WO2019104346A1 - Synthetic apomixis in a crop plant - Google Patents

Synthetic apomixis in a crop plant Download PDF

Info

Publication number
WO2019104346A1
WO2019104346A1 PCT/US2018/062663 US2018062663W WO2019104346A1 WO 2019104346 A1 WO2019104346 A1 WO 2019104346A1 US 2018062663 W US2018062663 W US 2018062663W WO 2019104346 A1 WO2019104346 A1 WO 2019104346A1
Authority
WO
WIPO (PCT)
Prior art keywords
plant
bbm1
plants
expression
protein
Prior art date
Application number
PCT/US2018/062663
Other languages
French (fr)
Inventor
Imtiyaz KHANDAY
Venkatesan Sundaresan
Original Assignee
The Regents Of The University Of California
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from PCT/US2017/063249 external-priority patent/WO2018098420A1/en
Application filed by The Regents Of The University Of California filed Critical The Regents Of The University Of California
Publication of WO2019104346A1 publication Critical patent/WO2019104346A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H6/00—Angiosperms, i.e. flowering plants, characterised by their botanic taxonomy
    • A01H6/46—Gramineae or Poaceae, e.g. ryegrass, rice, wheat or maize
    • A01H6/4636—Oryza sp. [rice]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8287—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for fertility modification, e.g. apomixis

Definitions

  • apomixis The principal functional components of apomixis include (i) the formation of an unreduced female gamete that also retains the parental genotype (apomeiosis), (ii) embryo development without fertilization of the egg cell by sperm (parthenogenesis) and (iii) endosperm development with or without fertilization of the central cell (pseudogamous or autonomous apomixis, respectively).
  • a plant that produces clonal progeny comprises inhibited or mutated gene products that induce a mitosis instead of meiosis (MiME) phenotype and further expresses a BABYBOOM polypeptide in egg cells.
  • the plant is a cereal monocot plant. In some embodiments, the plant is a rice plant.
  • the inhibited or mutated gene products comprise (i) OSD1 or an ortholog thereof, (ii) ATREC8 or an ortholog thereof, and (iii) ATSPOl l or an ortholog thereof.
  • the inhibited or mutated gene products comprise (i) OSD1 or an ortholog thereof, (ii) REC8 or an ortholog thereof, and (iii) PAIR1 or an ortholog thereof.
  • Orthologous sequences can be for example, substantially identical.
  • At least one or all of the gene products is inhibited. In some embodiments, at least one or all of the gene products is mutated to be inactive.
  • the plant is haploid or diploid.
  • the BABYBOOM polypeptide is substantially identical or is at least 70% (e.g., 75, 80, 85, 90, 95, 98, or 99%) identical to any of SEQ ID NOs: 1-3, 5, 7,
  • the BABYBOOM polypeptide is at least 40% identical to SEQ ID NO: 11. In some embodiments,
  • the BABYBOOM polypeptide is at least 40% identical to SEQ ID NO: 11 over the length of the protein and comprises a middle region that has at least 90% identity to the middle domain of a rice BABYBOOM1 sequence, e.g., SEQ ID NO:2.
  • the method comprises allowing the plant as described above or elsewhere herein to self-fertilize; and collecting clonal progeny from the plant.
  • This can be achieved, for example, when the parent plant produces gametes (e.g., egg or pollen cells) having the same number of chromosomes as somatic cells in the plant.
  • gametes e.g., egg or pollen cells
  • the gametes are also diploid.
  • MiME meiosis
  • FIG. 1 - BBM1 induced somatic embryogenesis and gene expression, a
  • FIG. 2 Paternal expression and parthenogenesis, a, A SNP (red arrow head), showing expression only from the male allele in hybrid (J, Japonica and I, Indicd) 2.5 HAP zygotes b to d, Confirmation of paternal expression of BBM1 in isogenic zygotes.
  • FIG. 3 Mutant phenotypes of 3 BBM genes a to c, 5 DAP embryos d to f, 10
  • DAP embryos develop normally when BBM1 is wild-type (a and d) but show an early arrest (b and e) or undergo a number of divisions without organ formation (c and f) in bbml bbm2 bbm3 triple homozygous mutants g to i, 10 DAP embryos heterozygous for BBM1 but homozygous mutant for bbm2 and bbm3. They either show a normal development g, are delayed h, or show as early arrest i. Scale bars, 100 pm. sc, scutellum; co, coleoptile; ep, epiblast; ra, radicle; SAM, shoot apical meristem; lp, leaf primordia.
  • FIG. 4 Confirmation of haploids and synthetic apomicts.
  • a Difference in height between haploid and diploid siblings. Scale bar, 5 cm.
  • b Anthesis stage control wild- type panicle c, A haploid panicle showing no anthesis.
  • d A haploid apomictic panicle undergoing anthesis.
  • e Seed formation on a diploid apomictic progeny panicle. Scale bars b to e, 1 cm.
  • Flow cytometric DNA histograms for ploidy determination f, Haploid showing a ln peak g, Wild-type diploid with a 2n peak h, A mixed sample of haploid and diploid showing ln and 2n peaks, i, An apomictic haploid (ln).
  • j Apomictic diploid progeny from a diploid parent with a 2n peak
  • k Tetraploid progeny from a diploid apomictic mother (4n peak).
  • FIG. 5 Ectopic overexpression of BBM1.
  • a Schematic of binary construct between T-DNA borders used for ectopic expression (BBMl-ox).
  • BBMl-ox Schematic of binary construct between T-DNA borders used for ectopic expression
  • b Confirmation of BBM1 overexpression by RT-PCR in leaf tissues of transgenic lines. BBM1 does not expresses in wild-type leaves
  • c RT-PCR of embryo marker genes to confirm the embryo identity of BBM1 overexpression induced somatic embryos, d to o, phenotypes caused by
  • BBMloverexpression in vegetative and reproductive organs d, wild-type anther, e, wild-type pollen, f, BBl-ox anthers, g, Pollenless BBl-ox anthers, h, Wild-type leaf, i, BBl-ox leaf with serrations and long trichomes.
  • j Wild-type spikelet.
  • k BBl-ox spikelet with lemma converted to an awn. 1, Wild-type stamen, m, Transparent pollenless BBl-ox stamens, n, Wild-type carpel, o, BBl-ox carpel with fused styles.
  • FIG. 6 Dexamethasone inducible BBM1:GR expression system, a, Schematic of plasmid construct for BBM1-GR for plant transformations, b, Mock treated 2 week-old BBM1-GR seedling, c, DEX treated BBM1-GR seedling showing aerial roots (red arrow). The seedlings were transferred to mock and dex containing media, one week after germination. Scale bars, 2 cm. d, Mock treated BBM1-GR panicle, e, DEX treated BBM1- GR panicle showing awns on florets. Plants were treated with mock or DEX containing water from 45 days after germination till panicles completely emerged out. Scale bars, 2 cm.
  • FIG. 7 Male specific expression of BBM1.
  • a to d Four additional SNPs showing expression only from male allele in 2.5 HAP hybrid zygotes. Red arrow points to SNP.
  • e Schematic of BBM1-GFP binary construct, f to h, Immunohistochemistry showing expression from both male and female BBM1 alleles in isogenic 6.5 HAP zygote nuclei.
  • FIG. 8 Parthenogenesis induced by BBM1 egg cell expression, a, Schematic showing wild-type expression pattern of BBM1. b, Schematic of binary vector between T- DNA borders for BBM1 egg cell expression c, Schematic representation of hypothesis whether egg cell BBM1 expression induces parthenogenesis d, A developing early stage parthenogenetic embryo. Scale bar, 100 pm.
  • FIG. 9 Genome editing of BBM- like genes in rice a, Mutations in Fl progeny plant used for all the downstream analysis. It is heterozygous for BBM1 with 1 bp deletion. BBM2 is homozygous 25 bp deletion and 1 bp substitution. BBM3 is homozygous 1 bp insertion b, Genotyping of nongerminating seeds. The 1 bp deletion mutation in BBM1 results in disruption a Sphl restriction site d, Additional image of aBBMl heterozygous 10 DAP embryo showing no organ formation e, Representative image of developing naked Fl seeds.
  • FIG. 10 Graphic representation of BBM1 function.
  • BBM1 expression starts in sperm cells. During early zygotes development after fertilization, it expresses only from male allele which is essential for initiation of embryogenesis. Since BBM1 can auto activate its own expression, male expressed BBM1 probably activates expression form the female allele. The expression in the later stage embryos is essential for organ morphogenesis.
  • FIG. 11 Haploid phenotypes in rice, a, A control diploid sibling panicle showing fertile florets b, A haploid panicle with infertile florets c, Size difference in haploid and control diploid florets d and e, Difference in the size of floral organs between haploid and wild-type diploid f to i, Pollen viability in haploids.
  • f and g Wild-type anther showing viable pollen h and i, An anther showing nonviable pollen in haploid.
  • FIG. 12 - Synthetic apomixis in rice, a, Schematic of CRISPR-Cas9 plasmid construct used for genome editing 3 MiMe rice genes, b, Schematic of genome integrated pDD45::BBMl. c, Panicle of a control MiM plant. Scale bar, 2 cm. d, Panicle of an apomictic haploid plant showing fertile seeds. Scale bar, 2 cm. e, Control wild-type anther. Scale bar, 0.2 mm. f, Wild-type pollen. Scale bar, 100 pm. g, Anther from an apomictic haploid showing viable pollen. Scale bar, 0.2 mm.
  • FIG. 13 Sexual reproduction vs synthetic apomixis.
  • Synthetic apomixis uses MiMe to skip meiosis which results in an unrecombined and unreduced (2n) egg cell.
  • This (2n) egg cell is converted parthenogenetically into a clonal embryo by BBM1 expression. Normal endosperm forms in both pathways by fertilization of central cell by a sperm cell.
  • FIG. 14 Confirmation of synthetic apomixis clonal progeny, a, Sequence chromatograms of wild-type sequences at mutation sites b, Mutant sequences in TO diploid apomixis mother plant c, Sequences of a representative Tl apomixis progeny. Sequences are shown for 3 MiMe genes, of which PAIR1 and RIB 'S are biallelic. Tl diploid progeny and TO mother plants have same mutations, indicating absence of segregation and thus clonal propagation.
  • MiMe leads to diploid gamete formation that are clones of mother plant. Parthenogenesis of diploid egg cell produces clonal progeny and fertilization of diploid gametes leads to 4n sexual progeny e, Flow cytometric DNA histograms for ploidy determination of S-Apo plants.
  • X-axis is the measure of relative florescence and Y-axis shows number of nuclei f, Chromosomal view showing 57 heterozygous SNPs (position in Mb) identified in the TO S-Apo mother plant of Line# 1.
  • the SNPs labelled in red are those additionally confirmed by PCR.
  • FIG. 18 - #BM/-induced somatic embryogenesis and auto-activation.
  • l8a Schematic of binary construct between T-DNA borders used for ectopic expression ( BBM1 - ox).
  • l8c Confirmation of ectopic BBM1 overexpression by RT-PCR in leaf tissues of transgenic lines.
  • l8d RT-PCR of embryo marker genes to confirm the embryo identity of BBM1 overexpression induced somatic embryos. OsH /. Oryza sativa HOMEOBOX1 md LEd, LEAFY
  • COTYLEDON 7(n 2 independent biological replicates).
  • l8e Schematic of plasmid construct for Dexamethasone (DEX) inducible BBM1-GR expression system.
  • l8f Schematic showing primer combinations to distinguish between endogenous BBM1 and BBM1-GR fusion transcripts.
  • FIG. 19 BBM1 expression in zygotes and gametes.
  • l9b Schematic of BBM1-GFP binary construct.
  • DIC image left panel
  • fluorescent image right panel
  • FIG. 20 Parthenogenesis induction by expression of BBM1 in the egg cell.
  • 20a Schematic showing wild-type expression pattern of BBM1.
  • 20b Sketch of T-DNA region of binary vector used for BBM1 egg cell expression.
  • 20c Schematic representation of hypothesis that egg cell expression of BBM1 can induce parthenogenesis.
  • 20d A
  • FIG. 21 CRISPR-Cas9 edited mutations in BBM1-3 genes in rice. 2la, DNA sequences of mutations in bbml/bbml bbm3/bbm3 plants.
  • 2lb DNA sequences of mutations in bbm2/bbm2 bbm3Zbbm3 plants, a and b, were chosen as parents for crosses to generate the bbml bbm2 bbm3 triple homozygous mutants shown in c and d.
  • 2lc Mutations in Fl progeny plant. It is heterozygous for BBM1 and BBM2, and biallelic for BBM3.
  • 2ld Mutations in F2 progeny plant used for genetic analysis. The plant is heterozygous for BBM1 with a 1 bp deletion.
  • the BBM2 locus has a homozygous 25 bp deletion and 1 bp
  • BBM3 locus is homozygous mutant with 1 bp insertion.
  • the 1 bp deletion mutation in BBM1 results in disruption of an Sphl restriction site.
  • 2lf Seed lethality in bbml bbm2 bbm3 triple homozygous plants.
  • Lower right panel is a zoomed in image of a
  • the 2n egg cell is converted parthenogenetically into a clonal embryo by BBMI-ee.
  • the endosperm forms in both pathways by fertilization of central cell (homodiploid in wild-type and tetraploid in synthetic apomicts) by a sperm cell (haploid in wild-type and diploid in synthetic apomicts).
  • the maternal: paternal genome ratio of 2: 1 is maintained in the endosperm in both the pathways, ensuring normal seed development.
  • FIG. 23 Asexual propagation through seed in rice. 23a, Schematic of CRISPR-
  • Cas9 plasmid construct used for genome editing of the three MiMe rice genes (upper panel). Schematic of genome integrated pDD45: :BBMl in the BBMI-QQ plants (lower panel).
  • 23c Panicle of a control TO diploid MiMe plant with fertile seeds (left). A tetraploid Tl MiMe panicle (middle), exhibiting complete infertility, i.e., no seed filling, and larger flowers (note scale bars), with awns (white arrow head).
  • FIG. 24 MiMe mutations and confirmation of clonal progeny from S-Apo plants.
  • PAIR1 md REC8 are biallelic while as OSD 1 is homozygous.
  • Table 1 Expression of four BBM genes in rice gametes and zygotes.
  • PPM/, BBM2 and BBM4 express in sperm cells. None of the 4 BBM genes express in egg cells. All except BBM4 , express in zygotes. The expression is presented as total read counts.
  • EC egg cell; Sp, sperm; Z, zygote.
  • Roman numerals represent biological replicates and 2.5, 5 and 9 is time in hours after pollination (HAP).
  • Table 2 Summary of seed sterility in bbml/BBMl heterozygous, bbm2/bbni2, bbm3/bbm3 homozygous mutant plants.
  • the Chi-square goodness of fit test value between expected and observed values is 68.623 and the P-value is ⁇ 0.001.
  • Tables 3A and 3B - Crosses to show paternal allele specific expression of BBM1 is required for embryo development in rice.
  • LOC_OsOlgl67l4 and LOC_Os07g25540 are statistically insignificant either in one or both the treatemnts. However, they are upregulated by BBM1 in both the treatments.
  • Table 5 Functional characterization of BBM genes in rice, a, Expression of four PPM-like genes in rice gametes and zygotes from previous studies 11 ⁇ 15 presented as reads per million averaged from three replicates.
  • Z2.5, Z5 and Z9 columns are from isogenic japonica zygotes at 2.5, 5 and 9 hours after pollination (HAP) respectively.
  • Jxl and IxJ columns are hybrid zygotes from crosses, the female parent is listed first.
  • EC egg cell
  • SpC sperm cell
  • Z zygote
  • b Summary of seed viability in progeny of BBM1/ bbml bbm2/bbm2 bbm3/bbm3 mutant plants.
  • Table 6 Haploid induction and clonal propagation in rice, a, Haploid induction in BBMI-QQ (pDD45::BBMl) transgenic plants.
  • the TO primary transformants were hemizygous for the BBMI-QQ transgene.
  • One diploid Tl plant #8c from transformant #8, was maintained as a haploid inducer line up to the T7 generation, b, Identification of synthetic haploid and diploid apomictic progeny from S-Apo ( MiMe + BBMI-QQ) plants of transformant lines #1 and #5.
  • DH#2 refers to a doubled haploid derived from self-pollination of Tl plants of the haploid apomixis line#2.
  • Table 7 Heterozygous SNPs identified in MT0, and their corresponding allele fraction in WT and progeny samples.
  • Quality by depth (QD) and Strand Odds Ratio (SOR) are quality measures used for ensuring a high-confidence set of SNPs.
  • the alternate allele fraction (AF), read depth (DP) and overall genotype quality score from GATK are reported.
  • no quality score is reported as these were not called as heterozygous.
  • An "endogenous” or “native” gene or protein sequence refers to a gene or protein sequence that is naturally occurring in the genome of the organism.
  • a polynucleotide or polypeptide sequence is "heterologous" to an organism or a second polynucleotide sequence if it originates from a foreign species, or, if from the same species, is modified from its original form.
  • a promoter when a promoter is said to be operably linked to a heterologous coding sequence, it means that the coding sequence is derived from one species whereas the promoter sequence is derived from another, different species; or, if both are derived from the same species, the coding sequence is not naturally associated with the promoter (e.g., is a genetically engineered coding sequence, e.g., from a different gene in the same species, or an allele from a different ecotype or variety).
  • promoter refers to a polynucleotide sequence capable of driving transcription of a coding sequence in a cell.
  • promoters can include c/.v-acting transcriptional control elements and regulatory sequences that are involved in regulating or modulating the timing and/or rate of transcription of a gene.
  • a promoter can be a c/.v-acting transcriptional control element, including an enhancer, a promoter, a transcription terminator, an origin of replication, a chromosomal integration sequence, 5' and 3' untranslated regions, or an intronic sequence, which are involved in transcriptional regulation.
  • a "plant promoter” is a promoter capable of initiating transcription in plant cells.
  • a “constitutive promoter” is one that is capable of initiating transcription in nearly all tissue types, whereas a “tissue-specific promoter” initiates transcription only in one or a few particular tissue types.
  • operably linked refers to a functional linkage between a nucleic acid expression control sequence (such as a promoter, or array of transcription factor binding sites) and a second nucleic acid sequence, wherein the expression control sequence directs transcription of the nucleic acid corresponding to the second sequence.
  • a nucleic acid expression control sequence such as a promoter, or array of transcription factor binding sites
  • plant includes whole plants, shoot vegetative organs and/or structures (e.g., leaves, stems and tubers), roots, flowers and floral organs (e.g., bracts, sepals, petals, stamens, carpels, anthers), ovules (including egg and central cells), seed (including zygote, embryo, endosperm, and seed coat), fruit (e.g., the mature ovary), seedlings, plant tissue (e.g., vascular tissue, ground tissue, and the like), cells (e.g., guard cells, egg cells, trichomes and the like), and progeny of same.
  • shoot vegetative organs and/or structures e.g., leaves, stems and tubers
  • roots e.g., bracts, sepals, petals, stamens, carpels, anthers
  • ovules including egg and central cells
  • seed including zygote, embryo, endosperm, and seed coat
  • fruit e.g., the mature
  • the class of plants that can be used in the method of the invention is generally as broad as the class of higher and lower plants amenable to transformation techniques, including angiosperms (monocotyledonous and dicotyledonous plants), gymnosperms, ferns, and multicellular algae. It includes plants of a variety of ploidy levels, including aneuploid, polyploid, diploid, haploid, and hemizygous.
  • a "transgene” is used as the term is understood in the art and refers to a
  • a transgenic plant is a plant that carries a transgene, i.e., is a genetically-modified plant.
  • the transgenic plant can be the initial plant into which the transgene was introduced as well as progeny thereof whose genomes contain the transgene.
  • a transgenic plant is transgenic with respect to the BABYBOOM gene.
  • a transgenic plant is transgenic with respect to one or more genes other than the BABYBOOM gene.
  • nucleic acid or “polynucleotide sequence” refers to a single or double- stranded polymer of deoxyribonucleotide or ribonucleotide bases read from the 5' to the 3' end. Nucleic acids may also include modified nucleotides that permit correct read through by a polymerase, and/or formation of double-stranded duplexes, and do not significantly alter expression of a polypeptide encoded by that nucleic acid.
  • nucleic acid sequence encoding refers to a nucleic acid which directs the expression of a specific protein or peptide.
  • the nucleic acid sequences include both the DNA strand sequence that is transcribed into RNA and the RNA sequence that is translated into protein.
  • the nucleic acid sequences include both the full length nucleic acid sequences as well as non-full length sequences derived from the full length sequences. It should be further understood that the sequence includes the degenerate codons of the native sequence or sequences which may be introduced to provide codon preference in a specific host cell.
  • nucleic acid sequences or polypeptide sequences refer to two or more sequences or subsequences that are the same or have a specified percentage of nucleotides or amino acid residues that are the same, when compared and aligned for maximum correspondence over a comparison window, as measured using one of the following sequence comparison algorithms or by manual alignment and visual inspection.
  • Two nucleic acid sequences or polypeptides are said to be “identical” if the sequence of nucleotides or amino acid residues, respectively, in the two sequences is the same when aligned for maximum correspondence as described below.
