WO2019107487A1 - Microrna and pharmaceutical composition having a derivative thereof as the active component - Google Patents

Abstract

A pharmaceutical composition used in treatment of tumors is provided that is based on a new concept that starts from the relation between cancer and BRD4. This pharmaceutical composition contains a polynucleotide having a base sequence represented by sequence number 1, sequence number 2, sequence number 4 or sequence number 5, and is used in the treatment of tumors.

Description

Pharmaceutical composition containing microRNA and its derivative as an active ingredient

The present invention relates to a pharmaceutical composition comprising microRNA and a derivative thereof as an active ingredient.

Cancer is the leading cause of death in Japan, and according to the National Cancer Center statistics in 2012, the probability of getting cancer in life is as high as 63% for Japanese men and 47% for women. In addition, according to statistics of the Ministry of Health, Labor and Welfare in 2015, the ratio of cancer as a cause of death is about 32% of Japanese men, 24% of women, and about one third of the whole population die of cancer. Deaths from cancer continue to increase, and by 2030 it is predicted that 11.4 million people will die annually from the world.

The Human Genome Project ended in 2003 will accelerate the movement to understand cancer at the gene level and protein molecule level and apply it to cancer diagnosis and treatment, resulting in diagnosis and treatment of cancer. Progress is remarkable. In particular, in terms of treatment, as a mechanism different from conventional anticancer agents, progress and development of so-called molecular target therapeutic agents targeting genes and proteins activated in cancer cells are also advanced. Such molecular target therapeutic agents are clinically applied by identifying molecules that are activated during cancer diagnosis.

Under the above-mentioned circumstances surrounding cancer, the present inventors focused on the relationship between cancer and BRD4, and based on a new concept based on this, a pharmaceutical composition used for treating a tumor is The issue was to provide.

The specific means for solving the said subject is as follows, and this invention includes the following aspects. The first embodiment is a pharmaceutical composition for treating a tumor, which comprises a polynucleotide having the base sequence represented by SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 4 or SEQ ID NO: 5. The second embodiment comprises at least one selected from the group consisting of BRD4, CDK2, BRD3, EGFR, and CDK6, which comprises at least one selected from the group consisting of miR-3140, miR-766 and derivatives thereof It is a pharmaceutical composition for treating a developing tumor. A third aspect is a method of treating a tumor comprising administering the pharmaceutical composition to a subject.

According to the present invention, it is possible to provide a pharmaceutical composition used for treatment of a tumor based on a new concept based on the relationship between cancer and BRD4.

It is drawing which shows the procedure of the screening of the microRNA which suppresses cell growth. FIG. 1-1 is a drawing showing the results of the screening in FIG. 1-1 in a pancreatic cancer cell line Panc1. It is the figure which showed the result of the screening of FIG. 1-2 with the Venn diagram. It is the microscope picture which showed the state of the said cancer cell line in, when introduce | transducing 1st double stranded miRNA which is one of the active ingredients with respect to two types of pancreatic cancer cell lines. It is the figure which showed the cell growth curve in the case of introduce | transducing the 1st double stranded miRNA which is one of the active ingredients with respect to various cancer cell lines. FIGS. 1-5 are diagrams showing cell growth curves when the first double-stranded miRNA, which is one of active ingredients, is introduced into various cancer cell lines. The results of expression array analysis performed after introducing the first double-stranded miRNA, which is one of the active ingredients, into a cancer cell line, and the target gene candidate that the relevant active ingredient is expected to act on the 3 'UTR region It is the drawing which each showed the number by the Venn diagram. It is a figure which shows the result of the western blot which examined about expression suppression of CDK2 gene and CDK6 gene in two types of pancreatic cancer cell lines which introduce | transduced the 1st double stranded miRNA which is one of the active ingredients. It is a figure which shows the result of the luciferase reporter assay of 1st double stranded miRNA which is one of the active ingredients using the construct which integrated CDK2 gene and 3'UTR area | region of EGFR gene in the luciferase vector. It is a figure which shows the influence on cell proliferation at the time of knocking down a CDK2 gene using siRNA with respect to two types of pancreatic cancer cell lines. It is drawing which shows the influence with respect to the cell proliferation at the time of knocking down EGFR gene using siRNA with respect to a pancreatic cancer cell line and a lung cancer cell line which promotes growth of cancer by EGFR as a driver. It is drawing which shows the influence with respect to cell growth at the time of introduce | transducing the 1st double stranded miRNA which is one of the active ingredients with respect to the lung cancer cell strain which EGFR promotes by driver and promotes cancer growth. The number of target gene candidates for which the active ingredient acts on the coding region predicted from the result of expression array analysis performed after introducing the first double-stranded miRNA, which is one of the active ingredients, into a cancer cell line, Each is a drawing shown by a Venn diagram. Western blot results showing the influence on the expression of BRD2 gene, BRD3 gene, BRD4 gene, etc. when the first double-stranded miRNA as one of active ingredients is introduced into two types of pancreatic cancer cell lines FIG. It is a figure which shows the influence on cell proliferation at the time of knocking down BRD2 gene, BRD3 gene, and BRD4 gene using siRNA with respect to a pancreatic cancer cell strain. It is a figure which shows the influence with respect to cell proliferation at the time of introduce | transducing BRD4 gene expression vector to a pancreatic cancer cell, and making BRD4 overexpress. Of the coding region of the BRD4 gene, the base sequence of the region homologous to the guide sequence of the first double-stranded miRNA which is one of the active components, the sequence of the generated mutation, and the luciferase reporter assay by introducing the active component It is a drawing showing the result of Of the coding region of the BRD3 gene, the base sequence of the region homologous to the guide sequence of the first double-stranded miRNA which is one of the active components, the sequence of the generated mutation, and luciferase reporter assay by introducing the active component It is a drawing showing the result of Indicates the base sequence of the region homologous to the guide sequence of the first double-stranded miRNA, which is one of the active components, in the 3'UTR region of the BRD3 gene, and the results of the luciferase reporter assay by the introduction of the active component. It is a drawing. It is a figure which shows the result of the western blot which shows the influence of 1st double stranded miRNA introduction which is one of the active ingredients to the expression of BRD4 in a pancreatic cancer cell. It is a figure which shows the result of the western blot which shows the influence of 1st double stranded miRNA introduction which is one of the active ingredients to the expression of BRD3 in a pancreatic cancer cell. The relationship between the mRNA of the BRD4-NUT fusion gene and the guide sequence of the first double-stranded miRNA, which is one of the active components, is shown. It is a figure which showed the result of having introduce | transduced the 1st double stranded miRNA which is one of the active ingredients into the cell line of NUT midline cancer by cell growth and a western blot. FIG. 6 shows the effect of a BET inhibitor on cell lines of NUT midline carcinoma by cell growth and Western blot. It is the figure which showed the cell line of NUT midline cancer, the dose-response curve and IC50 of the BET inhibitor resistant strain. It is a figure which showed the result of having introduce | transduced the 1st double stranded miRNA which is one of the active ingredients into the NUT midline cancer BET inhibitor resistant cell line by cell growth and a western blot. It is a figure which showed the administration schedule of the 1st double stranded miRNA which is one of the active ingredients in the in vivo test using a mouse. It is a photographic drawing which showed the appearance of the subcutaneous tumor of the mouse 23 days after the subcutaneous injection of a pancreatic cancer cell line. FIG. 5-2 is a photographic drawing of a tumor removed from the mouse of FIG. 5-2. It is a figure which shows the result of having investigated the effect of administration of the 1st double stranded miRNA which is one of the active ingredients in the said in-vivo test by the volume of the removed tumor. It is a figure which shows the result of having performed expression analysis of hsa-miR-3140 in the tumor excised in the said in vivo test. In the photograph which showed the decrease of expression of BRD4 gene, BRD3 gene, EGFR gene and CDK2 gene by the increase of expression of hsa-miR-3140 in the tumor removed in the above in vivo test by the immunostaining of the removed tumor. is there. It is a figure which shows the result of having examined the tumor suppression effect by 4 types of 1st double stranded miRNA (a base sequence modified type is included) which is an active ingredient. It is drawing which showed the summary of the mechanism of tumor growth suppression by the 1st double stranded miRNA which is an active ingredient. It is a figure which shows the result of having investigated the tumor suppression effect of the 2nd double stranded miRNA (hsa-miR-766-5p) which is an active ingredient by Western blot. FIG. 10 is a drawing showing the homologous regions of the BRD4 gene and the second double-stranded miRNA (hsa-miR-766-5p) as an active ingredient in the coding region and the 3 ′ UTR region. The figure which shows the result of the luciferase reporter assay performed about the homology domain with the 2nd double stranded miRNA (hsa-miR-766-5p) which is an active ingredient in the 1st and 2nd coding field of BRD4 gene is there. It is a figure showing the result of the luciferase reporter assay performed about the homology domain with the 2nd double stranded miRNA (hsa-miR-766-5p) which is an active ingredient in the 3rd coding field of BRD4 gene. It is a figure showing the result of the luciferase reporter assay performed about the homologous region with the 2nd double stranded miRNA (hsa-miR-766-5p) which is an active ingredient in the 4th coding region of BRD4 gene. It is a figure showing the result of the luciferase reporter assay performed about the homologous region with the 2nd double stranded miRNA (hsa-miR-766-5p) which is an active ingredient in the 5th coding region of BRD4 gene. It is a figure showing the result of the luciferase reporter assay performed about the homologous region with the 2nd double stranded miRNA (hsa-miR-766-5p) which is an active ingredient in the 3'UTR region of BRD4 gene. It is a figure which shows the influence on cell proliferation at the time of introduce | transducing the 1st double stranded miRNA which is one of the active ingredients with respect to the neuroblastoma cell line with amplification of MYCN gene. It is a figure which shows the influence on cell growth at the time of introduce | transducing the 1st double stranded miRNA which is one of the active ingredients with respect to the neuroblastoma cell line without amplification of a MYCN gene. It is a figure which shows the result of the western blot which shows the influence of the 1st double stranded miRNA introduction which is one of the active ingredients to the expression of BRD4 and MYCN in a neuroblastoma cell. It is a figure which shows the influence of the 1st double stranded miRNA introduction | transduction which is one of the active ingredients to the expression of MYCN in a neuroblastoma cell. It is a figure which shows the influence on cell proliferation at the time of introduce | transducing the 1st double stranded miRNA which is one of the active ingredients with respect to a glioblastoma cell line.

