mg, per dose (or equivalents thereof), to an average adult human subject.
  • the corticosteroid e.g., glucocorticoid
  • the corticosteroid such as a glucocorticoid is administered at an amount between at or about 0.4 and at or about 20 mg per day, for example, at or about 0.4 mg per day, 0.5 mg per day, 0.6 mg per day, 0.7 mg per day, 0.75 mg per day, 0.8 mg per day, 0.9 mg per day, 1 mg per day, 2 mg per day, 3 mg per day, 4 mg per day, 5 mg per day, 6 mg per day, 7 mg per day, 8 mg per day, 9 mg per day, 10 mg per day, 11 mg per day, 12 mg per day, 13 mg per day, 14 mg per day, 15 mg per day, 16 mg per day, 17 mg per day, 18 mg per day, 19 mg per day or 20 mg per day (or equivalents thereof), to an average adult human subject.
  • 0.4 mg per day 0.5 mg per day, 0.6 mg per day, 0.7 mg per day, 0.75 mg per day, 0.8 mg per day, 0.9 mg per day, 1 mg per day, 2 mg per day, 3 mg per
  • the corticosteroid such as a glucocorticoid is administered at an amount between at or about 10 and at or about 80 mg per day, for example, at or about 10 mg per day, 15 mg per day, 20 mg per day, 25 mg per day, 30 mg per day, 35 mg per day, 40 mg per day, 45 mg per day, 50 mg per day, 55 mg per day, 60 mg per day, 65 mg per day, 70 mg per day, 75 mg per day or 80 mg per day (or equivalents thereof), to an average adult human subject.
  • the corticosteroid is dexamethasone.
  • exemplary doses of dexamethasone that can be administered include an amount between at or about 0.1 and at or about 100 mg, per dose, 0.1 and 80 mg, 0.1 and 60 mg, 0.1 and 40 mg, 0.1 and 30 mg, 0.1 and 20 mg, 0.1 and 15 mg, 0.1 and 10 mg, 0.1 and 5 mg, 0.2 and 40 mg, 0.2 and 30 mg, 0.2 and 20 mg, 0.2 and 15 mg, 0.2 and 10 mg, 0.2 and 5 mg, 0.4 and 40 mg, 0.4 and 30 mg, 0.4 and 20 mg, 0.4 and 15 mg, 0.4 and 10 mg, 0.4 and 5 mg, 0.4 and 4 mg, 1 and 20 mg, 1 and 15 mg or 1 and 10 mg, to a 70 kg adult human subject.
  • the dexamethasone is
  • dexamethasone is administered at an amount between at or about 10 and at or about 40 mg, for example, at or about 10 mg, 15 mg, 20 mg, 25 mg, 30 mg, 35 mg or 40 mg per dose, to an average adult human subject.
  • the dexamethasone can be administered, for example, at an amount between at or about 0.1 and at or about 100 mg per day, 0.1 and 80 mg per day, 0.1 and 60 mg per day, 0.1 and 40 mg per day, 0.1 and 30 mg per day, 0.1 and 20 mg per day, 0.1 and 15 mg per day, 0.1 and 10 mg per day, 0.1 and 5 mg per day, 0.2 and 80 mg per day, 0.2 and 60 mg per day, 0.2 and 40 mg per day, 0.2 and 30 mg per day, 0.2 and 20 mg per day, 0.2 and 15 mg per day, 0.2 and 10 mg per day, 0.2 and 5 mg per day, 0.4 and 40 mg per day, 0.4 and 30 mg per day, 0.4 and 20 mg per day, 0.4 and 15 mg per day, 0.4 and 10 mg per day, 0.4 and 5 mg per day, 0.4 and 4 mg per day, 1 and 20 mg per day, 1 and 15 mg per day or 1 and 10 mg per day, to an adult human subject.
  • the dexamethasone is administered at an amount between at or about 0.4 and at or about 20 mg per day, for example, at or about 0.4 mg per day, 0.5 mg per day, 0.6 mg per day, 0.7 mg per day, 0.75 mg per day, 0.8 mg per day, 0.9 mg per day, 1 mg per day, 2 mg per day, 3 mg per day, 4 mg per day, 5 mg per day, 6 mg per day, 7 mg per day, 8 mg per day, 9 mg per day, 10 mg per day, 11 mg per day, 12 mg per day, 13 mg per day, 14 mg per day, 15 mg per day, 16 mg per day, 17 mg per day, 18 mg per day, 19 mg per day or 20 mg per day, to an average adult human subject.
  • the dexamethasone is administered at a high dose, such as in an amount between at or about 10 and at or about 40 mg per day, for example, at or about 10 mg per day, 15 mg per day, 20 mg per day, 25 mg per day, 30 mg per day, 35 mg per day or 40 mg per day, to an average adult human subject.
  • a high-dose of dexamethasone can be administered.
  • Exemplary high-dose dexamethasone include a dosage amount of at or about 20 mg, 25 mg, 30 mg, 35 mg, 40 mg, 45 mg, 50 mg, 55 mg, 60 mg, 65 mg, 70 mg, 75 mg or 80 mg dexamethasone or equivalent thereof, or a range defined by any of the foregoing, each inclusive, to an average adult human subject.
  • Exemplary high-dose dexamethasone include a dose of 20 mg per day, 25 mg per day, 30 mg per day, 35 mg per day, 40 mg per day, 45 mg per day, 50 mg per day, 55 mg per day, 60 mg per day, 65 mg per day, 70 mg per day, 75 mg per day or 80 mg per day, or a range defined by any of the foregoing, each inclusive, to an average adult human subject.
  • the corticosteroid can be administered, for example, at a dosage of at or about 0.001 mg/kg (of the subject), 0.002 mg/kg, 0.003 mg/kg, 0.004 mg/kg, 0.005 mg/kg, 0.006 mg/kg, 0.007 mg/kg, 0.008 mg/kg, 0.009 mg/kg, 0.01 mg/kg, 0.015 mg/kg, 0.02 mg/kg, 0.025 mg/kg, 0.03 mg/kg, 0.035 mg/kg, 0.04 mg/kg, 0.045 mg/kg, 0.05 mg/kg, 0.055 mg/kg, 0.06 mg/kg, 0.065 mg/kg, 0.07 mg/kg, 0.075 mg/kg, 0.08 mg/kg, 0.085 mg/kg, 0.09 mg/kg, 0.095 mg/kg, 0.1 mg/kg, 0.15 mg/kg, 0.2 mg/kg, 0.25 mg/kg, 0.30 mg/kg, 0.35 mg/kg, 0.40 mg/kg
  • the corticosteroid, or glucocorticoid for example dexamethasone, can be administered orally (tablets, liquid or liquid concentrate), PO, intravenously (IV),
  • the corticosteroid is administered as a bolus, and in other aspects it may be administered over a period of time. In some aspects, the corticosteroid is administered as a bolus, and in other aspects it may be administered over a period of time, e.g., over 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 120, 180, 240, 360, 480 or 720 minutes or more, or a range defined by any two of the foregoing values.
  • the glucocorticoid can be administered over a period of more than one day, such as over two days, over 3 days, or over 4 or more days.
  • the corticosteroid can be administered one per day, twice per day, or three times or more per day.
  • the corticosteroid e.g., dexamethasone
  • the steroid e.g., corticosteroid or glucocorticoid
  • exemplary dose per day includes at or about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.5, 2, 3, 4, 5, 6, 7, 8, 9 or 10 mg/kg per day, or a range defined by any two of the foregoing values and equivalents thereof.
  • the steroid e.g., corticosteroid or glucocorticoid
  • the steroid can be administered at or about 0.25, 0.5, 0.75, 1, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0,
  • exemplary dose per day includes 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150 or 200 mg per day, or a range defined by any two of the foregoing values and equivalents thereof.
  • the steroid e.g., corticosteroid or glucocorticoid
  • a steroid such as a corticosteroid, e.g., dexamethasone
  • a corticosteroid e.g., dexamethasone
  • a steroid may in some examples be administered at between or between about 5 mg and about 40 mg, such as about 10 mg and about 20 mg (or equivalent) IV or about 20 mg and about 40 mg (or equivalent) IV, at a frequency of once, twice, three times or four times a day, for a duration of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30,
  • a steroid such as a corticosteroid, e.g., dexamethasone
  • a corticosteroid e.g., dexamethasone
  • the corticosteroid e.g., dexamethasone
  • a steroid such as a glucocorticoid e.g., methylprednisolone
  • a steroid may in some examples be administered at between at or about 0.5 mg/kg and at or about 5 mg/kg, such as at or about 1 mg/kg, 2 mg/kg, 3 mg/kg, 4 mg/kg or 5 mg/kg (or equivalent).
  • the glucocorticoid e.g., methylprednisolone is administered once, twice, three times or four times a day for 2, 3, 4 or 5 days.
  • the glucocorticoid e.g., methylprednisolone is administered in multiple doses, including a loading dose and a follow-up dose.
  • the glucocorticoid e.g., methylprednisolone is administered at a loading dose of between about 1 and about 3 mg/kg, such as 2 mg/kg (or equivalent), followed by a follow-up dose of between at or about 1 and at or about 3 mg/kg, such as 2 mg/kg (or equivalent), that is divided between 1, 2, 3, 4 or 5 times over a day.
  • the dosage of corticosteroid e.g., glucocorticoid
  • the dose of corticosteroid is tapered, for example, gradually reduced over time.
  • the corticosteroid may be administered at an initial dose (or equivalent dose, such as with reference to dexamethasone) of 4 mg, and upon each successive administration the dose may be lowered, such that the dose is 3 mg for the next administration, 2 mg for the next administration, and 1 mg for the next administration.
  • the corticosteroid e.g., dexamethasone
  • an initial dose or equivalent dose, such as with reference to dexamethasone
  • exemplary tapered doses can include 3 mg for one of the next administrations, 2 mg for some of the subsequent administrations, and 1 mg for some of the subsequent administration.
  • the corticosteroid, e.g., dexamethasone may be administered at an initial dose (or equivalent dose, such as with reference to dexamethasone) of at or about 40 mg per day, and upon some of the successive administration the dose may be lowered.
  • exemplary tapered doses can include at or about 30 mg for one of the next administrations, at or about 20 mg for some of the subsequent administrations, and 10 mg for some of the subsequent administration.
  • the dose of corticosteroid administered is dependent upon the specific corticosteroid, as a difference in potency exists between different corticosteroids. It is typically understood that drugs vary in potency, and that doses can therefore vary, in order to obtain equivalent effects. Table 6 shows equivalence in terms of potency for various glucocorticoids and routes of administration. Equivalent potency in clinical dosing is well known. Information relating to equivalent steroid dosing (in a non-chronotherapeutic manner) may be found in the British National Formulary (BNF) 37, March 1999.
  • the steroid is administered in an equivalent dosage amount of from at or about 1.0 mg to at or about 20 mg dexamethasone per day, such as at or about 1.0 mg to at or about 15 mg dexamethasone per day, at or about 1.0 mg to at or about 10 mg dexamethasone per day, at or about 2.0 mg to at or about 8 mg dexamethasone per day, or at or about 2.0 mg to at or about 6.0 mg dexamethasone per day, each inclusive.
  • the steroid is administered in an equivalent dose of at or about 4 mg or at or about 8 mg
  • the steroid is administered if fever persists after treatment with tocilizumab.
  • dexamethasone is administered orally or intravenously at a dosage of 5-10 mg up to every 6-12 hours with continued fevers.
  • tocilizumab is administered concurrently with or subsequent to oxygen supplementation .
  • the agent capable of reducing, decreasing, and/or dampening CAR+ T cell expansion and/or proliferation is an inhibitor of a microglial cell activity.
  • the administration of the inhibitor modulates the activity of microglia.
  • the inhibitor is an antagonist that inhibits the activity of a signaling pathway in microglia.
  • the microglia inhibitor affects microglial homeostasis, survival, and/or proliferation.
  • the inhibitor targets the CSF1R signaling pathway.
  • the inhibitor is an inhibitor of CSF1R.
  • the inhibitor is a small molecule. In some cases, the inhibitor is an antibody.
  • administration of the inhibitor results in one or more effects selected from an alteration in microglial homeostasis and viability, a decrease or blockade of microglial cell proliferation, a reduction or elimination of microglial cells, a reduction in microglial activation, a reduction in nitric oxide production from microglia, a reduction in nitric oxide synthase activity in microglia, or protection of motor neurons affected by microglial activation.
  • the agent alters the level of a serum or blood biomarker of CSF1R inhibition, or a decrease in the level of urinary collagen type 1 cross-linked N-telopeptide (NTX) compared to at a time just prior to initiation of the administration of the inhibitor.
  • the administration of the agent transiently inhibits the activity of microglia activity and/or wherein the inhibition of microglia activity is not permanent.
  • the administration of the agent transiently inhibits the activity of CSF1R and/or wherein the inhibition of CSF1R activity is not permanent.
  • the agent capable of reducing, decreasing, and/or dampening CAR+ T cell expansion and/or proliferation is selected from an anti-inflammatory agent, an inhibitor of NADPH oxidase (NOX2), a calcium channel blocker, a sodium channel blocker, inhibits GM-CSF, inhibits CSF1R, specifically binds CSF-l, specifically binds IL-34, inhibits the activation of nuclear factor kappa B (NF-kB), activates a CB 2 receptor and/or is a CB 2 agonist, a phosphodiesterase inhibitor, inhibits microRNA-l55 (miR-l55), upregulates microRNA-l24 (miR-l24), inhibits nitric oxide production in microglia, inhibits nitric oxide synthase, or activates the transcription factor NRF2 (also called nuclear factor (erythroid-derived 2)-like 2, or NFE2L2).
  • NOX2 nuclear factor (erythroid-derived 2)-like 2, or NFE2L
  • the agent capable of reducing, decreasing, and/or dampening CAR+ T cell expansion and/or proliferation is one that targets a cytokine, e.g., is an antagonist or inhibitor of a cytokine, such as transforming growth factor beta (TGF-beta), interleukin 6 (IL- 6), interleukin 10 (IL-10), IL-2, MIRIb (CCL4), TNF alpha, IL-l, interferon gamma (IFN- gamma), or monocyte chemoattractant protein-l (MCP-l).
  • TGF-beta transforming growth factor beta
  • IL- 6 interleukin 6
  • IL-10 interleukin 10
  • IL-2 interleukin-2
  • MIRIb CCL4
  • TNF alpha TNF alpha
  • IL-l interferon gamma
  • IFN- gamma interferon gamma
  • MCP-l monocyte chemoattractant protein-l
  • the agent capable of reducing, decreasing, and/or dampening CAR+ T cell expansion and/or proliferation is one that targets (e.g. inhibits or is an antagonist of) a cytokine receptor, such as IL-6 receptor (IL-6R), IL-2 receptor (IL-2R/CD25), MCP-l (CCL2) receptor (CCR2 or CCR4), a TGF-beta receptor (TGF-beta I, II, or III), IFN-gamma receptor (IFNGR), MIRIb receptor (e.g., CCR5), TNF alpha receptor (e.g., TNFR1), IL-l receptor (ILl-Ra/IL-lRP), or IL-10 receptor (IL-10R).
  • a cytokine receptor such as IL-6 receptor (IL-6R), IL-2 receptor (IL-2R/CD25), MCP-l (CCL2) receptor (CCR2 or CCR4)
  • TGF-beta receptor TGF-beta I, II, or III
  • the amount of a selected agent capable of reducing, decreasing, and/or dampening CAR+ T cell expansion and/or proliferation can be determined by standard clinical techniques.
  • exemplary adverse events include, but are not limited to, an increase in alanine
  • aminotransferase an increase in aspartate aminotransferase, chills, febrile neutropenia, headache, hypotension, left ventricular dysfunction, encephalopathy, hydrocephalus, seizure, and/or tremor.
  • the agent is administered in a dosage amount of from or from about 30 mg to at or about 5000 mg, such as at or about 50 mg to at or about 1000 mg, at or about 50 mg to at or about 500 mg, at or about 50 mg to at or about 200 mg, at or about 50 mg to at or about 100 mg, at or about 100 mg to at or about 1000 mg, at or about 100 mg to at or about 500 mg, at or about 100 mg to at or about 200 mg, at or about 200 mg to at or about 1000 mg, at or about 200 mg to at or about 500 mg or at or about 500 mg to at or about 1000 mg.
  • the agent is administered from or from about 0.5 mg/kg to at or about 100 mg/kg, such as from at or about 1 mg/kg to at or about at or about 50 mg/kg, at or about 1 mg/kg to at or about 25 mg/kg, at or about 1 mg/kg to at or about 10 mg/kg, at or about 1 mg/kg to at or about 5 mg/kg, at or about 5 mg/kg to at or about 100 mg/kg, at or about 5 mg/kg to at or about 50 mg/kg, at or about 5 mg/kg to at or about 25 mg/kg, at or about 5 mg/kg to at or about 10 mg/kg, at or about 10 mg/kg to at or about 100 mg/kg, at or about 10 mg/kg to at or about 50 mg/kg, at or about 10 mg/kg to at or about 25 mg/kg, at or about 25 mg/kg to at or about 100 mg/kg, at or about 25 mg/kg to at or about 50 mg/kg to at or about 50 mg/kg to at or or about 50 mg/kg to at
  • the agent is administered in a dosage amount of from or from about 1 mg/kg to at or about 10 mg/kg, at or about 2 mg/kg to at or about 8 mg/kg, at or about 2 mg/kg to at or about 6 mg/kg, at or about 2 mg/kg to at or about 4 mg/kg or 6 mg/kg to at or about 8 mg/kg, at or about each inclusive.
  • the agent is administered in a dosage amount of at least or at least about or about 1 mg/kg, 2 mg/kg, 4 mg/kg, 6 mg/kg, 8 mg/kg, 10 mg/kg or more.
  • the agent is administered at a dose of 4 mg/kg or 8 mg/kg.
  • the agent is administered in a dosage amount of from at or about 1 mg/kg to at or about 20 mg/kg, at or about 2 mg/kg to at or about 19 mg/kg, at or about 4 mg/kg to at or about 16 mg/kg, at or about 6 mg/kg to at or about 14 mg/kg or at or about 8 mg/kg to at or about 12 mg/kg, each inclusive.
  • the agent is administered in a dosage amount of at least or at least about or about 1 mg/kg, 2 mg/kg, 4 mg/kg, 6 mg/kg, 8 mg/kg, 10 mg/kg, 12 mg/kg, 14 mg/kg, 16 mg/kg, 18 mg/kg, 20 mg/kg or more.
  • the agent is administered at a dosage amount of between about 8 mg/kg and at or about 12 mg/kg, such as at or about 8 mg/kg, 9 mg/kg, 10 mg/kg, 11 mg/kg or 12 mg/kg.
  • the agent is administered in a total dose per day of from at or about 30 mg/day to at or about at or about 5000 mg/day, such as at or about 50 mg/day to at or about 1000 mg/day, at or about 50 mg/day to at or about 500 mg/day, at or about 50 mg/day to at or about 200 mg/day, at or about 50 mg/day to at or about 100 mg/day, at or about 100 mg/day to at or about 1000 mg/day, at or about 100 mg/day to at or about 500 mg/day, at or about 100 mg/day to at or about 200 mg/day, at or about 200 mg/day to at or about 1000 mg/day, at or about 200 mg/day to at or about 500 mg/day or about 1000 mg/day.
  • the agent is administered in a total dose per day of from at or about 1 mg/kg/day to at or about at or about 20 mg/kg/day, at or about 2 mg/kg/day to at or about 19 mg/kg/day, at or about 4 mg/kg/day to at or about 16 mg/kg/day, at or about 6 mg/kg/day to at or about 14 mg/kg/day or at or about 8 mg/kg/day to at or about 12 mg/kg/day, each inclusive.