  • sequence identity When percentage of sequence identity is used in reference to proteins or peptides, it is recognized that residue positions that are not identical often differ by conservative amino acid substitutions, where amino acids residues are substituted for other amino acid residues with similar chemical properties (e.g., charge or hydrophobicity) and therefore do not change the functional properties of the molecule. Where sequences differ in conservative substitutions, the percent sequence identity may be adjusted upwards to correct for the conservative nature of the substitution. Means for making this adjustment are well known to those of skill in the art. Typically this involves scoring a conservative substitution as a partial rather than a full mismatch, thereby increasing the percentage sequence identity.
  • a conservative substitution is given a score between zero and 1.
  • the scoring of conservative substitutions is calculated according to, e.g., the algorithm of Meyers & Miller, Computer Applic. Biol. Sci. 4: 11-17 (1988) e.g., as implemented in the program PC/GENE (Intelligenetics, Mountain View, California, USA).
  • substantially identical used in the context of two nucleic acids or polypeptides, refers to a sequence that has at least 50% sequence identity with a reference sequence (e.g., any of SEQ ID NOs: 1, 2, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, or 41 as provided herein or any of the sequences referenced herein for any of OSD1, Cyclin-A CYCAl;2 (TAM), SPOl l-l, SPOl-2, PRD1, PRD2, PAIR1, DYAD, or REC8 proteins).
  • percent identity can be any integer from 50% to 100%.
  • Some embodiments include at least: 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, compared to a reference sequence using the programs described herein; preferably BLAST using standard parameters, as described below.
  • sequence comparison typically one sequence acts as a reference sequence, to which test sequences are compared.
  • test and reference sequences are entered into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. Default program parameters can be used, or alternative parameters can be designated.
  • sequence comparison algorithm then calculates the percent sequence identities for the test sequences relative to the reference sequence, based on the program parameters.
  • a “comparison window”, as used herein, includes reference to a segment of any one of the number of contiguous positions selected from the group consisting of from 20 to 600, usually about 50 to about 200, more usually about 100 to about 150 in which a sequence may be compared to a reference sequence of the same number of contiguous positions after the two sequences are optimally aligned.
  • Methods of alignment of sequences for comparison are well-known in the art.
  • Optimal alignment of sequences for comparison can be conducted, e.g., by the local homology algorithm of Smith & Waterman, A civ. Appl. Math. 2:482 (1981), by the homology alignment algorithm of Needleman & Wunsch, J. Mol. Biol.
  • Algorithms that are suitable for determining percent sequence identity and sequence similarity are the BLAST and BLAST 2.0 algorithms, which are described in Altschul el al. (1990) J. Mol. Biol. 215: 403-410 and Altschul et al. (1977) Nucleic Acids Res. 25: 3389- 3402, respectively.
  • Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information (NCBI) web site.
  • NCBI National Center for Biotechnology Information
  • the algorithm involves first identifying high scoring sequence pairs (HSPs) by identifying short words of length W in the query sequence, which either match or satisfy some positive-valued threshold score T when aligned with a word of the same length in a database sequence.
  • HSPs high scoring sequence pairs
  • T is referred to as the neighborhood word score threshold (Altschul et al, supra).
  • These initial neighborhood word hits acts as seeds for initiating searches to find longer HSPs containing them.
  • the word hits are then extended in both directions along each sequence for as far as the cumulative alignment score can be increased.
  • Cumulative scores are calculated using, for nucleotide sequences, the parameters M (reward score for a pair of matching residues; always >0) and N (penalty score for mismatching residues; always ⁇ 0). For amino acid sequences, a scoring matrix is used to calculate the cumulative score.
  • Extension of the word hits in each direction is halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative-scoring residue alignments; or the end of either sequence is reached.
  • the BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment.
  • the BLASTP program uses as defaults a word size (W) of 3, an expectation (E) of 10, and the BLOSUM62 scoring matrix (see Henikoff & Henikoff, Proc. Natl. Acad. Sci. USA 89: 10915 (1989)).
  • the BLAST algorithm also performs a statistical analysis of the similarity between two sequences (see, e.g., Karlin & Altschul, Proc. Nat'l. Acad. Sci. USA 90:5873-5787 (1993)).
  • One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance.
  • P(N) the smallest sum probability
  • a nucleic acid is considered similar to a reference sequence if the smallest sum probability in a comparison of the test nucleic acid to the reference nucleic acid is less than about 0.01, more preferably less than about 10 '5 , and most preferably less than about 10 '20 .
  • An "expression cassette” refers to a nucleic acid construct that, when introduced into a host cell, results in transcription and/or translation of an RNA or polypeptide, respectively.
  • the inventors have discovered how to generate clonal progeny from a plant by inducing the mitosis instead of meiosis (MiME) phenotype in a plant while also expressing a BABYBOOM gene product in the eggs of the plant.
  • the resulting plant when self-fertilized, will produce clonal progeny, i.e., progeny that are identical to the parent plant.
  • a plant having the MiMe (mitosis instead of meiosis) genotype is a plant in which a deregulation of meiosis results in a mitotic-like division and in which meiosis is replaced by mitosis.
  • MiMe plants are exemplified by MiMe- 1 plants as described by d'Erfurth, I. et al. Turning meiosis into mitosis.
  • the MiMe phenotype is induced by inhibiting or mutating OSD1 or an ortholog thereof, REC8 or an ortholog thereof, and at least one of SPOl 1 or PRD1, or PRD2 (see, e.g., Mieulet D., Cell Res. 2016 Nov; 26(11): 1242-1254).
  • MiMe genotype produces functional (e.g., diploid) gametes that are genetically identical to their parent.
  • exemplary MiMe plants combine phenotypes of (1) no second meiotic division, (2) no recombination and (3) modified chromatid segregation.
  • Exemplary MiMe-l plants combine inactivation of the OSD1 gene, with the inactivation of two or more other genes, one which encodes a protein necessary for efficient meiotic recombination in plants (e.g., SPOl 1-1, SPOl 1-2, PRD1, PRD2, or PAIR1), and whose inhibition eliminates recombination and pairing [Grelon M, Vezon D, Gendrot G, & Pelletier G. AtSPOl 1-1 is necessary for efficient meiotic recombination in plants.
  • MiMe-l plants are distinguished from MiMe-2 in that MiMe-l plants are generally more efficient for production of 2N female gametes.
  • NM _ 115648 This gene encodes a protein of 243 amino acids (GenBank NP _ 191345), whose sequence is also represented in the enclosed sequence listing as SEQ ID No. 1, Table 1 of US Patent Publication No. 2014/0298507.
  • the OSD1 gene of Arabidopsis thaliana had previously been designated “UVI4-Like” gene (UVI4-L), which describes its paralogue UVI4 as a suppressor of endo-reduplication and necessary for maintaining the mitotic state (Hase et al. Plant J, 46, 317-26, 2006).
  • OSD1 (UVI4-L) does not appear to be required for this process, but is necessary for allowing the transition from meiosis I to meiosis II.
  • An ortholog of the OSD1 gene of Arabidopsis thaliana has been identified in rice (Oryza sativa). The sequence of this gene is available as accession number Os02g37850 in the TAIR database and the gene encodes a protein of 234 amino acid (sequence provided as SEQ ID No. 2, Table 2 of US Patent Publication No. 2014/0298507).
  • Arabidopsis thaliana and Oryza sativa have 23.6% sequence identity and 35% sequence similarity over the whole length of their sequences.
  • a plant producing Second Division Restitution 2N gametes can, for example, be obtained by inhibition in the plant of an OSD1 protein.
  • Table 13 (SEQ ID Nos. 24-46 of US Patent Publication No. 2014/0298507) provides additional exemplary OSD1/UV14 protein sequences.
  • FIG. 3 of US Patent Publication No. 2014/0298507 includes a list of the OSD1/UV14 protein sequences of Tables 1, 2 and 13 in US Patent Publication No. 2014/0298507 and an NJ (Neighbor-joining) tree of these sequences.
  • Inactivation of the TAM gene in plants can result in skipping of the second meiotic division giving a phenotype similar to that of osdl mutants leading to the production of dyads of spores and diploid gametes that have undergone recombination. More specifically, Arabidopsis mutants including tam-2, tam-3, tam-4, tam-5, tam-6 and tam-7 as described in d'Erfurth, I. et al. (2010) express the dyad phenotype at normal growing temperatures and systematically produce mostly dyads. Plant mutants exhibiting inactivation of the TAM gene as in such mutants are useful in preparation of MiMe-2 plants.
  • Arabidopsis mutants such as tam-l [Magnard, J.-L., Yang, M., Chen, Y.-C. S., Leary, M. & McCormick, S.
  • the Arabidopsis gene Tardy Asynchronous Meiosis is required for the normal pace and synchrony of cell division during male meiosis Plant Physiol. 127: 1157-1166 (2001)] which exhibit a delay in the progression of meiosis and progress beyond the dyad stage are not useful in preparation of MiMe-2 plants.
  • the TAM gene encodes a protein exhibiting cyclin- dependent protein kinase activity.
  • TAM gene of Arabidopsis thaliana is available in the TAIR database under the accession number Atl G77390 (Table 9, SEQ ID No. 9 of US Patent Publication No. 2014/0298507).
  • This gene encodes a protein of 442 amino acids (GenBank NP 177863).
  • Cycbn-dependent kinases are reported to be highly conserved among plants and a CycAl;2 gene has been identified in rice (La, H., Li, J., Ji, Z., Cheng, Y., Li, X., Jiang, S., Venkatesh, P. N. & Ramachandran, S. Genome-wide analysis of cyclin family in rice (Oryza Sativa L.) Mol.
  • a Cyclin- Al-2 protein of rice (Accession Q0JPA4-1 in UniProtKB/Swiss-Prot. Database) is identified as having 477 amino acid (Table 10, SEQ ID No. 10 of US Patent Publication No.
  • a plant producing Second Division Restitution 2N gametes can, for example, be obtained by inhibition in the plant of an TAM (CycAl;2) protein.
  • Table 12 of US Patent Publication No. 2014/0298507 provides the protein sequence of CYCA1; 2 of A. lyrata (SEQ ID No. 23 of US Patent Publication No. 2014/0298507).
  • DYAD is a gene in Arabidopsis that is required for meiotic chromosome
  • DYAD DYAD cDNA coding sequence and the sequence of the protein encoded by the nucleic acid are provided as SEQ ID NOS: 70 and 71, respectively.
  • chromosomes During mitosis in diploid cells, chromosomes replicate and sister chromatids segregate to generate daughter cells that are diploid and genetically identical to the initial cell. During normal meiosis, two rounds of chromosome segregation follow a single round of replication. At division one, homologous chromosomes recombine and are separated. Meiosis II is more similar to mitosis resulting in equal distribution of sister chromatids. The spores obtained are thus haploid and carry recombined genetic information. In a mutant lacking OSD1 activity, meiosis II is skipped giving rise to diploid spores and SDR gametes with recombined genetic information.
  • a mutant lacking SPOl 1-1 undergoes an unbalanced first division followed by a second division leading to unbalanced spores and sterility.
  • a double mutant lacking both SPOl 1-1 and REC8 undergoes a mitotic-like division instead of a normal first meiotic division, followed by an unbalanced second division leading to unbalanced spores and sterility.
  • Arabidopsis MiMe-2 mutants are described in d'Erfurth, I. et al. (2010)
  • SPOl 1-1 and SPOl 1-2 proteins are related orthologs, both of which are required for meiotic recombination.
  • Arabidopsis SPOl 1-2 functions with SPOl 1-1 in meiotic recombination. The Plant Journal, 48, 206-216 (2006); Hartung F, Wurz-Wildersinn R, Fuchs J, Schubert I, Suer S, & Puchta H.
  • SPOl 1-1 and SPOl 1-2 are required for meiotic double-strand break induction in Arabidopsis.
  • Inhibition of one or both of SPOl 1-1 or SPOl 1-2 is useful in a MiMe plant.
  • SPOl 1-1 and SPOl 1-2 proteins are provided in Table 3 of US Patent Publication No. 2014/0298507 (SEQ ID No. 3 of US Patent Publication No. 2014/0298507) and Table 4 of US Patent Publication No. 2014/0298507 (SEQ ID NO. 4 of US Patent Publication No. 2014/0298507).
  • PRD1 protein is required for meiotic double stand break (DSB) formation and is exemplified by AtPRDl, a protein of 1330 amino acids (Table 5, SEQ ID No. 5 of US Patent Publication No. 2014/0298507) exhibiting significant sequence similarity with OsPRDl (NCB1 Accession number CAE02100) SEQ ID No. 47 of US Patent Publication No.
  • PRD1 homologs have also been identified in Physcomitrella patens (PpPRDl) from ASYA48856l.bl; Medicago truncatula (MtPRDl) from sequences AC147484 (start 9345l-end 101276) and Populus trichocarpa (PtPRDl) from LG_II: 20125180-20129370 (http://genome.jgi- psf.org/Poptrl _ l/Poptrl _ l.home.html), see De Muyt et al. 2007, FIG. 1 therein for a sequence comparison.
  • PRD2 protein is a DSB-forming protein exemplified by AtPRD2, a protein of 378 amino acids (Table 6, SEQ ID No: 6) amino acids (identified as a protein of 385 amino acids in De Muyt et al. (2009) see Sequence Accession NP 568869 (Table 11, SEQ ID No. 18 of US Patent Publication No. 2014/0298507), with homologues identified in the monocot Oryza sativa, Populous trichocarpa, Vitis vinifera and Physcomitrella patens [De Muyt A, Pereira L, & Vezon D, et al. A high throughput genetic screen identifies new early meiotic
  • PAIR1 (also called PRD3) is a DSB-forming protein exemplified by AtPAIRl, a protein a 449 amino acid protein (Table 7, SEQ ID No. 7 of US Patent Publication No.
  • REC8 protein is a subunit of the cohesion complex. In plants, exemplified by Arabidopsis, REC8 protein (Table 8, SEQ ID No. 8 of US Patent Publication No.
  • plants producing MiMe phenotype are produced by inhibition in the plant of the following proteins (a) a TAM (Cylin A CYCAl;2) or DYAD protein (as described herein); (b) a protein involved in initiation of meiotic recombination in plants exemplified herein as SPOl l-l; SPOl l-2; PRD; PRD2; or PAIR1 (also called PRD3); and (c) a protein necessary for the monopolar orientation of the kinetochores during meiosis exemplified herein as REC8 protein.
  • plants producing MiMe phenotype are produced by inhibition in the plant of the following proteins (a) an OSD 1 protein (as described herein);
  • the OSD1 protein is exemplified by the AtOSDl protein (SEQ ID No. 1 of US Patent Publication No. 2014/0298507) or the Os OSD1 protein (SEQ ID No. 2 of US Patent Publication No. 2014/0298507) and includes OSD1 protein wherein said protein has at least 20%, and by order of increasing preference, at least 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 98% sequence identity, or at least 29%, and by order of increasing preference, at least 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 98% sequence similarity with the AtOSDl protein of SEQ ID No. 1 of US Patent Publication No.
  • the OSD1 protein that is inhibited is at least 50%, or at least 55%, identical to SEQ ID NO:43.
  • the OSD1 protein is at least 60%, or in some embodiments, at least 65, 70, 75, 80, 85, 90, 95, or 99%, identical to SEQ ID NO:43.
  • the OSD1 protein that is inhibited is at least 50%, or at least 55%, identical to SEQ ID NO:45.
  • the OSD1 protein is at least 60%, or in some embodiments, at least 65, 70, 75, 80, 85, 90, 95, or 99%, identical to SEQ ID NO:45.
  • the Cycbn-A CYCAl;2 (TAM) protein is exemplified by the CYCA1; 2 protein of Arabidopsis (SEQ ID No. 9 of US Patent Publication No. 2014/0298507) or the CYCA1; 2 protein of rice (SEQ ID No. 10 of US Patent Publication No. 2014/0298507) protein wherein said protein has at least 20%, and by order of increasing preference, at least 25, 30, 35, 40,
  • the TAM1 protein is at least 40%, or at least 45, 50, or 55%, identical to SEQ ID NO:55. In some embodiments, the TAM1 protein is at least 60%, or at least 65, 70, 75, 80, 85, 90, 95, or 99%, identical to SEQ ID NO:55.
  • Illustrative rice Cycbn-Al protein sequences are provided as SEQ ID NOS:57, 59, 61, 63, and 65. In some embodiments, the Cycbn-Al protein is at least 40%, or at least 45, 50, or 55%, identical to any one of SEQ ID NOS:57, 59, 61, 63, or 65.
  • the Cycbn-Al protein is at least 60%, or at least 65, 70, 75, 80, 85, 90, 95, or 99%, identical to any one of SEQ ID NOS:57, 59, 61, 63, or 65.
  • Illustrative Cycbn-A3 protein sequences are provided as SEQ ID NOS:67 and 69.
  • the Cycbn-A3 protein is at least 40%, or at least 45, 50, or 55%, identical to SEQ ID NO:67 or SEQ ID NO:69.
  • the Cyclin-A3 protein is at least 60%, or at least 65, 70, 75, 80, 85, 90, 95, or 99%, identical to SEQ ID NO:67 or SEQ ID NO:69.
  • DYAD protein sequence is provided as SEQ ID NO:7l.
  • Illustrative rice DYAD homolog (SWITCH1) protein sequences are provide as SEQ ID NOS:73, 75, and 77.
  • the protein has at least 20%, and by order of increasing preference, at least 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 98% sequence identity, or at least 29%, and by order of increasing preference, at least 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 98% sequence similarity any one of SEQ ID NOS:7l, 73, 75, or 77.
  • the DYAD protein is at least 40%, or at least 45, 50, or 55%, identical to SEQ ID NO:7l.
  • the DYAD protein is at least 60%, or at least 65, 70, 75, 80, 85, 90, 95, or 99%, identical to SEQ ID NO:7l. In some embodiments, the DYAD protein is at least 40%, or at least 45, 50, or 55%, identical to any one of SEQ ID NOS:73, 75, or 77. In some embodiments, the DYAD protein is at least 60%, or at least 65, 70, 75, 80, 85, 90, 95, or 99%, identical to any one of SEQ ID NOS:73, 75, or 77.
  • the protein involved in initiation of meiotic recombination in plants is exemplified by an SPOl l-l or SPOl l-2 protein and particularly the AtSPOl l-l protein (SEQ ID No. 3 of US Patent Publication No. 2014/0298507), the AtSPOl 1-2 protein (SEQ ID No. 4 of US Patent Publication No. 2014/0298507) and includes SPOl 1-1 and SPOl 1-2 proteins having at least 40%, and by order of increasing preference, at least 45, 50, 55, 60, 65, 70, 75, 80, 85,
  • SPOl l-2 protein sequence is provided as SEQ ID NO:49.
  • the SPOl l-2 protein is at least 40%, or at least 45, 50, or 55%, identical to SEQ ID NO:49.
  • the SPOl l-2 protein is at least 60%, or at least 65, 70, 75, 80, 85, 90, 95, or 99%, identical to SEQ ID NO:49.
  • the protein involved in initiation of meiotic recombination in plants is also exemplified by a PRD1 or PRD2 protein and particularly the AtPRDl protein (SEQ ID No. 5 of US Patent Publication No. 2014/0298507), and the AtPRD2 protein (SEQ ID No. 6 of US Patent Publication No.
  • 2014/0298507 and includes PRD1 or PRD2 proteins having at least 25%, and by order of increasing preference, at least 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 98% sequence identity, or at least 35%, and by order of increasing preference, at least, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 98% sequence similarity with the PRD1 protein of SEQ ID No. 5 of US Patent Publication No. 2014/0298507) or PRD2 protein of SEQ ID NO. 6 of US Patent Publication No. 2014/0298507).
  • PAIR1 protein also known as a PRD3 protein
  • PRD3 protein The protein involved in initiation of meiotic recombination in plants is also exemplified by a PAIR1 protein (also known as a PRD3 protein) and particularly the
  • AtPAIRl protein (SEQ ID No. 7 of US Patent Publication No. 2014/0298507), and includes PAIR1 proteins having at least 30%, and by order of increasing preference, at least 35, 40,
  • the PAIR1 protein is at least 40%, or at least 45, 50, or 55%, identical to SEQ ID NO:47. In some embodiments, the PAIR protein is at least 60%, or at least 65, 70, 75, 80, 85, 90, 95, or 99%, identical to SEQ ID NO:47.
  • REC8 protein also designated DIF1/SYN1
  • REC8 protein includes AtREC8 protein (SEQ ID No. 8 of US Patent Publication No.
  • 2014/0298507 and includes REC8 protein having at least 40%, and by order of increasing preference, at least 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 98% sequence identity, or at least 45%, and by order of increasing preference at least, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 98% sequence similarity with the REC8 protein of SEQ ID No. 8 of US Patent Publication No. 2014/0298507.
  • Illustrative rice and Arabidopsis REC8 protein sequences are provided as as SEQ ID NOS:5l and 53, respectively.
  • the RECE8 protein is at least 50%, or at least 55, 60, or 65%, identical to SEQ ID NO:5l.
  • the REC8 protein is at least 70%, or at least 75, 80, 85, 90, 95, or 99%, identical to SEQ ID NO:5l. In some embodiments, the RECE8 protein is at least 50%, or at least 55, 60, or 65%, identical to SEQ ID NO:53. In some embodiments, the REC8 protein is at least 70%, or at least 75, 80, 85, 90, 95, or 99%, identical to SEQ ID NO:53.
  • SPOl l-l, SPOl l-2, PRD1, PRD2, PAIR1, and REC8 proteins are conserved in higher plants, monocotyledons as well as dicotyledons.