In the present specification, when there are a plurality of substances corresponding to each component in the composition, the content of each component in the composition is the total amount of the plurality of substances present in the composition unless otherwise specified. means. In addition to the polynucleotide (oligonucleotide) consisting of ribonucleotide, the microRNA (miRNA) includes a polynucleotide (oligonucleotide) consisting of ribonucleotide and modified nucleotide. Furthermore, the microRNA may be single stranded or double stranded. Furthermore, variants of microRNAs include derivatives with altered base sequences, derivatives containing modified nucleotides, derivatives containing modified nucleotides, and derivatives with altered base sequences, and the like. Hereinafter, embodiments of the present invention will be described in detail. However, the embodiments shown below exemplify pharmaceutical compositions and the like for embodying the technical concept of the present invention, and the present invention is not limited to the pharmaceutical compositions and the like shown below.

BRD4 is a protein that structurally has two bromo domains that bind to acetylated modified lysine, and a region that binds to p-TEFb (positive transcription elongation factor b) at the C-terminal side (for example, Jang, M. K., ET AL., MOL. CELL, vol 19, 2005, pages 523-534. Acetylation modification of histones positively correlates with transcriptional activity, and p-TEFb activates transcription by inactivating proteins that inhibit RNA polymerase II that performs transcription. By binding to lysine of acetylated modified histone, BRD4 functions to recruit p-TEFb to promote transcription. Abnormal activation of BRD4 expression contributes to the growth of cancer cells and suppression of BRD4 expression is effective in cancer treatment in several cancer types such as hematological malignancy, pancreatic cancer and breast cancer Possibilities have been reported (eg, Filippakopoulos, P., ET AL., NATURE, vol 468, 2010, pages 1067-1073; Delmore, J E., ET AL., CELL, 2011, vol 146, 2011 , Pages 904-917; Dawson, M. A., ET AL., NATURE, 2011, vol 478, pages 529-533; Chapay, B., ET AL., CANCER CELL, 2013, vol 24, pages 777-790 Shu S, ET AL., NATURE, 2016, vol 529, pages 413-417; Sahai V ET AL., MOL CANCER THER, 2014, vol 13, pages 1907-1917. Therefore, BET inhibitors that inhibit BRD4 are currently being developed. In many BET inhibitors, the BRD4 bromo domain has an inhibitory effect on the region bound to acetylated lysine (see, for example, Wang CY ET AL., TRENDS BIOCHEM SCI, 2015, vol 40, pages 468-79.) .

The present inventors focused on the role of microRNA (miRNA) for this BRD4. miRNAs regulate gene expression by interfering with their translation or stabilization through binding to the target transcript (mRNA) coding (CDS) region or 3'-untranslated region (3'UTR), endogenous (See, eg, Bartel DP, CELL, 2004, vol 116, pages 281-297; Ambros V, NATURE 2004, vol 431, pages 350-355.). Several miRNAs are able to downregulate oncogenes, and inactivation of tumor suppressor miRNAs leads to activation of the oncogenic pathway (eg, Zhang BH ET AL., DEV BIOL, 2007, vol 302, pages 1-12. Importantly, one mRNA can be targeted by multiple miRNAs, while one miRNA can be targeted to multiple mRNAs (eg, Lewis BP ET AL., CELL, 2005, vol 120, pages 15-20. That is, administration of miRNA capable of targeting multiple genes contributing to multiple oncogenic pathways is considered to be effective in cancer treatment.

As a result, hsa-miR-3140 and hsa-miR-766-5p have a tumor suppressor effect, and in particular, cancers in which expression of BRD4 is observed and expression of gene products of BRD4-NUT fusion gene are observed In addition to finding an excellent suppressive effect on cancer, hsa-miR-3140 has recognized expression of at least one selected from the group consisting of CDK2, CDK6, BRD3 and EGFR related to BRD4 gene It has been found that an excellent suppressive effect is also observed against

The pharmaceutical composition according to the first aspect of the present invention comprises at least one polynucleotide having the base sequence represented by SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 4 or SEQ ID NO: 5 as an active ingredient It is used for treatment. In addition, the pharmaceutical composition of the second aspect comprises at least one selected from the group consisting of miR-3140, miR-766 and derivatives thereof, and is used for the treatment of a tumor. Here, the treatment of the tumor may be any treatment to be given to the tumor, for example, treatment of the tumor, improvement, suppression of progression (prevention of deterioration), prevention, alleviation of symptoms caused by the tumor, etc. .

The pharmaceutical composition is used for treating a tumor, and for example, a pharmaceutical composition having a therapeutic effect on a wide variety of cancer types, drug-resistant cancer and refractory cancer is provided. In particular, the pharmaceutical composition is effective for treatment of cancers in which expression of BRD4 is observed, and in addition, NUT median cancer which is a refractory cancer in which expression of the gene product of the BRD4-NUT fusion gene is observed. Furthermore, a pharmaceutical composition comprising “a double-stranded polynucleotide (may be RNA) based on hsa-miR-3140 (mature miRNA)” which is one of the embodiments as an active ingredient is Thus, the effect of the treatment is observed on a tumor expressing at least one selected from the group consisting of CDK2, CDK6, BRD3 and EGFR.

The polynucleotide contained in the pharmaceutical composition may further have one or more optional nucleotides at the 5 'end or 3' end. When having an arbitrary nucleotide at the 5 'end or 3' end, the number of residues is, for example, 10 or less, preferably 5 or less, more preferably 2 or less. In addition, the polynucleotide may have a base sequence represented by SEQ ID NO: 1, and may have two arbitrary nucleotides at the 3 'end. The chain length of the polynucleotide is, for example, 20 or more and 35 or less, preferably 20 or more and 30 or less.

The pharmaceutical composition may contain the polynucleotide as single-stranded or double-stranded. When the polynucleotide is contained as a double strand, it may be at least partially double stranded, and may have a single stranded portion at least one end of the double stranded, a double stranded portion At least one pair of mismatched base pairs. When having a single-stranded portion at the end of double-stranded, it is preferable to have a single-stranded portion at least 3 '. In addition, the chain length of the single-stranded portion is, for example, 2 or more and 20 or less, preferably 2 or more and 12 or less, or 2 or more and 5 or less. On the other hand, when having a mismatched base pair in the double-stranded portion, the mismatched base pair may be arranged consecutively or may be arranged discontinuously, and the total number of mismatched base pairs is, for example, 10 base pairs or less Preferably, it is 6 bases or less or 4 bases or less, and for example, 1 base or more, 2 base pairs or more, or 3 base pairs or more.

The polynucleotide included in the pharmaceutical composition may be at least one selected from the group consisting of miR-3140, miR-766 and derivatives thereof. miR-3140 may be hsa-miR-3140 and miR-766 may be hsa-miR-766-5p. The derivatives also include those in which at least a part of the nucleotides of these natural microRNAs are modified, and those in which one or two bases are substituted, deleted or added in the base sequence of the natural microRNAs. .

The double-stranded polynucleotide is a double-stranded polynucleotide of the following (1) (hereinafter, also referred to as a first double-stranded polynucleotide), and a double-stranded polynucleotide of the following (2) (hereinafter, a second: It may be at least one of double stranded polynucleotides). Furthermore, the first double stranded polynucleotide may be a first double stranded RNA and the second double stranded polynucleotide may be a second double stranded RNA.

(1) The first double-stranded polynucleotide has the nucleotide sequence “AGCUUUUGGGAAUUCAGGUAk ₁ k ₂ ” [G is guanine, A is adenine, C is cytosine, T is thymine, and U is uracil, k ₁ and k ₂ is each independently any nucleotide, and may be G, T or U: a single-stranded polynucleotide of SEQ ID NO: 3], and a nucleotide sequence “UACCUGAAUUhCCAAAGCUUUU” [h is any nucleotide, It may be A, U or C: SEQ ID NO: 4] is a nearly complementary double-stranded polynucleotide consisting of a single-stranded polynucleotide. When constructing a substantially complementary double stranded polynucleotide, it is also possible to take the form of a hairpin structure.

The first double stranded polynucleotide is based on hsa-miR-3140 (mature miRNA). The hsa-miR-3140 (naturally occurring) guide strand is a single-stranded RNA having a base sequence in which "k ₁ k ₂ " is "GU", and the passenger strand is "h" for "A" It is a single-stranded RNA having a certain base sequence. These single-stranded RNAs bind to one another substantially complementarily to constitute, for example, double-stranded RNA of the following formula. In the following formula, a bold line between bases indicates a hydrogen bond between bases, indicating that the base pair of the portion is complementary. The “substantially complementary” means a portion in which a part of a double-stranded polynucleotide is single-stranded and / or a portion in which a part of base pairs is not bonded by hydrogen bonding (mismatch) as in the following formula ), While the double-stranded polynucleotide is composed as a whole, and all of the constituent bases of the single-stranded polynucleotide paired with the double-stranded polynucleotide are hydrogen-bonded. It includes the case of “completely complementary”.

The first double stranded polynucleotide can be obtained as a synthetic product, for example, from Ambion Inc. (USA). The following 4 aspects are mentioned as a suitable other aspect of a 1st double stranded polynucleotide.

These double stranded polynucleotides are available, for example, from Gene Design Co., Ltd., and may contain at least one type of modified nucleotide.

(2) The second double-stranded polynucleotide comprises a single-stranded polynucleotide of the nucleotide sequence "AGGAGGAAUUGGUGCUGGUCUU" (SEQ ID NO: 2) and a single-stranded polynucleotide of the nucleotide sequence "ACUCACAGCCCCACAGCCUCAGAC" (SEQ ID NO: 5) , Substantially complementary double stranded polynucleotides. SEQ ID NO: 2 is the base sequence of hsa-miR-766-5p (mature miRNA), and SEQ ID NO: 5 is the base sequence of hsa-miR-766-3p (mature miRNA) and has a nearly complementary structure described below have. In the natural mature miRNA, an RNA having the nucleotide sequence of SEQ ID NO: 2 is positioned as a guide strand, and an RNA having the nucleotide sequence of SEQ ID NO: 5 is positioned as a passenger strand.