  • the agent is administered in a dosage amount of at least or at least about or about 1 mg/kg/day, 2 mg/kg/day, 4 mg/kg/day, 6 mg/kg/day, 8 mg/kg/day, 10 mg/kg/day, 12 mg/kg/day, 14 mg/kg/day, 16 mg/kg/day, 18 mg/kg/day, 20 mg/kg/day or more.
  • the agent is administered at a dose of between at or about 8 mg/kg/day and at or about 12 mg/kg/day, such as at or about 8 mg/kg/day, 9 mg/kg/day, 10 mg/kg/day, 11 mg/kg/day or 12 mg/kg/day.
  • the agent is administered by injection, e.g., intravenous or subcutaneous injections, intraocular injection, periocular injection, subretinal injection, intravitreal injection, trans-septal injection, subscleral injection, intrachoroidal injection, intracameral injection, subconjectval injection, subconjuntival injection, sub-Tenon’s injection, retrobulbar injection, peribulbar injection, or posterior juxtascleral delivery.
  • injection e.g., intravenous or subcutaneous injections, intraocular injection, periocular injection, subretinal injection, intravitreal injection, trans-septal injection, subscleral injection, intrachoroidal injection, intracameral injection, subconjectval injection, subconjuntival injection, sub-Tenon’s injection, retrobulbar injection, peribulbar injection, or posterior juxtascleral delivery.
  • they are administered by parenteral, intrapulmonary, and intranasal, and, if desired for local treatment, intralesional
  • intramuscular, intravenous, intraarterial, intraperitoneal, or subcutaneous administration is administered.
  • the agent is administered via intravenous delivery.
  • the agent is administered via intravenous delivery over a period of time, e.g., over 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 120, 180, 240, 360, 480 or 720 minutes or more, or a range defined by any two of the foregoing values.
  • the amount of the agent is administered about or approximately twice daily, daily, every other day, three times a week, weekly, every other week or once a month.
  • the agent is administered in multiple or repeated doses, e.g., more than one dose. In some embodiments, the agent is administered in repeated doses until a desired expansion is observed or is likely to be observed and/or suppression of toxicity or symptoms associated with toxicity occurs and/or the risk for developing the toxicity has passed. In some embodiments, agent is administered in a total of 2, 3, 4, 5, 6, 7, 8, 9, 10 or more doses.
  • the agent is administered in multiple doses over a period of time.
  • the agent can be administered over a period of more than at or about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 days or more, or more than 2, 3, 4, 5, 6, 7, 8, 9, 10 weeks or more.
  • the agent can be administered in multiple or repeat doses over a total duration of about 6, 12, 18, 24 hours or more, or 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 days or more, or 2, 3, 4, 5, 6, 7, 8, 9, 10 weeks or more.
  • the agent can be administered one per day, twice per day, or three times or more per day.
  • the agent can be administered at least or at least about every 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 18, 24, 36, 48 hours, or every 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 days, or every 2, 3, 4, 5, 6, 7,
  • the agent is administered as part of a composition or formulation, such as a pharmaceutical composition or formulation as described below.
  • a composition or formulation such as a pharmaceutical composition or formulation as described below.
  • the composition comprising the agent is administered as described below.
  • the agent is administered alone and may be administered by any known acceptable route of administration or by one described herein, such as with respect to compositions and pharmaceutical formulations.
  • the agent is a small molecule, peptide, protein, antibody or antigen-binding fragment thereof, an antibody mimetic, an aptamer, or a nucleic acid molecule.
  • the method involves administration of an inhibitor of microglia activity.
  • the agent is an antagonist that inhibits the activity of a signaling pathway in microglia.
  • the agent affects microglial homeostasis, survival, and/or proliferation.
  • the agent capable of reducing, decreasing, and/or dampening CAR+ T cell expansion and/or proliferation is an antibody or antigen binding fragment.
  • the agent is tocilizumab, siltuximab, sarilumab, olokizumab (CDP6038), elsilimomab, ALD518/B MS-945429, sirukumab (CNTO 136), CPSI-2634, ARGX-109, FE301, or FMlOl.
  • the agent is an antagonist or inhibitor of IL-6 or the IL-6 receptor (IL-6R).
  • the agent is an antibody that neutralizes IL-6 activity, such as an antibody or antigen-binding fragment that binds to IL-6 or IL-6R.
  • the agent is or comprises tocilizumab (atlizumab) or sarilumab, anti-IL-6R antibodies.
  • the agent is an anti-IL-6R antibody described in U.S. Patent No: 8,562,991.
  • the agent that targets IL-6 is an anti-IL-6 antibody, such as siltuximab, elsilimomab, ALD518/BMS-945429, sirukumab (CNTO 136), CPSI-2634, ARGX- 109, FE301, FM101, or olokizumab (CDP6038).
  • the agent may neutralize IL-6 activity by inhibiting the ligand-receptor interactions. The feasibility of this general type of approach has been demonstrated with a natural occurring receptor antagonist for interleukin- 1. See Harmurn, C. H. et ah, Nature (1990) 343:336-340.
  • the IL-6/IL-6R antagonist or inhibitor is an IL-6 mutein, such as one described in U.S. Patent No. 5591827.
  • the agent that is an antagonist or inhibitor of IL-6/IL-6R is a small molecule, a protein or peptide, or a nucleic acid.
  • the agent is tocilizumab.
  • tocilizumab is administered as an early intervention in accord with the provided methods, and/or with the provided articles of manufacture or compositions, at a dosage of from or from about 1 mg/kg to at or aboutl2 mg/kg, such as at or about 4 mg/kg, 8 mg/kg, or 10 mg/kg.
  • tocilizumab is administered by intravenous infusion.
  • tocilizumab is administered for a persistent fever of greater than 39°C lasting 10 hours that is unresponsive to acetaminophen.
  • a second administration of tocilizumab is provided if symptoms recur after 48 hours of the initial dose.
  • tocilizumab is administered in accord with the provided methods at a dosage of from or from about 1 mg/kg to about 20 mg/kg, such as from at or about 8 mg/kg to at or about 12 mg/kg.
  • tocilizumab is administered by intravenous infusion.
  • tocilizumab is administered by intravenous infusion over approximately 1 hour, at a dose or dosage amount of approximately 4-12 mg/kg, e.g., at or about 8 mg/kg.
  • tocilizumab is administered as multiple or repeated doses, e.g., at least or at least about every 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 18, 24, 36, 48 hours, or every 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 days, or every 2, 3, 4, 5, 6, 7, 8, 9 or 10 weeks or more.
  • one or more dose of tocilizumab is administered.
  • tocilizumab is administered every 8, 10, 12, 14, 16, 18, 24 or 36 or more hours, or 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or more days, or 3, 4, 5, 6, 7, 8, 10, 11, 12 or more weeks.
  • the agent is an agent that binds to IL-6, e.g., an anti-IL-6 antibody or antigen-binding fragment thereof, such as siltuximab, clazakizumab, elsilimomab, ALD518/BMS-945429, sirukumab (CNTO 136), CPSI-2634, ARGX-109, FE301, FM101, or olokizumab (CDP6038) or antigen-binding fragment thererof.
  • the agent may neutralize IL-6 activity by inhibiting the ligand-receptor interactions. The feasibility of this general type of approach has been demonstrated with a natural occurring receptor antagonist for interleukin- 1.
  • the IL- 6/IL-6R antagonist or inhibitor is an IL-6 mutein or a modified IL-6 protein or portion thereof, such as one described in U.S. Patent No. 5591827.
  • the agent that is an antagonist or inhibitor of IL-6/IL-6R is a small molecule, a protein or peptide, or a nucleic acid. In some embodiments, agent is siltuximab.
  • siltuximab is administered in accord with the provided methods at a dosage of from or from about 1 mg/kg to about 20 mg/kg, such as from at or about 8 mg/kg to at or about 12 mg/kg.
  • siltuximab is administered by intravenous infusion.
  • siltuximab is administered by intravenous infusion over approximately 1 hour, at a dose of approximately 11 mg/kg.
  • siltuximab is administered as multiple or repeated doses, e.g., at least or at least about every 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 18, 24, 36, 48 hours, or every 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 days, or every 2, 3, 4, 5, 6, 7, 8, 9 or 10 weeks, or a range defined by any two of the foregoing values.
  • one or more dose of the siltuximab is administered.
  • the siltuximab is administered every 8, 10, 12, 14, 16, 18, 24 or 36 or more hours, or 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or more days, or 3, 4, 5, 6, 7, 8, 10, 11, 12 or more weeks or a range defined by any two of the foregoing values.
  • the agent is an agonist or stimulator of TGF-b or a TGF-b receptor (e.g., TGF-b receptor I, II, or III).
  • the agent is an antibody that increases TGF-b activity, such as an antibody or antigen-binding fragment that binds to TGF-b or one of its receptors.
  • the agent that is an agonist or stimulator of TGF-b and/or its receptor is a small molecule, a protein or peptide, or a nucleic acid.
  • the agent is an antagonist or inhibitor of MCP-l (CCL2) or a MCP-l receptor (e.g., MCP-l receptor CCR2 or CCR4).
  • the agent is an antibody that neutralizes MCP-l activity, such as an antibody or antigen-binding fragment that binds to MCP-l or one of its receptors (CCR2 or CCR4).
  • the MCP-l antagonist or inhibitor is any described in Gong et al. J Exp Med. 1997 Jul 7; 186(1): 131-137 or Shahrara et al. J Immunol 2008; 180:3447-3456.
  • the agent that is an antagonist or inhibitor of MCP-l and/or its receptor (CCR2 or CCR4) is a small molecule, a protein or peptide, or a nucleic acid.
  • the agent is an antagonist or inhibitor of IFN-g or an IFN-g receptor (IFNGR).
  • the agent is an antibody that neutralizes IFN-g activity, such as an antibody or antigen-binding fragment that binds to IFN-g or its receptor (IFNGR).
  • the IFN-gamma neutralizing antibody is any described in Dobber et al. Cell Immunol. 1995 Feb;l60(2):l85-92 or Ozmen et al. J Immunol. 1993 Apr l;l50(7):2698-705.
  • the agent that is an antagonist or inhibitor of IFN-y/IFNGR is a small molecule, a protein or peptide, or a nucleic acid.
  • the agent is an antagonist or inhibitor of IF- 10 or the IF- 10 receptor (IF-10R).
  • the agent is an antibody that neutralizes IF- 10 activity, such as an antibody or antigen-binding fragment that binds to IF- 10 or IF-10R.
  • the IF- 10 neutralizing antibody is any described in Dobber et al. Cell Immunol. 1995
  • the agent that is an antagonist or inhibitor of IF-10/IF-10R is a small molecule, a protein or peptide, or a nucleic acid.
  • the agent is an antagonist or inhibitor of IF-l or the IF-l receptor (IF-1R).
  • the agent is an IF-l receptor antagonist, which is a modified form of IF-1R, such as anakinra (see, e.g., Fleischmann et al., (2006) Annals of the rheumatic diseases. 65(8): 1006-12).
  • the agent is an antibody that neutralizes IF-l activity, such as an antibody or antigen-binding fragment that binds to IF-l or IF-1R, such as canakinumab (see also EP 2277543).
  • the agent that is an antagonist or inhibitor of IF-1/IF-1R is a small molecule, a protein or peptide, or a nucleic acid.
  • the agent is an antagonist or inhibitor of a tumor necrosis factor (TNF) or a tumor necrosis factor receptor (TNFR).
  • the agent is an antibody that blocks TNF activity, such as an antibody or antigen-binding fragment that binds to a TNF, such as TNFa, or its receptor (TNFR, e.g., TNFRp55 or TNFRp75).
  • TNFR tumor necrosis factor receptor
  • the agent is selected from among infliximab, adalimumab, certolizumab pegol, golimumab and etanercept.
  • the agent that is an antagonist or inhibitor of TNF/TNFR is a small molecule, a protein or peptide, or a nucleic acid.
  • the agent is an antagonist or inhibitor of signaling through the Janus kinase (JAK) and two Signal Transducer and Activator of Transcription (STAT) signaling cascade.
  • JAK/STAT proteins are common components of cytokine and cytokine receptor signaling.
  • the agent that is an antagonist or inhibitor of JAK/STAT such as ruxolitinib (see, e.g., Mesa et al. (2012) Nature Reviews Drug Discovery.
  • the agent is a small molecule, a protein or peptide, or a nucleic acid.
  • the agent is a kinase inhibitor.
  • Kinase inhibitors such as a CDK4 kinase inhibitor, a BTK kinase inhibitor, a MNK kinase inhibitor, or a DGK kinase inhibitor, can regulate the constitutively active survival pathways that exist in tumor cells and/or modulate the function of immune cells.
  • the kinase inhibitor is a Bruton’s tyrosine kinase (BTK) inhibitor, e.g., ibrutinib.
  • BTK tyrosine kinase
  • the kinase inhibitor is a phosphatidylinositol-4,5-bisphosphate 3-kinase (PI3K) inhibitor.
  • the kinase inhibitor is a CDK4 inhibitor, e.g., a CDK4/6 inhibitor.
  • the kinase inhibitor is an mTOR inhibitor, such as, e.g., rapamycin, a rapamycin analog, OSI-027.
  • the mTOR inhibitor can be, e.g., an mTORCl inhibitor and/or an mTORC2 inhibitor, e.g., an mTORCl inhibitor and/or mTORC2 inhibitor.
  • the kinase inhibitor is an MNK inhibitor, or a dual PI3K/mTOR inhibitor.
  • other exemplary kinase inhibitors include the AKT inhibitor perifosine, the mTOR inhibitor temsirolimus, the Src kinase inhibitors dasatinib and fostamatinib, the JAK2 inhibitors pacritinib and ruxolitinib, the RKOb inhibitors enzastaurin and bryostatin, and the AAK inhibitor alisertib.
  • the kinase inhibitor is a BTK inhibitor selected from ibrutinib (PCI- 32765); GDC-0834; RN-486; CGI-560; CGI-1764; HM-71224; CC-292; ONO-4059; CNX-774; and LFM-A13.
  • the BTK inhibitor does not reduce or inhibit the kinase activity of interleukin-2-inducible kinase (ITK), and is selected from GDC-0834; RN- 486; CGI-560; CGI-1764; HM-71224; CC-292; ONO-4059; CNX-774; and LFM-A13.
  • the kinase inhibitor is a BTK inhibitor, e.g., ibrutinib (1- [(3R)-3-[4-Amino-3-(4-phenoxyphenyl)-lH-pyrazolo[3,4-d]pyrimidin-l-yl]piperidin-l-yl]prop- 2-en-l-one; also known as PCI-32765).
  • the kinase inhibitor is a BTK inhibitor, e.g., ibrutinib (PCI-32765).
  • PCI-32765 ibrutinib
  • 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 or more cycles of ibrutinib are administered.
  • the BTK inhibitor is a BTK inhibitor described in International Application WO 2015/079417.
  • the kinase inhibitor is a PI3K inhibitor.
  • PI3K is central to the PI3K/Akt/mTOR pathway involved in cell cycle regulation and lymphoma survival.
  • Exemplary PI3K inhibitor includes idelalisib (PI3K5 inhibitor).
  • the agent is idelalisib and rituximab.
  • the agent is an inhibitor of mammalian target of rapamycin (mTOR).
  • mTOR mammalian target of rapamycin
  • the kinase inhibitor is an mTOR inhibitor selected from temsirolimus; ridaforolimus (also known as AP23573 and MK8669); everolimus (RAD001); rapamycin (AY22989); simapimod; AZD8055; PF04691502; SF1126; and XF765.
  • the agent is an inhibitor of mitogen-activated protein kinase (MAPK), such as vemurafenib, dabrafenib, and trametinib.
  • MAPK mitogen-activated protein kinase
  • a device such as absorbent resin technology with blood or plasma filtration, can be used to reduce cytokine levels.
  • the device used to reduce cytokine levels is a physical cytokine absorber, such as an extracorporeal cytokine absorber.
  • a physical cytokine absorber can be used to eliminate cytokines from the bloodstream in an ex vivo , extracorporeal manner.
  • the agent is a porous polymer.
  • the agent is CytoSorb (see, e.g., Basu et al. Indian J Crit Care Med. (2014) 18(12): 822-824).
  • treatment regimens e.g., including assessment, dosing and/or timing of administration of agents that can ameliorate or treat signs or symptoms of toxicity.
  • the methods include administration of one or more agents or treatments for treating, preventing, delaying, or attenuating the development of a toxicity.
  • the agent or other treatment capable of treating, preventing, delaying, or attenuating the development of a toxicity is administered prior to and/or concurrently with administration of a therapeutic cell composition comprising the genetically engineered cells.
  • the agent is a steroid.
  • the agent is an agent capable of binding an interleukin-6 receptor (IL-6R).
  • the agent is an agent capable of binding an interleukin-6 (IL-6).
  • the agent can be administered according to any dose, frequency, route of delivery and/or timing of administration described in Section IV. E above.
  • the agent is or comprises any agents that are capable of modulating the expansion and/or activity of cell therapy, such as any described in Section IV. E above.
  • one or more of the agents, such as any described herein, e.g., for use in modulating cell expansion or activity and/or treating, ameliorating or reducing the toxicity can be administered in combination.
  • one or more doses, such as multiple doses, of any of the agents can be any of the agents.
  • the dose, frequency, route of delivery and/or timing of administration of one or more of the doses of the agent include any of those described herein.
  • the agent is administered in combination with one or more further agent(s) for modulating cell expansion or activity and/or treating, ameliorating or reducing the toxicity, such as a steroid and/or an anti-IL-6 receptor (IL-6R) antibody.