  • orthologs of SPOl l-l, SPOl l-2, PRD1, PRD2, PAIR1 and REC8 proteins of Arabidopsis thaliana in monocotyledonous plants one can cite the Oryza sativa SPOl l-l, SPOl l-2, PRD1, PRD2, PAIR1, and REC8 proteins.
  • the sequence of the Oryza sativa SPOl 1-1 protein is available in GenBank under the accession number AAP68363 see Table 15 SEQ ID No. 48 of US Patent Publication No. 2014/0298507; the sequence of the Oryza sativa SPOl 1-2 protein is available in GenBank under the accession number NP _ 001061027 see Table 15
  • SEQ ID No. 49 of US Patent Publication No. 2014/0298507 the sequence of the Oryza sativa PRD1 protein is provided as SEQ ID No. 47 of US Patent Publication No. 2014/0298507 (Table 14 of US Patent Publication No. 2014/0298507); the sequence of the Oryza sativa PRD2 protein is provided (SEQ ID No. 21 of US Patent Publication No. 2014/0298507); the sequence of the Oryza sativa PAIR1 protein is available in SwissProt under the accession number Q75RY2, see Table 15 SEQ ID No. 50 of US Patent Publication No.
  • the inhibition of the above mentioned OSD1, Cyclin-A CYCAl;2 (TAM), SPOl l- 1, SPOl 1-2, PRD1, PRD2, PAIR1, DYAD, or REC8 proteins can be obtained either by abolishing, blocking, or decreasing their function, or advantageously, by preventing or downregulating the expression of the corresponding genes.
  • inhibition of said protein can be obtained by mutagenesis of the corresponding gene or of its promoter, and selection of the mutants having partially or totally lost the activity of said protein.
  • a mutation within the coding sequence can induce, depending on the nature of the mutation, the expression of an inactive protein, or of a protein with impaired activity; in the same way, a mutation within the promoter sequence can induce a lack of expression of said protein, or decrease thereof.
  • Mutagenesis can be performed for instance by targeted deletion of the coding sequence or of the promoter of the gene encoding said protein or of a portion thereof, or by targeted insertion of an exogenous sequence within said coding sequence or said promoter. It can also be performed by inducing random mutations, for instance through EMS mutagenesis or random insertional mutagenesis, followed by screening of the mutants within the desired gene. Methods for high throughput mutagenesis and screening are available in the art. By way of example, one can mention TILLING (Targeting Induced Local Lesions In Genomes) described by McCallum C. M., Comai, L., Greene, E. A., & Henikoff, S.
  • TILLING Targeting Induced Local Lesions In Genomes
  • mutants having a mutation within the REC8 gene those useful for obtaining a plant producing apomeiotic gametes can be identified on the basis of the phenotypic characteristics of the plants which are homozygous for this mutation, in particular chromosome fragmentation at meiosis, and sterility of the plant.
  • the inhibition of the target protein is obtained by silencing of the corresponding gene.
  • silencing of the corresponding gene See, for example, the review Baulcombe, D. RNA silencing in plants Nature 431 :356-363 (2004)].
  • Methods for gene silencing in plants are known in the art. For instance, antisense inhibition or co-suppression, as described by way of example in U.S. Pat. Nos. 5,190,065 and 5,283,323 can be used. It is also possible to use ribozymes targeting the mRNA of said protein. Preferred methods are those wherein gene silencing is induced by means of RNA interference (RNAi), using a silencing RNA targeting the gene to be silenced.
  • RNAi RNA interference
  • a "silencing RNA” is herein defined as a small RNA that can silence a target gene in a sequence-specific manner by base pairing to complementary mRNA molecules.
  • Silencing RNAs include in particular small interfering RNAs (siRNAs) and microRNAs (miRNAs).
  • DNA constructs for delivering a silencing RNA in a plant included a fragment of 300 bp or more (generally 300-800 bp, although shorter sequences may sometime induce efficient silencing) of the cDNA of the target gene, under transcriptional control of a promoter active in said plant.
  • silencing RNA constructs are those that can produce hairpin RNA (hpRNA) transcripts.
  • hpRNA hairpin RNA
  • the fragment of the target gene is inversely repeated, with generally a spacer region between the repeats [for a review, see Watson et al, (2005)].
  • amiRNAs artificial microRNAs directed against the gene to be silenced
  • silencing RNAs including in particular amiRNAs, in plants see for instance [Ossowski et al, Plant I, 53, 674-90 (2008)].
  • Useful expression cassettes comprise a promoter functional in a plant cell; one or more DNA construct(s) of 200 to 1000 bp, preferably of 300 to 900 bp, each comprising a fragment of a cDNA of a target gene selected among OSD1, TAM, SPOl 1-1, SPOl 1-2, PRD1, PRD2, PAIR1, and REC8, or of its complement, or having at least 95% identity, and by order of increasing preference, at least 96%, 97%, 98%, or 99% identity with said fragment, where the DNA construct(s) is placed under transcriptional control of the promoter.
  • DNA construct(s) of 200 to 1000 bp, preferably of 300 to 900 bp, each comprising a fragment of a cDNA of a target gene selected among OSD1, TAM, SPOl 1-1, SPOl 1-2, PRD1, PRD2, PAIR1, and REC8, or of its complement, or having at least 95% identity, and by order of increasing preference, at least 96%, 97%
  • Additional useful expression cassettes for hpRNA comprise a promoter functional in a plant cell, one or more hairpin DNA construct(s) capable, when transcribed, of forming a hairpin RNA targeting a gene selected among OSD1, TAM, SPOl 1-1, SPOl 1-2, PRD1, PRD2, PAIR1, and REC8; where the DNA construct(s) is placed under transcriptional control of the promoter.
  • useful hairpin DNA constructs comprise: i) a first DNA sequence of 200 to 1000 bp, preferably of 300 to 900 bp, such as a fragment of a cDNA of the target gene, or having at least 95% identity, and by order of increasing preference, at least 96%, 97%, 98%, or 99% identity with the fragment; ii) a second DNA sequence that is the complement of the first DNA, said first and second sequences being in opposite orientations and ii) a spacer sequence separating the first and second sequence, such that these first and second DNA sequences are capable, when transcribed, of forming a single double-stranded RNA molecule.
  • the spacer can be a random fragment of DNA.
  • a useful expression cassette for an amiRNA comprises: a promoter functional in a plant cell, one or more DNA construct(s) capable, when transcribed, of forming an amiRNA targeting a gene selected among OSD1, TAM, SPI11-1, SPOl l-2, PRD1, PRD2, PAIR1, and REC8; where the DNA construct(s) is placed under transcriptional control of the promoter.
  • Useful expression cassettes comprise a DNA construct targeting the OSD1 gene or comprise a DNA construct targeting the OSD 1 gene, and a DNA construct targeting a gene selected from one or more of SPOl 1-1, SPOl 1-2, PRD1, PRD2, or PAIR1, and a DNA construct targeting REC8.
  • Useful expression cassettes comprise a DNA construct targeting the TAM gene or comprise a DNA construct targeting the TAM gene, and a DNA construct targeting a gene selected from one or more of SPOl 1-1, SPOl 1-2, PRD1, PRD2, or PAIR1, and a DNA construct targeting REC8.
  • Additional useful expression cassettes comprise a DNA construct targeting the OSD1 gene and/or the TAM gene and/or comprise a DNA construct targeting the OSD1 gene and or the TAM gene, and/or a DNA construct targeting a gene selected from one or more of SPOl 1-1, SPOl 1-2, PRD1, PRD2, or PAIR1.
  • DSB double stranded DNA break
  • NHEJ error-prone non- homologous end joining
  • HR homologous recombination
  • DSBs can therefore be leveraged by geneticists to increase the frequency of mutations at defined sites, however intrinsic differences between the relative roles of HR and NHEJ can affect the mutation types at a targets locus.
  • ZFNs zinc finger nucleases
  • TALENs transcription activator-like endonucleases
  • CRISPR clustered regularly interspaced short palindromic repeats
  • Cas9 CRISPR-associated protein 9
  • This system is based on a bacterial immune system against invading bacteriophages in which a complex of 2 small RNAs, the CRISPR-RNA (crRNA) and the trans-activating crRNA (tracrRNA) directs a nuclease (Cas9) to a specific DNA sequence complementary to the crRNA.
  • CrRNA CRISPR-RNA
  • tracrRNA trans-activating crRNA
  • Cpf-l or CAS from other bacteria, for example, can be similarly used.
  • a DNA cassette homologous to the targeted site must be provided, preferably at a high concentration so that HR is favored or NHEJ.
  • RNAs the CRISPR-RNA (crRNA) and the trans-activating crRNA (tracrRNA) - directs the nuclease (Cas9) to a specific DNA sequence complementary to the crRNA (Jinek, M., et al. Science 337, 816-821 (2012)). Binding of these RNAs to Cas9 involves specific sequences and secondary structures in the RNA.
  • the two RNA components can be simplified into a single element, the single guide-RNA (sgRNA), which is transcribed from a cassette containing a target sequence defined by the user (Jinek, M., et al.
  • This system has been used for genome editing in humans, zebrafish, Drosophila, mice, nematodes, bacteria, yeast, and plants (Hsu, P.D., et al, Cell 157, 1262- 1278 (2014)).
  • the nuclease creates double stranded breaks at the target region programmed by the sgRNA. These can be repaired by non-homologous recombination, which often yields inactivating mutations. The breaks can also be repaired by homologous recombination, which enables the system to be used for gene targeted gene replacement (Li, J.-F., et al. Nat. Biotechnol.
  • the OSD1, SPOl l-l, SPOl l-2, PRD1, PRD2, or PAIRl mutations described in this application can be introduced into plants using the CAS9/CRISPR system.
  • a native OSD1, SPOl 1-1, SPOl 1-2, PRD1, PRD2, or PAIR1 coding sequence in a plant or plant cell can be altered in situ to generate a plant or plant cell carrying a polynucleotide encoding a OSD1, SPOl l-l, SPOl l-2, PRD1, PRD2, or PAIR1 polypeptide having one or more deletion or other inactivating mutations.
  • the CRISPR/Cas system has been modified for use in prokaryotic and eukaryotic systems for genome editing and transcriptional regulation.
  • CRISPR/Cas refers to a widespread class of bacterial systems for defense against foreign nucleic acid.
  • CRISPR/Cas systems are found in a wide range of eubacterial and archaeal organisms.
  • CRISPR/Cas systems include type I, II, and III sub- types. Wild-type type II CRISPR/Cas systems utilize the RNA-mediated nuclease, Cas9 in complex with guide and activating RNA to recognize and cleave foreign nucleic acid.
  • Cas9 homologs are found in a wide variety of eubacteria, including, but not limited to bacteria of the following taxonomic groups: Actinobacteria, Aquificae, Bacteroidetes-Chlorobi, Chlamydiae-Verrucomicrobia, Chlroflexi, Cyanobacteria, Firmicutes, Proteobacteria, Spirochaetes, and Thermotogae.
  • An exemplary Cas9 protein is the Streptococcus pyogenes Cas9 protein. Additional Cas9 proteins and homologs thereof are described in, e.g.,
  • the plant will also express a BABYBOOM polypeptide in in egg cells. As explained in the Examples, this combination results in a parent plant that when self-fertilized generates clonal progeny.
  • any naturally-or non-naturally-occurring active BABYBOOM polypeptide from a sexually reproducing plant can be expressed as described herein so long as the polypeptide (and/or RNA encoding the polypeptide) is expressed in egg cells in the plant.
  • the BABYBOOM polypeptide is from a species of plant of the genus
  • Abelmoschus Allium, Apium, Amaranthus, Arachis, Arabidopsis, Asparagus, Atropa, Avena, Benincasa, Beta, Brassica, Cannabis, Capsella, Cica, Cichorium, Citrus, Citrullus,
  • Capsicum Carthamus, Cocos, Coffea, Cucumis, Cucurbita, Cynasa, Daucus, Diplotaxis, Dioscorea, Elais, Eruca, Foeniculum, Fragaria, Glycine, Gossypium, Helianthus,
  • Heterocallis Hordeum, Hyoscyamus, Ipomea, Lactuca, Lagenaria, Lepidium, Linum, Lolium, Luffa, Luzula, Lycopersicon, Malus, Manihot, Majorana, Medicago, Momodica, Musa, Nicotiana, Olea, Oryza, Panicum, Pastinaca, Pennisetum, Persea, Petroselinium, Phaseolus, Physalis, Pinus, Pisum, Populus, Pyrus, Prunus, Raphanus, Saccharum, Secale, Senecio, Sesamum, Sinapis, Solanum, Sorghum, Spinacia, Theobroma, Trichosantes , Trigonella, Triticum, Turritis, Valerianelle, Vitis, Vigna, or Zea.
  • BABYBOOM polypeptide is identical or substantially identical to any of SEQ ID NOs: 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, or 41.
  • the BABYBOOM polypeptide comprises an amino acid sequence that is substantially identical to all of SEQ ID NOl, substantially identical to all of SEQ ID NO:3, or a first amino acid sequence substantially identical to SEQ ID NO: l and a second amino acid sequence substantially identical to SEQ ID NO:3, wherein the two sequences are separated by an AP2 domain-containing portion (e.g., substantially identical to SEQ ID NO:2).
  • BABY BOOM polypeptides contain two conserved AP2 domains. They lack a miRl72 binding site (thereby distinguishing BABY BOOM polypeptides from many other AP2 domain proteins that contain a miRl72 binding site.
  • the plant comprises heterologous expression cassette comprising a promoter that at least directs expression to egg cells operably linked to a
  • the promoter is egg cell-specific, meaning the promoter drives expression only or primarily in egg cells.
  • Exemplary promoters that drive expression in at least egg cells of a plant include, but are not limited to, the promoter of the egg-cell specific gene EC 1.1, EC 1.2, EC 1.3,
  • Arabidopsis DD45 promoter is used to express in rice egg cell (Ohnishi et al. Plant Physiology 165: 1533-1543 (2014).
  • An exemplary DD45 promoter sequence is as follows:
  • the expression cassette further comprises a transcriptional terminator.
  • exemplary terminators can include, but are not limited to, the rbcS E9 or nos terminators.
  • the expression cassette will include an egg cell enhancer.
  • Exemplary egg cell enhancers include, but are not limited to, the EC 1.2 enhancer or EASE enhancer (Yang et al, Plant Physiol. 139: 1421-32 (2005).
  • mutations can be introduced into the native BABYBOOM promoter such that BABYBOOM is expressed in egg cells based from the modified native promoter.
  • one or more nucleotide of the BABYBOOM promoter is modified by non-natural substitution, deletion or insertion.
  • Manipulation of the native promoter can be achieved via site-directed to random mutagenesis. Methods for introducing genetic mutations into plant genes and selecting plants with desired traits are well known and can be used to introduce mutations into the
  • seeds or other plant material can be treated with a mutagenic insertional polynucleotide (e.g., transposon, T-DNA, etc.) or chemical substance, according to standard techniques.
  • a mutagenic insertional polynucleotide e.g., transposon, T-DNA, etc.
  • chemical substances include, but are not limited to, the following: diethyl sulfate, ethylene imine, ethyl methanesulfonate and N-nitroso- N-ethylurea.
  • ionizing radiation from sources such as, X-rays or gamma rays can be used.
  • Plants having a mutated BABYBOOM promoter can then be identified, for example, by phenotype or by molecular techniques, including but not limited to TILLING methods. See, e.g., Comai, L. & Henikoff, S. The Plant Journal 45, 684-694 (2006).
  • Mutated BABYBOOM promoters can also be constructed in vitro by mutating the BABYBOOM promoter DNA sequence, such as by using site-directed or random
  • Nucleic acid molecules comprising the BABYBOOM promoter can be mutated in vitro by a variety of polymerase chain reaction (PCR) techniques well-known to one of ordinary skill in the art. See, e.g., PCR Strategies (M. A. Innis, D. H. Gelfand, and J. J. Sninsky eds., 1995, Academic Press, San Diego, CA) at Chapter 14; PCR Protocols : A Guide to Methods and Applications (M. A. Innis, D. H. Gelfand, J. J. Sninsky, and T. J.
  • PCR polymerase chain reaction
  • mutagenesis may be accomplished using site-directed mutagenesis, in which point mutations, insertions, or deletions are made to a DNA template.
  • Kits for site-directed mutagenesis are commercially available, such as the QuikChange Site- Directed Mutagenesis Kit (Stratagene). Briefly, a DNA template to be mutagenized is amplified by PCR according to the manufacturer's instructions using a high-fidelity DNA polymerase (e.g., Pfu TurboTM) and oligonucleotide primers containing the desired mutation. Incorporation of the oligonucleotides generates a mutated plasmid, which can then be transformed into suitable cells (e.g., bacterial or yeast cells) for subsequent screening to confirm mutagenesis of the DNA.
  • suitable cells e.g., bacterial or yeast cells
  • mutagenesis may be accomplished by means of error-prone PCR amplification (ePCR), which modifies PCR reaction conditions (e.g., using error-prone polymerases, varying magnesium or manganese concentration, or providing unbalanced dNTP ratios) in order to promote increased rates of error in DNA replication.
  • ePCR error-prone PCR amplification
  • Kits for ePCR mutagenesis are commercially available, such as the GeneMorph® PCR Mutagenesis kit (Stratagene) and Diversify® PCR Random Mutagenesis Kit (Clontech). Briefly, DNA polymerase (e.g., Taq polymerase), salt (e.g, MgCl2, MgS04, or MnS04), dNTPs in unbalanced ratios, reaction buffer, and DNA template are combined and subjected to standard PCR amplification according to manufacturer's instructions.
  • DNA polymerase e.g., Taq polymerase
  • salt e.g, MgCl2, MgS04, or MnS04
  • reaction products are cloned into a suitable vector to construct a mutagenized library, which can then be transformed into suitable cells (e.g., yeast or plant cells) for subsequent screening (e.g., via a two-hybrid screen) as described below.
  • suitable cells e.g., yeast or plant cells
  • mutagenesis can be accomplished by recombination (i.e. DNA shuffling).
  • DNA shuffling i.e. DNA shuffling
  • a shuffled mutant library is generated through DNA shuffling using in vitro homologous recombination by random fragmentation of a parent DNA followed by reassembly using PCR, resulting in randomly introduced point mutations.
  • Methods of performing DNA shuffling are known in the art (see, e.g., Stebel, S.C. et al, Methods Mol Biol 352: 167-190 (2007)).
  • DSBs can therefore be leveraged by geneticists to increase the frequency of mutations at defined sites, however intrinsic differences between the relative roles of HR and NHEJ can affect the mutation types at a targets locus.
  • ZFNs zinc finger nucleases
  • TALENs transcription activator-like endonucleases
  • CRISPR clustered regularly interspaced short palindromic repeats
  • Cas9 CRISPR-associated protein 9
  • This system is based on a bacterial immune system against invading bacteriophages in which a complex of 2 small RNAs, the CRISPR-RNA (crRNA) and the trans-activating crRNA (tracrRNA) directs a nuclease (Cas9) to a specific DNA sequence complementary to the crRNA.
  • crRNA CRISPR-RNA
  • tracrRNA trans-activating crRNA
  • a DNA cassette homologous to the targeted site must be provided, preferably at a high concentration so that HR is favored or NHEJ.
  • RNAs the CRISPR-RNA (crRNA) and the trans-activating crRNA (tracrRNA) - directs the nuclease (Cas9) to a specific DNA sequence complementary to the crRNA (Jinek, M., et al. Science 337, 816-821 (2012)). Binding of these RNAs to Cas9 involves specific sequences and secondary structures in the RNA.
  • the two RNA components can be simplified into a single element, the single guide-RNA (sgRNA), which is transcribed from a cassette containing a target sequence defined by the user (Jinek, M., et al.
  • This system has been used for genome editing in humans, zebrafish, Drosophila, mice, nematodes, bacteria, yeast, and plants (Hsu, P.D., et al, Cell 157, 1262- 1278 (2014)).
  • the nuclease creates double stranded breaks at the target region programmed by the sgRNA. These can be repaired by non-homologous recombination, which often yields inactivating mutations. The breaks can also be repaired by homologous recombination, which enables the system to be used for gene targeted gene replacement (Li, J.-F., et al. Nat. Biotechnol.
  • RNA-guided CRISPR-Cas9 system can achieve the activation of genes without modifying the promoter sequence of the native gene.
  • Such a system utilizes a deactivated Cas9 protein (dCas9) fused to a transcriptional activation domain (Lowder, L.G. et al. (2015), Plant physiology, 169, 971-985) and uses guide RNAs to activate a specific promoter in a genome.
  • An exemplary transcriptional activation domain is VP64.
  • An exemplary dCas9 coding sequence is:
  • a BABYBOOM promoter sequence in a plant or plant cell can be altered in situ to generate a plant or plant cell carrying a polynucleotide encoding a modified BABYBOOM promoter linked to the native BABYBOOM coding sequence.
  • CRISPR/Cas systems include type I, II, and III sub-types. Wild-type type II CRISPR/Cas systems utilize the RNA-mediated nuclease, Cas9 in complex with guide and activating RNA to recognize and cleave foreign nucleic acid. Cas9 homologs are found in a wide variety of eubacteria, including, but not limited to bacteria of the following taxonomic groups: Actinobacteria, Aquiflcae,
  • An exemplary Cas9 protein is the Streptococcus pyogenes Cas9 protein. Additional Cas9 proteins and homologs thereof are described in, e.g., Chylinksi, et al., RNA Biol. 2013 May 1; 10(5): 726-737 ; Nat. Rev. Microbiol. 2011 June; 9(6): 467-477; Hou, et al., Proc Natl Acad Sci U S A. 2013 Sep 24;l 10(39): 15644-9; Sampson et al., Nature. 2013 May 9;497(7448):254-7; and Jinek, et al., Science. 2012 Aug 17;337(6096):816-21.