Nucleotides constituting the polynucleotide may contain at least one ribonucleotide, and may contain, in place of ribonucleotide, corresponding deoxyribonucleotide and at least one of modified nucleotides. Modified nucleotides include nucleotides in which a phosphate moiety has been modified, nucleotides in which a sugar moiety has been modified, nucleotides in which a base moiety has been modified, and the like. The modified nucleotide may be one in which any of a phosphate moiety, a sugar moiety and a base moiety is modified, or a combination of two or more kinds of modifications. For modified nucleotides, for example, JP-A-10-304889, WO2005 / 021570, JP-A-10-195098, JP-A-2002-521310, WO2007 / 143315, International See, for example, Publication No. 2008/043753, WO 2008/029619, WO 2008/049085 and the like.

As modification of the phosphoric acid moiety, "phosphorothioate modification" (S-formation) in which an oxygen atom is replaced by a sulfur atom is known.

As modification of the sugar moiety, non-crosslinking modification and crosslinking modification are known. Examples of non-crosslinkable modification include fluorine (F) conversion at the 2 'position, O-methylation, modification of the 2' hydroxyl group such as MOE conversion, modification by morpholino nucleic acid conversion, and the like. In addition, examples of the crosslinkable modification include LNA (2 ', 4'-BNA) formation, ENA formation and the like.

The polynucleotide contained in the pharmaceutical composition may be one obtained by substitution or deletion of one or two bases in the nucleotide sequence of the above-mentioned polynucleotide, and one or two bases are added at any position of the above-mentioned polynucleotide It may be one.

The polynucleotide according to the present embodiment can be synthesized using a known polynucleotide synthesis method or the like. The method for synthesizing a polynucleotide includes the phosphoroamidite method and its modified method, the H-phosphonate method and its modified method, enzyme synthesis (in vitro transcription method) and the like. Moreover, it is also possible to adapt the commercially available nucleic acid, or the commissioned manufactured nucleic acid.

The pharmaceutical composition may further contain, as an active ingredient, other antitumor compound in addition to the polynucleotide. Other antitumor compounds include, for example, antimetabolites, molecular targeting agents, alkylating agents, plant alkaloid agents, anticancer antibiotics, platinum preparations, hormone agents, biological response modifiers, immune checkpoints An inhibitor etc. are mentioned.

The pharmaceutical composition may be prepared in the form of a pharmaceutical composition, including a suitable pharmaceutical carrier, together with a nucleic acid (polynucleotide) as the active ingredient described above. As the pharmaceutical carrier, carriers according to the form of use can be selected, and fillers, fillers, binders, moisturizers, disintegrants, excipients such as surfactants, diluents, etc. It can be used. It is also possible to make it a desiccant which can be made liquid at the time of use by adding a suitable carrier to the above-mentioned nucleic acid as an active ingredient.

The pharmaceutical composition may comprise the active ingredient polynucleotide in a state of being enclosed or bound in a pharmaceutically acceptable carrier. For example, drug delivery systems such as polymeric micelles, nanoparticles composed of cyclodextrin-containing polymers, stable nucleic acid lipid particles, multifunctional envelope-type nanostructures, etc. can be used to further improve the effect of the pharmaceutical composition It is possible.

The form of the pharmaceutical composition is not particularly limited as long as it can effectively contain the above-described nucleic acid as an active ingredient, and solid agents such as tablets, powders, granules, pills and the like, ointments It may be an agent, a hap agent. In addition, injections such as solutions, suspensions, and emulsions are also suitable. At present, the pharmaceutical composition is effective for topical administration. The dosage form suitable for this mode of administration is usually in the form of an injection, an ointment or a happ. For local administration using an injection, the active ingredient is directly injected into the tumor by external injection such as intravenous, subcutaneous, intradermal or intramuscular injection, and the inside of the body is further endoscopically used. For example, the active ingredient is directly injected into a tumor (in the digestive tract, in the uterus, in the bladder, etc.), and the like. Topical administration using an ointment or a happ is carried out in such a manner as to directly infiltrate the active ingredient against skin cancer.

The dose of the above-described nucleic acid as an active ingredient to the human body is, for example, about 0.01 μg to 100 mg per adult per day. This administration may be once a day, or twice or more and five times or less, and may be performed on a daily basis or every several days.

The pharmaceutical composition is used, for example, as a cancer therapeutic agent. The pharmaceutical composition can be administered intravenously, intramuscularly, subcutaneously, intracutaneously, on the skin, in the digestive tract, in utero, intravesically, intravesically, intraperitoneally, etc., depending on the administration route suitable for the form. To be administered. The content of the above-mentioned nucleic acid as an active ingredient in the pharmaceutical composition is appropriately selected according to the administration method, administration form, purpose of use, symptoms of the patient, etc. of the composition, and is not constant. It is desirable that the composition be prepared in the form of a composition containing about 0.1% by mass to 95% by mass of the nucleic acid, and that the administration be performed with the dose and the administration frequency of the active ingredient described above.

The tumor to be treated with the pharmaceutical composition is not particularly limited. For example, a tumor expressing at least BRD4, a tumor expressing a gene product of a BRD4-NUT fusion gene is a subject of suitable treatment. The BRD4-NUT fusion gene is a fusion gene recognized by translocation of chromosome 15 and chromosome 19 in NUT midline carcinoma, an intractable cancer that mainly occurs in the upper gastrointestinal tract .

In addition, tumors expressing at least one selected from the group consisting of CDK2, CDK6, BRD3 and EGFR are also subjects of suitable treatment. For example, it is suitable when the pharmaceutical composition comprises the first double-stranded polynucleotide as an active ingredient.

For CDK2 and CDK6, CDK is an abbreviation of "cyclin-dependent kinase", and CDK2 forms a CDK2-CyclinE complex with CyclinE to shift the cell cycle from G1 phase to S phase . When the CDK inhibitor p21 binds to the complex, the cell cycle does not shift to S phase (G1 / S phase checkpoint). This is known to be an important function that prevents canceration of DNA-damaged cells (see, eg, O'Connor PM, Cancer Surv., 1997, vol 29, pages 82-151. ), Overexpression of CDK2 in cancer cells is considered as a promoting effect of cancer. CDK6 is also a gene that controls the cell cycle from G1 to S phase, and overexpression of the CDK6 gene in cancer cells is regarded as a growth promoting effect in cancer, and it is low targeting CDK6. Molecular compounds have been developed and are in clinical trials in various cancers. A cancer in which the CDK2 or CDK6 is overexpressed is a preferred treatment subject of the pharmaceutical composition of the aspect comprising the first double stranded polynucleotide or the first double stranded RNA.

Like the above-mentioned BRD4, BRD3 is one of "bromo domains" which is a protein domain having a function of recognizing histone acetylated lysine and collecting regulatory proteins to control chromatin structure and gene expression. Known as one of the BET (bromodomain and extra-terminal) family proteins having a bromo domain repeat sequence and a specific terminal sequence, a gene encoding this is one of the targets of the anticancer drug BET inhibitor It is A cancer in which BRD3 is overexpressed is a preferred treatment subject of the pharmaceutical composition of the aspect comprising the first double stranded polynucleotide or the first double stranded RNA.

“EGFR is a receptor that recognizes and signals epidermal growth factor (EGF), which regulates cell growth and growth.“ EGFR is found in many cancers. Overexpression is observed (see, for example, Normanno N ET AL., Journal of Cellular Physiology, 2003, vol. 194, No. 1, pages 13-19.), And overexpression of EGFR in cancer is a poor prognostic factor (For example, Selvaggi G. T. AL., Annals of Oncology, 2004, vol. 15, No. 1, 2004, pages 28-32; Hirsch FR, E. T. AL., Journal of Clinical Oncology, 2003, vol. 21, No. Especially, lung cancer is known to be strongly promoted by EGFR, and the medicament of the embodiment comprising the first double-stranded polynucleotide or the first double-stranded RNA With the preferred treatment subject of the composition The pharmaceutical composition of this aspect is also effective against lung cancer that has acquired resistance to an EGFR inhibitor.

Furthermore, when aiming at "coexistence with cancer", it may be an application target of the pharmaceutical composition. That is, by suppressing the expression of BRD4, EGFR, CDK2, and CDK6 including the expression of BRD4 in cancer, the pharmaceutical composition can be used to prevent malignancy or progression of cancer and achieve natural lifespan. It is considered to be suitable.

The above-mentioned quantification of gene expression can be performed according to a routine method. For example, as a method for quantifying the expression of BRD4 gene, CDK2 gene, CDK6 gene, BRD3 gene, EGFR gene, etc., Northern blotting method, Western blotting method, in situ hybridization method (ISH method), quantitative RT-PCR method These include RNase (including real-time PCR), RNase protection assay, in vitro transcription, expression array analysis, immunohistochemical staining, etc., or a modification of these methods. In addition, diagnosis of NUT midline cancer is generally based on splitapart FISH method using flanking NUT probe, RT-PCR method, Western blotting method, immunohistochemical staining method or the like.

The expression of BRD4, BRD3, EGFR, CDK2, CDK6 etc in the tumor to be treated may be over-expression. The presence or absence of overexpression of a predetermined gene can be identified as follows. Appropriate cutoff values are comprehensively or individually set based on the normal expression level of each gene. By applying the cut-off value to the expression quantitative value of a predetermined gene in the tumor determined by applying the method for quantifying gene expression described above to the tumor to be treated, excess of the predetermined gene is obtained. The presence or absence of expression can be identified. Cancers in which overexpression of such a predetermined gene is observed can be identified as a suitable application target of the pharmaceutical composition.