  • the methods include administering to a subject one or more additional or further agent(s), intervention(s) and/or treatment(s) capable of modulating cell expansion or activity and/or treating, preventing, delaying, or attenuating the development of a toxicity.
  • a multiple dose or a repeated dose of the one or more further agent is
  • the agent is administered simultaneously or near
  • the agent is administered before and/or after administering the one or more further agents.
  • the agent is administered as a first-line therapy to modulate the expansion or persistence of cells and/or to treat, prevent, reduce and/or ameliorate symptoms of a toxicity of a cell therapy.
  • the one or more further agents are administered as a second-, third- or fourth-line or subsequent therapy.
  • a combination of the agent and the further agent(s) is administered as a first-line therapy.
  • the one or more further agents are administered as a first-line therapy.
  • the agent is administered as a second-, third- or fourth-line or subsequent therapy.
  • the agent and/or one or more further agents can be administered in multiple doses.
  • each of the agent and/or one or more further agents can be administered in multiple or repeat doses depending on the grade, progression and/or manifestations of symptoms of the toxicity or potential toxicity, e.g., CRS or neurotoxicity, and/or based on the assessment of biomarkers, e.g. any described herein and/or according to exemplary methods and/or procedures described herein.
  • the agent is administered with or without concurrent administration of a further agent, as a first-line therapy for treating, ameliorating or reducing the toxicity.
  • a further agent is administered with or without the agent and/or a different further agent, e.g., a steroid, as a first-line therapy for treating, ameliorating or reducing the toxicity.
  • a first dose of the agent is administered within at or about 24, 36, 48, 72, 96 or 120 hours of administration of the immunotherapy and/or cell therapy.
  • an additional dose of the agent is administered within at or about 6, 12, 18, 24, 36, 48, 72, 96 or 120 hours of the first or initial dose, or prior doses of the agent.
  • one or more doses of one or more further agent(s) can be administered simultaneously with and/or subsequently to the first dose of the agent.
  • one or more doses of the one or more further agent(s) can be administered within at or about 6, 12, 18, 24, 36, 48, 72, 96 or 120 hours of the first or initial dose, or prior doses of the agent or within at or about 6, 12, 18, 24, 36, 48, 72, 96 or 120 hours of the first or initial dose, or prior doses of the further agent.
  • a different further agent e.g., a different steroid, can be administered as second-, third- or fourth-line or subsequent therapy.
  • a further agent e.g., anti-IL-6R antibody and/or a steroid, with or without concurrent administration of the agent and/or a different further agent, is administered as a first-line therapy for treating, ameliorating or reducing the toxicity.
  • an additional dose of the further agent is administered within at or about 6, 12,
  • one or more doses of the agent or a different further agent can be administered within at or about 6, 12, 18, 24, 36, 48, 72, 96 or 120 hours of the first or initial dose, or prior doses of the further agent, e.g., anti-IL-6R antibody and/or a steroid, or within at or about 6, 12, 18, 24, 36, 48, 72, 96 or 120 hours of the first or initial dose, or prior doses of the agent.
  • the further agent e.g., anti-IL-6R antibody and/or a steroid
  • the agent can be administered as second-, third- or fourth-line or subsequent therapy.
  • one or more doses of the agent and/or further agent(s) is administered prior to administration of the immunotherapy or cell therapy or initiation thereof.
  • one or more doses of the agent and/or further agent(s) is administered after administration of the immunotherapy or cell therapy or initiation thereof. In some embodiments, one or more doses of the agent and/or further agent(s) is administered
  • the additional doses of one or both of the agent and the further agent are administered after administration of the immunotherapy or cell therapy.
  • the one or more further agent(s) is administered alone or is administered as part of a composition or formulation, such as a pharmaceutical composition or formulation, as described herein.
  • Also provided are methods for ameliorating a toxicity e.g., cytokine release syndrome (CRS), comprising administering, to a subject exhibiting one or more physical signs or symptom of a toxicity, one or more agent(s) capable of reducing and/or ameliorating the one or more physical signs or symptoms associated with the toxicity, said subject having been administered a dose of genetically engineered cells comprising T cells expressing a recombinant receptor.
  • the one or more agent(s) is administered in a treatment regimen.
  • the subject after administration of the dose of genetically engineered cells comprising T cells expressing a recombinant receptor, the subject is monitored for manifestation of one or more physical signs or symptom of a toxicity, e.g., CRS. In some aspects, after administration of the dose of genetically engineered cells comprising T cells expressing a recombinant receptor, the subject is monitored for development of a fever. In some
  • the fever is a fever of or greater than 38°C or l00.4°F.
  • the subject is monitored for one or more physical signs or symptoms indicative of grade 1, grade 2, grade 3 or grade 4 or higher CRS, e.g., signs or symptoms described herein.
  • a subject is monitored for signs or symptoms of CRS during and/or after administration of the immunotherapy or cell therapy.
  • a subject is monitored if they develop a fever of or greater than 38°C or 100.4°F more than or equal to 72 hours post administration of the immunotherapy or cell therapy.
  • the subject being monitored may be moved on to first or subsequent lines of therapy if they exhibit clinical progression of CRS and/or rapidly deteriorate after developing a fever of or greater than 38°C or l00.4°F.
  • the treatment regimen comprises administering one or more agent(s) if: at or greater than 72 hours after receiving administration of the dose of genetically engineered cells, the subject exhibits a fever, and exhibits one or more physical signs or symptoms associated with the toxicity, e.g., cytokine release syndrome (CRS), exhibits clinical progression of CRS, and/or exhibits a rapid progression of the physical signs or symptoms associated with the toxicity; or within 48 or 72 hours after receiving administration of the dose of genetically engineered cells, the subject exhibits a fever and/or one or more physical signs or symptoms associated with grade 2 or higher CRS.
  • the one or more agent(s) is administered as a first-line therapy or first-line treatment for ameliorating the toxicity.
  • the treatment regimen comprises administering one or more agent(s) if, within 24, 48 or 72 hours after administration of any one or more agent(s) above, e.g., first-line therapy, the subject does not exhibit an improvement of the fever and/or the one or more physical signs or symptoms associated with the toxicity and/or exhibits a rapid progression of the physical signs or symptoms associated with the toxicity, which one or more agent(s) optionally are different from any one or more agent(s) administered above and/or is
  • the one or more agent(s) is administered at the same or higher dose and/or frequency as any one or more agent(s) administered above, e.g., first-line therapy.
  • the one or more agent(s) is administered as a second-line therapy or second-line treatment for ameliorating the toxicity.
  • the treatment regimen comprises administering one or more agent(s) if, within 24, 48 or 72 hours after administration of any one or more agent(s) above, e.g., second-line therapy, the subject does not exhibit an improvement of the fever and/or the one or more physical signs or symptoms associated with the toxicity and/or exhibits a rapid progression of the physical signs or symptoms associated with the toxicity, which one or more agent(s) optionally are different from any one or more agent(s) administered above and/or is administered at the same or higher dose and/or frequency as any one or more agent(s) administered above, e.g., first- or second-line therapy.
  • the one or more agent(s) is administered as a third-line therapy or third-line treatment for ameliorating the toxicity.
  • the treatment regimen comprises administering one or more agent(s) if, after administration of any one or more agent(s) above, e.g., third-line therapy, the subject does not exhibit an improvement of the fever and/or the one or more physical signs or symptoms associated with the toxicity, which one or more agent(s) optionally are different from any one or more agent(s) administered above and/or is administered at the same or higher dose and/or frequency as any one or more agent(s) administered above, e.g., first-, second- or third- line therapy.
  • the one or more agent(s) is administered as a fourth-line therapy or fourth-line treatment for ameliorating the toxicity.
  • the one or more agent(s) is selected from an agent capable of binding an interleukin-6 receptor (IL-6R) or one or more steroid, optionally one or more doses of the one or more steroid.
  • IL-6R interleukin-6 receptor
  • Also provided are methods for ameliorating a toxicity e.g., optionally neurotoxicity (NT), comprising administering, to a subject exhibiting one or more physical signs or symptom of a toxicity, one or more agent(s) capable of reducing and/or ameliorating the one or more physical signs or symptoms associated with the toxicity, said subject having been administered a dose of genetically engineered cells comprising T cells expressing a recombinant receptor,
  • the one or more agent(s) is administered in a treatment regimen.
  • the subject after administration of the dose of genetically engineered cells comprising T cells expressing a recombinant receptor, the subject is monitored for manifestation of one or more physical signs or symptom of a toxicity, e.g., NT.
  • the subject is monitored for one or more physical signs or symptoms indicative of grade 1, grade 2, grade 3 or grade 4 or higher NT, e.g., signs or symptoms described herein.
  • the treatment regimen comprises administering one or more agent(s) if: at or greater than 72 hours after receiving administration of the dose of genetically engineered cells, the subject exhibits one or more physical signs or symptoms associated with the toxicity, optionally neurotoxicity (NT); or within at or about 48 or 72 hours after receiving administration of the dose of genetically engineered cells, the subject exhibits one or more physical signs or symptoms associated with the toxicity.
  • the one or more agent(s) is administered as a first-line therapy or first-line treatment for ameliorating the toxicity.
  • the treatment regimen comprises administering one or more agent(s) if, within at or about 24, 48 or 72 hours after administration of any one or more agent(s) above, e.g., first-line therapy, the subject does not exhibit an improvement of the one or more physical signs or symptoms associated with the toxicity and/or exhibits a progression of the physical signs or symptoms associated with the toxicity, which one or more agent(s) optionally are different from any one or more agent(s) administered above and/or is administered at the same or higher dose and/or frequency as any one or more agent(s) administered above, e.g., first-line therapy.
  • the one or more agent(s) is administered as a second- line therapy or second-line treatment for ameliorating the toxicity.
  • the treatment regimen comprises administering one or more agent(s) if, within at or about 24, 48 or 72 hours after administration of any one or more agent(s) above, the subject does not exhibit an improvement of the one or more physical signs or symptoms associated with the toxicity and/or exhibits a rapid progression of the physical signs or symptoms associated with the toxicity, which one or more agent(s) optionally are different from any one or more agent(s) administered in above and/or is administered at the same or higher dose and/or frequency as any one or more agent(s) administered above, e.g., first- or second-line therapy.
  • the one or more agent(s) is administered as a third- line therapy or third-line treatment for ameliorating the toxicity.
  • the one or more agent(s) is one or more steroid, optionally one or more doses of the one or more steroid.
  • the agent used for first-line therapy is a steroid.
  • the agent used for first-line therapy is an agent capable of binding an IL-6 receptor, e.g., an anti-IL-6R antibody.
  • the agent used for first-line therapy is a combination of a steroid and an anti-IL-6R antibody.
  • the agent used for second-line therapy is a steroid.
  • the agent used for second-line therapy is an agent capable of binding an IL-6 receptor, e.g., an anti-IL-6R antibody.
  • the agent used for second-line therapy is a combination of a steroid and an anti-IL-6R antibody.
  • the agent used for second-line therapy is different from the agent used for first-line therapy.
  • one or more further agents are used for second-line therapy.
  • the agent used for second-line therapy is the same as the agent used for first-line therapy. In some embodiments, the agent(s) for second-line therapy is administered at the same or higher dose and/or frequency as the first-line therapy.
  • the agent used for third-line therapy is a steroid.
  • the agent used for third-line therapy is an agent capable of binding an IL-6 receptor, e.g., an anti-IL-6R antibody.
  • the agent used for third-line therapy is a combination of a steroid and an anti-IL-6R antibody.
  • the agent used for third-line therapy is different from the agent used for first- or second-line therapy.
  • one or more further agents are used for third-line therapy.
  • the agent used for third-line therapy is the same as the agent used for first- or second-line therapy.
  • the agent(s) for third-line therapy is administered at the same or higher dose and/or frequency as the first- or second-line therapy.
  • the agent used for fourth-line therapy or subsequent therapy is a steroid.
  • the agent used for fourth-line therapy or subsequent therapy is an agent capable of binding an IL-6 receptor, e.g., an anti-IL-6R antibody.
  • the agent used for fourth-line therapy or subsequent therapy is a combination of a steroid and an anti-IL-6R antibody.
  • the agent used for fourth-line therapy or subsequent therapy is different from the agent used for first-, second- or third-line therapy.
  • one or more further agents are used for fourth-line therapy or subsequent therapy.
  • the agent(s) for fourth-line therapy or subsequent therapy is administered at the same or higher dose and/or frequency as the first-, second- or third-line therapy.
  • any one or more of the agent(s) described in Section IV. E.2, or a combination thereof, such as one or more steroid and/or an anti-IL-6R antibody and/or an anti-IL-6 antibody can be administered as the one or more agent(s) capable of reducing and/or ameliorating the one or more physical signs or symptoms associated with the toxicity.
  • the dose and/or frequency of administration is the same as described can be the dose and/or frequency for each of the agents described in Section IV.E.2.
  • the agent is a steroid, e.g., dexamethasone or
  • the further agent is an anti-IL-6R antibody, e.g., a tocilizumab. In some embodiments, the agent is an anti-IL-6R antibody, e.g., a tocilizumab. In some embodiments, the further agent is a steroid, e.g., dexamethasone or methylprednisolone.
  • the steroid is dexamethasone or methylprednisolone. In some embodiments, the steroid is dexamethasone. In some embodiments, the steroid is
  • the dexmethasone is administered after the administration of the anti-IL-6 antibody.
  • the steroid is dexmethasone, and the dexmethasone is administered prior to the administration of the anti-IL-6 antibody.
  • the agent is administered to a subject after initiation of administration of the immunotherapy and/or cell therapy.
  • the agent is administered prior to or after the subject exhibits signs or symptoms of toxicity, e.g., cytokine release syndrome (CRS) or neurotoxicity (NT).
  • the agent is also an agent that can treat or ameliorate a toxicity.
  • the agent can be administered based on or according certain procedures or guidelines, e.g., based on assessment and monitoring of outcomes, such as toxicity and/or response outcomes, and/or monitoring of parameters or biomarkers, e.g., pharmacokinetic parameters, patient attributes or factors and/or expression of biomarkers, such as any described herein.
  • the agent is administered according to exemplary procedure or guidelines for treatment or amelioration of toxicity, such as those described in Table 7 below.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Immunology (AREA)
  • Medicinal Chemistry (AREA)
  • Organic Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Molecular Biology (AREA)
  • Engineering & Computer Science (AREA)
  • Epidemiology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Genetics & Genomics (AREA)
  • Biochemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Cell Biology (AREA)
  • Biophysics (AREA)
  • Toxicology (AREA)
  • Microbiology (AREA)
  • Biomedical Technology (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Mycology (AREA)
  • Hematology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Oncology (AREA)
  • Biotechnology (AREA)
  • Urology & Nephrology (AREA)
  • Food Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Endocrinology (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
PCT/US2018/063502 2017-12-01 2018-11-30 Methods for dosing and for modulation of genetically engineered cells Ceased WO2019109053A1 (en)