  • the plant described herein can be any plant species.
  • the plant is a dicot plant.
  • the plant is a monocot plant.
  • the plant is a grass.
  • the plant is a cereal (e.g., including but not limited to Poaceae, e.g., rice, wheat, maize).
  • the plant is a species of plant of the genus Abelmoschus, Allium, Apium, Amaranthus, Arachis, Arabidopsis, Asparagus, Atropa, Avena, Benincasa, Beta, Brassica, Cannabis, Capsella, Cica, Cichorium, Citrus, Citrullus, Capsicum, Carthamus, Cocos, Coffea, Cucumis, Cucurbita, Cynasa, Daucus, Diplotaxis, Dioscorea, Elais, Eruca,
  • Hyoscyamus Ipomea, Lactuca, Lagenaria, Lepidium, Linum, Lolium, Luffa, Luzula, Lycopersicon, Malus, Manihot, Majorana, Medicago, Momodica, Musa, Nicotiana, Olea, Oryza, Panicum, Pastinaca, Pennisetum, Persea, Petroselinium, Phaseolus, Physalis, Pinus, Pisum, Populus, Pyrus, Prunus, Raphanus, Saccharum, Secale, Senecio, Sesamum, Sinapis, Solanum, Sorghum, Spinacia, Theobroma, Trichosantes , Trigonella, Triticum, Turritis, Valerianelle, Vitis, Vigna, or Zea.
  • BABY BOOM lineage of genes belongs to the APETALA 2/ETHYLENE
  • the overexpression of Arabidopsis thaliana and Brassica napus genes have been shown to induce somatic embryos on seedlings 9 .
  • a tBBM has been shown to express in later stage embryos, its gametic and zygotic expression have not been described 3 .
  • Our previous results 10 showed that the expression of BBM- like genes in rice is induced very early in zygotes after fertilization, indicating they may have a potential role in initiation of embryogenesis (Table 1).
  • We selected the highest expressing gene in zygotes, called BBMJ for ectopic expression in transgenic rice seedlings (FIG.FIG. 5a, b)
  • somatic embryo-like structures arising from leaves FIG. la, b
  • the embryonic identity of these structures was confirmed by the expression of embryo marker genes in rice (FIG.FIG. 5c).
  • DEX dexamethasone
  • GR glucocorticoid receptor
  • BBM1-GR seedlings When one week old BBM1-GR seedlings were shifted to a DEX containing medium, they developed roots from aerial tissues (FIG.FIG. 6b, c). Moreover, BBM1-GR plants watered with DEX around the flowering transition developed awns from lemmas (FIG.FIG. 6d, e). These phenotypes together with the phenotypes observed on BBM1 overexpression
  • FIG.FIG. 5d-o have been shown to be associated with auxin accumulation 11 , or transport and response 12 13 .
  • Auxin treatment is required for induction of somatic embryogenesis during plant regeneration from somatic tissue 14 . Since BBM1 overexpression led to somatic embryogenesis in the absence of auxin and we observe direct regulation of the expression of auxin biosynthesis, it likely controls somatic embryogenesis by controlling auxin
  • BBM1 IS PREFERENTIALLY EXPRESSED FROM THE PATERNAL GENOME
  • BBM1 genomic locus was translationally fused to GFP (BBM1-GFP) and transgenic plants were generated in the inbred Japonica ( Kitaake ) cultivar (FIG.FIG. 7e).
  • BBM1-GFP fusion plants were then reciprocally crossed to wild-type plants, and the GFP expression was probed in zygotes at 2.5 HAP. Due to the difficulty of isolating live rice zygotes for GFP
  • BBM1 expression continues through the later stages of the developing rice embryo (FIG.FIG. 7i, j).
  • BBM1 RNA can be detected in sperm cells by RT-PCR, but no expression is detected in egg cells (FIG.FIG. 7k), consistent with RNA-seq transcriptome data (Table 1).
  • BBM genes have been isolated from several plant species, and their capability to induce somatic embryogenesis has been demonstrated 9 , their function in early embryogenesis has been uncharacterized, in part because loss of function mutants in
  • progeny which were heterozygous for BBM1 but homozygous mutant for bbm.2 and bbm3 could be recovered, and appeared fertile, therefore the progeny of these plants were analyzed in detail (FIG.FIG. 9a).
  • 106 ⁇ 36 %) failed to germinate (Table 2).
  • the genetic segregation ratios derived from genotyping of the germinated seedlings suggests that the viability of the bbml bbm2 bbm3 triple mutant seeds is severely affected, and that the viability of bbml/BBMl bbm2/bbm2 bbm3/bbm3 heterozygous progeny is also reduced (Table 2).
  • genotyping of a subset of the non-germinating seeds was attempted using the endosperm, and they were determined to be either homozygous for the bbml allele (6/8), or were heterozygous for bbml (2/8), but not homozygous ⁇ oc BBMI (FIG.FIG. 9b).
  • BBM4 (LOC_Os04g42570; Table 1), that was not mutated, may be providing residual function in the zygote which is sufficient for
  • Haploid plants contain only one set of chromosomes, either maternal or paternal depending on the gamete that gives rise to them or the technique used to produce them. This makes them efficient tools to reduce the time for new cultivar release in crops. Homozygous isogenic lines can be produced in one generation after chromosome doubling, bypassing the several generations it takes by inbreeding procedures 19 . As described earlier, BBM1 egg cell specific expression can induce parthenogenesis in rice (FIG. 2e). However, parthenogenesis in emasculated DD45:BBMl flowers did not result in autonomous endosperm development, and the seeds aborted.
  • Tl progeny from these transgenic plants to determine whether endosperm development by fertilization of the central cell could produce viable seeds containing parthenogenetically developing embryos.
  • the ploidy of the putative haploid plants was confirmed by flow cytometry (FIG. 4f-h).
  • the haploid induction frequency increased to about 29% (93 haploids out of total 321 plants) in a homozygous T2 line #8C.
  • the haploid inducer line was propagated by selecting diploid progeny, and has continued to produce a high frequency of haploids (about 30%) even after 6 generations of propagation.
  • Our method presents a very efficient and clean way of producing haploids in rice. Other methods like androgenesis involves laborious tissue culturing and some rice cultivars are recalcitrant to andreogensis.
  • Crop yields can be improved markedly by the use of hybrid plants that exhibit enhanced vigor (“hybrid vigor”).
  • hybrid vigor enhanced vigor
  • high-yielding hybrid plants produce progeny that give variable yields, due to segregation of multiple genetic factors in the next (F2) generation. For this reason, hybrid seeds need to be bought afresh every season and are consequently underutilized.
  • meiosis and fertilization the two fundamental processes of sexual reproduction are bypassed, hybrids can be propagated through seeds.
  • Engineering apomixis in crop plants has been described as“the holy grail of agriculture” 6 . Although natural apomixis is known in over 300 angiosperm species 21 ⁇ 22 , it has not been reported in a crop plant with the exception of a few forage grasses and fruit trees that are minor crops 23 .
  • MiMe A genetic approach called MiMe, that skips recombination and substitutes mitosis for meiosis, has been reported in Arabidopsis 4 and more recently in rice 5 .
  • MiMe by combining null mutations in three meiotic genes, REC8, PA1R1 and OSD I . unrecombined diploid male and female gametes are produced.
  • the three rice MiMe genes 5 were genome edited using CRISPR-Cas9 in haploid plants carrying the pDD45::BBMl transgene that results in egg cell expression of BBM1 (FIG.FIG. l2a, b). Since meiosis is omitted in MiMe plants, we obtained fertile haploid plants which have viable pollen (FIG.FIG. l2e to g) and seed set comparable to control diploid MiMe plants (FIG.FIG. l2c, d). While wild-type haploids do not undergo anthesis (FIG. 4c), MiMe haploids show normal anthesis (FIG. 4b, d).
  • MiMe haploid plants results in doubling of the chromosome number 25 , so that the progeny of haploid MiMe plants are expected to be diploid.
  • these MiMe haploid plants also carried the egg cell promoter fusion ior BBMl (pDD45::BBMl), we expected to also produce haploid progeny by parthenogenesis, that would then be genetically identical to the parent.
  • This diploid MiMe plant with egg cell-expressed BBM1 can be expected to yield progeny that are either tetraploid due to fertilization by the diploid gametes, or diploid due to asexual reproduction arising from parthenogenesis of the diploid egg cell.
  • Flow cytometry analysis of 13 progeny from this plant showed that 2 progeny were indeed diploid as expected from asexual propagation, while the rest were tetraploid.
  • the mother plants and Tl diploid progeny were genotyped for 3 MiMe genes as PAIR1 and REC8 mutations are bi-allelic, to test if the progeny are clones or segregate in Tl generation.
  • the Tl diploid progeny have identical mutations as that of the mother plant indicating there was no segregation or recombination (FIG.FIG. 14).
  • FIG.FIG. 14 shows that both haploid and diploid progeny obtained from these haploid and diploid apomictic plants respectively are clones of the parental lines.
  • the double haploid progeny from haploid apomixis mother plants also yielded diploid and tetraploid plants in the T2 generation.
  • parthenogenesis gene of apomict origin elicits embryo formation from unfertilized eggs in a sexual plant. Proceedings of the National Academy of Sciences of the United States of America 112, 11205-11210, doi: 10. l073/pnas.1505856112 (2015).
  • Wild-type, mutant and transgenic seeds were germinated on half strength Murashige and Skoog’s medium 26 containing 1% sucrose and 0.3% phytagel in a growth chamber for 12 days under 16 h light: 8 h dark cycle at 28 ° C and 80% relative humidity. Seedlings were then transferred to greenhouse and grown under natural light conditions at Davis, California.
  • Plasmid constructs Full length open reading frame (ORF) of BBM1 was amplified from cDNAs made from rice calli using two sets of primers (KitBlFl 5’- CGGATCC ATGGCCTCCATC ACC-3’, KitBlRl 5’-CCTTCGACCCCATCCCAT-3’ and KitBlF2 5’ -GGATGGGATGGGGTCGAAG-3’ , KitBlR2 3’-
  • the whole BBM1 locus roughly 3kb upstream sequences and transcribed region till stop codon were PCR amplified in two fragments from genomic DNA using 2 primer pairs pBlFl 5 -CTCGAGGTCAACACCAACGCCATC -3’, pBlRl 5’- GAAGTCCTCCAGCTTCGGCGC -3’ and, pBlF2 5’- TT GATT GT GTT GAT GT GC AGAGT GGGG -3’ and pBlR2 5’- CTCGAGCGGTGTCGGCAAAACC -3’.
  • the two fragments were joined at a unique restriction enzyme site, No! I. present downstream of start codon in the sequence.
  • RNAi knockdown construct for BBM1 was designed by amplifying a 600 bp gene specific fragment from 3’ UTR with BlRNAi F 5’- CCTCGAGCAACTATGGTTCGCAGC -3’ and BlRNAi R 5’- GATATC
  • single guide RNA (gRNA) sequences 5’- GGAGGACTTCCTCGGCATGC -3’, 5’- GTATGCAATATACTCCTGCC -3’ and 5’- GACGGCGGGAGCTGATCCTG -3’ respectively were designed by using the web tool https://www.genome.arizona.edu/crispr/ as per 30 .
  • the gRNAs were cloned in pENTR-sgRNA entry vector.
  • the binary vectors for plant transformations (pCRISPR BBM1+BBM3, pCRISPR BBM2+BBM3 and pCRISPR BBM1+ BBM2+BBM3) were constructed by Gateway LR clonase (Life Technologies) recombination with pUbi-Cas9 destination vector as described in 31 .
  • pC A B I A2300 MiMe CRISPR-Cas9 was transformed in embryogenic calli derived from pDD45::BBMl#8c haploid inducer lines (FIG.FIG. 8b). Rice transformations were carried out as per 32 at UC Davis plant transformation facility. TO plants were grown in green house and screened for MiMe mutations. Tl plants obtained from seeds were subjected to ploidy determination and genotyping for MiMe mutations.
  • panicles used as females were emasculated and bagged with pollen donor panicles. The bags were gently finger tapped for next three days and left bagged to make seeds. Fl seeds (FIG.FIG. 9e) were harvested 4 weeks after pollination.
  • Tl or T2 progeny plants in which CRISPR-Cas9 transgene had already segregated out were used as male or female parents.
  • Flow cytometry Nuclei for Fluorescence-Activated Cell Sorting (FACS) analysis were isolated by leaf chopping method as described by 36 . The isolated nuclei were stained with propidium iodide at 40 pg/ml concentration in Galbraith’s buffer. FACS analysis and DNA content estimation was done with Becton Dickinson FACScan system as per 37 ⁇ 38 .
  • FACS Fluorescence-Activated Cell Sorting
  • Alexander staining of pollen grains Stamens were harvested just before anthesis. Anthers were put on a glass slide in a drop of Alexander’s stain containing 40 pl of glacial acetic acid per milliliter of stain 39 . Anthers were covered with a cover slip and slides were heated at 55 ° C on a heating block, till the visible staining of pollen was observed.
  • RNA isolation, quality assessment, quantification and library preparations were done as described in 10 with some modifications. Libraries were prepared from two biological replicates for each sample with 80 ng of input RNA, using NuGEN Ovation RNA-seq Systems 1-16 for Arabidopsis following manufacturer instructions. Samples were multiplexed and 8 libraries per lane were run on Illumina HiSeq platforms at UC Davis, Genome Center.
  • Cutadapt 40 was used to remove 3’ adapters and quality -trim reads at a Phred quality threshold of 13. High-quality reads were then mapped to the Oryza sativa Nipponbare reference genome 41 (MSU v7.0) using Tophat2 42 with the minimum and maximum intron sizes set at 20 and 15000 bases and the microexon search switched on. Mapped reads were assigned to the MSU v7.0 gene models (Phytozome release 323) using HTSeq. Differential expression analysis was performed using the edgeR package 43 . Effective library sizes were calculated using the trimmed mean of M-values (TMM) method and a quasi-likelihood (QL) negative binomial generalized linear model was fitted to the data 44 (Chen 2016).
  • TMM trimmed mean of M-values
  • QL quasi-likelihood
  • cDNAs were synthesized using the iScript cDNA synthesis kit (BioRad) as per manufacturer instructions. RT-PCRs were done with MyTaq ® Red Mix (Bioline) and RT- qPCRs with iTaq TM universal SYBR ® Green supermix (BioRad) using CFX96 TouchTM realtime PCR system (BioRad). OsUbiquitin5 (Os03gl3l70) was used as internal control and fold changes in the relative abundance of transcripts were calculated as described by 45 . RT- qPCR amplifications for each gene were performed in two biological replicates and each biological replicate was repeated in technical replicates for each sample. All the primers used are listed here.
  • PCRs were done with hybrid, 2.5 HAP zygote cDNAs from reciprocally crossed rice japonica cultivar Kitaake and indica cultivar IR50 as described in 10 .
  • Primers BlRNAi F and BlRNAi R which amplified a gene specific fragment of ⁇ 600 bp of BBM1 contains 5 SNPs between Kitaake and IR50 (FIG. 2a; FIG.FIG. 7a-d).
  • the PCR amplicons were Sanger sequenced 33 and chromatograms were analyzed for SNPs.
  • a major unresolved problem in plant development is the molecular pathway underlying the initiation of embryogenesis by a fertilized egg cell (Palovaara, J., de Zeeuw,
  • BBM genes from Arabidopsis thaliana and Brassica napus can ectopically induce somatic embryos (Boutilier, K. et al, The Plant cell 14, 1737-1749 (2002)); however, a role in initiation of zygotic embryos has not been established (Horstman, A. et al, Trends in plant science 19, 146-157, doi: 10. l0l6/j.tplants.2013.10.010 (2014)).
  • Kitaake cultivar We reciprocally crossed wild-type plants to transgenic plants carrying a translational fusion of the BBM1 genomic locus to GFP ( BBM1-GFP ) (FIG. l9b). Zygotes at 2.5 HAP displayed GFP expression only if the BBM1-GFP transgene was transmitted from the male parent (FIG. l5a). Consistent with this observation, in BBM1-GFP selfed progeny, GFP was detected in about half the zygotes, instead of the three-fourths ratio expected if there is no parent-of-origin bias (FIG. l5a).
  • GFP expression can be detected from the female allele in 6.5 HAP zygotes, corresponding to mid to late G2 phase (FIG. l9c, d).
  • BBM1 is capable of auto-activation of its own promoter (FIG. l8h)
  • the late expression of BBM1 from the female allele might result from earlier male BBM1 allele expression.
  • Other redundantly acting BBM genes might also contribute to this delayed activation (see below).
  • BBM1 expression continues through later stages of embryo development (FIG. l9e). In gametes, BBM1 RNA can be detected by RT-PCR in sperm cells but not in egg cells (FIG. l9f), consistent with RNA-seq data (Anderson, S. N.
  • expression of a single wild-type transcription factor BBM1 can overcome the fertilization requirement for embryo initiation by an egg cell.
  • a wild-type gene from a sexually reproducing plant is sufficient to induce parthenogenesis when mis-expressed suggests that asexual reproduction could potentially evolve from altered expression of existing genes within the sexual pathway.
  • BBM1, BBM2 md BBM3 (Osl lgl9060, 0s02g40070 and OsOlg674lO respectively), are consistently expressed in early zygotes (Extended Data Table la).
  • BBMl/bbml bbm2/bbm2 bbm3/bbm3 seedlings were also under-represented, suggesting that the viability of this genotype is also compromised (Table 5b).
  • a subset of the non-germinating seeds could be genotyped using their endosperm, and found to be either homozygous or heterozygous for bbml, but not homozygous ⁇ oc BBMI (FIG. 2le).
  • the two bml bbm2 bbm3 triple homozygotes showed normal growth with no obvious vegetative or floral defects, and produced normal seed sets, indicating that the BBM1-3 genes are not required for post-embryonic development.
  • Haploid plants are efficient tools to accelerate plant breeding, as homozygous isogenic lines can be produced in one generation after chromosome doubling (Murovec, J. & Bohanec, B., Haploids and Doubled Haploids in Plant Breeding (2012)).
  • Egg cell expression of BBM1 initiated parthenogenesis in emasculated flowers (FIG. l5b), but the seeds aborted without endosperm (FIG. 20d).
  • Self-pollinated Tl progeny from BBMI-ee transgenic plants were analyzed to determine whether endosperm development by fertilization could produce viable seeds containing parthenogenetically derived haploid embryos. We identified haploids by small size vs. diploid siblings, as well as sterile flowers due to defective meiosis
  • Crop yields can be improved markedly by the use of Fl hybrid plants that exhibit enhanced vigor (“hybrid vigor”). If meiosis and fertilization are bypassed, hybrids could be propagated through seeds without segregation. Asexual propagation through seeds, known as apomixis, is known to occur naturally in >400 species but not in the major crop plants (Hand, M. L. & Koltunow, A. M. et al., Genetics 197, 441-450, doi: 10.1534/genetics.114.163105 (2014); Ozias-Akins, P. & van Dijk, P.
  • MiMe A genetic approach called MiMe, that eliminates recombination and substitutes mitosis for meiosis (FIG. l7c, d), has been reported in Arabidopsis (d'Erfurth, I. et al, PLoS biology 7, el000l24, doi: l0T37l/joumal.pbio. l000l24 (2009)) and rice (Mieulet, D. et al, Cell research 26, 1242-1254, doi: l0. l038/cr.20l6. H7 (2016)).
  • MiMe a triple knockout of meiotic genes REC8, PAIR1 and OSDI. produces unrecombined diploid male and female gametes.
  • the diploid progeny are expected only from parthenogenesis of the diploid egg cell.
  • the rest of the progeny were tetraploid (FIG. l7e).
  • Progeny from a control MiMe diploid plant were all determined to be tetraploid (FIG. 23b, c,). Since Tl diploid progeny from diploid S-Apo parents arise from parthenogenesis of unreduced female gametes, they are predicted to be clonal with the parent, with no genetic segregation.
  • the Tl diploids were propagated, and two more generations (T2 and T3) of diploid clones were identified by flow cytometry screening.
  • the clonally propagated seeds preserve the 2: 1 maternal to paternal genome ratio in endosperm required for seed viability (Lafon-Placette, C. & Kohler, C., Molecular ecology 25, 2620-2629, doi: l 0.11 l l/mec. l 3552 (2016); Sekine, D. et al, The Plant Journal 76, 792-799, doi: 10.111 l/tpj.12333 (2013)).
  • Engineering a completely asexual system involving autonomous endosperm formation may not be straightforward in a sexually reproducing crop, nor is it essential as many natural apomicts also form seeds with fertilized endosperm (Hand, M. L. & Koltunow, A. M. et al, Genetics 197, 441-450,
  • hybrids can provide a rapid route to higher yields from favorable gene combinations, and have been extensively exploited in maize.
  • Plant materials and growth conditions Rice cultivar Kitaake ( Oryza sativa L. subsp. japonicd) was used for transformations for raising transgenic lines and as a wild-type control. Wild-type, mutant and transgenic seeds were germinated on half strength Murashige and Skoog’s medium (Murashige, T. & Skoog, F., Physiologia Plantarum 15, 473-497, doi: l0. l l l l l/j. l399-3054.