Tumors that exhibit the above-mentioned genetic characteristics are suitable subjects for treatment of the pharmaceutical composition. As tumors targeted for treatment, in outline, in addition to the above-mentioned NUT midline cancer, esophagus cancer, lung cancer, oral cancer, gastric cancer, colon cancer, uterine cancer, skin cancer, brain tumor, Neuroblastoma, glioblastoma, breast cancer, pancreatic cancer, ovarian cancer, prostate cancer, bladder cancer, esophageal cancer, liver cancer, solid cancer such as kidney cancer, and hematologic malignancy, blood Blood tumors including cancer and the like are exemplified. Of course, the objects to be treated are not limited to the external form of these cancers, and preferably, the selection of the objects to be treated based on the above-mentioned genetic characteristics is performed. In addition, since the nucleic acid which is the active ingredient can reliably reach the tumor, a local administration, that is, a tumor which can directly contact the pharmaceutical composition with the tumor is suitable as a treatment target.

Diseases to be treated based on genetic characteristics include, for example, acute myeloid leukemia (AML), mixed lineage leukemia (MLL), Burkitt's lymphoma, and diseases most often in childhood as diseases associated with the BRD4 and BRD3 genes. Common brain tumors medulloblastoma, MYCN amplified neuroblastoma, castration resistant prostate cancer, metastatic castration resistant prostate cancer (CRPC), Ewing's sarcoma, colorectal cancer myeloma, lymphoma, leukemia, multiple Myeloma, solid tumor (eg, pancreatic and prostate cancer), breast cancer, non-small cell lung cancer (NSCLC), myelodysplastic syndrome (MDS), medullary falsification / myeloproliferative neoplasm, filiform fibroid tumor not classified NUT midline cancer (NMC), diffuse large B cell lymphoma (DLBCL), triple negative breast cancer (TNBC), pancreatic ductal gland Cancer, polymorphic glioblastoma, type 2 diabetes mellitus, coronary artery disease, cardiovascular disease (eg, Int. J. Mol. Sci. 2016, 17, 1849; Cold Spring Harb Perspect Med. 2017; 7: a026674 See, etc.).

Diseases associated with the CDK2 gene and the CDK6 gene include advanced colorectal cancer, primary / recurrent colorectal cancer, colon cancer, pancreatic cancer, non-small cell lung cancer (NSCLC), endometrial cancer, head and neck Head squamous cell carcinoma, multiple myeloma, breast cancer, colorectal cancer, ovarian cancer, uterine serous cancer, chronic lymphoblastic leukemia, various malignant lymphomas, esophageal squamous cell carcinoma, hepatocellular carcinoma , Benign / malignant thyroid tumor, endometrial adenocarcinoma, soft tissue sarcoma, gastric cancer, esophagus cancer, acute lymphoblastic leukemia, Hodgkin's lymphoma, early NSCLC, malignant pleural mesothelioma, melanoma, retinoblastoma, bone Sarcoma, gastric cancer, Barrett's esophagus cancer, prostate cancer, relapsed / non-recurrent prostate cancer, pancreatic / gastrointestinal neuroendocrine tumor, bladder cancer, ovarian cancer, childhood acute lymphoblastic leukemia, adult acute lymphoblastic Bulbous leukemia, large diffuse B-cell lymphoma (DLBCL), primary colorectal cancer, glioblastoma, cervical cancer, glioblastoma / anaplastic astrocytoma, liposarcoma, rhabdomyosarcoma, primary pancreatic cancer , Glioma, medulloblastoma, T-cell lymphoma / leukemia, PNET / neuroblastoma, lung cancer, thymus cancer, lymphoma, kidney cancer, liver cancer, skin cancer, neuroblastoma, urothelium Head and neck cancer (see, for example, Pharmacological Research 2016, 107, 249-275; European Journal of Medicinal Chemistry, 2017, 142, 424-458.) And the like.

Diseases associated with the EGFR gene include lung cancer, breast cancer, stomach cancer, colon cancer, prostate cancer, kidney cancer, ovarian cancer, head and neck cancer (eg, Journal of Cellular Physiology, 2002, 194, 13-19. See, etc.).

Method of Treating Tumor The method of treating a tumor is a method of treating a tumor comprising administering an effective amount of the pharmaceutical composition to a subject. The tumor to be treated is as described above, and is, for example, a tumor expressing at least one selected from the group consisting of BRD4, CDK2, BRD3, EGFR, and CDK6. Also, the details and method of administration of the pharmaceutical composition are as described above. The subject of treatment is, for example, a mammal, which includes humans. The subject of treatment may also be a non-human animal.

The invention also includes, in another aspect, the use of said polynucleotide in the manufacture of a pharmaceutical composition for use in the treatment of a tumor, the use of said polynucleotide in the treatment of a tumor, said polynucleotide for use in the treatment of a tumor. Do.

EXAMPLES Hereinafter, the present invention will be specifically described by way of examples, but the present invention is not limited to these examples.

1. Materials and Methods Prior to the disclosure of the results of the examples, the materials and test methods used therein will be described.

(1) MicroRNA (Use for verifying the usefulness of the active ingredient of a pharmaceutical composition)
(A) First double stranded RNA (hsa-miR-3140 (mature miRNA))
(A) -1: double stranded RNA
As “hsa-miR-3140 (mature miRNA)”, a synthesized product of the microRNA was obtained from Ambion (Ambion, Inc .: USA) (trade name of Ambion: MC17496). The said microRNA is double stranded RNA which has the following base sequences. Hereinafter, in this example, this double-stranded RNA is referred to as "miR-X" unless otherwise specified.

(A) -2: Variant The synthesis of a double-stranded RNA variant of hsa-miR-3140 (mature miRNA) was requested to Gene Design, Inc. The variants are the following four types, each containing a modified nucleotide.

Hereinafter, in this example, this variant is described as "gene design-1" unless otherwise specified.

Hereinafter, in this example, this modified product is described as "gene design-2" unless otherwise specified.

Hereinafter, in the present example, this variant is described as "gene design-3" unless otherwise specified.

Hereinafter, in this example, this modified product is described as "gene design-4" unless otherwise specified.

(B) Second double stranded RNA (miR-766)
A synthetic product of double-stranded miRNA having hsa-miR-766-5p (mature miRNA) as a guide strand was obtained from Ambion (Ambion, Inc .: USA) (trade name of Ambion: MC23847). The double-stranded miRNA is known to have the following structure as a naturally occurring substantially complementary strand consisting of hsa-miR-766-5p (mature miRNA) and hsa-miR-766-3p (mature miRNA) There is. Hereinafter, in the present example, this double stranded RNA is described as "miR-766-5p" unless otherwise specified.

(C) Control miRNA and siRNA
As a control miRNA, a control miRNA (negative control # 1; miR-NC) (Ambion) was used.

BRD2 (siGENOME SMARTpool: M-004935-02-0005), BRD3 (siGENOME SMARTpool: M-004936-01-0005), BRD 4 (siGENOME SMARTpool: M-004937-02-0005), EGFR (siGENOME SMARTpool: M-003114) The siRNA against CDK2 (siGENOME SMARTpool: M-003236-04-0005) was obtained from Dermacon, respectively.

(2) Cancer cell lines Pancreatic cancer cell lines (Panc1, MIAPaCa2 cells, CFPAC1 cells, SW1990 cells), Breast cancer cell lines (MDA-MB-231 cells, SK-BR3 cells, T-47D cells, CRL1500 cells, YMB -1-E cells), lung cancer cell lines (NCI-H1650 cells, NCI-H1975 cells, A549 cells, HUT29 cells, 11-18 cells), hepatoma cell lines (Sk-Hep1 cells, Hep3 B cells, HepG2 cells, Huh7 cells, PLC / PRF / 5 cells) were purchased from American Culture Collection (USA). NUT midline carcinoma cell line (Ty-82 cells) was purchased from JCRB cell bank. The esophageal cancer cell line (KYSE150 cells) was donated by Dr. Yu Kuwata (Toyama University), and the KYSE150 cisplatin resistant strain was the one established previously (Fujiwara N ET AL., CANCER RES, 2015, vol 75 , pages 3890-3901).

Panc1, MIAPaCa2, KYSE150, KYSE150 Cisplatin resistant strain, CFPAC1, SW1990, HepG2, Huh7, PLC / PRF / 5, SK-BR3, T-47D, CRL1500, YMB-1-E cells in Dulbecco's modified Eagle's medium, A549, HUT29, NCI-H1975, Ty-82, NCI-H1650, 11-18 cells in RPMI 1640 medium, Sk-Hep1, Hep3 B cells in William E medium, MDA-MB-231 cells in L15 medium in 10% fetal bovine serum Was added and cultured at 5% CO ₂ · 37 ° C.

The colon cancer cell lines HCT116 + / + cells and HCT116-/-cells were donated by Vogelstein laboratory, and were cultured at 5% CO ₂ · 37 ° C. by adding 10% fetal bovine serum to Dulbecco's modified Eagle's medium.

(3) Antibody and BET inhibitor As antibodies for Western blotting, anti-BRD4 antibody (cell signaling), anti-BRD3 antibody (Bethyl laboratories), anti-BRD2 antibody (cell signaling), anti-MYC antibody (cell signaling), Anti-NUT antibody (cell signaling), anti-CCND2 antibody (cell signaling), anti-EGFR antibody (Santa Cruz Biotechnology), anti-CDK2 antibody (Santa Cruz Biotechnology), anti-CDK6 antibody (cell signaling), anti-Vinculin antibody (Sigma), anti-β actin antibody (Sigma) was used Anti-BRD4 antibody for immunohistological staining (Atlas antibodies), anti-BRD Antibody (Bethyl laboratories, Inc.), anti-CDK2 antibody (Bethyl laboratories, Inc.), .BET inhibitors with anti-EGFR antibody (Santa Cruz Biotechnology, Inc.) was used JQ1 (ApExBIO Inc.).

(4) Statistical Analysis The differences between the subgroups were analyzed by Student t-test and Paired t-test (which were used in the analysis of mouse tumor weight in the in vivo test described below). When the calculated P value was less than 0.05, it was judged as statistically significant.