Priority Applications (5)

Application Number Priority Date Filing Date Title
US16/768,575 US20210198372A1 (en) 2017-12-01 2018-11-30 Methods for dosing and for modulation of genetically engineered cells
JP2020529479A JP2021508317A (ja) 2017-12-01 2018-11-30 遺伝子操作された細胞の投与および調節のための方法
EP18821900.0A EP3716980A1 (en) 2017-12-01 2018-11-30 Methods for dosing and for modulation of genetically engineered cells
KR1020207018924A KR20200116081A (ko) 2017-12-01 2018-11-30 유전자 조작된 세포의 투약 및 조절 방법
CN201880087684.XA CN111989106A (zh) 2017-12-01 2018-11-30 基因工程化细胞的给药和调节方法

Applications Claiming Priority (10)

Application Number Priority Date Filing Date Title
US201762593878P 2017-12-01 2017-12-01
US62/593,878 2017-12-01
US201762596773P 2017-12-08 2017-12-08
US62/596,773 2017-12-08
US201862633599P 2018-02-21 2018-02-21
US62/633,599 2018-02-21
US201862679763P 2018-06-01 2018-06-01
US201862679764P 2018-06-01 2018-06-01
US62/679,764 2018-06-01
US62/679,763 2018-06-01

Publications (1)

Publication Number Publication Date
WO2019109053A1 true WO2019109053A1 (en) 2019-06-06

Family

ID=64734219

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2018/063502 Ceased WO2019109053A1 (en) 2017-12-01 2018-11-30 Methods for dosing and for modulation of genetically engineered cells

Country Status (7)

Country Link
US (1) US20210198372A1 (https=)
EP (1) EP3716980A1 (https=)
JP (1) JP2021508317A (https=)
KR (1) KR20200116081A (https=)
CN (1) CN111989106A (https=)
MA (1) MA51210A (https=)
WO (1) WO2019109053A1 (https=)

Cited By (29)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2020097403A1 (en) * 2018-11-08 2020-05-14 Juno Therapeutics, Inc. Methods and combinations for treatment and t cell modulation
WO2020113194A3 (en) * 2018-11-30 2020-07-23 Juno Therapeutics, Inc. Methods for treatment using adoptive cell therapy
WO2021236962A1 (en) * 2020-05-20 2021-11-25 The Medical College Of Wisconsin, Inc. Compositions and methods for inhibiting cytokine-release syndrome
US11413310B2 (en) 2017-06-02 2022-08-16 Juno Therapeutics, Inc. Articles of manufacture and methods for treatment using adoptive cell therapy
WO2022238901A1 (en) * 2021-05-11 2022-11-17 Janssen Biotech, Inc. Methods of minimizing neurotoxicity associated with chimeric antigen receptor (car) t cell therapy
US11564946B2 (en) 2017-11-01 2023-01-31 Juno Therapeutics, Inc. Methods associated with tumor burden for assessing response to a cell therapy
US11590167B2 (en) 2016-12-03 2023-02-28 Juno Therapeutic, Inc. Methods and compositions for use of therapeutic T cells in combination with kinase inhibitors
US11773434B2 (en) 2017-06-20 2023-10-03 The Medical College Of Wisconsin, Inc. Assessing transplant complication risk with total cell-free DNA
US11931674B2 (en) 2019-04-04 2024-03-19 Natera, Inc. Materials and methods for processing blood samples
US11939634B2 (en) 2010-05-18 2024-03-26 Natera, Inc. Methods for simultaneous amplification of target loci
US11946101B2 (en) 2015-05-11 2024-04-02 Natera, Inc. Methods and compositions for determining ploidy
EP4353818A3 (en) * 2017-02-27 2024-06-19 Juno Therapeutics, Inc. Compositions, articles of manufacture and methods related to dosing in cell therapy
US12020778B2 (en) 2010-05-18 2024-06-25 Natera, Inc. Methods for non-invasive prenatal ploidy calling
US12024738B2 (en) 2018-04-14 2024-07-02 Natera, Inc. Methods for cancer detection and monitoring
US12084720B2 (en) 2017-12-14 2024-09-10 Natera, Inc. Assessing graft suitability for transplantation
US12100478B2 (en) 2012-08-17 2024-09-24 Natera, Inc. Method for non-invasive prenatal testing using parental mosaicism data
US12110552B2 (en) 2010-05-18 2024-10-08 Natera, Inc. Methods for simultaneous amplification of target loci
US12146195B2 (en) 2016-04-15 2024-11-19 Natera, Inc. Methods for lung cancer detection
US12152275B2 (en) 2010-05-18 2024-11-26 Natera, Inc. Methods for non-invasive prenatal ploidy calling
US12221653B2 (en) 2010-05-18 2025-02-11 Natera, Inc. Methods for simultaneous amplification of target loci
US12234509B2 (en) 2018-07-03 2025-02-25 Natera, Inc. Methods for detection of donor-derived cell-free DNA
US12258580B2 (en) 2017-11-01 2025-03-25 Juno Therapeutics, Inc. Process for generating therapeutic compositions of engineered cells
US12260934B2 (en) 2014-06-05 2025-03-25 Natera, Inc. Systems and methods for detection of aneuploidy
US12270073B2 (en) 2010-05-18 2025-04-08 Natera, Inc. Methods for preparing a biological sample obtained from an individual for use in a genetic testing assay
US12305229B2 (en) 2014-04-21 2025-05-20 Natera, Inc. Methods for simultaneous amplification of target loci
US12410476B2 (en) 2010-05-18 2025-09-09 Natera, Inc. Methods for simultaneous amplification of target loci
US12460264B2 (en) 2016-11-02 2025-11-04 Natera, Inc. Method of detecting tumour recurrence
US12509728B2 (en) 2005-07-29 2025-12-30 Natera, Inc. System and method for cleaning noisy genetic data and determining chromosome copy number
US12571043B2 (en) 2005-11-26 2026-03-10 Natera, Inc. System and method for cleaning noisy genetic data from target individuals using genetic data from genetically related individuals

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP4371125A1 (en) * 2021-07-13 2024-05-22 Genentech, Inc. Multi-variate model for predicting cytokine release syndrome