  • Plasmid constructs Full length coding sequence (CDS) of BBM1 was amplified from cDNAs made from rice calli using two sets of primers (KitBlFl 5’- CGGATCC ATGGCCTCCATC ACC-3’, KitBlRl 5’-CCTTCGACCCCATCCCAT-3’ and KitBlF2 5’ -GGATGGGATGGGGTCGAAG-3’ , KitBlR2 3’-
  • the whole BBM1 locus roughly 3kb upstream sequences and transcribed region till stop codon were PCR amplified in two fragments from genomic DNA using 2 primer pairs pBlFl 5 -CTCGAGGTCAACACCAACGCCATC -3’, pBlRl 5’- GAAGTCCTCCAGCTTCGGCGC -3’ and, pBlF2 5’- TT GATT GT GTT GAT GT GC AGAGT GGGG -3’ and pBlR2 5’- CTCGAGCGGTGTCGGCAAAACC -3’.
  • the two fragments were joined at a unique restriction enzyme site, Noll, present downstream of start codon in the sequence.
  • gRNA sequences 5’-GGAGGACTTCCTCGGCATGC -3’, 5’- GTATGCAATATACTCCTGCC -3’ and 5’- GACGGCGGGAGCTGATCCTG -3’ respectively were designed by using the web tool https://www.genome.arizona.edu/crispr/ as described (Xie, K., Zhang, J. & Yang, Y., Molecular plant 7, 923-926, doi: l0. l093/mp/ssu009 (2014)).
  • the gRNAs were cloned in pENTR-sgRNA entry vector.
  • the binary vectors for plant transformations (pCRISPR BBM1+BBM3, pCRISPR BBM2+BBM3 and pCRISPR BBM1+ BBM2+BBM3) were constructed by Gateway LR clonase (Life Technologies) recombination with pUbi-Cas9 destination vector as described (Zhou, H. et al., Nucleic acids research 42, 10903-10914, doi: l0.l093/nar/gku806 (2014)).
  • Three candidate genes (OSl) I . Os02g37850; PAIR/.
  • 0s03g0l590 and RI/CH. 0s05g504l0 for creating MiMe mutations in rice were selected as per (Mieulet, D. et al, Cell research 26, 1242-1254, doi: l0. l038/cr.20l6. H7 (2016)) and gRNAs sequences 5 -GCGCTCGCCGACCCCTCGGG -3’, 5’- GGTGAGGAGGTTGTCGTCGA -3’ and 5’- GTGTGGCGATCGTGTACGAG -3’ respectively for CRISPR-Cas9 based knockout were designed as described (Xie, K., Zhang,
  • Vector pCAMBIA23()() MiMe CRISPR-Cas9 (FIG. 23a) for plant transformations was constructed as described (Zhou, H. et al, Nucleic acids research 42, 10903-10914, doi:l0T093/nar/gku806 (2014)) except the resistance marker in the destination vector pUbi-Cas9 was changed to Kanamycin (Neomycin Phosphotransferase II).
  • pCAMBIA2300 MiMe CRISPR-Cas9 was transformed in embryogenic calli derived from pDD45: :BBMl#8c haploid inducer lines (FIG. 20b). Rice transformations were carried out as describe previously (Hiei, Y. & Komari, T., Nature protocols 3, 824-834, doi: l0. l038/nprot.2008.46 (2008)) at UC Davis plant transformation facility. TO plants were grown in green house and screened for MiMe mutations. Tl plants obtained from seeds were subjected to ploidy determination and genotyping for MiMe mutations.
  • Genotyping of BBM1, BBM2 and BBM3 mutants was carried out by PCR amplifying DNA at the mutation site with primers BBM1 SeqF 5’- TTGATTGTGTTGATGTGC -3’ BBM I SeqR 5’- GAGAGACGACCTACTTGGTGAC -3’; BBM2 SeqF 5’-TAGCTAGCTTGTTAATAGATCATAG -3’, BBM2 SeqR 5’- TCATATCTCAGTGTGATAGTCTG -3’ ; BBM3 SeqF 5’- AT GCT GCT GCTCC GAGAAG -3’ and BBM3 SeqR 5’- GCTTAGTGCTCCAAACCTCTC -3’.
  • OSD1 R 5'- ACCTTGACGACTGACGTGATGTC -3'; PAIR I F 5'- GT GGT GT GGT GT GTT C AGGAG -3', PAIR I R 5'- TGGAATCCCCAATCAGTAAGGCAC -3'; REC8 F 5'- GC ACT AAGGCT CTCC GGAATT CTC -3' and REC8 R 5'-
  • Emasculation, crosses and pollinations Flowers from BBM1-QQ TO transgenic rice lines were emasculated around the anthesis stage, bagged and let to grow for another 9 days after emasculation (DAE). Carpels were harvested and fixed for analysis in FAA
  • a translational fusion consisting of the BBM1 genomic locus to GFP (BBM1-GFP; FIG. l9b) was introduced into the inbred japonica (Kitaake) cultivar by transformation. Plants hemizygous for the BBM1-GFP transgene were then reciprocally crossed to wild-type plants. Flowers from wild-type or BBM1-GFP transgenic plants were hand pollinated around the anthesis stage and carpels were harvested after 2.5 and 6.5 hours after pollination (HAP).
  • mutant embryos For phenotypic analysis of mutant embryos, self-pollinated flowers from mutant plants were scored for anthesis, and harvested 5 or 10 days after pollination (DAP). For crosses of bbml bbm3 and bbm2 bbm3 plants, only T2 progeny plants in which the CRISPR- Cas9 transgene had already segregated out were used as parents.
  • panicles used as females were emasculated and bagged with pollen donor panicles. The bags were gently finger tapped (twice a day) for next two days. Male panicles were removed, and female panicles were left bagged to make seeds. Fl seeds were harvested 4 weeks after pollination.
  • Immunohistochemistry was carried out using standard protocols (Sessions, A., CSH protocols 2008, pdb.prot4946, doi: l0.H0l/pdb.prot4946 (2008)) except an antigen retrieval step was also included.
  • Antigen retrieval was done by microwaving the slides in 10 mm sodium citrate buffer (pH 6.0) for 10 mins.
  • Rabbit anti-GFP antibody ab6556 (Abeam) was used as primary antibody and goat anti-rabbit alkaline phosphatase conjugate A9919 (Sigma) was used as secondary antibody.
  • Toluidine blue staining after rehydration, sections crosslinked to glass slides were stained with 0.01% toluidine blue for 30 seconds.
  • Flow cytometry Nuclei for Fluorescence-Activated Cell Sorting (FACS) analysis were isolated by a leaf chopping method described previously (Galbraith, D. W. et al,
  • Alexander staining of pollen grains Stamens were harvested just before anthesis. Anthers were put on a glass slide in a drop of Alexander’s stain containing 40 pl of glacial acetic acid per milliliter of stain (Alexander, M. P., Stain technology 44, 117-122 (1969)). Anthers were covered with a cover slip and slides were heated at 55 ° C on a heating block, untill the visible staining of pollen was observed.
  • PCR-free DNA libraries were prepared from a wild-type Kitaake control plant, the TO S-Apo line#l mother plant, two Tl and two T2 progeny clones from S-Apo line# 1 with 500 ng of input DNA, using NuGEN CeleroTM DNA- Seq kit, following manufacturer instructions. Samples were multiplexed and 6 libraries per lane were run on Illumina HiSeq platforms at UC Davis, Genome Center.
  • the variant finder GATK4.0 HaplotypeCaller was used in single sample mode (Van der Auwera, G. A. et al, Current protocols in bioinformatics 43, 11 10 11-33, doi: 10.1002/0471250953. bil 1 l0s43 (2013)) and selecting only for SNPs. Repeated elements of the genome were masked from analysis using annotated repeats from
  • RT-PCR and RT-qPCR All the cDNAs were synthesized using the iScript cDNA synthesis kit (BioRad) as per manufacturer instructions. RT-PCRs were performed with MyTaq ® Red Mix (Bioline) and RT-qPCRs with iTaq TM universal SYBR ® Green supermix (BioRad) using CFX96 TouchTM real-time PCR system (BioRad). UBIQUITIN5
  • BBM1 RT F 5’- TACTACCTTTCCGAGGGTTCG-3’ was used in combination with BlRNAi R 5’- GATATC CCAGACTGAGAACAGAGGC -3’ to detect endogenous transcript and with GR RT R 5’- TCTTGTGAGACTCCTGCAGTG-3’ to detect BBM1-GR transgenic transcript in RT-qPCRS.
  • ASMiintronF 5’ -GTGGCAGGAAACAAGGATCTG-3’ with BlRNAi R which span an intron were used in RT-PCRs.
  • LEC1A F 5’-GACAGGTGATCGAGCTCGTC-3’ LEC1A R 5’- CTCTTTCGATGAAACGGTGGC-3’
  • LEC1B F 5’-ACAGC AGCAGAATGGCGATC-3’ LEC1B R 5’-CTCATCGATCACTACCTGAACG-3’
  • GE Y 5’- C AGGAGC AC AAGGCGAAGCG-3’ GA R 5’- CTTCGCCTGGATCTCCGGGTG-3’
  • OSH I F 5’-GAGATTGATGCACATGGTGTG-3’ OSH I R-2n 5’- CGAGGGGTAAGGCC ATTTGTA-3’
  • SNP analysis Detection of SNPs in BBM1 transcripts from hybrid zygotes was performed by PCR of 2.5 HAP zygote cDNAs from reciprocally crossed rice japonica cultivar Kitaake and indica cultivar IR50 as described previously (Anderson, S. N. et al, Developmental Cell 43, 349-358 e344, doi: l0. l0l6/j.devcel.2017.10.005 (2017)).
  • the PCR amplicons were Sanger sequenced (Sanger, F., Nicklen, S. & Coulson, A. R., Proceedings of the National Academy of Sciences of the United States of America 74, 5463-5467 (1977)) and chromatograms were analyzed for SNPs. For detection of heterozygous SNPs present in the S-Apo mother plants and their progeny, 50 ng of input DNA was used for each PCR reaction. Sanger (Sanger, F., Nicklen, S. & Coulson, A. R., Proceedings of the National Academy of Sciences of the United States of America 74, 5463- 5467 (1977)) sequenced PCR chromatograms were analyzed for presence of SNPs.
  • the primers for 11 SNPs analyzed are 1 Chr2 F 5’ - TGG GTG CCA CGT TAT CTA GG-3’ , 1 Chr2 R 5’- GGA TTT GGC TAC CCT CAA GCT-3’; 2 Chr2 F 5’-GAA TGG GCA ACT AAC AAC CGT G-3’, 2 Chr2 R 5 -ACCGTG GAAAGGAAC AGCTG-3’ ; 1 Chr3 F 5’-TGC TGA AGG TGA CGT TGA TCT G-3’, 1 Chr3 R 5 -CGA CGC CAA CGA GAA GGA-3’; 2 Chr3 F 5’-GCT CCA GTG CTA GAG AGA CAT C-3 ⁇ 2 Chr3 R 5’- AGCCACCCAGTAACCGTTG-3’; Chr4 F 5’-GAT TGG CAA ACC AGC TAC TGC-3’, Chr4 R 5’ -CTGATGGCAAGCTGTTGGC-3’ ; Chr5 F 5’-ATG ATC TGC
  • Code availability Codes for the different analyses are available from the corresponding author upon request for noncommercial use.
  • RNA-seq data from previously published datasets (Anderson, S. N. et al. Developmental Cell 43, 349-358 e344, (2017); Anderson, S. N. et al. The Plant journal 76, 729-741), are available from the NCBI Short Read Archive as Project # SRP119200 and NCBI Gene Expression Omnibus accession number GSE50777.

Abstract

Plants that produce clonal progeny are provided. This can be achieved for example by inducing a mitosis instead of meiosis (MiMe) phenotype in a plant while expressing BABYBOOM in the egg of the plant.

Description

SYNTHETIC APOMIXIS IN A CROP PLANT
CROSS-REFERENCES TO RELATED APPLICATIONS
[0001] The present application claim priority to PCT Application No. PCT/US 17/63249, filed on November 27, 2017 and U.S. Provisional Patent Application No. 62/678,169, filed May 30, 2018, both of which are incorporated by reference for all purposes.
BACKGROUND OF THE INVENTION
[0002] Sexual reproduction in flowering plants involves two fertilization events: fusion of a sperm cell with the egg cell to give a zygote; and fusion of a second sperm nucleus with the central cell nucleus which initiates development of endosperm, the embryo nourishing tissue. Apomixis in nature occurs by a range of alterations to the regular sexual developmental pathway (FIG. 1). The principal functional components of apomixis include (i) the formation of an unreduced female gamete that also retains the parental genotype (apomeiosis), (ii) embryo development without fertilization of the egg cell by sperm (parthenogenesis) and (iii) endosperm development with or without fertilization of the central cell (pseudogamous or autonomous apomixis, respectively).
[0004] Apomixis, asexual reproduction through seeds, results in progeny that are genetic clones of the maternal parent. Cloning through seeds has potential revolutionary applications in agriculture because its introduction into sexual crops would allow perpetuation of any elite heterozygous genotype. However, despite the natural occurrence of apomixis in hundreds of plant species, very few crop species reproduce via apomixis and attempts to introduce this trait by conventional breeding have failed.
BRIEF SUMMARY OF THE INVENTION
[0003] In some embodiments, a plant that produces clonal progeny is provided. In some embodiments, the plant comprises inhibited or mutated gene products that induce a mitosis instead of meiosis (MiME) phenotype and further expresses a BABYBOOM polypeptide in egg cells. [0004] In some embodiments, the plant is a cereal monocot plant. In some embodiments, the plant is a rice plant.
[0005] In some embodiments, the inhibited or mutated gene products comprise (i) OSD1 or an ortholog thereof, (ii) ATREC8 or an ortholog thereof, and (iii) ATSPOl l or an ortholog thereof. In some embodiments, the inhibited or mutated gene products comprise (i) OSD1 or an ortholog thereof, (ii) REC8 or an ortholog thereof, and (iii) PAIR1 or an ortholog thereof. Orthologous sequences can be for example, substantially identical.
[0006] In some embodiments, at least one or all of the gene products is inhibited. In some embodiments, at least one or all of the gene products is mutated to be inactive.
[0007] In some embodiments, the plant is haploid or diploid.
[0008] In some embodiments, the BABYBOOM polypeptide is substantially identical or is at least 70% (e.g., 75, 80, 85, 90, 95, 98, or 99%) identical to any of SEQ ID NOs: 1-3, 5, 7,
9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, or 41. In some embodiments, the BABYBOOM polypeptide is at least 40% identical to SEQ ID NO: 11. In some
embodiments, the BABYBOOM polypeptide is at least 40% identical to SEQ ID NO: 11 over the length of the protein and comprises a middle region that has at least 90% identity to the middle domain of a rice BABYBOOM1 sequence, e.g., SEQ ID NO:2.
[0009] Also provided is a method of making clonal progeny. In some embodiments, the method comprises allowing the plant as described above or elsewhere herein to self-fertilize; and collecting clonal progeny from the plant.
[0010] In some embodiments, one can make clonal plants from a parent plant expressing BABYBOOM in egg cell, e.g., as described in PCT/US 17/63249. This can be achieved, for example, when the parent plant produces gametes (e.g., egg or pollen cells) having the same number of chromosomes as somatic cells in the plant. Thus for example, if the plant is diploid (the somatic tissue is diploid) then the gametes are also diploid. This can be achieved in various ways, for example by inducing a“mitosis instead of meiosis” (MiME) phenotype in the parent plant (in addition to the expression of BABYBOOM). See, e.g., US Patent Publication No. 2012/0042408 and PCT Publication No. WO 2012/075195. In some embodiments, one generates mutations in in each of OSD1, ATREC8, and ATSPOll or orthologs thereof to create the MiME phonotype. See., e.g., D’Erfurth el al, One PLOS 7(6):el000l24 (June 2009) and Brownfield and Kohler, J. Exp. Botany 62(5): 1659-1668 (2011). Some of the resulting progeny of the plants will have the same number of chromosomes as the parent and in some embodiments will be clonal.
BRIEF DESCRIPTION OF THE DRAWINGS
[0011] FIG. 1 - BBM1 induced somatic embryogenesis and gene expression, a,
Somatic embryo-like structures induced by BBM1 ectopic expression in rice leaves. Scale bar, 1 cm. b, Magnified view of a somatic embryo. Scale bar, 0.5 mm. Fourteen of the 20 transgenic plants raised showed the development of such embryo-like structures and they were observed only on adult seedlings, 4th leaf onwards c, Gene expression analysis by RNA-seq in 6 h treated samples from BBM1 :GR seedlings. Of the 162 dex induced genes, the expression of 138 is directly activated by BBM1. d, Confirmation of BBM1 direct upregulation of 3 YUCCA genes by RT-qPCR. e, Autoactivation of BBM1 in 24 h treated samples by RT-qPCR.
[0012] FIG. 2 - Paternal expression and parthenogenesis, a, A SNP (red arrow head), showing expression only from the male allele in hybrid (J, Japonica and I, Indicd) 2.5 HAP zygotes b to d, Confirmation of paternal expression of BBM1 in isogenic zygotes.
Expression is observed only when the BBM:GFP is used as a male parent. Red arrows point to zygote nuclei. Scale bars, 25 pm. e, Development of parthenogenetic embryos (red arrow) in pDD45::BBMl carpels. Scale bar, 100 pm.
[0013] FIG. 3 - Mutant phenotypes of 3 BBM genes a to c, 5 DAP embryos d to f, 10
DAP embryos. Embryos develop normally when BBM1 is wild-type (a and d) but show an early arrest (b and e) or undergo a number of divisions without organ formation (c and f) in bbml bbm2 bbm3 triple homozygous mutants g to i, 10 DAP embryos heterozygous for BBM1 but homozygous mutant for bbm2 and bbm3. They either show a normal development g, are delayed h, or show as early arrest i. Scale bars, 100 pm. sc, scutellum; co, coleoptile; ep, epiblast; ra, radicle; SAM, shoot apical meristem; lp, leaf primordia.
[0014] FIG. 4 - Confirmation of haploids and synthetic apomicts. a, Difference in height between haploid and diploid siblings. Scale bar, 5 cm. b, Anthesis stage control wild- type panicle c, A haploid panicle showing no anthesis. d, A haploid apomictic panicle undergoing anthesis. e, Seed formation on a diploid apomictic progeny panicle. Scale bars b to e, 1 cm. f to k, Flow cytometric DNA histograms for ploidy determination f, Haploid showing a ln peak g, Wild-type diploid with a 2n peak h, A mixed sample of haploid and diploid showing ln and 2n peaks, i, An apomictic haploid (ln). j, Apomictic diploid progeny from a diploid parent with a 2n peak, k, Tetraploid progeny from a diploid apomictic mother (4n peak).
[0015] FIG. 5 - Ectopic overexpression of BBM1. a, Schematic of binary construct between T-DNA borders used for ectopic expression (BBMl-ox). b, Confirmation of BBM1 overexpression by RT-PCR in leaf tissues of transgenic lines. BBM1 does not expresses in wild-type leaves, c, RT-PCR of embryo marker genes to confirm the embryo identity of BBM1 overexpression induced somatic embryos, d to o, phenotypes caused by
BBMloverexpression in vegetative and reproductive organs, d, wild-type anther, e, wild-type pollen, f, BBl-ox anthers, g, Pollenless BBl-ox anthers, h, Wild-type leaf, i, BBl-ox leaf with serrations and long trichomes. j, Wild-type spikelet. k, BBl-ox spikelet with lemma converted to an awn. 1, Wild-type stamen, m, Transparent pollenless BBl-ox stamens, n, Wild-type carpel, o, BBl-ox carpel with fused styles.
[0016] FIG. 6 - Dexamethasone inducible BBM1:GR expression system, a, Schematic of plasmid construct for BBM1-GR for plant transformations, b, Mock treated 2 week-old BBM1-GR seedling, c, DEX treated BBM1-GR seedling showing aerial roots (red arrow). The seedlings were transferred to mock and dex containing media, one week after germination. Scale bars, 2 cm. d, Mock treated BBM1-GR panicle, e, DEX treated BBM1- GR panicle showing awns on florets. Plants were treated with mock or DEX containing water from 45 days after germination till panicles completely emerged out. Scale bars, 2 cm. f and g, Expression of endogenous and GR fused transgenic BBM1 in 6 h, 12 h and 24 h treated samples, h, Schematic showing primer combinations to distinguish between endogenous and GR fused BBM1 transcripts, i, RT-qPCR for fold changes in BBM1-GR transcript in 24 h treated sample.
[0017] FIG. 7 - Male specific expression of BBM1. a to d, Four additional SNPs showing expression only from male allele in 2.5 HAP hybrid zygotes. Red arrow points to SNP. e, Schematic of BBM1-GFP binary construct, f to h, Immunohistochemistry showing expression from both male and female BBM1 alleles in isogenic 6.5 HAP zygote nuclei.
Scale bars, 25 pm. i and j, BBM1-GFP expression in globular stage rice embryos, i, DIC image, j, Florescence image. Scale bars, 200 pm. k, RT-PCR showing BBM1 expression in sperm cells but the transcript is not detected in egg cells. 1 and m, BBM1-GFP expression in sperm cells. 1, DIC image of germinating pollen m, BBM1-GFP expression in sperm cells. Scale bars, 50 pm.