2. Disclosure of Examples [Example Group A]
Example group A (Examples A1 to A5) shows the results of studies on miR-X and variants thereof as an active ingredient of a pharmaceutical composition.

Example A1 Screening of miRNA that Suppresses Cell Proliferation FIG. 1-1 shows a procedure for screening miRNA that suppresses cell proliferation.

10 nmol of 1090 types of precursor miR libraries [Pre-miR-miRNA precursor library-Human V15 (Ambion)] or control miRNA in Panc1-derived cells # 1, # 2 (3000 cells / well or 5000 cells / well) / L was introduced using Lipofectamine RNAiMAX (Invitrogen) according to the attached protocol, and after 3 days, the cell survival number was evaluated by a crystal violet (CV) staining assay. The cells were washed with PBS and fixed for 5 minutes with 10% formaldehyde PBS containing 0.2% CV. After excess CV solution was removed and completely air dried, stained cells were dissolved by adding 2% SDS solution and shaking the plate for 1 hour. The optical density (OD) absorbance was measured at 560 nm using a microplate reader (ARVOmx; Perkin-Elmer), and the percentage absorbance was calculated for each well. The OD absorbance value of control miRNA-introduced cells in control wells was arbitrarily set at 100% to determine the percentage of viable cells.

FIG. 1-2 shows the results of the screening of Panc1 # 1 (3000 cells / well) and Panc1 # 2 (5000 cells / well) described above. The figure shows the ratio of cell survival when introducing 1090 precursor miRNAs, as compared to control miRNAs. The left shows results for Panc1 # 1 cells (A), and the right shows results for Panc1 # 2 cells (B). The relative number of viable cells when the number of viable cells when transfected with control miRNA is 1, is shown. The ratio to the control was less than 0.6 as a standard of the growth inhibitory effect.

When the cut-off value of cell growth suppression was less than 0.6, it was 12 types of miRNA that both Panc1 # 1 and Panc1 # 2 showed growth suppression. Figure 1-3 is a Venn diagram showing this result. In Panc1 # 1, 29 types were found to have a cell growth inhibitory effect, and 65 types that Panc1 # 2 had a growth inhibitory effect, indicating that 12 types exist as common to both.

Among them, there were four kinds of miRNAs (Annotation confidence: high), which are likely to be present in database analysis of miRBase. Among the four types, hsa-miR-3140 was identified as a miRNA that has not been reported as a tumor suppressor miRNA.

Next, attach 10 nmol / L of miR-X (control: control miRNA (negative control # 1 (Ambion): miR-NC), respectively) to the target cancer cell line using Lipofectamine RNAiMAX respectively Introduced according to the

Target cancer cell lines include pancreatic cancer cell lines [Panc1, MIAPaCa2, CFPAC1 cells, SW1990 cells], and breast cancer cell lines [MDA-MB-231 cells (triple negative breast cancer cell lines: triple negative breast cancer, estrogen receptor, Breast cancer that does not express either progesterone receptor or HER2 in tumor cells, and the effectiveness of hormonal therapy and molecular targeting drugs focusing on these receptors has not been recognized, and it is known as a cancer with a poor prognosis ), SK-BR3 cells, T-47D cells, CRL1500 cells, YMB-1-E cells], lung cancer cell lines [NCI-H1650 cells, NCI-H1975 cells, A549 cells (non-small cell lung cancer cell lines) , HUT29 cells (non-small cell lung cancer cell line), 11-18 cells], hepatoma cell line [Sk Hep1 cells, Hep3B cells, HepG2 cells, Huh7 cells, PLC / PRF / 5 cells, and the esophageal cancer cell lines [KYSE150, was the cisplatin (CDDP) resistant strain KYSE150 CDDP-R].

FIGS. 1-4 are photomicrographs of the two types of pancreatic cancer cell lines (Panc1 (A, B), MIAPaCa2 (C, D)) 72 hours after the introduction. In each of the pancreatic cancer cell lines, it is shown that a large number of dead cells are observed in the miR-X introduction group (B, D) and the number of viable cells is smaller than that in the control (A, C).

Figure 1-5 shows pancreatic cancer cell lines (Pancl (A), MIAPaCa2 (B)), triple negative breast cancer cell line (MDA-MB-231 (C)), esophageal cancer cell line (KYSE150 (D) , Its cisplatin (CDDP) resistant strain KYSE150 CDDP-R (E), hepatoma cell line (Sk-Hep1 (F)), non-small cell lung cancer cell line (HUT29 (G), A549 cells (H)) Shows cell growth curves upon miR-NC or miR-X administration. In all cell lines, miR-X administration showed a remarkable growth inhibitory effect.

Furthermore, target cancer cell lines other than the cancer cell lines illustrated in FIG. 1-5, that is, pancreatic cancer cell lines [CFPAC1 cells (A), SW1990 cells (B)], breast cancer cell lines [SK-BR3 Cell (E), T-47D cell (F), CRL1500 cell (G), YMB-1-E cell (H)], lung cancer cell line [NCI-H1650 cell (C), 11-18 cell (D)] Also, in hepatoma cell lines [Hep3B cells (I), HepG2 cells (J), Huh7 cells (K), PLC / PRF / 5 cells (L)], miR-X administration significantly suppresses growth Was recognized (Figure 1-6).

From the above results, it has been shown that miR-X exhibits a remarkable growth inhibitory effect in various cancer types including refractory cancer.

<Example A2> Identification of EGFR gene or CDK family gene as a functional target of miR-X For Panc1 cells, MIAPaCa2 cells, MDA-MB-231 cells into which miR-NC or miR-X described above has been introduced , Array analysis of gene expression was performed. The said gene expression array analysis was performed according to the operation manual using Agilent 4x44K gene expression array (Agilent Technology). Gene expression array analysis was performed twice for each miR-introduced cancer cell, and data were analyzed using GeneSpring software (Agilent Technology).

FIG. 2-1 is a Venn diagram showing the results of the above gene expression array analysis and the number of target gene candidates that miR-X acts on the 3 'UTR region predicted from the Target Scan database. Among the genes whose expression was suppressed more than twice as compared with the miR-NC introduction group, there were 228 genes common to the three cancer cell lines. Among the 228 common genes, there were 99 genes listed as candidate target genes for the 3 'UTR region of miR-X in the Target Scan database.

From these results, we focused on the EGFR gene, the CDK2 gene, and the CDK6 gene, which are genes associated with cell growth, as target candidates for miR-X. FIG. 2-2 shows the results of Western blotting in Panc1 cells (A) and MIAPaCa2 cells (B), which are pancreatic cancer cell lines into which miR-X was introduced as described in Example A1. It is a photograph drawing. Western blot performed SDS-PAGE on lysates of whole cells, transferred proteins to PVDF membrane (GE Healthcare), and 1 hour at room temperature using TBS containing 0.05 % Tween 20 and 5% skimmed milk After blocking, the membrane was reacted with the antibody overnight at 4 ° C. The dilution ratio of the secondary antibody was anti-EGFR antibody (1/200), anti-CDK2 antibody (1/200), anti-CDK6 antibody (1/1000), and anti-β-actin antibody (1/5000). After the membrane was washed, it was exposed to HRP-conjugated anti-mouse or anti-rabbit IgG antibody (both 1/5000) for 1 hour at room temperature. Bound antibodies were visualized using SuperSignal West Femto Substrate (Thermo Fisher Scientific). As a result, suppression of the expression of the CDK2 gene, the CDK6 gene, and the EGFR gene was observed by introducing miR-X into these pancreatic cancer cells.

Fig. 2-3 shows the results of verification by the miR-X luciferase reporter assay using a construct in which the 3 'UTR region of the CDK2 gene (A) and the EGFR gene (B) is incorporated into a luciferase vector. The EGFR gene and the CDK2 gene each have one region homologous to the base sequence of the guide strand of miR-X, and the luciferase reporter plasmid used for the assay is the luciferase of pmiRGlo Dual-Luciferase miRNA Target Expression Vector (Promega) The gene was prepared by inserting, downstream of the gene, the 3 ′ UTR region of the CDK2 gene or EGFR gene containing the homologous region, or a sequence in which a mutation was inserted into this region. All site-directed mutations were generated using the KOD mutagenesis kit (TOYOBO). The luciferase reporter plasmid was introduced into Panc1 cells or MIAPaCa2 cells using Lipofectamine 2000 (Invitrogen) according to the attached protocol, and miR-X or control miRNA was introduced the next day. Two days later, firefly luciferase activity and sea pansy luciferase activity are measured using Dual-Luciferase Reporter Assay System (Promega Corp.), and relative luciferase activity is corrected with the corresponding internal standard control sea pansy luciferase activity. , Firefly luciferase activity was normalized and calculated.

By introducing the miR-X into both the CDK2 gene, the EGFR gene, and miR-X, a decrease in the luciferase activity corresponding to the wild-type 3'UTR region was observed, and in the vector in which the region matching the base sequence of miR-X guide strand was mutated Luciferase activity was restored. From these results, it was shown that miR-X directly suppresses the expression of the CDK2 gene and the EGFR gene by the action on the 3'UTR region of the CDK2 gene and the EGFR gene.

Fig. 2-4 shows the effect on cell proliferation when knockdown of CDK2 gene by causing siRNA to act on pancreatic cancer cell lines Panc1 cells (A, B) and MIAPaCa2 cells (C, D). There is. The effect of siRNA on the CDK2 gene was compared to when control siRNA (si-NC) was introduced. It was shown that expression of the CDK2 gene was suppressed by performing Western blotting in the same manner as described in Example A2 (A, B). In addition, in MIAPaCa2 cells, cell proliferation was suppressed with knockdown of the CDK2 gene (D). This confirms that the expression of the CDK2 gene actually contributes to the growth of these pancreatic cancer cell lines. In addition, the degree of inhibition of cell growth is smaller than when the active ingredient of the pharmaceutical composition of the present embodiment is allowed to act, so that the efficacy of the pharmaceutical composition is clarified.