Citations (129)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4452773A (en) 1982-04-05 1984-06-05 Canadian Patents And Development Limited Magnetic iron-dextran microspheres
US4690915A (en) 1985-08-08 1987-09-01 The United States Of America As Represented By The Department Of Health And Human Services Adoptive immunotherapy as a treatment modality in humans
US4795698A (en) 1985-10-04 1989-01-03 Immunicon Corporation Magnetic-polymer particles
EP0090505B1 (en) 1982-03-03 1990-08-08 Genentech, Inc. Human antithrombin iii, dna sequences therefor, expression vehicles and cloning vectors containing such sequences and cell cultures transformed thereby, a process for expressing human antithrombin iii, and pharmaceutical compositions comprising it
US5033252A (en) 1987-12-23 1991-07-23 Entravision, Inc. Method of packaging and sterilizing a pharmaceutical product
US5052558A (en) 1987-12-23 1991-10-01 Entravision, Inc. Packaged pharmaceutical product
US5087616A (en) 1986-08-07 1992-02-11 Battelle Memorial Institute Cytotoxic drug conjugates and their delivery to tumor cells
US5200084A (en) 1990-09-26 1993-04-06 Immunicon Corporation Apparatus and methods for magnetic separation
US5219740A (en) 1987-02-13 1993-06-15 Fred Hutchinson Cancer Research Center Retroviral gene transfer into diploid fibroblasts for gene therapy
US5323907A (en) 1992-06-23 1994-06-28 Multi-Comp, Inc. Child resistant package assembly for dispensing pharmaceutical medications
EP0452342B1 (en) 1988-12-28 1994-11-30 MILTENYI, Stefan Methods and materials for high gradient magnetic separation of biological materials
US5424297A (en) 1992-04-27 1995-06-13 University Of Virginia Alumni Patents Foundation Adenosine dextran conjugates
US5504090A (en) 1994-03-30 1996-04-02 Trustees Of The University Of Pennsylvania Compositions and methods for the prevention and treatment of ischemia-reperfusion organ injury
WO1996013593A2 (en) 1994-10-26 1996-05-09 Procept, Inc. Soluble single chain t cell receptors
WO1996018105A1 (en) 1994-12-06 1996-06-13 The President And Fellows Of Harvard College Single chain t-cell receptor
US5545627A (en) 1988-07-19 1996-08-13 The United States Of America As Represented By The Department Of Health And Human Services Irreversible inhibitors of adenosine receptors
US5565566A (en) 1987-04-24 1996-10-15 Discovery Therapeutics, Inc. N6 -substituted 9-methyladenines: a new class of adenosine receptor antagonists
US5591827A (en) 1992-10-20 1997-01-07 Cetus Oncology Corporation Interleukin-6 receptor antagonists
US5635517A (en) 1996-07-24 1997-06-03 Celgene Corporation Method of reducing TNFα levels with amino substituted 2-(2,6-dioxopiperidin-3-yl)-1-oxo-and 1,3-dioxoisoindolines
US5670501A (en) 1994-09-01 1997-09-23 Discovery Therapeutics, Inc. N-substituted 9-alkyladenines
US5712291A (en) 1993-03-01 1998-01-27 The Children's Medical Center Corporation Methods and compositions for inhibition of angiogenesis
US5786360A (en) 1996-11-19 1998-07-28 Link Technology Incorporated A1 adenosine receptor antagonists
US5861405A (en) 1993-05-03 1999-01-19 The United States Of America As Represented By The Department Of Health And Human Services S-substituted 1,3,7-trialkyl-xanthine derivatives
WO1999018129A1 (en) 1997-10-02 1999-04-15 Sunol Molecular Corporation Soluble single-chain t-cell receptor proteins
WO1999020758A1 (en) 1997-10-21 1999-04-29 Human Genome Sciences, Inc. Human tumor necrosis factor receptor-like proteins tr11, tr11sv1, and tr11sv2
WO1999040196A1 (en) 1998-02-09 1999-08-12 Genentech, Inc. Novel tumor necrosis factor receptor homolog and nucleic acids encoding the same
WO1999060120A2 (en) 1998-05-19 1999-11-25 Avidex Limited Soluble t cell receptor
WO2000014257A1 (en) 1998-09-04 2000-03-16 Sloan-Kettering Institute For Cancer Research Fusion receptors specific for prostate-specific membrane antigen and uses thereof
US6040177A (en) 1994-08-31 2000-03-21 Fred Hutchinson Cancer Research Center High efficiency transduction of T lymphocytes using rapid expansion methods ("REM")
US6066642A (en) 1996-01-29 2000-05-23 The United States Of America As Represented By The Department Of Health And Human Services Dihydropyridine-, pyridine-, benzopyran-4-one- and triazoloquinazoline derivative, their preparation and their use as adenosine receptor antagonists
US6111090A (en) 1996-08-16 2000-08-29 Schering Corporation Mammalian cell surface antigens; related reagents
WO2001003720A2 (en) 1999-07-12 2001-01-18 Genentech, Inc. Promotion or inhibition of angiogenesis and cardiovascularization by tumor necrosis factor ligand/receptor homologs
US6207453B1 (en) 1996-03-06 2001-03-27 Medigene Ag Recombinant AAV vector-based transduction system and use of same
US6232297B1 (en) 1999-02-01 2001-05-15 University Of Virginia Patent Foundation Methods and compositions for treating inflammatory response
US6313131B1 (en) 1999-02-16 2001-11-06 Upsher-Smith Laboratories, Inc. Method of kidney treatment
US6322771B1 (en) 1999-06-18 2001-11-27 University Of Virginia Patent Foundation Induction of pharmacological stress with adenosine receptor agonists
US6326390B1 (en) 1998-08-25 2001-12-04 King Pharmaceuticals Reseach And Development, Inc. Use of adenosine A3 receptor antagonists to inhibit tumor growth
US6410319B1 (en) 1998-10-20 2002-06-25 City Of Hope CD20-specific redirected T cells and their use in cellular immunotherapy of CD20+ malignancies
WO2002055083A1 (en) 2001-01-10 2002-07-18 Vernalis Research Limited TRIAZOLO[4,5-d] PYRIMIDINE DERIVATIVES AND THEIR USE AS PURINERGIC RECEPTOR ANTAGONISTS
WO2002059106A1 (en) 2000-12-27 2002-08-01 Celgene Corporation Isoindole-imide compounds, compositions, and uses thereof
WO2002068414A2 (en) 2001-02-27 2002-09-06 The Governement Of The United States Of America, As Represented By The Secretary Of The Department Of Health And Human Services Analogs of thalidomide as potential angiogenesis inhibitors
US6451995B1 (en) 1996-03-20 2002-09-17 Sloan-Kettering Institute For Cancer Research Single chain FV polynucleotide or peptide constructs of anti-ganglioside GD2 antibodies, cells expressing same and related methods
US20020131960A1 (en) 2000-06-02 2002-09-19 Michel Sadelain Artificial antigen presenting cells and methods of use thereof
US20020150914A1 (en) 1995-06-30 2002-10-17 Kobenhavns Universitet Recombinant antibodies from a phage display library, directed against a peptide-MHC complex
WO2003020763A2 (en) 2001-08-31 2003-03-13 Avidex Limited Soluble t cell receptor
WO2003068201A2 (en) 2002-02-13 2003-08-21 Technion Research & Development Foundation Ltd. High affinity antibody having a tcr-like specificity and use in detection and treatment
US20030170238A1 (en) 2002-03-07 2003-09-11 Gruenberg Micheal L. Re-activated T-cells for adoptive immunotherapy
US20030223994A1 (en) 2002-02-20 2003-12-04 Hoogenboom Henricus Renerus Jacobus Mattheus MHC-peptide complex binding ligands
WO2004033685A1 (en) 2002-10-09 2004-04-22 Avidex Ltd Single chain recombinant t cell receptors
US20040191260A1 (en) 2003-03-26 2004-09-30 Technion Research & Development Foundation Ltd. Compositions capable of specifically binding particular human antigen presenting molecule/pathogen-derived antigen complexes and uses thereof
WO2005007190A1 (en) 2003-07-11 2005-01-27 Schering Corporation Agonists or antagonists of the clucocorticoid-induced tumour necrosis factor receptor (gitr) or its ligand for the treatment of immune disorders, infections and cancer
WO2005055808A2 (en) 2003-12-02 2005-06-23 Genzyme Corporation Compositions and methods to diagnose and treat lung cancer
WO2005115451A2 (en) 2004-04-30 2005-12-08 Isis Innovation Limited Methods for generating improved immune response
WO2006000830A2 (en) 2004-06-29 2006-01-05 Avidex Ltd Cells expressing a modified t cell receptor
US20060034850A1 (en) 2004-05-27 2006-02-16 Weidanz Jon A Antibodies as T cell receptor mimics, methods of production and uses thereof
US7070995B2 (en) 2001-04-11 2006-07-04 City Of Hope CE7-specific redirected immune cells
WO2006083289A2 (en) 2004-06-04 2006-08-10 Duke University Methods and compositions for enhancement of immunity by in vivo depletion of immunosuppressive cell activity
US7091353B2 (en) 2000-12-27 2006-08-15 Celgene Corporation Isoindole-imide compounds, compositions, and uses thereof
US20070116690A1 (en) 2001-12-10 2007-05-24 Lili Yang Method for the generation of antigen-specific lymphocytes
WO2007133822A1 (en) 2006-01-19 2007-11-22 Genzyme Corporation Gitr antibodies for the treatment of cancer
EP1866339A2 (en) 2005-03-25 2007-12-19 TolerRx, Inc Gitr binding molecules and uses therefor
US7446179B2 (en) 2000-11-07 2008-11-04 City Of Hope CD19-specific chimeric T cell receptor
US7446190B2 (en) 2002-05-28 2008-11-04 Sloan-Kettering Institute For Cancer Research Nucleic acids encoding chimeric T cell receptors
WO2008147482A2 (en) 2007-02-13 2008-12-04 Northeastern University Methods and compositions for improving immune responses
WO2008154353A1 (en) 2007-06-08 2008-12-18 Charlesson, Llc Thalidomide analogs for treating vascular abnormalities
WO2009072003A2 (en) 2007-12-07 2009-06-11 Miltenyi Biotec Gmbh Sample processing system and methods
US20090226474A1 (en) 2004-05-27 2009-09-10 Weidanz Jon A Antibodies as T cell receptor mimics, methods of production and uses thereof
US7618632B2 (en) 2003-05-23 2009-11-17 Wyeth Method of treating or ameliorating an immune cell associated pathology using GITR ligand antibodies
US20090304679A1 (en) 2004-05-27 2009-12-10 Weidanz Jon A Antibodies as T cell receptor mimics, methods of production and uses thereof
WO2010003118A1 (en) 2008-07-02 2010-01-07 Trubion Pharmaceuticals, Inc. Tgf-b antagonist multi-target binding proteins
WO2010033140A2 (en) 2008-05-06 2010-03-25 Innovative Micro Technology Removable/disposable apparatus for mems particle sorting device
EP2277543A1 (en) 2002-09-06 2011-01-26 Amgen, Inc Therapeutic anti-IL-1R1 monoclonal antibody
WO2011028683A1 (en) 2009-09-03 2011-03-10 Schering Corporation Anti-gitr antibodies
WO2011044186A1 (en) 2009-10-06 2011-04-14 The Board Of Trustees Of The University Of Illinois Human single-chain t cell receptors
WO2011051726A2 (en) 2009-10-30 2011-05-05 Isis Innovation Ltd Treatment of obesity
WO2011056983A1 (en) 2009-11-05 2011-05-12 Genentech, Inc. Zirconium-radiolabeled, cysteine engineered antibody conjugates
WO2011066048A1 (en) 2009-10-22 2011-06-03 Thomas Jefferson University Cell-based anti-cancer compositions and methods of making and using the same
WO2011090754A1 (en) 2009-12-29 2011-07-28 Emergent Product Development Seattle, Llc Polypeptide heterodimers and uses thereof
WO2011109789A2 (en) 2010-03-05 2011-09-09 The Johns Hopkins University Compositions and methods for targeted immunomodulatory antibodies and fusion proteins
US8080554B2 (en) 2001-12-12 2011-12-20 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Methods for using extracellular adenosine inhibitors and adenosine receptor inhibitors to enhance immune response and inflammation
WO2012129514A1 (en) 2011-03-23 2012-09-27 Fred Hutchinson Cancer Research Center Method and compositions for cellular immunotherapy
US8324353B2 (en) 2001-04-30 2012-12-04 City Of Hope Chimeric immunoreceptor useful in treating human gliomas
US8339645B2 (en) 2008-05-27 2012-12-25 Canon Kabushiki Kaisha Managing apparatus, image processing apparatus, and processing method for the same, wherein a first user stores a temporary object having attribute information specified but not partial-area data, at a later time an object is received from a second user that includes both partial-area data and attribute information, the storage unit is searched for the temporary object that matches attribute information of the received object, and the first user is notified in response to a match
EP2537416A1 (en) 2007-03-30 2012-12-26 Memorial Sloan-Kettering Cancer Center Constitutive expression of costimulatory ligands on adoptively transferred T lymphocytes
US8398282B2 (en) 2011-05-12 2013-03-19 Delphi Technologies, Inc. Vehicle front lighting assembly and systems having a variable tint electrowetting element
WO2013039954A1 (en) 2011-09-14 2013-03-21 Sanofi Anti-gitr antibodies
WO2013071154A1 (en) 2011-11-11 2013-05-16 Fred Hutchinson Cancer Research Center Cyclin a1-targeted t-cell immunotherapy for cancer
US20130149337A1 (en) 2003-03-11 2013-06-13 City Of Hope Method of controlling administration of cancer antigen
US8479118B2 (en) 2007-12-10 2013-07-02 Microsoft Corporation Switching search providers within a browser search box
EP1947183B1 (en) 1996-08-16 2013-07-17 Merck Sharp & Dohme Corp. Mammalian cell surface antigens; related reagents
WO2013123061A1 (en) 2012-02-13 2013-08-22 Seattle Children's Hospital D/B/A Seattle Children's Research Institute Bispecific chimeric antigen receptors and therapeutic uses thereof
WO2013126726A1 (en) 2012-02-22 2013-08-29 The Trustees Of The University Of Pennsylvania Double transgenic t cells comprising a car and a tcr and their methods of use
US8562991B2 (en) 2008-09-26 2013-10-22 Chugai Seiyaku Kabushiki Kaisha Antibody molecules that bind to IL-6 receptor
US20130287748A1 (en) 2010-12-09 2013-10-31 The Trustees Of The University Of Pennsylvania Use of Chimeric Antigen Receptor-Modified T-Cells to Treat Cancer
WO2013166321A1 (en) 2012-05-03 2013-11-07 Fred Hutchinson Cancer Research Center Enhanced affinity t cell receptors and methods for making the same
US8586023B2 (en) 2008-09-12 2013-11-19 Mie University Cell capable of expressing exogenous GITR ligand
US8591886B2 (en) 2007-07-12 2013-11-26 Gitr, Inc. Combination therapies employing GITR binding molecules
WO2014031687A1 (en) 2012-08-20 2014-02-27 Jensen, Michael Method and compositions for cellular immunotherapy
WO2014055668A1 (en) 2012-10-02 2014-04-10 Memorial Sloan-Kettering Cancer Center Compositions and methods for immunotherapy
US8802374B2 (en) 2009-11-03 2014-08-12 City Of Hope Truncated epiderimal growth factor receptor (EGFRt) for transduced T cell selection
US8822647B2 (en) 2008-08-26 2014-09-02 City Of Hope Method and compositions using a chimeric antigen receptor for enhanced anti-tumor effector functioning of T cells
US20140271635A1 (en) 2013-03-16 2014-09-18 The Trustees Of The University Of Pennsylvania Treatment of cancer using humanized anti-cd19 chimeric antigen receptor
US20140294841A1 (en) 2011-04-01 2014-10-02 Eureka Therapeutics, Inc. T cell receptor-like antibodies specific for a wti peptide presented by hla-a2
US20140322183A1 (en) 2013-03-15 2014-10-30 The Trustees Of The University Of Pennsylvania Targeting cytotoxic cells with chimeric receptors for adoptive immunotherapy
US8883500B2 (en) 2008-12-05 2014-11-11 Northeastern University Method of preparing adenosine-resistant anti-tumor T lymphocytes for adoptive immunotherapy
US20140377240A1 (en) 2012-01-17 2014-12-25 Northeastern University Methods and compositions for expanding immunosuppressive t regulatory cells in vitro and uses thereof
US8987279B2 (en) 2008-06-25 2015-03-24 Vernalis (R&D) Limited Triazolo [4, 5-D] pyramidine derivatives and their use as purine receptor antagonists
WO2015079417A1 (en) 2013-11-29 2015-06-04 Novartis Ag Novel amino pyrimidine derivatives
US20150175711A1 (en) 2012-06-15 2015-06-25 Sinomab Bioscience Limited Anti-cd22 anti-idiotypic antibodies and uses thereof
US9108442B2 (en) 2013-08-20 2015-08-18 Ricoh Company, Ltd. Image forming apparatus
US20150283178A1 (en) 2014-04-07 2015-10-08 Carl H. June Treatment of cancer using anti-cd19 chimeric antigen receptor
US20160068601A1 (en) 2014-08-19 2016-03-10 The Trustees Of The University Of Pennsylvania Treatment of cancer using a cd123 chimeric antigen receptor
US20160096902A1 (en) 2013-05-24 2016-04-07 Board Of Regents, The University Of Texas System Chimeric antigen receptor-targeting monoclonal antibodies
WO2016069647A1 (en) 2014-10-27 2016-05-06 Fred Hutchinson Cancer Research Center Compositions and methods for boosting the efficacy of adoptive cellular immunotherapy
US20160152723A1 (en) 2014-08-28 2016-06-02 Juno Therapeutics, Inc. Antibodies and chimeric antigen receptors specific for cd19
WO2016090312A1 (en) 2014-12-05 2016-06-09 Memorial Sloan-Kettering Cancer Center Chimeric antigen receptors targeting g-protein coupled receptor and uses thereof
WO2016090329A2 (en) 2014-12-05 2016-06-09 Memorial Sloan-Kettering Cancer Center Antibodies targeting g-protein coupled receptor and methods of use
WO2016090327A2 (en) 2014-12-05 2016-06-09 Memorial Sloan-Kettering Cancer Center Antibodies targeting b-cell maturation antigen and methods of use
WO2016090320A1 (en) 2014-12-05 2016-06-09 Memorial Sloan-Kettering Cancer Center Chimeric antigen receptors targeting b-cell maturation antigen and uses thereof
US9405601B2 (en) 2012-12-20 2016-08-02 Mitsubishi Electric Corporation In-vehicle apparatus and program
US20160304624A1 (en) 2013-03-15 2016-10-20 Thomas Jefferson University Cell-Based Anti-Cancer Compositions With Reduced Toxicity and Methods of Making and Using the Same
US9476028B2 (en) 2011-04-13 2016-10-25 Immunicum Ab Method for proliferation of antigen-specific T cells
US20160313300A1 (en) 2013-12-06 2016-10-27 Celgene Corporation Methods for determining drug efficacy for the treatment of diffuse large b-cell lymphoma, multiple myeloma, and myeloid cancers
US20170051035A1 (en) 2014-05-02 2017-02-23 The Trustees Of The University Of Pennsylvania Compositions and methods of chimeric autoantibody receptor t cells
WO2017096331A1 (en) * 2015-12-04 2017-06-08 Juno Therapeutics, Inc. Methods and compositions related to toxicity associated with cell therapy
WO2017165571A1 (en) * 2016-03-22 2017-09-28 Seattle Children's Hospital (dba Seattle Children's Research Institute) Early intervention methods to prevent or ameliorate toxicity
WO2018102787A1 (en) * 2016-12-03 2018-06-07 Juno Therapeutics, Inc. Methods for determining car-t cells dosing
WO2018223098A1 (en) * 2017-06-02 2018-12-06 Juno Therapeutics, Inc. Articles of manufacture and methods related to toxicity associated with cell therapy
WO2018223101A1 (en) * 2017-06-02 2018-12-06 Juno Therapeutics, Inc. Articles of manufacture and methods for treatment using adoptive cell therapy

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
RS66511B1 (sr) * 2015-05-20 2025-03-31 Amgen Res Munich Gmbh Deplecija b ćelija kao dijagnostički marker
JP6905163B2 (ja) * 2015-09-03 2021-07-21 ザ トラスティーズ オブ ザ ユニバーシティ オブ ペンシルバニア サイトカイン放出症候群を予測するバイオマーカー