[0018] FIG. 8 - Parthenogenesis induced by BBM1 egg cell expression, a, Schematic showing wild-type expression pattern of BBM1. b, Schematic of binary vector between T- DNA borders for BBM1 egg cell expression c, Schematic representation of hypothesis whether egg cell BBM1 expression induces parthenogenesis d, A developing early stage parthenogenetic embryo. Scale bar, 100 pm.
[0019] FIG. 9 - Genome editing of BBM- like genes in rice a, Mutations in Fl progeny plant used for all the downstream analysis. It is heterozygous for BBM1 with 1 bp deletion. BBM2 is homozygous 25 bp deletion and 1 bp substitution. BBM3 is homozygous 1 bp insertion b, Genotyping of nongerminating seeds. The 1 bp deletion mutation in BBM1 results in disruption a Sphl restriction site d, Additional image of aBBMl heterozygous 10 DAP embryo showing no organ formation e, Representative image of developing naked Fl seeds.
[0020] FIG. 10 - Graphic representation of BBM1 function. BBM1 expression starts in sperm cells. During early zygotes development after fertilization, it expresses only from male allele which is essential for initiation of embryogenesis. Since BBM1 can auto activate its own expression, male expressed BBM1 probably activates expression form the female allele. The expression in the later stage embryos is essential for organ morphogenesis.
[0021] FIG. 11 - Haploid phenotypes in rice, a, A control diploid sibling panicle showing fertile florets b, A haploid panicle with infertile florets c, Size difference in haploid and control diploid florets d and e, Difference in the size of floral organs between haploid and wild-type diploid f to i, Pollen viability in haploids. f and g, Wild-type anther showing viable pollen h and i, An anther showing nonviable pollen in haploid.
[0022] FIG. 12 - Synthetic apomixis in rice, a, Schematic of CRISPR-Cas9 plasmid construct used for genome editing 3 MiMe rice genes, b, Schematic of genome integrated pDD45::BBMl. c, Panicle of a control MiM plant. Scale bar, 2 cm. d, Panicle of an apomictic haploid plant showing fertile seeds. Scale bar, 2 cm. e, Control wild-type anther. Scale bar, 0.2 mm. f, Wild-type pollen. Scale bar, 100 pm. g, Anther from an apomictic haploid showing viable pollen. Scale bar, 0.2 mm. h, Zoomed in image of viable haploid apomictic pollen. Scale bar, 100 pm. i, Size comparison of progeny seeds from a synthetic apomictic haploid (left), control wild-type diploid (middle) and an apomictic diploid (right). [0023] FIG. 13 - Sexual reproduction vs synthetic apomixis. a, Schematic
representation of sexual reproduction which involves reduction and recombination during meiosis. During fertilization, different gametes combine to form a diploid progeny. Both these processes result in loss of vigor in hybrids b, Synthetic apomixis uses MiMe to skip meiosis which results in an unrecombined and unreduced (2n) egg cell. This (2n) egg cell is converted parthenogenetically into a clonal embryo by BBM1 expression. Normal endosperm forms in both pathways by fertilization of central cell by a sperm cell.
[0024] FIG. 14 - Confirmation of synthetic apomixis clonal progeny, a, Sequence chromatograms of wild-type sequences at mutation sites b, Mutant sequences in TO diploid apomixis mother plant c, Sequences of a representative Tl apomixis progeny. Sequences are shown for 3 MiMe genes, of which PAIR1 and RIB 'S are biallelic. Tl diploid progeny and TO mother plants have same mutations, indicating absence of segregation and thus clonal propagation.
[0025] FIG. 15 - Paternal expression of BBM1 in zygotes. 15a, Paternal allele-specific expression of BBM1 in isogenic zygotes at 2.5 HAP. Expression of BBM1 fusion to a GFP reporter was detected by antibody staining. GFP expression is observed only when BBM1- GFP is transmitted by the male parent (n=20 for each panel, c2 test P=0.039). (left panel n=l 1/20, middle n=9/20, right n=0/20) Red arrows point to zygote nuclei. Scale bars, 25 pm. 15b, Development of parthenogenetic embryos (red arrow head) by egg cell-specific expression of BBM1 in carpels of emasculated BBM1-QQ plant at 9 days after emasculation (n=l2/98). In the absence of fertilization, endosperm development is not observed (black arrow). In fertilized control wild-type (4 DAP) carpels both embryo (red arrow head) and endosperm development (black arrow) is observed (n=30). em, embryo; en, endosperm. Scale bar, 100 pm.
[0026] FIG. 16 - Phenotypes of bbml bbm2 bbm3 mutant embryos and haploid induction, a, 5 DAP and 10 DAP embryos. Embryos develop normally when BBM1 is wild- type (n=50; left panels) but show an early arrest (n=24/82; middle panels) or undergo a number of divisions without organ formation (n=58/82; right panels) in bbml bbm2 bbm3 triple homozygous mutant embryos b, 10 DAP embryos heterozygous for BBM1 but homozygous mutant for bbm2 and bbm3. They either show normal development (n= 38/53, left panel), are delayed (n=8/53; middle panel), or show early arrest (n=4/53; right panel). Scale bars, 100 pm. sc, scutellum; co, coleoptile; ep, epiblast; ra, radicle; SAM, shoot apical meristem; lp, leaf primordia. c, Schematic model of BBM1 function in rice embryogenesis. d to f, Characterization of BBMI-QQ induced haploids. d, Difference in height between parthenogenetic haploid and sexual diploid siblings (n=555). Scale bar, 5 cm. e, A BBMI-QQ parthenogenetic haploid panicle showing no anthesis (right) compared to an anthesis stage control wild-type panicle (n=H3). f, Flow cytometric DNA histograms for ploidy determination. Parthenogenetic haploid showing a ln peak (n=l9, upper panel), wild-type diploid with a 2n peak (middle) and a mixed sample of BBMI-QQ and wild-type showing ln and 2n peaks.
[0027] FIG. 17 - Characterization of asexually-derived (apomictic) haploids and diploids, a, An S-Apo haploid (n=45) and S-Apo diploid panicle (n=57) undergoing anthesis. Scale bar 1 cm. b, Comparison of wild-type, S-Apo diploid (n=57/38l) and sexual tetraploid (n=324/38l) progeny plants. Scale bar, 5 cm. c and d, Schematic showing difference between natural meiosis mdMiMe. While meiosis and fertilization produce recombined haploid gametes and diploid progeny. MiMe leads to diploid gamete formation that are clones of mother plant. Parthenogenesis of diploid egg cell produces clonal progeny and fertilization of diploid gametes leads to 4n sexual progeny e, Flow cytometric DNA histograms for ploidy determination of S-Apo plants. An S-Apo haploid (ln, upper panel, n=30), S-Apo diploid progeny of a diploid S-Apo parent shows a 2n peak (n=26; middle panel) and a sexual tetraploid progeny of a diploid S-Apo parent, shows a 4n peak (n=90). X-axis is the measure of relative florescence and Y-axis shows number of nuclei f, Chromosomal view showing 57 heterozygous SNPs (position in Mb) identified in the TO S-Apo mother plant of Line# 1. The SNPs labelled in red are those additionally confirmed by PCR.
[0028] FIG. 18 - #BM/-induced somatic embryogenesis and auto-activation. l8a, Schematic of binary construct between T-DNA borders used for ectopic expression ( BBM1 - ox). l8b, Somatic embryo-like structures induced by BBM1 ectopic expression in rice leaves (n=l4/20 transgenic lines). Scale bar, 1 cm. Magnified view of a somatic embryo (inset). Scale bar, 0.5 mm. Fourteen of the 20 transgenic plants raised showed the development of such embryo-like structures observed on adult seedlings from the 4th leaf onwards. l8c, Confirmation of ectopic BBM1 overexpression by RT-PCR in leaf tissues of transgenic lines. BBM1 does not expresses in wild-type leaves (n=2 independent replicates). l8d, RT-PCR of embryo marker genes to confirm the embryo identity of BBM1 overexpression induced somatic embryos. OsH /. Oryza sativa HOMEOBOX1 md LEd, LEAFY
COTYLEDON 7(n=2 independent biological replicates). l8e, Schematic of plasmid construct for Dexamethasone (DEX) inducible BBM1-GR expression system. l8f, Schematic showing primer combinations to distinguish between endogenous BBM1 and BBM1-GR fusion transcripts. l8g, RT-qPCR for fold changes in BBM1-GR fusion transcript in 24h treated samples showing essentially no differences between treatments (n=2 independent biological replicates (see methods), mean ± s.e.m, each data point represents average fold change from 3 replicates). l8h, Autoactivation of BBM1 in 24 h DEX-treated samples detected by RT-qPCR (n=2 independent biological replicates (see methods), mean ± s.e.m., each data point represents average of log2 fold change from 3 replicates).
[0029] FIG. 19 - BBM1 expression in zygotes and gametes. l9a, RT-PCR sequenced 5 SNPs (red arrow), showing expression only from the male allele in hybrid (J Japonica and I, indica) 2.5 HAP zygotes (n=2, biological replicates). l9b, Schematic of BBM1-GFP binary construct. l9c, Immunohistochemistry showing expression from both male and female BBM1 alleles in isogenic 6.5 HAP zygote nuclei (n=20), as compared to male-specific expression at 2.5 HAP (FIG. la). Scale bars, 25 pm. l9d, Holistic view of a 6.5 HAP embryo sac showing BBM1-GFP expression in zygote nucleus (left panel), while as in the same embryo sac expression is not detected in the dividing endosperm (right panel), zg, zygote; en, endosperm (n=20). Scale bar 100 pm. l9e, BBM1-GFP expression in globular stage rice embryos (white arrow head, n=30). DIC image (left panel), florescence image (right panel). Scale bars, 200 pm. l9f, RT-PCR showing BBM1 expression in sperm cells, but the transcript is not detected in egg cells (n=2 independent biological replicates). Primers used for detecting BBM1 transcript span an intron (see Methods), g, BBM1-GFP expression in sperm cells (white arrow head points to sperm nuclei, n=20). DIC image (left panel) and fluorescent image (right panel) of a germinating pollen grain showing BBM1-GFP expression in the two sperm cell nuclei.
[0030] FIG. 20 - Parthenogenesis induction by expression of BBM1 in the egg cell.
20a, Schematic showing wild-type expression pattern of BBM1. 20b, Sketch of T-DNA region of binary vector used for BBM1 egg cell expression. 20c, Schematic representation of hypothesis that egg cell expression of BBM1 can induce parthenogenesis. 20d, A
degenerating parthenogenetic embryo ( BBM1-QQ ) at 9 days after emasculation (red arrow head). No endosperm development (black arrow) is observed in emasculated carpels leading to abortion of embryos (n=l2/98). Scale bar, 100 pm. [0031] FIG. 21 - CRISPR-Cas9 edited mutations in BBM1-3 genes in rice. 2la, DNA sequences of mutations in bbml/bbml bbm3/bbm3 plants. 2lb, DNA sequences of mutations in bbm2/bbm2 bbm3Zbbm3 plants, a and b, were chosen as parents for crosses to generate the bbml bbm2 bbm3 triple homozygous mutants shown in c and d. 2lc, Mutations in Fl progeny plant. It is heterozygous for BBM1 and BBM2, and biallelic for BBM3. 2ld, Mutations in F2 progeny plant used for genetic analysis. The plant is heterozygous for BBM1 with a 1 bp deletion. The BBM2 locus has a homozygous 25 bp deletion and 1 bp
substitution, and BBM3 locus is homozygous mutant with 1 bp insertion. 2le, Genotyping of nongerminating seeds (n=8). The 1 bp deletion mutation in BBM1 results in disruption of an Sphl restriction site. 2lf, Seed lethality in bbml bbm2 bbm3 triple homozygous plants. Upper panels show germinating one week old wild-type seeds (n=30). Scale bar, 1 cm. Right panel shows a magnified view. Lower panels show nongerminating seeds of bbml bbm2 bbm3 triple homozygous plants (n=70). Lower right panel is a zoomed in image of a
nongerminating bbml bbm2 bbm3 seed, one week after plating. No seedling emerged from the embryo site (red arrow head). 2lg, Additional image of a BBMl/bbml heterozygous bbm2/bbm2 bbm3/bbm3 homozygous 10 DAP embryo (n=3/53) showing no organ formation, similar to triple homozygote phenotype (see FIG. l6a). Scale bar, 100 pm.
[0032] FIG. 22 - Haploid induction and synthetic apomixis. Haploids shown are derived from BBMI-ee diploids by parthenogenesis. 22a, A control diploid sibling panicle with fertile florets (n=442 plants). Scale bar, lcm. 22b, A haploid panicle with infertile florets (n=l 13 plants). Scale bar, 1 cm. 22c, Differences in floret and floral organ sizes between haploid and control diploid. Left panels, BBMI-ee haploid; right panels, control wild-type (n=20). Scale bar, lmm. 22d, Pollen viability in haploids by Alexander staining. Control wild-type anther with viable pollen (upper panel, h=10). BBMI-ee haploid anther with nonviable pollen (lower panels, n=20). Scale bar, left panels 0.5 mm, right panels 200 pm. 22e and 22f, Sexual reproduction vs. asexual reproduction through seed (synthetic apomixis). 22e, Schematic representation of sexual reproduction. Gametes form by meiotic recombination and division; fertilization and gamete fusion give rise to diploid progeny. 22f, Synthetic apomixis. MiMe omits meiosis and gives an unrecombined and unreduced (2n) egg cell. The 2n egg cell is converted parthenogenetically into a clonal embryo by BBMI-ee. The endosperm forms in both pathways by fertilization of central cell (homodiploid in wild-type and tetraploid in synthetic apomicts) by a sperm cell (haploid in wild-type and diploid in synthetic apomicts). The maternal: paternal genome ratio of 2: 1 is maintained in the endosperm in both the pathways, ensuring normal seed development.
[0033] FIG. 23 - Asexual propagation through seed in rice. 23a, Schematic of CRISPR-
Cas9 plasmid construct used for genome editing of the three MiMe rice genes (upper panel). Schematic of genome integrated pDD45: :BBMl in the BBMI-QQ plants (lower panel). 23b, DNA histogram of flow cytometric peak showing 4n ploidy in Tl progeny (n=33/33 tested) of a control TO MiMe plant. 23c, Panicle of a control TO diploid MiMe plant with fertile seeds (left). A tetraploid Tl MiMe panicle (middle), exhibiting complete infertility, i.e., no seed filling, and larger flowers (note scale bars), with awns (white arrow head). Awns are normally suppressed in most japonica rice cultivars including Kitaake. All Tl MiMe progeny (n=l39) were scored for the phenotype of complete infertility and presence of awns, including 33 plants that were additionally confirmed in part b by flow cytometry. Panicle of an S-Apo haploid plant showing fertile seeds (right, n=45). Scale bar, 2 cm. 23d, Wild-type and S-Apo haploid anthers, showing viable pollen (n=l5). Scale bar, 0.2 mm for upper panels and 100 pm for lower panels. 23e, Comparison of panicles from wild type (left), with diploid clonal progeny (57/381) and sexual tetraploid progeny (n=324/38l) from a diploid S-Apo plant (right). White arrow head show awns in tetraploid. Scale bar, 2 cm. 23f, Size comparison of progeny seeds from control wild-type, a synthetic S-Apo haploid, a control MiMe, a synthetic S-Apo diploid clone, and an infrequent (3%) filled seed produced by the sexual tetraploid progeny of an S-Apo diploid (h=100 for each genotype). Scale bar, 2 mm. 23g, Comparison of seed size between control MiMe, diploid S-Apo line #1, diploid S-Apo line #5, and double-haploid S-Apo line DH2 (h=100 for each transgenic line). No noticeable variation in seed size is observed. Scale bar, 2 mm.
[0034] FIG. 24 - MiMe mutations and confirmation of clonal progeny from S-Apo plants. 24a, Sequence chromatograms at mutation sites of MiMe genes in wild-type, TO diploid S-Apo mother plant and two diploid progeny from each of Tl, T2 and T3 generations of S-Apo line#l (n=7). Red arrows point to mutation sites. PAIR1 md REC8 are biallelic while as OSD 1 is homozygous. 24b, Sequences of the TO S-Apo mother plant and 5 Tl S-Apo diploid progeny at MiMe mutation sites and one heterozygous SNP in apomixis line#5 (n=6). Red arrows show the mutation sites/SNP. All the three MiMe mutations i.e., OSD I. PAIR1 and REC8 are biallelic. All the progeny across different generations in both the S-Apo lines have same mutations as the TO mother plants, indicating absence of segregation and thus clonal propagation. [0035] FIG. 25 - Confirmation of SNPs by PCR. Sequence chromatograms of 11 SNPs are shown for wild-type, TO diploid S-Apo mother plant and 2 diploid S-Apo progeny from each of the Tl, T2 and T3 generations for line#l (n=7). All the 11 SNPs were found to be present in TO mother plant and all the progeny across different generations, confirming there is no segregation; thus clonal propagation. Red arrow shows SNP location. Chr, chromosome and the numbers indicate the position on the respective chromosome.
[0036] Table 1 - Expression of four BBM genes in rice gametes and zygotes. PPM/, BBM2 and BBM4 express in sperm cells. None of the 4 BBM genes express in egg cells. All except BBM4 , express in zygotes. The expression is presented as total read counts. EC, egg cell; Sp, sperm; Z, zygote. Roman numerals represent biological replicates and 2.5, 5 and 9 is time in hours after pollination (HAP).
[0037] Table 2 - Summary of seed sterility in bbml/BBMl heterozygous, bbm2/bbni2, bbm3/bbm3 homozygous mutant plants. The Chi-square goodness of fit test value between expected and observed values is 68.623 and the P-value is < 0.001.
[0038] Tables 3A and 3B - Crosses to show paternal allele specific expression of BBM1 is required for embryo development in rice.
[0039] Table 4 - A total of 138 genes are upregulated at FDR < 0.05 and log2 fold change of >1. The negative (-) sign in log fold change indicates up-regulation.
[0040] The two YUCCA genes LOC_OsOlgl67l4 and LOC_Os07g25540 are statistically insignificant either in one or both the treatemnts. However, they are upregulated by BBM1 in both the treatments.
[0041] Table 5 - Functional characterization of BBM genes in rice, a, Expression of four PPM-like genes in rice gametes and zygotes from previous studies11· 15 presented as reads per million averaged from three replicates. Z2.5, Z5 and Z9 columns are from isogenic japonica zygotes at 2.5, 5 and 9 hours after pollination (HAP) respectively. Jxl and IxJ columns are hybrid zygotes from crosses, the female parent is listed first. EC, egg cell; SpC, sperm cell; Z, zygote; J Japonica,· I, indica. b, Summary of seed viability in progeny of BBM1/ bbml bbm2/bbm2 bbm3/bbm3 mutant plants. A loss of viability was observed, as -36% (106/297) of seeds fail to germinate. Of the germinated seedlings, only 1% (2/191) were triple homozygotes, instead of the expected 25% if there is no effect of genotype on viability, c and d, Dependence of seed viability on paternal allele transmission of BBML c, When the bbml allele is transmitted by the male parent, ~27 % of the genotyped
heterozygotes fail to germinate (23/(23+62)), despite a functional BBM1 allele inherited from the female parent, d, All seeds germinate when the mutant bbml allele is transmitted by the female parent (n=67).
*The Chi-square value for goodness-of-fit between the expected Mendelian 1:2: 1 ratio and the observed data is 68.623; the corresponding right-tail P-value is l.7l4e-l5.
**The two-tailed Fisher's exact test P- value is 0.0001, for the genotyped non-germinating seeds to contain all heterozygotes and no wild-types.
[0042] Table 6 - Haploid induction and clonal propagation in rice, a, Haploid induction in BBMI-QQ (pDD45::BBMl) transgenic plants. The TO primary transformants were hemizygous for the BBMI-QQ transgene. One diploid Tl plant #8c from transformant #8, was maintained as a haploid inducer line up to the T7 generation, b, Identification of synthetic haploid and diploid apomictic progeny from S-Apo ( MiMe + BBMI-QQ) plants of transformant lines #1 and #5. For T2 and subsequent generations, propagation was performed by selecting from each generation, haploid and diploid progeny respectively. DH#2 refers to a doubled haploid derived from self-pollination of Tl plants of the haploid apomixis line#2.
[0043] Table 7 - Heterozygous SNPs identified in MT0, and their corresponding allele fraction in WT and progeny samples. The chromosomal location of SNPs identified as heterozygous in the TO mother plant by genome sequencing and GATK variant calling (see methods), indicating the reference (REF) and alternate (ALT) alleles. Quality by depth (QD) and Strand Odds Ratio (SOR) are quality measures used for ensuring a high-confidence set of SNPs. For TO mother and the four progeny, the alternate allele fraction (AF), read depth (DP) and overall genotype quality score from GATK are reported. For the wild-type sample, no quality score is reported as these were not called as heterozygous.
DEFINITIONS
[0044] An "endogenous" or "native" gene or protein sequence, as used with reference to an organism, refers to a gene or protein sequence that is naturally occurring in the genome of the organism.
[0045] A polynucleotide or polypeptide sequence is "heterologous" to an organism or a second polynucleotide sequence if it originates from a foreign species, or, if from the same species, is modified from its original form. For example, when a promoter is said to be operably linked to a heterologous coding sequence, it means that the coding sequence is derived from one species whereas the promoter sequence is derived from another, different species; or, if both are derived from the same species, the coding sequence is not naturally associated with the promoter (e.g., is a genetically engineered coding sequence, e.g., from a different gene in the same species, or an allele from a different ecotype or variety).