Figure 2-5 shows Panc1 cells (A and B), which are pancreatic cancer cell lines, and lung cancer cell lines, and NCI-H1975 cells (C, D) The effect of siRNA on cell growth when knocking down the EGFR gene is shown. The effect of siRNA on the EGFR gene was compared to when control siRNA (si-NC) was introduced. Western blot showed that the expression of the EGFR gene was suppressed (A, B). Moreover, in these cells, cell proliferation was suppressed with knockdown of the EGFR gene (C, D). This confirms that expression of the EGFR gene actually contributes to the growth of these cancer cell lines. In addition, the degree of inhibition of cell growth is smaller than when the active ingredient of the pharmaceutical composition of the present embodiment is allowed to act, so that the efficacy of the pharmaceutical composition is clarified.

FIG. 2-6 shows the effect of miR-X on cell proliferation when lung cancer cell line NCI-H1975 cells are introduced. As described above, NCI-H1975 cells are lung cancer cells in which EGFR promotes a growth of cancer by being a driver, and are known to have a mutation resistant to an EGFR inhibitor. Western blot shows that, even in such EGFR inhibitor-resistant lung cancer cells, miR-X introduction reduces EGFR expression and CDK2 expression (A). Cell proliferation was also clearly suppressed (B).

These results indicate that miR-X suppresses the expression of these genes by directly binding to the CDK2 gene and the 3'UTR region of the EGFR gene, and further contributes to a marked suppression of cell proliferation. It shows.

Example A3 Identification of BRD4 and BRD3 Genes as Functional Targets of miR-X Panc1 cells and MIAPaCa2 cells, which are pancreatic cancer cell lines, and MDA-MB-231 cells, which are triple negative breast cancer cell lines Then, miR-NC or miR-X was introduced as described in Example A1, and subjected to the above expression array analysis. FIG. 3-1 shows the results of the expression array performed on these miR-introduced cells and the number of target gene candidates of the miR-X coding region (CDS) predicted from the StarMirDB database in a Venn diagram.

Among the genes whose expression is suppressed to less than 1/2 compared to the miR-NC introduction group, there are 228 genes common to the above three cancer cell lines, and among these, miR- There were 103 genes listed as target gene candidates for X CDS.

From these results, we focused on the BRD4 gene associated with cell proliferation as a target candidate for miR-X.

As described above, the expression of BRD2, BRD3, BRD4, CyclinD2, MYC, phosphorylated STAT3 (p-STAT3 (Tyr705)), STAT3 protein in miR-X-introduced pancreatic cancer cell lines Panc1 cells and MIAPaCa2 cells, The expression of β-actin protein was examined by performing a Western blot with positive control. The results are shown in the photographic drawing of Figure 3-2. As shown in FIG. 3-2, in Panc1 cells (A) and MIAPaCa2 cells (B), expression suppression of BRD4 by miR-X introduction is remarkably observed, and expression of BET family BRD2 and BRD3 proteins is further observed. Repression was noted. Decreased expression of MYC, p-STAT3 and CCND2 (CyclinD2), which are targets downstream of BRD4, was also observed.

Figure 3-3 shows the effect of knocking down the BRD2 gene, BRD3 gene, and BRD4 gene into pancreatic cancer cell line Panc1 using siRNA, respectively, and the effect on gene expression and cell proliferation as control siRNA (si-NC) Is shown in comparison with the case of using. Western blot showed that the expression of these genes was suppressed (A) and cell proliferation was also suppressed (B).

FIG. 3-4 shows the effect on cell proliferation when a BRD4 expression vector is introduced into Panc1 cells and the BRD4 gene is overexpressed. The BRD4 expression vector was prepared by purchasing BRD4 cDNA from Kazusa DNA Research Institute and integrating it into pFN28A Halotag CMV-neo Flexi vector purchased from Promega. By tagging the BRD4 gene with Halotag, BRD4 introduced into exogenous (exo) could be distinguished from BRD4 expressed in endogenous (endo). By the introduction of the BRD4 expression vector, expression of exogenously introduced BRD4 was observed and expression of MYC, which is a downstream target of BRD4, was also increased, as compared with cells into which the empty vector as control was introduced. , Western blot, as shown in the drawing (A). Then, it was found that overexpression of BRD4 by introduction of the BRD4 gene promotes cell proliferation (B).

From these results, it was shown that miR-X suppresses the expression of BET family genes including the BRD4 gene and suppresses the growth of cancer cells.

Next, in order to determine whether miR-X directly regulates BRD4 and BRD3 genes, the miR-X luciferase using a construct in which the CDS regions of BRD4 and BRD3 genes have been incorporated into a luciferase vector Verification by reporter assay was performed generally as described in Example A2. The region homologous to the base sequence of the guide strand of miR-X is present in two places in close proximity to the CDS of the BRD4 gene and in one place in the CDS of the BRD3 gene. A wild type CDS region containing this region or a sequence in which a mutation was inserted into this region was incorporated into a luciferase reporter vector, introduced into a pancreatic cancer cell line MIAPaCa2 cells, and then miR-X was introduced. Figures 3-5 (A) and 3-6 (A) show the gene sequence of the region originally homologous to the base sequence of the guide strand of miR-X among the CDS sequences of the BRD4 gene and BRD3 gene and the above mutations, respectively. Shows the introduced sequence of FIG. 3-5 (B) shows the mutation state in the mutant. As shown in Fig. 3-5 (C) and Fig. 3-6 (B), a decrease in luciferase activity was observed in wild-type CDS by introducing BRD4 gene and BRD3 gene together and miR-X, and guiding miR-X The luciferase activity was restored in the vector in which the region homologous to the base sequence of the chain was mutated.

Also, as shown in FIG. 3-7, the same luciferase reporter assay as described above was performed in the region (A) homologous to the base sequence of the miR-X guide strand present in the 3'UTR region of the BRD3 gene, No reduction in luciferase activity was observed due to the introduction of miR-X (B), and it was shown that miR-X did not target the 3'UTR region of the BRD3 gene.

Furthermore, miRs using expression vectors of BRD4 gene and BRD3 gene, and a construct in which a mutation has been introduced so as not to change the amino acid sequence in the region homologous to the base sequence of miR-X in CDS of these genes It was verified whether -X actually regulates gene expression through CDS of BRD3 gene and BRD4 gene. FIGS. 3-8 and 3-9 show that the expression of the BRD4 gene and the BRD3 gene is suppressed by miR-X via the respective CDS in the photograph of the western blot. In these figures, after introducing the expression vector of BRD4 gene or BRD3 gene and these gene mutation vectors into MIAPaCa2 cell which is a pancreatic cancer cell line, when miR-X is introduced, wild type BRD4 gene or BRD3 is introduced. In the cells into which the gene has been introduced, their expression is suppressed by miR-X, while when mutant BRD4 gene or BRD3 gene is introduced, the expression suppression of these genes by miR-X is released It is shown.

From these results, it was revealed that miR-X suppresses the expression of these genes by directly binding to the BRD4 gene and the CDS region of the BRD3 gene.

<Example A4> Identification of BRD4-NUT fusion gene as a functional target of miR-X A rare but extremely high grade NUT midline cancer main pathogenesis is translocation of chromosome 15 and chromosome 19 It is known to be a BRD4-NUT fusion gene produced by FIG. 4-1 shows the relationship between mRNA of BRD4-NUT fusion gene and miR-X. Since miR-X targets the CDS of the BRD4 gene as described above, this BRD4-NUT fusion gene was also predicted to be a target.

The results of miR-X introduction into the NUT midline carcinoma cell line Ty-82 cells are shown in FIG. 4-2 by the cell growth curve (A) and the photographic drawing of the western blot (B). Ty-82 expresses the BRD4-NUT fusion gene, but the introduction of miR-X suppresses the expression of the gene product of the BRD4-NUT fusion gene and also suppresses the downstream MYC, resulting in It has been shown that cell proliferation was significantly suppressed.

In addition, a BET inhibitor is considered to be effective in clinical trials for NUT midline carcinoma, and Figure 4-3 shows the effect of the BET inhibitor JQ1 on Ty-82. At a JQ1 concentration of 500 nM, MYC downstream of the BRD4-NUT fusion gene was suppressed (B) and cell proliferation was markedly suppressed (A).

Next, in order to test whether miR-X can overcome the resistance of BET inhibitor, Ty-82 cells were used to establish a JQ1 resistant strain. That is, the Ty-82 cells are cultured in a culture solution to which a low concentration of JQ1 is added, and the surviving cells are grown in a culture solution not containing JQ1, and then the concentration of JQ1 is increased compared to the previous time. The cells were cultured in the culture medium, and the surviving cells were grown in a culture medium not containing JQ1 and then cultured in a culture medium in which the concentration of JQ1 was increased more than that in the previous time. Repeat this step of gradually increasing the concentration of JQ1 to ensure culture of surviving cells for at least one month, and finally secure cells that can survive even in a culture solution with a concentration of 2.5 μM of JQ1, and establish this Used as a strain.

FIG. 4-4 shows the JQ1 dose response curve and IC50 of Ty-82 cells (A) and a newly established Ty-82 JQ1 resistant strain (B), which were measured using the xCELLigence system. It has been shown that Ty-82JQ1 resistant cells are about 3 times higher in IC50 than Ty-82 cells, and are JQ1 resistant.

The results of introducing miR-X into the Ty-82JQ1-resistant cells are shown in FIG. 4-5 in the cell growth curve (A) and the photograph (B) of the western blot. By introducing miR-X, the expression of BRD4-NUT fusion gene and the expression of downstream MYC gene are clearly suppressed and the cell proliferation is also clearly suppressed even in Ty-82JQ1 resistant cells. became.