Patent Citations (150)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0090505B1 (en) 1982-03-03 1990-08-08 Genentech, Inc. Human antithrombin iii, dna sequences therefor, expression vehicles and cloning vectors containing such sequences and cell cultures transformed thereby, a process for expressing human antithrombin iii, and pharmaceutical compositions comprising it
US4452773A (en) 1982-04-05 1984-06-05 Canadian Patents And Development Limited Magnetic iron-dextran microspheres
US4690915A (en) 1985-08-08 1987-09-01 The United States Of America As Represented By The Department Of Health And Human Services Adoptive immunotherapy as a treatment modality in humans
US4795698A (en) 1985-10-04 1989-01-03 Immunicon Corporation Magnetic-polymer particles
US5087616A (en) 1986-08-07 1992-02-11 Battelle Memorial Institute Cytotoxic drug conjugates and their delivery to tumor cells
US5219740A (en) 1987-02-13 1993-06-15 Fred Hutchinson Cancer Research Center Retroviral gene transfer into diploid fibroblasts for gene therapy
US5565566A (en) 1987-04-24 1996-10-15 Discovery Therapeutics, Inc. N6 -substituted 9-methyladenines: a new class of adenosine receptor antagonists
US5033252A (en) 1987-12-23 1991-07-23 Entravision, Inc. Method of packaging and sterilizing a pharmaceutical product
US5052558A (en) 1987-12-23 1991-10-01 Entravision, Inc. Packaged pharmaceutical product
US5545627A (en) 1988-07-19 1996-08-13 The United States Of America As Represented By The Department Of Health And Human Services Irreversible inhibitors of adenosine receptors
EP0452342B1 (en) 1988-12-28 1994-11-30 MILTENYI, Stefan Methods and materials for high gradient magnetic separation of biological materials
US5200084A (en) 1990-09-26 1993-04-06 Immunicon Corporation Apparatus and methods for magnetic separation
US5424297A (en) 1992-04-27 1995-06-13 University Of Virginia Alumni Patents Foundation Adenosine dextran conjugates
US5323907A (en) 1992-06-23 1994-06-28 Multi-Comp, Inc. Child resistant package assembly for dispensing pharmaceutical medications
US5591827A (en) 1992-10-20 1997-01-07 Cetus Oncology Corporation Interleukin-6 receptor antagonists
US5712291A (en) 1993-03-01 1998-01-27 The Children's Medical Center Corporation Methods and compositions for inhibition of angiogenesis
US5861405A (en) 1993-05-03 1999-01-19 The United States Of America As Represented By The Department Of Health And Human Services S-substituted 1,3,7-trialkyl-xanthine derivatives
US5504090A (en) 1994-03-30 1996-04-02 Trustees Of The University Of Pennsylvania Compositions and methods for the prevention and treatment of ischemia-reperfusion organ injury
US6040177A (en) 1994-08-31 2000-03-21 Fred Hutchinson Cancer Research Center High efficiency transduction of T lymphocytes using rapid expansion methods ("REM")
US5981524A (en) 1994-09-01 1999-11-09 Discovery Therapeutics, Inc. Substituted 9-alkyladenines
US5670501A (en) 1994-09-01 1997-09-23 Discovery Therapeutics, Inc. N-substituted 9-alkyladenines
WO1996013593A2 (en) 1994-10-26 1996-05-09 Procept, Inc. Soluble single chain t cell receptors
WO1996018105A1 (en) 1994-12-06 1996-06-13 The President And Fellows Of Harvard College Single chain t-cell receptor
US20020150914A1 (en) 1995-06-30 2002-10-17 Kobenhavns Universitet Recombinant antibodies from a phage display library, directed against a peptide-MHC complex
US6066642A (en) 1996-01-29 2000-05-23 The United States Of America As Represented By The Department Of Health And Human Services Dihydropyridine-, pyridine-, benzopyran-4-one- and triazoloquinazoline derivative, their preparation and their use as adenosine receptor antagonists
US6207453B1 (en) 1996-03-06 2001-03-27 Medigene Ag Recombinant AAV vector-based transduction system and use of same
US6451995B1 (en) 1996-03-20 2002-09-17 Sloan-Kettering Institute For Cancer Research Single chain FV polynucleotide or peptide constructs of anti-ganglioside GD2 antibodies, cells expressing same and related methods
US5635517A (en) 1996-07-24 1997-06-03 Celgene Corporation Method of reducing TNFα levels with amino substituted 2-(2,6-dioxopiperidin-3-yl)-1-oxo-and 1,3-dioxoisoindolines
US5635517B1 (en) 1996-07-24 1999-06-29 Celgene Corp Method of reducing TNFalpha levels with amino substituted 2-(2,6-dioxopiperidin-3-YL)-1-oxo-and 1,3-dioxoisoindolines
US7025962B1 (en) 1996-08-16 2006-04-11 Schering Corporation Mammalian cell surface antigens; related reagents
EP1947183B1 (en) 1996-08-16 2013-07-17 Merck Sharp & Dohme Corp. Mammalian cell surface antigens; related reagents
US6111090A (en) 1996-08-16 2000-08-29 Schering Corporation Mammalian cell surface antigens; related reagents
US6117998A (en) 1996-11-19 2000-09-12 Link Technology Incorporated A1 adenosine receptor antagonists
US5786360A (en) 1996-11-19 1998-07-28 Link Technology Incorporated A1 adenosine receptor antagonists
WO1999018129A1 (en) 1997-10-02 1999-04-15 Sunol Molecular Corporation Soluble single-chain t-cell receptor proteins
WO1999020758A1 (en) 1997-10-21 1999-04-29 Human Genome Sciences, Inc. Human tumor necrosis factor receptor-like proteins tr11, tr11sv1, and tr11sv2
WO1999040196A1 (en) 1998-02-09 1999-08-12 Genentech, Inc. Novel tumor necrosis factor receptor homolog and nucleic acids encoding the same
WO1999060120A2 (en) 1998-05-19 1999-11-25 Avidex Limited Soluble t cell receptor
US6326390B1 (en) 1998-08-25 2001-12-04 King Pharmaceuticals Reseach And Development, Inc. Use of adenosine A3 receptor antagonists to inhibit tumor growth
WO2000014257A1 (en) 1998-09-04 2000-03-16 Sloan-Kettering Institute For Cancer Research Fusion receptors specific for prostate-specific membrane antigen and uses thereof
US6410319B1 (en) 1998-10-20 2002-06-25 City Of Hope CD20-specific redirected T cells and their use in cellular immunotherapy of CD20+ malignancies
US6232297B1 (en) 1999-02-01 2001-05-15 University Of Virginia Patent Foundation Methods and compositions for treating inflammatory response
US6313131B1 (en) 1999-02-16 2001-11-06 Upsher-Smith Laboratories, Inc. Method of kidney treatment
US6322771B1 (en) 1999-06-18 2001-11-27 University Of Virginia Patent Foundation Induction of pharmacological stress with adenosine receptor agonists
WO2001003720A2 (en) 1999-07-12 2001-01-18 Genentech, Inc. Promotion or inhibition of angiogenesis and cardiovascularization by tumor necrosis factor ligand/receptor homologs
US20020131960A1 (en) 2000-06-02 2002-09-19 Michel Sadelain Artificial antigen presenting cells and methods of use thereof
US7446179B2 (en) 2000-11-07 2008-11-04 City Of Hope CD19-specific chimeric T cell receptor
WO2002059106A1 (en) 2000-12-27 2002-08-01 Celgene Corporation Isoindole-imide compounds, compositions, and uses thereof
US7091353B2 (en) 2000-12-27 2006-08-15 Celgene Corporation Isoindole-imide compounds, compositions, and uses thereof
US20030045552A1 (en) 2000-12-27 2003-03-06 Robarge Michael J. Isoindole-imide compounds, compositions, and uses thereof
US7405219B2 (en) 2001-01-10 2008-07-29 Vernalis Research Limited Triazolo [4,5-d] pyrimidine derivatives and their use as purinergic receptor antagonists
US7141575B2 (en) 2001-01-10 2006-11-28 Vernalis Research Ltd. Triazolo[4,5-d]pyrimidine derivatives and their use as purinergic receptor antagonists
WO2002055083A1 (en) 2001-01-10 2002-07-18 Vernalis Research Limited TRIAZOLO[4,5-d] PYRIMIDINE DERIVATIVES AND THEIR USE AS PURINERGIC RECEPTOR ANTAGONISTS
US8716315B2 (en) 2001-02-27 2014-05-06 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Analogs of thalidomide as potential angiogenesis inhibitors
WO2002068414A2 (en) 2001-02-27 2002-09-06 The Governement Of The United States Of America, As Represented By The Secretary Of The Department Of Health And Human Services Analogs of thalidomide as potential angiogenesis inhibitors
US7320991B2 (en) 2001-02-27 2008-01-22 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services, National Institutes Of Health Analogs of thalidomide as potential angiogenesis inhibitors
US7070995B2 (en) 2001-04-11 2006-07-04 City Of Hope CE7-specific redirected immune cells
US7446191B2 (en) 2001-04-11 2008-11-04 City Of Hope DNA construct encoding CE7-specific chimeric T cell receptor
US7265209B2 (en) 2001-04-11 2007-09-04 City Of Hope CE7-specific chimeric T cell receptor
US7354762B2 (en) 2001-04-11 2008-04-08 City Of Hope Method for producing CE7-specific redirected immune cells
US8324353B2 (en) 2001-04-30 2012-12-04 City Of Hope Chimeric immunoreceptor useful in treating human gliomas
WO2003020763A2 (en) 2001-08-31 2003-03-13 Avidex Limited Soluble t cell receptor
US20070116690A1 (en) 2001-12-10 2007-05-24 Lili Yang Method for the generation of antigen-specific lymphocytes
US8080554B2 (en) 2001-12-12 2011-12-20 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Methods for using extracellular adenosine inhibitors and adenosine receptor inhibitors to enhance immune response and inflammation
US20140056922A1 (en) 2001-12-12 2014-02-27 The United States Of America,As Represented By The Secretary, Department Of Health And Human Service Methods for using extracellular adenosine inhibitors and adenosine receptor inhibitors to enhance immune response and inflammation
US8716301B2 (en) 2001-12-12 2014-05-06 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Methods for using extracellular adenosine inhibitors and adenosine receptor inhibitors to enhance immune response and inflammation
WO2003068201A2 (en) 2002-02-13 2003-08-21 Technion Research & Development Foundation Ltd. High affinity antibody having a tcr-like specificity and use in detection and treatment
US20030223994A1 (en) 2002-02-20 2003-12-04 Hoogenboom Henricus Renerus Jacobus Mattheus MHC-peptide complex binding ligands
US20030170238A1 (en) 2002-03-07 2003-09-11 Gruenberg Micheal L. Re-activated T-cells for adoptive immunotherapy
US7446190B2 (en) 2002-05-28 2008-11-04 Sloan-Kettering Institute For Cancer Research Nucleic acids encoding chimeric T cell receptors
EP2277543A1 (en) 2002-09-06 2011-01-26 Amgen, Inc Therapeutic anti-IL-1R1 monoclonal antibody
WO2004033685A1 (en) 2002-10-09 2004-04-22 Avidex Ltd Single chain recombinant t cell receptors
US20130149337A1 (en) 2003-03-11 2013-06-13 City Of Hope Method of controlling administration of cancer antigen
US20040191260A1 (en) 2003-03-26 2004-09-30 Technion Research & Development Foundation Ltd. Compositions capable of specifically binding particular human antigen presenting molecule/pathogen-derived antigen complexes and uses thereof
US7618632B2 (en) 2003-05-23 2009-11-17 Wyeth Method of treating or ameliorating an immune cell associated pathology using GITR ligand antibodies
WO2005007190A1 (en) 2003-07-11 2005-01-27 Schering Corporation Agonists or antagonists of the clucocorticoid-induced tumour necrosis factor receptor (gitr) or its ligand for the treatment of immune disorders, infections and cancer
WO2005055808A2 (en) 2003-12-02 2005-06-23 Genzyme Corporation Compositions and methods to diagnose and treat lung cancer
WO2005115451A2 (en) 2004-04-30 2005-12-08 Isis Innovation Limited Methods for generating improved immune response
US20090304679A1 (en) 2004-05-27 2009-12-10 Weidanz Jon A Antibodies as T cell receptor mimics, methods of production and uses thereof
US20070092530A1 (en) 2004-05-27 2007-04-26 Weidanz Jon A Antibodies as T cell receptor mimics, methods of production and uses thereof
US20090226474A1 (en) 2004-05-27 2009-09-10 Weidanz Jon A Antibodies as T cell receptor mimics, methods of production and uses thereof
US20060034850A1 (en) 2004-05-27 2006-02-16 Weidanz Jon A Antibodies as T cell receptor mimics, methods of production and uses thereof
WO2006083289A2 (en) 2004-06-04 2006-08-10 Duke University Methods and compositions for enhancement of immunity by in vivo depletion of immunosuppressive cell activity
WO2006000830A2 (en) 2004-06-29 2006-01-05 Avidex Ltd Cells expressing a modified t cell receptor
EP1866339A2 (en) 2005-03-25 2007-12-19 TolerRx, Inc Gitr binding molecules and uses therefor
US7812135B2 (en) 2005-03-25 2010-10-12 Tolerrx, Inc. GITR-binding antibodies
US8388967B2 (en) 2005-03-25 2013-03-05 Gitr, Inc. Methods for inducing or enhancing an immune response by administering agonistic GITR-binding antibodies
WO2007133822A1 (en) 2006-01-19 2007-11-22 Genzyme Corporation Gitr antibodies for the treatment of cancer
WO2008147482A2 (en) 2007-02-13 2008-12-04 Northeastern University Methods and compositions for improving immune responses
US8389282B2 (en) 2007-03-30 2013-03-05 Memorial Sloan-Kettering Cancer Center Constitutive expression of costimulatory ligands on adoptively transferred T lymphocytes
EP2537416A1 (en) 2007-03-30 2012-12-26 Memorial Sloan-Kettering Cancer Center Constitutive expression of costimulatory ligands on adoptively transferred T lymphocytes
WO2008154353A1 (en) 2007-06-08 2008-12-18 Charlesson, Llc Thalidomide analogs for treating vascular abnormalities
US8591886B2 (en) 2007-07-12 2013-11-26 Gitr, Inc. Combination therapies employing GITR binding molecules
WO2009072003A2 (en) 2007-12-07 2009-06-11 Miltenyi Biotec Gmbh Sample processing system and methods
US20110003380A1 (en) 2007-12-07 2011-01-06 Stefan Miltenyi Sample Processing System and Methods
US8479118B2 (en) 2007-12-10 2013-07-02 Microsoft Corporation Switching search providers within a browser search box
WO2010033140A2 (en) 2008-05-06 2010-03-25 Innovative Micro Technology Removable/disposable apparatus for mems particle sorting device
US8339645B2 (en) 2008-05-27 2012-12-25 Canon Kabushiki Kaisha Managing apparatus, image processing apparatus, and processing method for the same, wherein a first user stores a temporary object having attribute information specified but not partial-area data, at a later time an object is received from a second user that includes both partial-area data and attribute information, the storage unit is searched for the temporary object that matches attribute information of the received object, and the first user is notified in response to a match
US8987279B2 (en) 2008-06-25 2015-03-24 Vernalis (R&D) Limited Triazolo [4, 5-D] pyramidine derivatives and their use as purine receptor antagonists
WO2010003118A1 (en) 2008-07-02 2010-01-07 Trubion Pharmaceuticals, Inc. Tgf-b antagonist multi-target binding proteins
US8822647B2 (en) 2008-08-26 2014-09-02 City Of Hope Method and compositions using a chimeric antigen receptor for enhanced anti-tumor effector functioning of T cells
US8586023B2 (en) 2008-09-12 2013-11-19 Mie University Cell capable of expressing exogenous GITR ligand
US8562991B2 (en) 2008-09-26 2013-10-22 Chugai Seiyaku Kabushiki Kaisha Antibody molecules that bind to IL-6 receptor
US8883500B2 (en) 2008-12-05 2014-11-11 Northeastern University Method of preparing adenosine-resistant anti-tumor T lymphocytes for adoptive immunotherapy
WO2011028683A1 (en) 2009-09-03 2011-03-10 Schering Corporation Anti-gitr antibodies
WO2011044186A1 (en) 2009-10-06 2011-04-14 The Board Of Trustees Of The University Of Illinois Human single-chain t cell receptors
WO2011066048A1 (en) 2009-10-22 2011-06-03 Thomas Jefferson University Cell-based anti-cancer compositions and methods of making and using the same
WO2011051726A2 (en) 2009-10-30 2011-05-05 Isis Innovation Ltd Treatment of obesity
US8802374B2 (en) 2009-11-03 2014-08-12 City Of Hope Truncated epiderimal growth factor receptor (EGFRt) for transduced T cell selection
WO2011056983A1 (en) 2009-11-05 2011-05-12 Genentech, Inc. Zirconium-radiolabeled, cysteine engineered antibody conjugates
WO2011090754A1 (en) 2009-12-29 2011-07-28 Emergent Product Development Seattle, Llc Polypeptide heterodimers and uses thereof
WO2011109789A2 (en) 2010-03-05 2011-09-09 The Johns Hopkins University Compositions and methods for targeted immunomodulatory antibodies and fusion proteins
US20130287748A1 (en) 2010-12-09 2013-10-31 The Trustees Of The University Of Pennsylvania Use of Chimeric Antigen Receptor-Modified T-Cells to Treat Cancer
US9102760B2 (en) 2010-12-09 2015-08-11 The Trustees Of The University Of Pennsylvania Compositions for treatment of cancer
US8911993B2 (en) 2010-12-09 2014-12-16 The Trustees Of The University Of Pennsylvania Compositions for treatment of cancer
WO2012129514A1 (en) 2011-03-23 2012-09-27 Fred Hutchinson Cancer Research Center Method and compositions for cellular immunotherapy
US20140294841A1 (en) 2011-04-01 2014-10-02 Eureka Therapeutics, Inc. T cell receptor-like antibodies specific for a wti peptide presented by hla-a2
US9476028B2 (en) 2011-04-13 2016-10-25 Immunicum Ab Method for proliferation of antigen-specific T cells
US8398282B2 (en) 2011-05-12 2013-03-19 Delphi Technologies, Inc. Vehicle front lighting assembly and systems having a variable tint electrowetting element
WO2013039954A1 (en) 2011-09-14 2013-03-21 Sanofi Anti-gitr antibodies
WO2013071154A1 (en) 2011-11-11 2013-05-16 Fred Hutchinson Cancer Research Center Cyclin a1-targeted t-cell immunotherapy for cancer
US20140377240A1 (en) 2012-01-17 2014-12-25 Northeastern University Methods and compositions for expanding immunosuppressive t regulatory cells in vitro and uses thereof
WO2013123061A1 (en) 2012-02-13 2013-08-22 Seattle Children's Hospital D/B/A Seattle Children's Research Institute Bispecific chimeric antigen receptors and therapeutic uses thereof
WO2013126726A1 (en) 2012-02-22 2013-08-29 The Trustees Of The University Of Pennsylvania Double transgenic t cells comprising a car and a tcr and their methods of use
WO2013166321A1 (en) 2012-05-03 2013-11-07 Fred Hutchinson Cancer Research Center Enhanced affinity t cell receptors and methods for making the same
US20150175711A1 (en) 2012-06-15 2015-06-25 Sinomab Bioscience Limited Anti-cd22 anti-idiotypic antibodies and uses thereof
WO2014031687A1 (en) 2012-08-20 2014-02-27 Jensen, Michael Method and compositions for cellular immunotherapy
WO2014055668A1 (en) 2012-10-02 2014-04-10 Memorial Sloan-Kettering Cancer Center Compositions and methods for immunotherapy
US9405601B2 (en) 2012-12-20 2016-08-02 Mitsubishi Electric Corporation In-vehicle apparatus and program
US20140322183A1 (en) 2013-03-15 2014-10-30 The Trustees Of The University Of Pennsylvania Targeting cytotoxic cells with chimeric receptors for adoptive immunotherapy
US20160304624A1 (en) 2013-03-15 2016-10-20 Thomas Jefferson University Cell-Based Anti-Cancer Compositions With Reduced Toxicity and Methods of Making and Using the Same
US20140271635A1 (en) 2013-03-16 2014-09-18 The Trustees Of The University Of Pennsylvania Treatment of cancer using humanized anti-cd19 chimeric antigen receptor
US20160096902A1 (en) 2013-05-24 2016-04-07 Board Of Regents, The University Of Texas System Chimeric antigen receptor-targeting monoclonal antibodies
US9108442B2 (en) 2013-08-20 2015-08-18 Ricoh Company, Ltd. Image forming apparatus
WO2015079417A1 (en) 2013-11-29 2015-06-04 Novartis Ag Novel amino pyrimidine derivatives
US20160313300A1 (en) 2013-12-06 2016-10-27 Celgene Corporation Methods for determining drug efficacy for the treatment of diffuse large b-cell lymphoma, multiple myeloma, and myeloid cancers
US20150283178A1 (en) 2014-04-07 2015-10-08 Carl H. June Treatment of cancer using anti-cd19 chimeric antigen receptor
US20170051035A1 (en) 2014-05-02 2017-02-23 The Trustees Of The University Of Pennsylvania Compositions and methods of chimeric autoantibody receptor t cells
US20160068601A1 (en) 2014-08-19 2016-03-10 The Trustees Of The University Of Pennsylvania Treatment of cancer using a cd123 chimeric antigen receptor
US20160152723A1 (en) 2014-08-28 2016-06-02 Juno Therapeutics, Inc. Antibodies and chimeric antigen receptors specific for cd19
WO2016069647A1 (en) 2014-10-27 2016-05-06 Fred Hutchinson Cancer Research Center Compositions and methods for boosting the efficacy of adoptive cellular immunotherapy
WO2016090320A1 (en) 2014-12-05 2016-06-09 Memorial Sloan-Kettering Cancer Center Chimeric antigen receptors targeting b-cell maturation antigen and uses thereof
WO2016090327A2 (en) 2014-12-05 2016-06-09 Memorial Sloan-Kettering Cancer Center Antibodies targeting b-cell maturation antigen and methods of use
WO2016090329A2 (en) 2014-12-05 2016-06-09 Memorial Sloan-Kettering Cancer Center Antibodies targeting g-protein coupled receptor and methods of use
WO2016090312A1 (en) 2014-12-05 2016-06-09 Memorial Sloan-Kettering Cancer Center Chimeric antigen receptors targeting g-protein coupled receptor and uses thereof
WO2017096331A1 (en) * 2015-12-04 2017-06-08 Juno Therapeutics, Inc. Methods and compositions related to toxicity associated with cell therapy
WO2017165571A1 (en) * 2016-03-22 2017-09-28 Seattle Children's Hospital (dba Seattle Children's Research Institute) Early intervention methods to prevent or ameliorate toxicity
WO2018102787A1 (en) * 2016-12-03 2018-06-07 Juno Therapeutics, Inc. Methods for determining car-t cells dosing
WO2018223098A1 (en) * 2017-06-02 2018-12-06 Juno Therapeutics, Inc. Articles of manufacture and methods related to toxicity associated with cell therapy
WO2018223101A1 (en) * 2017-06-02 2018-12-06 Juno Therapeutics, Inc. Articles of manufacture and methods for treatment using adoptive cell therapy