[0046] The term "promoter," as used herein, refers to a polynucleotide sequence capable of driving transcription of a coding sequence in a cell. Thus, promoters can include c/.v-acting transcriptional control elements and regulatory sequences that are involved in regulating or modulating the timing and/or rate of transcription of a gene. For example, a promoter can be a c/.v-acting transcriptional control element, including an enhancer, a promoter, a transcription terminator, an origin of replication, a chromosomal integration sequence, 5' and 3' untranslated regions, or an intronic sequence, which are involved in transcriptional regulation. These c/.v-acting sequences typically interact with proteins or other biomolecules to carry out (turn on/off, regulate, modulate, etc.) gene transcription. A "plant promoter" is a promoter capable of initiating transcription in plant cells. A "constitutive promoter" is one that is capable of initiating transcription in nearly all tissue types, whereas a "tissue-specific promoter" initiates transcription only in one or a few particular tissue types.
[0047] The term "operably linked" refers to a functional linkage between a nucleic acid expression control sequence (such as a promoter, or array of transcription factor binding sites) and a second nucleic acid sequence, wherein the expression control sequence directs transcription of the nucleic acid corresponding to the second sequence.
[0048] The term "plant" includes whole plants, shoot vegetative organs and/or structures (e.g., leaves, stems and tubers), roots, flowers and floral organs (e.g., bracts, sepals, petals, stamens, carpels, anthers), ovules (including egg and central cells), seed (including zygote, embryo, endosperm, and seed coat), fruit (e.g., the mature ovary), seedlings, plant tissue (e.g., vascular tissue, ground tissue, and the like), cells (e.g., guard cells, egg cells, trichomes and the like), and progeny of same. The class of plants that can be used in the method of the invention is generally as broad as the class of higher and lower plants amenable to transformation techniques, including angiosperms (monocotyledonous and dicotyledonous plants), gymnosperms, ferns, and multicellular algae. It includes plants of a variety of ploidy levels, including aneuploid, polyploid, diploid, haploid, and hemizygous. [0049] A "transgene" is used as the term is understood in the art and refers to a
heterologous nucleic acid introduced into a cell by human molecular manipulation of the cell's genome ( e.g by molecular transformation). Thus, a "transgenic plant" is a plant that carries a transgene, i.e., is a genetically-modified plant. The transgenic plant can be the initial plant into which the transgene was introduced as well as progeny thereof whose genomes contain the transgene. In some embodiments, a transgenic plant is transgenic with respect to the BABYBOOM gene. In some embodiments, a transgenic plant is transgenic with respect to one or more genes other than the BABYBOOM gene.
[0050] The phrase "nucleic acid" or "polynucleotide sequence" refers to a single or double- stranded polymer of deoxyribonucleotide or ribonucleotide bases read from the 5' to the 3' end. Nucleic acids may also include modified nucleotides that permit correct read through by a polymerase, and/or formation of double-stranded duplexes, and do not significantly alter expression of a polypeptide encoded by that nucleic acid.
[0051] The phrase "nucleic acid sequence encoding" refers to a nucleic acid which directs the expression of a specific protein or peptide. The nucleic acid sequences include both the DNA strand sequence that is transcribed into RNA and the RNA sequence that is translated into protein. The nucleic acid sequences include both the full length nucleic acid sequences as well as non-full length sequences derived from the full length sequences. It should be further understood that the sequence includes the degenerate codons of the native sequence or sequences which may be introduced to provide codon preference in a specific host cell.
[0052] The terms "identical" or percent "identity," in the context of two or more nucleic acids or polypeptide sequences, refer to two or more sequences or subsequences that are the same or have a specified percentage of nucleotides or amino acid residues that are the same, when compared and aligned for maximum correspondence over a comparison window, as measured using one of the following sequence comparison algorithms or by manual alignment and visual inspection. Two nucleic acid sequences or polypeptides are said to be "identical" if the sequence of nucleotides or amino acid residues, respectively, in the two sequences is the same when aligned for maximum correspondence as described below. When percentage of sequence identity is used in reference to proteins or peptides, it is recognized that residue positions that are not identical often differ by conservative amino acid substitutions, where amino acids residues are substituted for other amino acid residues with similar chemical properties (e.g., charge or hydrophobicity) and therefore do not change the functional properties of the molecule. Where sequences differ in conservative substitutions, the percent sequence identity may be adjusted upwards to correct for the conservative nature of the substitution. Means for making this adjustment are well known to those of skill in the art. Typically this involves scoring a conservative substitution as a partial rather than a full mismatch, thereby increasing the percentage sequence identity. Thus, for example, where an identical amino acid is given a score of 1 and a non-conservative substitution is given a score of zero, a conservative substitution is given a score between zero and 1. The scoring of conservative substitutions is calculated according to, e.g., the algorithm of Meyers & Miller, Computer Applic. Biol. Sci. 4: 11-17 (1988) e.g., as implemented in the program PC/GENE (Intelligenetics, Mountain View, California, USA).
[0053] The phrase "substantially identical," used in the context of two nucleic acids or polypeptides, refers to a sequence that has at least 50% sequence identity with a reference sequence (e.g., any of SEQ ID NOs: 1, 2, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, or 41 as provided herein or any of the sequences referenced herein for any of OSD1, Cyclin-A CYCAl;2 (TAM), SPOl l-l, SPOl l-2, PRD1, PRD2, PAIR1, DYAD, or REC8 proteins). Alternatively, percent identity can be any integer from 50% to 100%. Some embodiments include at least: 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, compared to a reference sequence using the programs described herein; preferably BLAST using standard parameters, as described below.
[0054] For sequence comparison, typically one sequence acts as a reference sequence, to which test sequences are compared. When using a sequence comparison algorithm, test and reference sequences are entered into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. Default program parameters can be used, or alternative parameters can be designated. The sequence comparison algorithm then calculates the percent sequence identities for the test sequences relative to the reference sequence, based on the program parameters.
[0055] A "comparison window", as used herein, includes reference to a segment of any one of the number of contiguous positions selected from the group consisting of from 20 to 600, usually about 50 to about 200, more usually about 100 to about 150 in which a sequence may be compared to a reference sequence of the same number of contiguous positions after the two sequences are optimally aligned. Methods of alignment of sequences for comparison are well-known in the art. Optimal alignment of sequences for comparison can be conducted, e.g., by the local homology algorithm of Smith & Waterman, A civ. Appl. Math. 2:482 (1981), by the homology alignment algorithm of Needleman & Wunsch, J. Mol. Biol. 48:443 (1970), by the search for similarity method of Pearson & Lipman, Proc. Nat'l. Acad. Sci. USA 85:2444 (1988), by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, WI), or by manual alignment and visual inspection.
[0056] Algorithms that are suitable for determining percent sequence identity and sequence similarity are the BLAST and BLAST 2.0 algorithms, which are described in Altschul el al. (1990) J. Mol. Biol. 215: 403-410 and Altschul et al. (1977) Nucleic Acids Res. 25: 3389- 3402, respectively. Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information (NCBI) web site. The algorithm involves first identifying high scoring sequence pairs (HSPs) by identifying short words of length W in the query sequence, which either match or satisfy some positive-valued threshold score T when aligned with a word of the same length in a database sequence. T is referred to as the neighborhood word score threshold (Altschul et al, supra). These initial neighborhood word hits acts as seeds for initiating searches to find longer HSPs containing them. The word hits are then extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Cumulative scores are calculated using, for nucleotide sequences, the parameters M (reward score for a pair of matching residues; always >0) and N (penalty score for mismatching residues; always <0). For amino acid sequences, a scoring matrix is used to calculate the cumulative score. Extension of the word hits in each direction is halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative-scoring residue alignments; or the end of either sequence is reached. The BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment. The BLASTN program (for nucleotide sequences) uses as defaults a word size (W) of 28, an expectation (E) of 10, M=l, N=-2, and a comparison of both strands. For amino acid sequences, the BLASTP program uses as defaults a word size (W) of 3, an expectation (E) of 10, and the BLOSUM62 scoring matrix ( see Henikoff & Henikoff, Proc. Natl. Acad. Sci. USA 89: 10915 (1989)).
[0057] The BLAST algorithm also performs a statistical analysis of the similarity between two sequences (see, e.g., Karlin & Altschul, Proc. Nat'l. Acad. Sci. USA 90:5873-5787 (1993)). One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance. For example, a nucleic acid is considered similar to a reference sequence if the smallest sum probability in a comparison of the test nucleic acid to the reference nucleic acid is less than about 0.01, more preferably less than about 10'5, and most preferably less than about 10'20.
[0058] An "expression cassette" refers to a nucleic acid construct that, when introduced into a host cell, results in transcription and/or translation of an RNA or polypeptide, respectively.
DETAILED DESCRIPTION OF THE INVENTION
[0059] The inventors have discovered how to generate clonal progeny from a plant by inducing the mitosis instead of meiosis (MiME) phenotype in a plant while also expressing a BABYBOOM gene product in the eggs of the plant. The resulting plant, when self-fertilized, will produce clonal progeny, i.e., progeny that are identical to the parent plant.
[0060] Methods for generation of plants having the MiME phenotype are known. See, e.g., US Patent Publication No. 2012/0042408; US Patent Publication No. 2014/0298507, and PCT Publication No. WO 2012/075195. A plant having the MiMe (mitosis instead of meiosis) genotype is a plant in which a deregulation of meiosis results in a mitotic-like division and in which meiosis is replaced by mitosis. MiMe plants are exemplified by MiMe- 1 plants as described by d'Erfurth, I. et al. Turning meiosis into mitosis. PLoS Biol 7, el000l24 (2009) and International patent application W02001/079432, published Jul. 15, 2010) and MiMe-2 plants as described by d'Erfurth, I. et al. The cyclin-A CYCAl;2/TAM is required for the meiosis I to meiosis II transition and cooperates with OSD1 for the prophase to first meiotic division transition. PLoS Genet 6, el000989 (2010). Each of these three references is incorporated by reference herein in its entirety to provide details of plants having the MiMe genotype and the OSD1 gene and the TAM gene (also designated
CYCLIN-A CYCAl;2/TAM, which encodes the Cyclin A CycAl;2 protein) and to provide methods for making MiMe plants. Additional detailed methods provided in these references include sources of plant material, plant growth conditions, genotyping employing PCR and primers useful for such genotyping, and methods of cytology and flow cytometry. These references also provide details of specific mutants employed to produce MiMe plants. In some embodiments, the MiMe phenotype is induced by inhibiting or mutating OSD1 or an ortholog thereof, REC8 or an ortholog thereof, and at least one of SPOl 1 or PRD1, or PRD2 (see, e.g., Mieulet D., Cell Res. 2016 Nov; 26(11): 1242-1254).
[0061] Mercier, R. & Grelon M. Meiosis in plants: ten years of gene discovery Cytogeneti Genome Res 120:281-290 (2008) provides a review of plant meiotic genes that have been functionally characterized, particularly in Arabidopsis, rice and maize. This reference provides an overview of methods employed for such characterization.
[0062] Plants having the MiMe genotype produce functional (e.g., diploid) gametes that are genetically identical to their parent. Exemplary MiMe plants combine phenotypes of (1) no second meiotic division, (2) no recombination and (3) modified chromatid segregation.
[0063] Exemplary MiMe-l plants combine inactivation of the OSD1 gene, with the inactivation of two or more other genes, one which encodes a protein necessary for efficient meiotic recombination in plants (e.g., SPOl 1-1, SPOl 1-2, PRD1, PRD2, or PAIR1), and whose inhibition eliminates recombination and pairing [Grelon M, Vezon D, Gendrot G, & Pelletier G. AtSPOl 1-1 is necessary for efficient meiotic recombination in plants. EMBO Journal 20, 589-600 (2001)], and another which encodes a protein necessary for the monopolar orientation of the kinetochores during meiosis, e.g., REC8, and whose inhibition modifies chromatid segregation [Chelysheva L, Diallo S, & Vezon D, AtREC8 and AtSCC3 are essential to the monopolar orientation of the kinetochores during meiosis. Journal of Cell Science 118, 4621-4632. (2005)]. Exemplary MiMe-2 plants combine inactivation of the TAM gene [d'Erfurth, I. et al. (2010)] with the inactivation of two or more other genes, one which encodes a protein necessary for efficient meiotic recombination in plants (e.g., SPOl 1- 1, SPOl 1-2, PRD1, PRD2, or PAIR1), and whose inhibition eliminates recombination and pairing [Grelon et al, (2001)], and another which encodes a protein necessary for the monopolar orientation of the kinetochores during meiosis, e.g., REC8, and whose inhibition modifies chromatid segregation [Chelysheva et al (2005)]. MiMe-l plants are distinguished from MiMe-2 in that MiMe-l plants are generally more efficient for production of 2N female gametes. For example, in Arabidopsis thaliana specific MiMe-2 mutants generate .about.30% of 2N female gametes, compared to 80% in comparable MiMe-l mutants [d'Erfurth, I. et al. (2009) and d'Erfurth, I. et al. (2010)].
[0064] Inactivation of the OSD1 gene (omission of second division) in plants results in the skipping of the second meiotic division. This generates diploid male and female spores, giving rise to viable diploid male and female gametes, which are SDR gametes. The sequence of the OSD1 gene of Arabidopsis thaliana is available in the TAIR database under the accession number At3g57860, or in the GenBank database under the accession number
NM _ 115648. This gene encodes a protein of 243 amino acids (GenBank NP _ 191345), whose sequence is also represented in the enclosed sequence listing as SEQ ID No. 1, Table 1 of US Patent Publication No. 2014/0298507. The OSD1 gene of Arabidopsis thaliana had previously been designated "UVI4-Like" gene (UVI4-L), which describes its paralogue UVI4 as a suppressor of endo-reduplication and necessary for maintaining the mitotic state (Hase et al. Plant J, 46, 317-26, 2006). However, OSD1 (UVI4-L) does not appear to be required for this process, but is necessary for allowing the transition from meiosis I to meiosis II. An ortholog of the OSD1 gene of Arabidopsis thaliana has been identified in rice (Oryza sativa). The sequence of this gene is available as accession number Os02g37850 in the TAIR database and the gene encodes a protein of 234 amino acid (sequence provided as SEQ ID No. 2, Table 2 of US Patent Publication No. 2014/0298507). The OSD1 proteins of
Arabidopsis thaliana and Oryza sativa have 23.6% sequence identity and 35% sequence similarity over the whole length of their sequences. A plant producing Second Division Restitution 2N gametes can, for example, be obtained by inhibition in the plant of an OSD1 protein. Table 13 (SEQ ID Nos. 24-46 of US Patent Publication No. 2014/0298507) provides additional exemplary OSD1/UV14 protein sequences. FIG. 3 of US Patent Publication No. 2014/0298507 includes a list of the OSD1/UV14 protein sequences of Tables 1, 2 and 13 in US Patent Publication No. 2014/0298507 and an NJ (Neighbor-joining) tree of these sequences.
[0065] Inactivation of the TAM gene in plants can result in skipping of the second meiotic division giving a phenotype similar to that of osdl mutants leading to the production of dyads of spores and diploid gametes that have undergone recombination. More specifically, Arabidopsis mutants including tam-2, tam-3, tam-4, tam-5, tam-6 and tam-7 as described in d'Erfurth, I. et al. (2010) express the dyad phenotype at normal growing temperatures and systematically produce mostly dyads. Plant mutants exhibiting inactivation of the TAM gene as in such mutants are useful in preparation of MiMe-2 plants. In contrast, Arabidopsis mutants such as tam-l [Magnard, J.-L., Yang, M., Chen, Y.-C. S., Leary, M. & McCormick, S. The Arabidopsis gene Tardy Asynchronous Meiosis is required for the normal pace and synchrony of cell division during male meiosis Plant Physiol. 127: 1157-1166 (2001)] which exhibit a delay in the progression of meiosis and progress beyond the dyad stage are not useful in preparation of MiMe-2 plants. The TAM gene encodes a protein exhibiting cyclin- dependent protein kinase activity. The sequence of the TAM gene of Arabidopsis thaliana is available in the TAIR database under the accession number Atl G77390 (Table 9, SEQ ID No. 9 of US Patent Publication No. 2014/0298507). This gene encodes a protein of 442 amino acids (GenBank NP 177863). Cycbn-dependent kinases are reported to be highly conserved among plants and a CycAl;2 gene has been identified in rice (La, H., Li, J., Ji, Z., Cheng, Y., Li, X., Jiang, S., Venkatesh, P. N. & Ramachandran, S. Genome-wide analysis of cyclin family in rice (Oryza Sativa L.) Mol. Gen Genomics 275:374-386 (2006)]. A Cyclin- Al-2 protein of rice (Accession Q0JPA4-1 in UniProtKB/Swiss-Prot. Database) is identified as having 477 amino acid (Table 10, SEQ ID No. 10 of US Patent Publication No.
2014/0298507). A plant producing Second Division Restitution 2N gametes can, for example, be obtained by inhibition in the plant of an TAM (CycAl;2) protein. Table 12 of US Patent Publication No. 2014/0298507 provides the protein sequence of CYCA1; 2 of A. lyrata (SEQ ID No. 23 of US Patent Publication No. 2014/0298507).
[0066] DYAD is a gene in Arabidopsis that is required for meiotic chromosome
organization and female meitoci progression (Agashe et al, Development 129:3935-3943, 2002). Disruption of DYAD can result in conversion fo meiosis to mitosis. An illustrative Arabidopsis DYAD cDNA coding sequence and the sequence of the protein encoded by the nucleic acid are provided as SEQ ID NOS: 70 and 71, respectively.
[0067] Published International application WO 2010/07943 provides a schematic comparison between the mechanisms of mitosis, normal meiosis, meiosis in an osdl mutant, meiosis in a mutant lacking SPOl 1-1 activity (e.g., Atspol 1-1), meiosis in a double mutant lacking both SPOl 1-1 and REC8 activity (e.g., Atspol l-l/Atrec8), and meiosis in a MiMe mutant (e.g., osdl/Atspol l-l/Atrec8). During mitosis in diploid cells, chromosomes replicate and sister chromatids segregate to generate daughter cells that are diploid and genetically identical to the initial cell. During normal meiosis, two rounds of chromosome segregation follow a single round of replication. At division one, homologous chromosomes recombine and are separated. Meiosis II is more similar to mitosis resulting in equal distribution of sister chromatids. The spores obtained are thus haploid and carry recombined genetic information. In a mutant lacking OSD1 activity, meiosis II is skipped giving rise to diploid spores and SDR gametes with recombined genetic information. A mutant lacking SPOl 1-1 undergoes an unbalanced first division followed by a second division leading to unbalanced spores and sterility. A double mutant lacking both SPOl 1-1 and REC8 undergoes a mitotic-like division instead of a normal first meiotic division, followed by an unbalanced second division leading to unbalanced spores and sterility. Arabidopsis MiMe-2 mutants are described in d'Erfurth, I. et al. (2010)
[0068] SPOl 1-1 and SPOl 1-2 proteins are related orthologs, both of which are required for meiotic recombination. [Grelon et al. (2001); Stacey N J, Kuromori T, Azumi Y, Roberts G, Breuer C, Wada T, Maxwell A, Roberts K, & Sugimoto-Shirasu K. Arabidopsis SPOl 1-2 functions with SPOl 1-1 in meiotic recombination. The Plant Journal, 48, 206-216 (2006); Hartung F, Wurz-Wildersinn R, Fuchs J, Schubert I, Suer S, & Puchta H. The catalytically active tyrosine residues of both SPOl 1-1 and SPOl 1-2 are required for meiotic double-strand break induction in Arabidopsis. The Plant Cell 19, 3090-3099 (2007)]. Inhibition of one or both of SPOl 1-1 or SPOl 1-2 is useful in a MiMe plant. Examples of SPOl 1-1 and SPOl 1-2 proteins are provided in Table 3 of US Patent Publication No. 2014/0298507 (SEQ ID No. 3 of US Patent Publication No. 2014/0298507) and Table 4 of US Patent Publication No. 2014/0298507 (SEQ ID NO. 4 of US Patent Publication No. 2014/0298507).
[0069] PRD1 protein is required for meiotic double stand break (DSB) formation and is exemplified by AtPRDl, a protein of 1330 amino acids (Table 5, SEQ ID No. 5 of US Patent Publication No. 2014/0298507) exhibiting significant sequence similarity with OsPRDl (NCB1 Accession number CAE02100) SEQ ID No. 47 of US Patent Publication No.
2014/0298507 (Table 14 of US Patent Publication No. 2014/0298507). PRD1 homologs have also been identified in Physcomitrella patens (PpPRDl) from ASYA48856l.bl; Medicago truncatula (MtPRDl) from sequences AC147484 (start 9345l-end 101276) and Populus trichocarpa (PtPRDl) from LG_II: 20125180-20129370 (http://genome.jgi- psf.org/Poptrl _ l/Poptrl _ l.home.html), see De Muyt et al. 2007, FIG. 1 therein for a sequence comparison.