These results indicate that miR-X can suppress the growth of NUT midline carcinoma by suppressing the expression of BRD4-NUT fusion gene, and can also overcome the BET inhibitor JQ1 resistance. The

Example A5 Growth Inhibitory Effect of Tumor Cells in Vivo by Administration of miR-X Seven-week-old Balb / c nude mice were purchased from Oriental Bioservices, and were bred in a sterile state. 100 μl of PBS containing MIAPaCa2 cells, a 5 × 10 ⁶ pancreatic cancer cell line, was injected subcutaneously into the dorsal flank of the mouse. Fig. 5-1 shows the schedule of in vivo tests after this subcutaneous injection. A mixture of 1 nmol of miR-X or a control miRNA and 200 μl of AteroGene (KOKEN) was administered to the space between the tumor and the skin for a total of 5 times (7, 11, 15, 18 after injection of MIAPaCa2 cells) 21 days later). Twenty-three days after cell administration, mice were euthanized and tumors removed. The experimental procedures performed for all mice were approved by the Animal Experiment Committee of Tokyo Medical and Dental University.

FIG. 5-2 shows the appearance of subcutaneous tumors of representative mice 23 days after injection of MIAPaCa2 cells.

FIG. 5-3 shows a photograph (A) of the excised tumor. When the weight of the removed tumor was weighed for each mouse, the weight of the tumor in the miR-X administration group was significantly smaller than that in the control miRNA administration group (B).

Tumor volume was significantly reduced by administration of miR-X compared to administration of control miRNA (miR-NC) (FIG. 5-4). Tumor volume was calculated by (long diameter) × (short diameter) ² × 0.5.

FIG. 5-5 shows expression analysis of miR-3140 in excised tumors. The expression level of miR-3140 shows the result calculated by quantitative RT-PCR.

In this quantitative RT-PCR, total RNA is separated from tumor tissue by standard methods using TRIsure reagent (Bioline), and single-stranded RNA prepared from the total RNA is specific to miR-3140. Amplified with different primers. Real-time RT-PCR for miR-3140 can be performed by ABI Prism 7500 Fast Real-time PCR system (Applied Biosystems), Taqman Universal PCR Master Mix (Applied Biosystems), Taqman Universal PCR Master Mix (Applied Biosystems), It carried out according to these operation manuals using Taqman microRNA Assays (Applied Biosystems). The expression level of miR-3140 was normalized by correcting with the expression level of RNU6B as a normalization control of the initial amount of total RNA.

As a result of examination by this quantitative RT-PCR, it could be confirmed that the expression of miR-3140 in tumor cells was markedly increased in the miR-X administration group.

In FIG. 5-6, decreased expression of the BRD4, BRD3, EGFR, and CDK2 genes associated with the increased expression of miR-3140 described above was shown by immunostaining of excised tumors.

In immunostaining, tumor samples are fixed in PBS containing 10% formaldehyde, embedded in paraffin, sectioned into 4 μm thick sections, immunohistochemical staining of BRD4, BRD3, EGFR, CDK2 by avidin-biotin-peroxidase method. Did. The paraffin-embedded tumor sections were deparaffinized with xylene and rehydrated with ethanol. Antigen was activated by boiling in 10 mM citrate buffer (pH 6.0), and the sections were treated with methanol containing 0.3% hydrogen peroxide to inactivate endogenous peroxidase. Thereafter, the sections are treated with anti-BRD4 antibody (1/500 dilution), anti-BRD3 antibody (1/500 dilution), anti-EGFR antibody (1/200 dilution) or anti-CDK2 antibody (1/500 dilution) at 4 ° C. Let react overnight. Bound antibodies were visualized using diaminobenzidine (VECTASTAIN-EluteABCkit: Vector Laboratory) as color antigen, and then the sections were counterstained with hematoxylin.

From these results, it was shown that administration of miR-X suppressed the expression of BRD4 gene, BRD3 gene, EGFR gene and CDK2 gene in tumor tissues in vivo and suppressed tumor growth. That is, the pharmaceutical composition containing miR-3140 is expected to have an effect on various tumors resulting from the expression of at least one selected from the group consisting of BRD4, BRD3, EGFR, CDK2, and CDK6. Ru.

Example A6 Examination of the Inhibitory Effect of Variants on Cancer Cells FIG. 6 shows the introduction of four first double-stranded miRNAs (including modified nucleotide sequences) that are part of the active ingredient of the pharmaceutical composition. It is a figure which shows the result of having examined the tumor suppression effect by in comparison with miR-X. That is, miR-NC (in the figure, NC), miR-X (in the figure, miRVana), gene design-1, gene design, as described in Example A1, to the pancreatic cancer cell line MIAPaCa2 cells. Design-2, gene design-3 and gene design-4 were introduced, and these introduced cells were subjected to photographs of western blots (A) and growth of cancer cells over time, based on this. Cell growth curve (B) is shown.

From these results, it was revealed that the above four variants were found to have the same tumor suppressor effect as hsa-miR-3140.

<Summary of Example A Group>
FIG. 7 is a diagram summarizing the mechanism by which miR-X suppresses tumor growth, derived from the results of Example A above.

From the results of Example A above, miR-X suppresses the protein level expression of BRD4 gene by directly targeting the coding region of the transcript mRNA of BRD4 gene, and it is an anticancer agent in various cancers. I found that I would be effective. Furthermore, direct targeting to the transcript mRNA of the BRD4-NUT fusion gene and targeting to the 3 'UTR region of transcript mRNAs of the EGFR gene and the CDK2 gene were also revealed. Moreover, it also became clear to suppress the expression of the CDK6 gene.

Drug resistance is often a problem in the treatment of cancer. In lung cancer, EGFR inhibitors have been clinically applied and actually used and their efficacy has been confirmed, but on the other hand, resistance to EGFR inhibitors has become a problem. In this respect, as shown in the above-mentioned Example A group, it becomes clear that introduction of miR-X can suppress the growth of the lung cancer cells by reducing EGFR itself even in lung cancer cells resistant to EGFR inhibitor, It has been shown that miR-X can overcome drug resistance in EGFR resistant lung cancer.

In addition, NUT midline carcinoma has a very high grade prognosis and a very poor prognosis, and its main etiology is known to be BRD4-NUT fusion gene, but there is no treatment method so far, and it is a clinical research level BET inhibitors are used (see, for example, Stathis A ET AL., CANCER DIS, 2016, vol 6, pages 492-500.). In this respect, as shown in the above-mentioned Example A group, it was found that miR-X exerts a high anti-cancer effect also in NUT midline cancer cells by directly suppressing the BRD4-NUT fusion gene. Furthermore, it was found that the growth can be suppressed even for BET inhibitor-resistant NUT midline cancer cells. This indicates that miR-X is extremely effective against refractory NUT midline cancer.

Furthermore, in double-stranded RNAs (gene design-1, gene design-2, gene design-3, and gene design-4) in which miR-X is partially modified, the tumor suppression effect equivalent to miR-X is It was recognized that it was also possible to diversify the active ingredient by the structural approach of the microRNA.

Previous studies have also shown that one miRNA can inhibit the expression of multiple targets by directly binding to the coding region or 3 'UTR region of each gene, which indicates that cancer It is shown that one miRNA targets multiple pathways involved in the activation of For example, hsa-miR-34a is known to suppress tumor growth through multiple targets such as CCND1 gene, CDK6 gene, MYC gene, c-MET gene, NOTCH gene (eg, Sun F ET) See AL., FEBS LETT, 2008, vol 582, pages 1564-1568; Li Y ET AL., CANCER RES, 2009, vol 69, pages 7569-7576). In Example A above, when miR-X and variants thereof target the BRD4 gene, BRD3 gene, EGFR gene, CDK2 gene, and CDK6 gene, the pancreas formed subcutaneously in nude mice is The effect of suppressing the growth of tumors derived from the cancer cell line MIAPaCa2 cells was observed.

Thus, the present embodiment is particularly effective for a tumor in which the BRD4 gene, the BRD3 gene, the EGFR gene, the CDK2 gene, or the CDK6 gene is activated, and a tumor in which the BRD4-NUT fusion gene is expressed. Provided by the present invention are provided.

[Example B] Examination of the tumor suppressor effect of miR-766-5p HCT116 + / + (cell line of p53 gene is wild type), HCT116-/-(wild type p53 gene is lacking) which is a colon cancer cell line Of 10 nmol / L of miR-766-5p against Lipofectamine RNAiMAX (Invitrogen) against the lost cell line, KYSE 150, which is an esophageal cancer cell line, and MIAPaCa2, which is a pancreatic cancer cell line Western blots were performed on BRD4 and MYC as described in Example A2, for each of the transfected cells which were introduced into a target cancer cell line according to the attached protocol and 72 hours after the introduction. The results are shown in Figure 8-1.

As shown in FIG. 8-1, it was revealed that the introduction of miR-766-5p suppresses the expression of the BRD4 gene of the above-mentioned cancer cells and the downstream MYC gene.

Next, verification by a luciferase reporter assay of miR-766-5p was performed using a construct in which the CDS region and the 3'UTR region of the BRD4 gene were incorporated into a luciferase vector. There are five regions (R1-5) in the CDS region and one region (R6) in the 3'UTR region of the region homologous to the base sequence of miR-766-5p (FIG. 8-2).

The luciferase reporter plasmid used in the assay was prepared by inserting the CDS region or 3 'UTR region of the BRD4 gene containing the homologous region downstream of the luciferase gene of pmiRGlo Dual-Luciferase miRNA Target Expression Vector (Promega). . The luciferase reporter plasmid was introduced into colon cancer cell line HCT116-/-cells using Lipofectamine 2000 (Invitrogen) according to the attached protocol, and the next day miR-766-5p or control miRNA (MiR-NC) was introduced. Two days later, firefly luciferase activity and sea pansy luciferase activity are measured using Dual-Luciferase Reporter Assay System (Promega Corp.), and relative luciferase activity is corrected with the corresponding internal standard control sea pansy luciferase activity. , Firefly luciferase activity was normalized and calculated.

FIG. 8-3 shows the result (C) of the above luciferase reporter assay when targeting R1 and R2 of the homologous part of the CDS region of the BRD4 gene. 8-3 (A) and (B) show the positional relationship of the target sequence. From this, miR-766-5p is considered to target R1 and R2 in the CDS region of BRD4.

FIG. 8-4 shows the result (C) of the above luciferase reporter assay when R3 was targeted to the homologous part of the CDS region of the BRD4 gene. 8-4 (A) and (B) show the positional relationship of the target sequence. From this, miR-766-5p is considered to target R3 in the CDS region of BRD4.