Non-Patent Citations (153)

* Cited by examiner, † Cited by third party
Title
"Antibody-antigen interactions: Contact analysis and binding site topography", J. MOL. BIOL., vol. 262, pages 732 - 745
"Biocomputing: Informatics and Genome Projects", 1993, ACADEMIC PRESS
"Cell Behavior In Vitro and In Vivo", vol. 2, HUMANA PRESS INC., pages: 17 - 25
"Common Terminology for Adverse Events (CTCAE", 28 May 2009, U.S. DEPARTMENT OF HEALTH AND HUMAN SERVICES
"Computational Molecular Biology", 1988, OXFORD UNIVERSITY PRESS
"Computer Analysis of Sequence Data", 1994, HUMANA PRESS
"Current Protocols in Molecular Biology", JOHN WILEY & SONS
"Metastasis Research Protocols", METHODS IN MOLECULAR MEDICINE, vol. 58
"Remington: The Science and Practice of Pharmacy", 1 May 2005, LIPPINCOTT WILLIAMS & WILKINS
"Remington's Pharmaceutical Sciences", 1980
"Remington's Pharmaceutical Sciences", 1980, MACK PUB. CO.
"Sequence Analysis Primer", 1991, M STOCKTON PRESS
AL-LAZIKANI ET AL., JMB, vol. 273, 1997, pages 927 - 948
ALONSO-CAMINO ET AL., MOL THER NUCL ACIDS, vol. 2, 2013, pages e93
BARRETT ET AL., CHIMERIC ANTIGEN RECEPTOR THERAPY FOR CANCER ANNUAL REVIEW OF MEDICINE, vol. 65, 2014, pages 333 - 347
BASU ET AL., INDIAN J CRIT CARE MED., vol. 18, no. 12, 2014, pages 822 - 824
BATLEVI C L ET AL: "Novel immunotherapies in lymphoid malignancies", NATURE REVIEWS CLINICAL ONCOLOGY, NATURE, NY, US, vol. 13, no. 1, 1 January 2016 (2016-01-01), pages 25 - 40, XP009503771, ISSN: 1759-4774, DOI: 10.1038/NRCLINONC.2015.187 *
BAUM ET AL., MOLECULAR THERAPY: THE JOURNAL OF THE AMERICAN SOCIETY OF GENE THERAPY, vol. 13, 2006, pages 1050 - 1063
BEAVIS ET AL., PROC NATL ACAD SCI U S A, vol. 110, 2013, pages 14711 - 14716
BENDLE ET AL., J. IMMUNOL., vol. 191, no. 6, 2013, pages 3232 - 3239
BOLLARD ET AL., MOLECULAR THERAPY., vol. 20, 2012, pages S22
BORIS-LAWRIE; TEMIN, CUR. OPIN. GENET. DEVELOP., vol. 3, 1993, pages 102 - 109
BRANDON R. SHANK ET AL: "Chimeric Antigen Receptor T Cells in Hematologic Malignancies", PHARMACOTHERAPY : THE JOURNAL OF HUMAN PHARMACOLOGY AND DRUG THERAPY, vol. 37, no. 3, 1 March 2017 (2017-03-01), US, pages 334 - 345, XP055471941, ISSN: 0277-0008, DOI: 10.1002/phar.1900 *
BRASH ET AL., MOL. CELL BIOL., vol. 7, 1987, pages 2031 - 2034
BRENTJENS ET AL., BLOOD, vol. 118, no. 18, 2011, pages 4817 - 4828
BRENTJENS ET AL., SCI TRANSL MED, vol. 5, no. 177, 2013
BRENTJENS ET AL., SCI TRANSL MED., vol. 5, no. 177, 2013
BRENTJENS ET AL., SCI. TRANSL. MED., vol. 5, 2013, pages 177ra38
BRITISH NATIONAL FORMULARY (BNF, vol. 37, March 1999 (1999-03-01)
BURNS ET AL., PROC. NATL. ACAD. SCI. USA, vol. 90, 1993, pages 8033 - 8037
CARCELLER ET AL., PEDIATR BLOOD CANCER, vol. 63, no. 8, 2016, pages 1400 - 1406
CARLENS ET AL., EXP HEMATOL., vol. 28, no. 10, 2000, pages 1137 - 46
CARRILLO ET AL., SIAM J APPLIED MATH, vol. 48, 1988, pages 1073
CAVALIERI ET AL., BLOOD, vol. 102, no. 2, 2003, pages 497 - 505
CHEADLE ET AL., METHODS MOL BIOL., vol. 907, 2012, pages 645 - 66
CHERVIN ET AL., J IMMUNOL METHODS, vol. 339, 2008, pages 175 - 84
CHESON ET AL., JCO, vol. 32, no. 27, 2014, pages 3059 - 3067
CHESON, B.D., CHIN CLIN ONCOL, vol. 4, no. 1, 2015, pages 5
CHICAYBAM ET AL., PLOS ONE, vol. 8, no. 3, 2013, pages e60298
CHO ET AL., LAB CHIP, vol. 10, 2010, pages 1567 - 1573
CHOTHIA ET AL., EMBO J., vol. 7, 1988, pages 3745
CLARKSON ET AL., NATURE, vol. 352, 1991, pages 624 - 628
COHEN CJ. ET AL., I MOL. RECOGN., vol. 16, 2003, pages 324 - 332
COHEN ET AL., J IMMUNOL., vol. 175, 2005, pages 5799 - 5808
COOPER ET AL., BLOOD, vol. 101, 2003, pages 1637 - 1644
COUSTAN-SMITH ET AL., LANCET, vol. 351, 1998, pages 550 - 554
DAVILA ET AL., ONCOIMMUNOLOGY, vol. 1, no. 9, 2012, pages 1577 - 1583
DAVILA ET AL., PLOS ONE, vol. 8, no. 4, 2013, pages e61338
DAVILA ET AL., SCI TRANSL MED, vol. 6, 2014, pages 224ra25
DAVILLA ET AL., SCIENCE TRANSLATIONAL MEDICINE, vol. 6, no. 224, 2014, pages 224ra25
DE FELIPE, GENETIC VACCINES AND THER., vol. 2, 2004, pages 13
DEFELIPE ET AL., TRAFFIC, vol. 5, 2004, pages 616 - 626
DOBBER ET AL., CELL IMMUNOL., vol. 160, no. 2, February 1995 (1995-02-01), pages 185 - 92
EISENHAUER ET AL., EUR J CANCER., vol. 45, no. 2, 2009, pages 228 - 247
EISENHAUER ET AL., EUROPEAN JOURNAL OF CANCER, vol. 45, 2009, pages 228 - 247
FEDOROV ET AL., SCI. TRANSL. MEDICINE, vol. 5, no. 215, 2013
FLEISCHMANN ET AL., ANNALS OF THE RHEUMATIC DISEASES, vol. 65, no. 8, 2006, pages 1006 - 12
FOON; TODD, BLOOD, vol. 68, 1986, pages 1 - 31
FOON; TODD, BLOOD, vol. 68, no. 1, 1986, pages 1 - 31
FOSTER ET AL., J IMMUNOTHER., vol. 31, 2008, pages 500 - 505
FRECHA ET AL., MOLECULAR THERAPY: THE JOURNAL OF THE AMERICAN SOCIETY OF GENE THERAPY, vol. 18, 2010, pages 1748 - 1757
GODIN ET AL., J BIOPHOTON., vol. 1, no. 5, 2008, pages 355 - 376
GONG ET AL., J EXP MED., vol. 186, no. 1, 7 July 1997 (1997-07-07), pages 131 - 137
GRUPP ET AL., N. ENGL. J. MED., vol. 368, 2013, pages 1509 - 1518
GUIDO CAVALETTI; PAOLA MARMIROLI, NATURE REVIEWS NEUROLOGY, vol. 6, December 2010 (2010-12-01), pages 657 - 666
HACKETT ET AL., MOLECULAR THERAPY: THE JOURNAL OF THE AMERICAN SOCIETY OF GENE THERAPY, vol. 18, 2010, pages 674 - 683
HAILEMICHAEL; OVERWIJK, INT J BIOCHEM CELL BIOL., vol. 53, 2014, pages 46 - 50
HALLEK ET AL., BLOOD, vol. 111, no. 12, 15 June 2008 (2008-06-15), pages 5446 - 5456
HARMURN, C. H. ET AL., NATURE, vol. 343, 1990, pages 336 - 340
HEINJE, G.: "Sequence Analysis in Molecular Biology", 1987, ACADEMIC PRESS
HERMAN ET AL., J. IMMUNOLOGICAL METHODS, vol. 285, no. 1, 2004, pages 25 - 40
HOLLER ET AL., NAT IMMUNOL, vol. 4, 2003, pages 55 - 62
HOLLER ET AL., PROC NATL ACAD SCI USA, vol. 97, 2000, pages 5387 - 92
HONEGGER A; PLIICKTHUN A: "Yet another numbering scheme for immunoglobulin variable domains: an automatic modeling and analysis tool", J MOL BIOL, vol. 309, no. 3, 8 June 2001 (2001-06-08), pages 657 - 70, XP004626893, DOI: doi:10.1006/jmbi.2001.4662
HOO, W. F. ET AL., PNAS (USA, vol. 89, 1992, pages 4759
HUANG ET AL., METHODS MOL BIOL, vol. 506, 2009, pages 115 - 126
HUDECEK ET AL., CLIN. CANCER RES., vol. 19, 2013, pages 3153
HUNTER ET AL., J IMMUNOL., vol. 174, no. 11, 1 June 2005 (2005-06-01), pages 7368 - 75
JACOBSON; GAO, NAT REV DRUG DISCOV., vol. 5, no. 3, 2006, pages 247 - 264
JANEWAY ET AL.: "Immunobiology: The Immune System in Health and Disease", vol. 33, 1997, CURRENT BIOLOGY PUBLICATIONS, pages: 4
JENA ET AL., PLOS ONE, vol. 8, no. 3, 2013, pages e57838
JENNIFER N. BRUDNO ET AL: "Toxicities of chimeric antigen receptor T cells: recognition and management", BLOOD, vol. 127, no. 26, 20 May 2016 (2016-05-20), US, pages 3321 - 3330, XP055547499, ISSN: 0006-4971, DOI: 10.1182/blood-2016-04-703751 *
JENSEN ET AL., BIOL BLOOD MARROW TRANSPLANT, vol. 16, no. 9, September 2010 (2010-09-01), pages 1245 - 1256
JIN ET AL., CANCER RES., vol. 70, no. 6, 2010, pages 2245 - 2255
JOHNSON ET AL., RADIOLOGY, vol. 2, 2015, pages 323 - 338
JOHNSTON, NATURE, vol. 346, 1990, pages 776 - 777
JORES ET AL., PROC. NAT'L ACAD. SCI. U.S.A., vol. 87, 1990, pages 9138
KABAT ET AL.: "Sequences of Proteins of Immunological Interest", 1991, PUBLIC HEALTH SERVICE, NATIONAL INSTITUTES OF HEALTH
KABAT ET AL.: "Sequences of Proteins of Immunological Interest", 1991, US DEPT. HEALTH AND HUMAN SERVICES
KINDT ET AL.: "Kuby Immunology", 2007, W.H. FREEMAN AND CO., pages: 91
KLEBANOFF ET AL., J IMMUNOTHER., vol. 35, no. 9, 2012, pages 651 - 660
KOCHENDERFER ET AL., BLOOD, vol. 119, 2012, pages 2709 - 2720
KOCHENDERFER ET AL., J. IMMUNOTHERAPY, vol. 32, no. 7, 2009, pages 689 - 702
KOCHENDERFER ET AL., NATURE REVIEWS CLINICAL ONCOLOGY, vol. 10, 2013, pages 267 - 276
KOSTE ET AL., GENE THERAPY, 2014
KOTB, CLINICAL MICROBIOLOGY REVIEWS, vol. 8, 1995, pages 411 - 426
KURUCZ, I. ET AL., PNAS (USA), vol. 90, 1993, pages 3830
LAMERS, BLOOD, vol. 117, 2011, pages 72 - 82
LEE ET AL., BLOOD, vol. 124, no. 2, 2014, pages 188 - 95
LEE ET AL., THE LANCET, vol. 385, no. 9967, 2015, pages 517 - 528
LEFRANC ET AL., DEV. COMP. IMMUNOL., vol. 27, 2003, pages 55
LEFRANC MP ET AL.: "IMGT unique numbering for immunoglobulin and T cell receptor variable domains and Ig superfamily V-like domains", DEV COMP IMMUNOL, vol. 27, no. 1, January 2003 (2003-01-01), pages 55 - 77, XP055144492, DOI: doi:10.1016/S0145-305X(02)00039-3
LEONE ET AL., COMPUTATIONAL AND STRUCTURAL BIOTECHNOLOGY JOURNAL, vol. 13, 2015, pages 265 - 272
LEUNG ET AL., MABS, vol. 7, no. l, 2015, pages 66 - 76
LI ET AL., NAT BIOTECHNOL, vol. 23, 2005, pages 349 - 54
LI, NAT BIOTECHNOL., vol. 23, 2005, pages 349 - 354
LING, N. R. ET AL., LEUCOCYTE TYPING, vol. III, 1987, pages 302
LIU ET AL., NATURE BIOTECH., vol. 34, no. 4, April 2016 (2016-04-01), pages 430 - 434
LONG ET AL., NATURE MEDICINE, vol. 21, no. 6, 2015, pages 581 - 590
LUPTON S. D. ET AL., MOL. AND CELL BIOL., vol. 11, 1991, pages 6
MACCALLUM ET AL., J. MOL. BIOL., vol. 262, 1996, pages 732 - 745
MANURI ET AL., HUM GENE THER, vol. 21, no. 4, 2010, pages 427 - 437
MARTIN ET AL.: "Modeling antibody hypervariable loops: a combined algorithm", PNAS, vol. 86, no. 23, 1989, pages 9268 - 9272, XP000165667, DOI: doi:10.1073/pnas.86.23.9268
MESA ET AL., NATURE REVIEWS DRUG DISCOVERY, vol. 11, no. 2, 2012, pages 103 - 104
MILLER, A. D., HUMAN GENE THERAPY, vol. 1, 1990, pages 5 - 14
MILLER; ROSMAN, BIOTECHNIQUES, vol. 7, 1989, pages 980 - 990
MONSKY ET AL., ANTICANCER RES., vol. 32, no. 11, 2012, pages 4951 - 4961
OHTA ET AL., PROC NATL ACAD SCI U S A, vol. 103, 2006, pages 13132 - 13137
OZMEN ET AL., J IMMUNOL., vol. 150, no. 7, 1 April 1993 (1993-04-01), pages 2698 - 705
PARDOLL, NAT REV CANCER, vol. 12, no. 4, 22 March 2012 (2012-03-22), pages 252 - 264
PARK ET AL., MOLECULAR THERAPY, vol. 15, no. 4, 2007, pages 825 - 833
PARK ET AL., TRENDS BIOTECHNOL., vol. 29, no. 11, November 2011 (2011-11-01), pages 550 - 557
PARKHURST ET AL., CANCER RES., vol. 15, 2009, pages 169 - 180
PINNA, A., EXPERT OPIN INVESTIG DRUGS, vol. 18, 2009, pages 1619 - 1631
PORTOLANO ET AL., J. IMMUNOL., vol. 150, 1993, pages 880 - 887
RIDDELL ET AL., HUMAN GENE THERAPY, vol. 3, 1992, pages 319 - 338
ROSENBERG, NAT REV CLIN ONCOL., vol. 8, no. 10, 2011, pages 577 - 85
SADELAIN ET AL., CANCER DISCOV., vol. 3, no. 4, 2013, pages 388 - 398
SAVOLDO ET AL., JCI, vol. 121, no. 5, 2011, pages 1822 - 1826
SCARPA ET AL., VIROLOGY, vol. 180, 1991, pages 849 - 852
SCHLUETER, C. J. ET AL., J. MOL. BIOL., vol. 256, 1996, pages 859
SCHULER ET AL., IMMUNOINFORMATICS METHODS IN MOLECULAR BIOLOGY, vol. 409, no. 1, 2007, pages 75 - 93
SCHULER ET AL.: "SYFPEITHI, Database for Searching and T-Cell Epitope Prediction", IMMUNOINFORMATICS METHODS IN MOLECULAR BIOLOGY, vol. 409, no. 1, 2007, pages 75 - 93
SHAHRARA ET AL., J IMMUNOL, vol. 180, 2008, pages 3447 - 3456
SHARMA ET AL., MOLEC THER NUCL ACIDS, vol. 2, 2013, pages e74
SINGH; RAGHAVA, BIOINFORMATICS, vol. 17, no. 12, 2001, pages 1236 - 1237
SINGH; RAGHAVA: "ProPred: prediction of HLA-DR binding sites", BIOINFORMATICS, vol. 17, no. 12, 2001, pages 1236 - 1237, XP002371461, DOI: doi:10.1093/bioinformatics/17.12.1236
SITKOVSKY ET AL., CANCER IMMUNOL RES, vol. 2, no. 7, 2014, pages 598 - 605
TERAKURA ET AL., BLOOD, vol. 1, 2012, pages 72 - 82
THEMELI ET AL., NAT BIOTECHNOL., vol. 31, no. 10, 2013, pages 928 - 933
TSUKAHARA ET AL., BIOCHEM BIOPHYS RES COMMUN, vol. 438, no. 1, 2013, pages 84 - 9
TURTLE ET AL., CURR. OPIN. IMMUNOL., vol. 24, no. 5, 2012, pages 633 - 39
VAN TEDELOO ET AL., GENE THERAPY, vol. 7, no. 16, 2000, pages 1431 - 1437
VARELA-ROHENA ET AL., NAT MED., vol. 14, 2008, pages 1390 - 1395
VERHOEYEN ET AL., METHODS MOL BIOL., vol. 506, 2009, pages 97 - 114
WADWA ET AL., J. DRUG TARGETING, vol. 3, 1995, pages 1 1 1
WANG ET AL., IIMMUNOTHER., vol. 35, no. 9, 2012, pages 689 - 701
WANG ET AL., J IMMUNOTHER., vol. 35, no. 9, 2012, pages 689 - 701
WANG ET AL., J. IMMUNOTHER., vol. 35, no. 9, 2012, pages 689 - 701
WIILFING, C.; PLIICKTHUN, A., J. MOL. BIOL., vol. 242, 1994, pages 655
WU ET AL., CANCER, vol. 18, no. 2, 2012, pages 160 - 75
XU ET AL., CANCER LETTERS, vol. 343, 2014, pages 172 - 78
ZHAO ET AL., PLOS ONE, vol. 9, no. 5, 2014, pages e96697

Cited By (35)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US12509728B2 (en) 2005-07-29 2025-12-30 Natera, Inc. System and method for cleaning noisy genetic data and determining chromosome copy number
US12571043B2 (en) 2005-11-26 2026-03-10 Natera, Inc. System and method for cleaning noisy genetic data from target individuals using genetic data from genetically related individuals
US12020778B2 (en) 2010-05-18 2024-06-25 Natera, Inc. Methods for non-invasive prenatal ploidy calling
US12152275B2 (en) 2010-05-18 2024-11-26 Natera, Inc. Methods for non-invasive prenatal ploidy calling
US12110552B2 (en) 2010-05-18 2024-10-08 Natera, Inc. Methods for simultaneous amplification of target loci
US12270073B2 (en) 2010-05-18 2025-04-08 Natera, Inc. Methods for preparing a biological sample obtained from an individual for use in a genetic testing assay
US12410476B2 (en) 2010-05-18 2025-09-09 Natera, Inc. Methods for simultaneous amplification of target loci
US11939634B2 (en) 2010-05-18 2024-03-26 Natera, Inc. Methods for simultaneous amplification of target loci
US12221653B2 (en) 2010-05-18 2025-02-11 Natera, Inc. Methods for simultaneous amplification of target loci
US12100478B2 (en) 2012-08-17 2024-09-24 Natera, Inc. Method for non-invasive prenatal testing using parental mosaicism data
US12305229B2 (en) 2014-04-21 2025-05-20 Natera, Inc. Methods for simultaneous amplification of target loci
US12260934B2 (en) 2014-06-05 2025-03-25 Natera, Inc. Systems and methods for detection of aneuploidy
US11946101B2 (en) 2015-05-11 2024-04-02 Natera, Inc. Methods and compositions for determining ploidy
US12146195B2 (en) 2016-04-15 2024-11-19 Natera, Inc. Methods for lung cancer detection
US12460264B2 (en) 2016-11-02 2025-11-04 Natera, Inc. Method of detecting tumour recurrence
US11590167B2 (en) 2016-12-03 2023-02-28 Juno Therapeutic, Inc. Methods and compositions for use of therapeutic T cells in combination with kinase inhibitors
EP4353818A3 (en) * 2017-02-27 2024-06-19 Juno Therapeutics, Inc. Compositions, articles of manufacture and methods related to dosing in cell therapy
US12163952B2 (en) 2017-02-27 2024-12-10 Juno Therapeutics, Inc. Determining toxicity risk in CAR T-cell therapy
US11944647B2 (en) 2017-06-02 2024-04-02 Juno Therapeutics, Inc. Articles of manufacture and methods for treatment using adoptive cell therapy
US11413310B2 (en) 2017-06-02 2022-08-16 Juno Therapeutics, Inc. Articles of manufacture and methods for treatment using adoptive cell therapy
US12583904B2 (en) 2017-06-02 2026-03-24 Juno Therapeutics, Inc. Articles of manufacture and methods for treatment using adoptive cell therapy
US11773434B2 (en) 2017-06-20 2023-10-03 The Medical College Of Wisconsin, Inc. Assessing transplant complication risk with total cell-free DNA
US12258580B2 (en) 2017-11-01 2025-03-25 Juno Therapeutics, Inc. Process for generating therapeutic compositions of engineered cells
US12168027B2 (en) 2017-11-01 2024-12-17 Juno Therapeutics, Inc. Methods associated with tumor burden for assessing response to a cell therapy
US11564946B2 (en) 2017-11-01 2023-01-31 Juno Therapeutics, Inc. Methods associated with tumor burden for assessing response to a cell therapy
US12084720B2 (en) 2017-12-14 2024-09-10 Natera, Inc. Assessing graft suitability for transplantation
US12024738B2 (en) 2018-04-14 2024-07-02 Natera, Inc. Methods for cancer detection and monitoring
US12385096B2 (en) 2018-04-14 2025-08-12 Natera, Inc. Methods for cancer detection and monitoring
US12234509B2 (en) 2018-07-03 2025-02-25 Natera, Inc. Methods for detection of donor-derived cell-free DNA
WO2020097403A1 (en) * 2018-11-08 2020-05-14 Juno Therapeutics, Inc. Methods and combinations for treatment and t cell modulation
US12263190B2 (en) 2018-11-08 2025-04-01 Juno Therapeutics, Inc. Methods and combinations for treatment and T cell modulation
WO2020113194A3 (en) * 2018-11-30 2020-07-23 Juno Therapeutics, Inc. Methods for treatment using adoptive cell therapy
US11931674B2 (en) 2019-04-04 2024-03-19 Natera, Inc. Materials and methods for processing blood samples
WO2021236962A1 (en) * 2020-05-20 2021-11-25 The Medical College Of Wisconsin, Inc. Compositions and methods for inhibiting cytokine-release syndrome
WO2022238901A1 (en) * 2021-05-11 2022-11-17 Janssen Biotech, Inc. Methods of minimizing neurotoxicity associated with chimeric antigen receptor (car) t cell therapy

Also Published As

Publication number Publication date
KR20200116081A (ko) 2020-10-08
US20210198372A1 (en) 2021-07-01
EP3716980A1 (en) 2020-10-07
MA51210A (fr) 2020-10-07
JP2021508317A (ja) 2021-03-04
CN111989106A (zh) 2020-11-24

Similar Documents

Publication Publication Date Title
US20210198372A1 (en) Methods for dosing and for modulation of genetically engineered cells
US12168027B2 (en) Methods associated with tumor burden for assessing response to a cell therapy
EP3548084B1 (en) Methods for determining car-t cells dosing
US11413310B2 (en) Articles of manufacture and methods for treatment using adoptive cell therapy
CA3120869A1 (en) Methods for treatment using adoptive cell therapy
EP3585402A2 (en) Compositions, articles of manufacture and methods related to dosing in cell therapy
WO2020113188A2 (en) Methods for dosing and treatment of b cell malignancies in adoptive cell therapy
US20240302349A1 (en) Methods of assessing or monitoring a response to a cell therapy
JP2024016134A (ja) 細胞療法に関連する毒性に関する製造物品および方法
US20230053787A1 (en) Methods related to toxicity and response associated with cell therapy for treating b cell malignancies

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 18821900

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2020529479

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2018821900

Country of ref document: EP

Effective date: 20200701