FIG. 8-5 shows the result (C) of the above luciferase reporter assay when R4 was targeted to the homologous part of the CDS region of the BRD4 gene. 8-5 (A) and (B) show the positional relationship of target sequences. This suggests that miR-766-5p does not target R4 in the CDS region of BRD4.

FIG. 8-6 shows the result (C) of the above luciferase reporter assay when targeting R5 of the homologous part of the CDS region of BRD4 gene. 8-6 (A) and (B) show the positional relationship of the target sequence. From this, miR-766-5p is considered to target R5 in the CDS region of BRD4.

FIGS. 8-7 show the results (C) of the above luciferase reporter assay when targeting R6 of the homologous part of the 3 ′ UTR region of the BRD4 gene. 8-7 (A) and (B) show the positional relationship of the target sequence. This indicates that miR-766-5p does not target the 3'UTR region of the BRD4 gene.

From the above results, miR-766-5p targets at least R1, R2, R3, and R5 in the CDS region of the BRD4 gene, suppresses the expression of BRD4, and is against cancers that over-express the BRD4 gene. Have been shown to have an inhibitory effect.

[Example C1] MYCN suppressive effect and proliferation suppressive effect on neuroblastoma cells The cell growth suppressive effect of miR-3410 on these cells was evaluated using cells with and without MYCN gene amplification as neuroblastoma cells. . GOTO (purchased from the American Culture Collection (ATCC)), IMR-32 (purchased from the ATCC), and RT-BMV-C6 (provided by the Department of Pediatrics, Kyoto Prefectural University of Medicine) are prepared as cell lines that have the MYCN gene amplification As cell lines without amplification of MYCN gene, SK-N-AS and SH-SY5Y (both purchased from ATCC) were prepared. In the same manner as in Example A1, 10 nmol / L of miR-X (control is a control miRNA (negative control # 1 (Ambion): miR-NC), respectively, using Lipofectamine RNAiMAX (Invitrogen)) The target cancer cell line was introduced according to the attached protocol, and also for si-BRD4 (20 nM; control: siNC), JQ1 (500 nM; control: DMSO), and OTX015 (500 nM; control: DMSO) The cell growth inhibitory effect was evaluated, and the results are shown in FIGS.

FIG. 9-1 shows the cell proliferation curve (GOTO cell line (A) after introduction of miR-NC or miR-X (denoted as miR-3140 in FIG. 9-1) in each cell line in which there is amplification of the MYCN gene. ), IMR-32 cell line (B), RT-BMV-C6 (C), cell growth curve after introduction of si-BRD4 or siNC (GOTO cell line (D), IMR-32 cell line (E), RT) -BMV-C6 (F), cell growth curve after addition of JQ1 or DMSO (GOTO cell line (G), IMR-32 cell line (H), RT-BMV-C6 (I)), and OTX015 or DMSO addition Later cell growth curves (GOTO cell line (J), IMR-32 cell line (K), RT-BMV-C6 (L)) are shown. In all cell lines, miR-X administration showed a remarkable growth inhibitory effect.

FIG. 9-2 shows cell proliferation curves (SK-N-AS) after introduction of miR-NC or miR-X (denoted as miR-3140 in FIG. 9-2) in respective cell lines without amplification of the MYCN gene. Cell line (A), SH-SY5Y cell line (B), cell growth curve after introduction of si-BRD4 or siNC (SK-N-AS cell line (C), SH-SY5Y cell line (D)), JQ1 Or cell growth curve (SK-N-AS cell line (E), SH-SY5Y cell line (F)) after addition of DMSO, and cell growth curve (SK-N-AS cell line (G) after addition of OTX015 or DMSO ), SH-SY5Y cell line (H)). In all cell lines, miR-X administration showed a remarkable growth inhibitory effect.

Example C2
Example A2 for expression of BRD4 and MYCN in neuroblastoma cell lines with amplification of MYCN transfected with miR-NC or miR-X and expression of BRD4 and MYC in neuroblastoma cell lines without amplification of MYCN According to, it evaluated by Western blot. The results are shown in Figure 9-3. FIG. 9-3 (A) shows the expression levels of BRD4 and MYCN in neuroblastoma cell lines with MYCN amplification, and FIG. 9-3 (B) shows BRD4 in neuroblastoma cell lines without MYCN amplification. And the expression level of MYCN.

Example C3
The mRNA expression level of MYCN gene in neuroblastoma cell lines (IMR-32 and RT-BMV-C6) into which miR-NC or miR-X (denoted as miR-3140 in FIG. 9-4) was expressed as GAPDH Based on the mRNA expression level of the gene, it was evaluated by quantitative RT-PCR. The results are shown in Figure 9-4. FIG. 9-4 (A) shows the expression level of MYCN in the IMR-32 cell line, and FIG. 9-4 (B) shows the expression level of MYCN in the RT-BMV-C6 cell line.

In neuroblastoma, gene amplification of MYCN is a biomarker of poor prognosis. MiR-3140 showed a better growth inhibitory effect compared to siRNA (si-BRD4) and BET inhibitors (JQ1 and OTX015) against BRD4 in cells with and without MYCN amplification (Fig. 9- 1, Figure 9-2). In cells with MYCN amplification, introduction of miR-3140 (10 nM) resulted in suppression of BRD4, and further decreased expression of MYCN mRNA and protein levels. On the other hand, in the cells without MYCN amplification, the expression of MYC was decreased (Fig. 9-3, Fig. 9-4).

Example D1
In 22 types of glioblastoma cell lines, miR-X inhibited the cell growth inhibitory effect. According to Example A1, cell proliferation was evaluated by crystal violet staining 72 hours after transfection with miR-X at a concentration of 20 nM.

Examples of glioblastoma cell lines include A172, AM-36, Becker, GB-1, KALS-1, KINGS-1, KNS-42, KNS-60, KNS-81, KNS-89, KNS-1, Marcus, NMC-G1, no. 10, No. 11, SF126, T98G (all purchased from JCRB cell bank), U-87 MG (purchased from ATCC), U-251-MG (purchased from JCRB cell bank), U373-MG (purchased from ATCC), YH-13 (purchased from JCRB cell bank) and YKG-1 (purchased from JCRB cell bank) were prepared.

As shown in FIGS. 10 (A) to (V), in 19 types of glioblastoma cells among 22 types, cell proliferation is 60 by introduction of miR-X (denoted as miR-3140 in FIG. 10). It was suppressed to less than%.

The disclosure of Japanese Patent Application 2017-2290467 (filing date: November 29, 2017) is incorporated herein by reference in its entirety. All documents, patent applications, and technical standards described herein are as specific and distinct as when individual documents, patent applications, and technical standards are incorporated by reference. Hereby incorporated by reference.

Claims (14)

1. A pharmaceutical composition for treating a tumor, which comprises a polynucleotide having a base sequence represented by SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 4, or SEQ ID NO: 5.
2. The pharmaceutical composition according to claim 1, wherein the polynucleotide further comprises one or more optional nucleotides at the 5 'end or the 3' end.
3. The pharmaceutical composition according to claim 1 or 2, wherein the polynucleotide has a base sequence represented by SEQ ID NO: 1 and two arbitrary nucleotides at the 3 'end.
4. The pharmaceutical composition according to any one of claims 1 to 3, comprising the polynucleotide as a double strand.
5. The pharmaceutical composition according to any one of claims 1 to 4, wherein the polynucleotide is at least one of a double stranded polynucleotide of the following (1) and a double stranded polynucleotide of the following (2):
   (1) Base sequence [AGCUUUUGGGAAUUCAGGUAk ₁ k ₂ ] [k ₁ and k ₂ are each independently an arbitrary nucleotide] single-stranded polynucleotide and base sequence “UACCUGAAUUhCCAAAGCUUU” [h is any nucleotide A substantially complementary double-stranded polynucleotide consisting of a single-stranded polynucleotide;
   (2) A substantially complementary double-stranded polynucleotide comprising a single-stranded polynucleotide of the nucleotide sequence "AGGAGGAAUUGGGUCUGGUCUU" and a single-stranded polynucleotide of the nucleotide sequence "ACUCACAGCCCCACAGGCUCAGAC".
6. The pharmaceutical composition according to any one of claims 1 to 5, wherein the polynucleotide comprises at least one type of modified nucleotide.
7. The pharmaceutical composition according to any one of claims 1 to 6, wherein one or two bases are substituted, deleted or added in the polynucleotide.
8. The pharmaceutical composition according to any one of claims 1 to 7, wherein the polynucleotide is encapsulated or bound to a pharmaceutically acceptable carrier.
9. The pharmaceutical composition according to any one of claims 1 to 8, wherein the tumor to be treated comprises tumor cells expressing BRD4.
10. The pharmaceutical composition according to any one of claims 1 to 9, wherein the tumor to be treated comprises a tumor cell expressing the gene product of the BRD4-NUT fusion gene.
11. The pharmaceutical composition according to any one of claims 1 to 10, wherein the tumor to be treated includes a tumor cell expressing at least one selected from the group consisting of CDK2, BRD3, EGFR, and CDK6. object.
12. Tumors to be treated include esophageal cancer, lung cancer, oral cancer, stomach cancer, colon cancer, uterine cancer, skin cancer, blood cancer, brain cancer, neuroblastoma, glioblastoma, breast cancer, pancreatic cancer The agent according to any one of claims 1 to 11, which is at least one member selected from the group consisting of ovarian cancer, prostate cancer, bladder cancer, esophagus cancer, liver cancer, renal cancer and NUT midline cancer. Pharmaceutical composition as described in a term.
13. The pharmaceutical composition according to any one of claims 1 to 12, wherein a tumor to be treated is a tumor capable of locally administering the pharmaceutical composition.
14. at least one member selected from the group consisting of BRD4, CDK2, BRD3, EGFR, and CDK6 comprising at least one member selected from the group consisting of hsa-miR-3140, hsa-miR-766, and derivatives thereof Pharmaceutical composition for treating a developing tumor.

Images