[0070] PRD2 protein is a DSB-forming protein exemplified by AtPRD2, a protein of 378 amino acids (Table 6, SEQ ID No: 6) amino acids (identified as a protein of 385 amino acids in De Muyt et al. (2009) see Sequence Accession NP 568869 (Table 11, SEQ ID No. 18 of US Patent Publication No. 2014/0298507), with homologues identified in the monocot Oryza sativa, Populous trichocarpa, Vitis vinifera and Physcomitrella patens [De Muyt A, Pereira L, & Vezon D, et al. A high throughput genetic screen identifies new early meiotic
recombination functions in Arabidopsis thaliana. PLoS Genetics 5, el000654 (2009)] and see (Table 11, SEQ ID Nos. 19-22 of US Patent Publication No. 2014/0298507). PAIR1 (also called PRD3) is a DSB-forming protein exemplified by AtPAIRl, a protein a 449 amino acid protein (Table 7, SEQ ID No. 7 of US Patent Publication No. 2014/0298507) and its presumed ortholog OsPAIRl [Nonomura K, Nakano M, Fukuda T, Eiguchi M, & Miyao A, The novel gene Homologous Pairing Aberration In Rice Meiosisl of rice encodes a putative coiled-coil protein required for homologous chromosome pairing in meiosis. Plant Cell 16: 1008-1020 (2004)] a 492-amino acid protein, see Table 15, SEQ ID No. 50 of US Patent Publication No. 2014/0298507.
[0071] REC8 protein is a subunit of the cohesion complex. In plants, exemplified by Arabidopsis, REC8 protein (Table 8, SEQ ID No. 8 of US Patent Publication No.
2014/0298507) is necessary for monopolar orientation of the kinetochores [Chelysheva et al. (2005)].
[0072] In specific embodiments, plants producing MiMe phenotype are produced by inhibition in the plant of the following proteins (a) a TAM (Cylin A CYCAl;2) or DYAD protein (as described herein); (b) a protein involved in initiation of meiotic recombination in plants exemplified herein as SPOl l-l; SPOl l-2; PRD; PRD2; or PAIR1 (also called PRD3); and (c) a protein necessary for the monopolar orientation of the kinetochores during meiosis exemplified herein as REC8 protein.
[0073] In specific embodiments, plants producing MiMe phenotype are produced by inhibition in the plant of the following proteins (a) an OSD 1 protein (as described herein);
(b) a protein involved in initiation of meiotic recombination in plants exemplified herein as SPOl l-l; SPOl l-2; PRD; PRD2; or PAIR1 (also called PRD3); and (c) a protein necessary for the monopolar orientation of the kinetochores during meiosis exemplified herein as REC8 protein.
[0074] The OSD1 protein is exemplified by the AtOSDl protein (SEQ ID No. 1 of US Patent Publication No. 2014/0298507) or the Os OSD1 protein (SEQ ID No. 2 of US Patent Publication No. 2014/0298507) and includes OSD1 protein wherein said protein has at least 20%, and by order of increasing preference, at least 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 98% sequence identity, or at least 29%, and by order of increasing preference, at least 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 98% sequence similarity with the AtOSDl protein of SEQ ID No. 1 of US Patent Publication No.
20l4/0298507or with the OsOSDl protein of SEQ ID No. 2 of US Patent Publication No. 2014/0298507. Illustrative rice and Arabidopsis OSD1 protein sequences are provided as SEQ ID NOS:43 and 45, respectively. In some embodiments, the OSD1 protein that is inhibited is at least 50%, or at least 55%, identical to SEQ ID NO:43. In some embodiments, the OSD1 protein is at least 60%, or in some embodiments, at least 65, 70, 75, 80, 85, 90, 95, or 99%, identical to SEQ ID NO:43. In some embodiments, the OSD1 protein that is inhibited is at least 50%, or at least 55%, identical to SEQ ID NO:45. In some embodiments, the OSD1 protein is at least 60%, or in some embodiments, at least 65, 70, 75, 80, 85, 90, 95, or 99%, identical to SEQ ID NO:45.
[0075] The Cycbn-A CYCAl;2 (TAM) protein is exemplified by the CYCA1; 2 protein of Arabidopsis (SEQ ID No. 9 of US Patent Publication No. 2014/0298507) or the CYCA1; 2 protein of rice (SEQ ID No. 10 of US Patent Publication No. 2014/0298507) protein wherein said protein has at least 20%, and by order of increasing preference, at least 25, 30, 35, 40,
45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 98% sequence identity, or at least 29%, and by order of increasing preference, at least 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 98% sequence similarity with the CYCA1; 2 protein of SEQ ID NO. 9 of US Patent Publication No. 20l4/0298507or with the CYCA1; 2 protein of SEQ ID NO: 10 of US Patent Publication No. 2014/0298507. An illustrative Arabidopsis TAM1 protein sequence is provided as SEQ ID NO:55. In some embodiments, the TAM1 protein is at least 40%, or at least 45, 50, or 55%, identical to SEQ ID NO:55. In some embodiments, the TAM1 protein is at least 60%, or at least 65, 70, 75, 80, 85, 90, 95, or 99%, identical to SEQ ID NO:55. Illustrative rice Cycbn-Al protein sequences are provided as SEQ ID NOS:57, 59, 61, 63, and 65. In some embodiments, the Cycbn-Al protein is at least 40%, or at least 45, 50, or 55%, identical to any one of SEQ ID NOS:57, 59, 61, 63, or 65. In some embodiments, the Cycbn-Al protein is at least 60%, or at least 65, 70, 75, 80, 85, 90, 95, or 99%, identical to any one of SEQ ID NOS:57, 59, 61, 63, or 65. Illustrative Cycbn-A3 protein sequences are provided as SEQ ID NOS:67 and 69. In some embodiments, the Cycbn-A3 protein is at least 40%, or at least 45, 50, or 55%, identical to SEQ ID NO:67 or SEQ ID NO:69. In some embodiments, the Cyclin-A3 protein is at least 60%, or at least 65, 70, 75, 80, 85, 90, 95, or 99%, identical to SEQ ID NO:67 or SEQ ID NO:69.
[0076] In some embodiments, expression of a DYAD protein is inhibited. An illustrative Arabidopsis DYAD protein sequence is provided as SEQ ID NO:7l. Illustrative rice DYAD homolog (SWITCH1) protein sequences are provide as SEQ ID NOS:73, 75, and 77. In some embodiments, the protein has at least 20%, and by order of increasing preference, at least 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 98% sequence identity, or at least 29%, and by order of increasing preference, at least 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 98% sequence similarity any one of SEQ ID NOS:7l, 73, 75, or 77. In some embodiments, the DYAD protein is at least 40%, or at least 45, 50, or 55%, identical to SEQ ID NO:7l. In some embodiments, the DYAD protein is at least 60%, or at least 65, 70, 75, 80, 85, 90, 95, or 99%, identical to SEQ ID NO:7l. In some embodiments, the DYAD protein is at least 40%, or at least 45, 50, or 55%, identical to any one of SEQ ID NOS:73, 75, or 77. In some embodiments, the DYAD protein is at least 60%, or at least 65, 70, 75, 80, 85, 90, 95, or 99%, identical to any one of SEQ ID NOS:73, 75, or 77.
[0077] The protein involved in initiation of meiotic recombination in plants is exemplified by an SPOl l-l or SPOl l-2 protein and particularly the AtSPOl l-l protein (SEQ ID No. 3 of US Patent Publication No. 2014/0298507), the AtSPOl 1-2 protein (SEQ ID No. 4 of US Patent Publication No. 2014/0298507) and includes SPOl 1-1 and SPOl 1-2 proteins having at least 40%, and by order of increasing preference, at least 45, 50, 55, 60, 65, 70, 75, 80, 85,
90, 95 or 98% sequence identity, or at least 60%, and by order of increasing preference, at least, 65, 70, 75, 80, 85, 90, 95 or 98% sequence similarity with the SPOl l-l protein of SEQ ID No. 3 of US Patent Publication No. 20l4/0298507or the SPOl 1-2 protein of SEQ ID No.
4 of US Patent Publication No. 2014/0298507. An illustrative Arabidopsis SPOl l-2 protein sequence is provided as SEQ ID NO:49. In some embodiments, the SPOl l-2 protein is at least 40%, or at least 45, 50, or 55%, identical to SEQ ID NO:49. In some embodiments, the SPOl l-2 protein is at least 60%, or at least 65, 70, 75, 80, 85, 90, 95, or 99%, identical to SEQ ID NO:49.
[0078] The protein involved in initiation of meiotic recombination in plants is also exemplified by a PRD1 or PRD2 protein and particularly the AtPRDl protein (SEQ ID No. 5 of US Patent Publication No. 2014/0298507), and the AtPRD2 protein (SEQ ID No. 6 of US Patent Publication No. 2014/0298507) and includes PRD1 or PRD2 proteins having at least 25%, and by order of increasing preference, at least 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 98% sequence identity, or at least 35%, and by order of increasing preference, at least, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 98% sequence similarity with the PRD1 protein of SEQ ID No. 5 of US Patent Publication No. 2014/0298507) or PRD2 protein of SEQ ID NO. 6 of US Patent Publication No. 2014/0298507).
[0079] The protein involved in initiation of meiotic recombination in plants is also exemplified by a PAIR1 protein (also known as a PRD3 protein) and particularly the
AtPAIRl protein (SEQ ID No. 7 of US Patent Publication No. 2014/0298507), and includes PAIR1 proteins having at least 30%, and by order of increasing preference, at least 35, 40,
45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 98% sequence identity, or at least 40%, and by order of increasing preference, at least, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 98% sequence similarity with the PAIR1 protein of SEQ ID No. 7 of US Patent Publication No. 2014/0298507. An illustrative rice PAIR1 protein sequence is provided as SEQ ID NO:47.
In some embodiments, the PAIR1 protein is at least 40%, or at least 45, 50, or 55%, identical to SEQ ID NO:47. In some embodiments, the PAIR protein is at least 60%, or at least 65, 70, 75, 80, 85, 90, 95, or 99%, identical to SEQ ID NO:47.
[0080] The protein for the monopolar orientation of the kinetochores during meiosis is exemplified herein as a REC8 protein (also designated DIF1/SYN1) a member of the cohesion complex in plants, particularly Arabidopsis. REC8 protein includes AtREC8 protein (SEQ ID No. 8 of US Patent Publication No. 2014/0298507) and includes REC8 protein having at least 40%, and by order of increasing preference, at least 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 98% sequence identity, or at least 45%, and by order of increasing preference at least, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 98% sequence similarity with the REC8 protein of SEQ ID No. 8 of US Patent Publication No. 2014/0298507. Illustrative rice and Arabidopsis REC8 protein sequences are provided as as SEQ ID NOS:5l and 53, respectively. In some embodiments, the RECE8 protein is at least 50%, or at least 55, 60, or 65%, identical to SEQ ID NO:5l. In some embodiments, the REC8 protein is at least 70%, or at least 75, 80, 85, 90, 95, or 99%, identical to SEQ ID NO:5l. In some embodiments, the RECE8 protein is at least 50%, or at least 55, 60, or 65%, identical to SEQ ID NO:53. In some embodiments, the REC8 protein is at least 70%, or at least 75, 80, 85, 90, 95, or 99%, identical to SEQ ID NO:53.
[0081] The SPOl l-l, SPOl l-2, PRD1, PRD2, PAIR1, and REC8 proteins are conserved in higher plants, monocotyledons as well as dicotyledons. By way of non-limitative examples of orthologs of SPOl l-l, SPOl l-2, PRD1, PRD2, PAIR1 and REC8 proteins of Arabidopsis thaliana in monocotyledonous plants, one can cite the Oryza sativa SPOl l-l, SPOl l-2, PRD1, PRD2, PAIR1, and REC8 proteins. The sequence of the Oryza sativa SPOl 1-1 protein is available in GenBank under the accession number AAP68363 see Table 15 SEQ ID No. 48 of US Patent Publication No. 2014/0298507; the sequence of the Oryza sativa SPOl 1-2 protein is available in GenBank under the accession number NP _ 001061027 see Table 15
SEQ ID No. 49 of US Patent Publication No. 2014/0298507; the sequence of the Oryza sativa PRD1 protein is provided as SEQ ID No. 47 of US Patent Publication No. 2014/0298507 (Table 14 of US Patent Publication No. 2014/0298507); the sequence of the Oryza sativa PRD2 protein is provided (SEQ ID No. 21 of US Patent Publication No. 2014/0298507); the sequence of the Oryza sativa PAIR1 protein is available in SwissProt under the accession number Q75RY2, see Table 15 SEQ ID No. 50 of US Patent Publication No. 2014/0298507; the sequence of the Oryza sativa REC8 protein (also designated RAD21-4) is available in GenBank under the accession number AAQ75095., see Table 15, SEQ ID No. 51 of US Patent Publication No. 2014/0298507. Additional non-limiting examples of orthologs of PRD2 include Vitis vinifera VvPRD2 (accession number CA066652) see Table 11, SEQ ID No. 20 of US Patent Publication No. 2014/0298507; Populous trichocarpa PtPRD2 (obtained from JCI (fgenesh4_pm. C_LG_VI000547) see Table 11 SEQ ID NO. 20 of US Patent Publication No. 2014/0298507 and Physcomitrella patens PpPRD2 obtained from JGI (jgi|Phypal _ l|73600|fgeneshl_pg. scaffold _ 42000158).
[0082] The inhibition of the above mentioned OSD1, Cyclin-A CYCAl;2 (TAM), SPOl l- 1, SPOl 1-2, PRD1, PRD2, PAIR1, DYAD, or REC8 proteins can be obtained either by abolishing, blocking, or decreasing their function, or advantageously, by preventing or downregulating the expression of the corresponding genes. By way of example, inhibition of said protein can be obtained by mutagenesis of the corresponding gene or of its promoter, and selection of the mutants having partially or totally lost the activity of said protein. For instance, a mutation within the coding sequence can induce, depending on the nature of the mutation, the expression of an inactive protein, or of a protein with impaired activity; in the same way, a mutation within the promoter sequence can induce a lack of expression of said protein, or decrease thereof.
[0083] Mutagenesis can be performed for instance by targeted deletion of the coding sequence or of the promoter of the gene encoding said protein or of a portion thereof, or by targeted insertion of an exogenous sequence within said coding sequence or said promoter. It can also be performed by inducing random mutations, for instance through EMS mutagenesis or random insertional mutagenesis, followed by screening of the mutants within the desired gene. Methods for high throughput mutagenesis and screening are available in the art. By way of example, one can mention TILLING (Targeting Induced Local Lesions In Genomes) described by McCallum C. M., Comai, L., Greene, E. A., & Henikoff, S. Targeting Induced Local Lesions IN Genomes (TILLING) for Plant Functional Genomics Plant Physiol, Vol. 123, pp. 439-442 (2000)). [0084] Among the mutations within the OSD1 gene or TAM gene, those resulting in the ability to produce SDR 2n gametes can be identified on the basis of the phenotypic characteristics of the plants which are homozygous for this mutation: these plants can form at least 5%, preferably at least 10%, more preferably at least 20%, yet more preferably 30% or more, still more preferably at least 50%, and up to 100% of dyads as a product of meiosis.
[0085] Among the mutations within a gene encoding a protein involved in initiation of meiotic recombination in plants, such as the SPOl 1-1 gene or the SPOl 1-2, PRD1, PRD2 or PAIR1 gene, those useful for obtaining a plant producing apomeiotic gametes can be identified on the basis of the phenotypic characteristics of the plants which are homozygous for this mutation, in particular the presence of univalents instead of bivalents at meiosis I, and the sterility of the plant. Among the mutants having a mutation within the REC8 gene, those useful for obtaining a plant producing apomeiotic gametes can be identified on the basis of the phenotypic characteristics of the plants which are homozygous for this mutation, in particular chromosome fragmentation at meiosis, and sterility of the plant.
[0086] Alternatively, the inhibition of the target protein is obtained by silencing of the corresponding gene. [See, for example, the review Baulcombe, D. RNA silencing in plants Nature 431 :356-363 (2004)]. Methods for gene silencing in plants are known in the art. For instance, antisense inhibition or co-suppression, as described by way of example in U.S. Pat. Nos. 5,190,065 and 5,283,323 can be used. It is also possible to use ribozymes targeting the mRNA of said protein. Preferred methods are those wherein gene silencing is induced by means of RNA interference (RNAi), using a silencing RNA targeting the gene to be silenced. Various methods and DNA constructs for delivery of silencing RNAs are available in the art.
[0087] A "silencing RNA" is herein defined as a small RNA that can silence a target gene in a sequence-specific manner by base pairing to complementary mRNA molecules.
Silencing RNAs include in particular small interfering RNAs (siRNAs) and microRNAs (miRNAs).
[0088] Initially, DNA constructs for delivering a silencing RNA in a plant included a fragment of 300 bp or more (generally 300-800 bp, although shorter sequences may sometime induce efficient silencing) of the cDNA of the target gene, under transcriptional control of a promoter active in said plant. Currently, the more widely used silencing RNA constructs are those that can produce hairpin RNA (hpRNA) transcripts. In these constructs, the fragment of the target gene is inversely repeated, with generally a spacer region between the repeats [for a review, see Watson et al, (2005)]. One can also use artificial microRNAs (amiRNAs) directed against the gene to be silenced (for review about the design and applications of silencing RNAs, including in particular amiRNAs, in plants see for instance [Ossowski et al, Plant I, 53, 674-90 (2008)].
[0089] Tools for silencing one or more target gene(s) selected among OSD1, TAM, SPOl l-l SPOl l-2, PRD1, PAIR1, PRD2, and REC8, including expression cassettes for hpRNA or amiRNA targeting said gene (s) are described and provided in PCT application WO 2010/079432. Useful expression cassettes comprise a promoter functional in a plant cell; one or more DNA construct(s) of 200 to 1000 bp, preferably of 300 to 900 bp, each comprising a fragment of a cDNA of a target gene selected among OSD1, TAM, SPOl 1-1, SPOl 1-2, PRD1, PRD2, PAIR1, and REC8, or of its complement, or having at least 95% identity, and by order of increasing preference, at least 96%, 97%, 98%, or 99% identity with said fragment, where the DNA construct(s) is placed under transcriptional control of the promoter. Additional useful expression cassettes for hpRNA comprise a promoter functional in a plant cell, one or more hairpin DNA construct(s) capable, when transcribed, of forming a hairpin RNA targeting a gene selected among OSD1, TAM, SPOl 1-1, SPOl 1-2, PRD1, PRD2, PAIR1, and REC8; where the DNA construct(s) is placed under transcriptional control of the promoter.
[0090] Generally, useful hairpin DNA constructs comprise: i) a first DNA sequence of 200 to 1000 bp, preferably of 300 to 900 bp, such as a fragment of a cDNA of the target gene, or having at least 95% identity, and by order of increasing preference, at least 96%, 97%, 98%, or 99% identity with the fragment; ii) a second DNA sequence that is the complement of the first DNA, said first and second sequences being in opposite orientations and ii) a spacer sequence separating the first and second sequence, such that these first and second DNA sequences are capable, when transcribed, of forming a single double-stranded RNA molecule. The spacer can be a random fragment of DNA. However, preferably, one will use an intron which is spliceable by the target plant cell. Its size is generally 400 to 2000 nucleotides in length. A useful expression cassette for an amiRNA comprises: a promoter functional in a plant cell, one or more DNA construct(s) capable, when transcribed, of forming an amiRNA targeting a gene selected among OSD1, TAM, SPI11-1, SPOl l-2, PRD1, PRD2, PAIR1, and REC8; where the DNA construct(s) is placed under transcriptional control of the promoter. Useful expression cassettes comprise a DNA construct targeting the OSD1 gene or comprise a DNA construct targeting the OSD 1 gene, and a DNA construct targeting a gene selected from one or more of SPOl 1-1, SPOl 1-2, PRD1, PRD2, or PAIR1, and a DNA construct targeting REC8. Useful expression cassettes comprise a DNA construct targeting the TAM gene or comprise a DNA construct targeting the TAM gene, and a DNA construct targeting a gene selected from one or more of SPOl 1-1, SPOl 1-2, PRD1, PRD2, or PAIR1, and a DNA construct targeting REC8. Additional useful expression cassettes comprise a DNA construct targeting the OSD1 gene and/or the TAM gene and/or comprise a DNA construct targeting the OSD1 gene and or the TAM gene, and/or a DNA construct targeting a gene selected from one or more of SPOl 1-1, SPOl 1-2, PRD1, PRD2, or PAIR1.
[0091] Other mutation induction systems, such as genome editing methods, can be used to target deletions in OSD1, SPOl l-l, SPOl l-2, PRD1, PRD2, or PAIR1 (Lozano- Juste, J., and Cutler, S.R. (2014) Trends in Plant Science 19, 284-287). The sequence-specific introduction of a double stranded DNA break (DSB) in a genome leads to the recruitment of DNA repair factors at the breakage site, which then repair lesion by either the error-prone non- homologous end joining (NHEJ) or homologous recombination (HR) pathways. NHEJ repairs the breaks, but is imprecise and often creates diverse mutations at and around the DSB. In cells in which the HR machinery repairs the DSB, sequences with homology flanking the DSB, including exogenously supplied sequences, can be incorporated at the region of the DSB. DSBs can therefore be leveraged by geneticists to increase the frequency of mutations at defined sites, however intrinsic differences between the relative roles of HR and NHEJ can affect the mutation types at a targets locus. A number of technologies have been developed to create DSBs at specific sites including synthetic zinc finger nucleases (ZFNs), transcription activator-like endonucleases (TALENs) and most recently the clustered regularly interspaced short palindromic repeats (CRISPR)/ CRISPR-associated protein 9 (Cas9) system. This system is based on a bacterial immune system against invading bacteriophages in which a complex of 2 small RNAs, the CRISPR-RNA (crRNA) and the trans-activating crRNA (tracrRNA) directs a nuclease (Cas9) to a specific DNA sequence complementary to the crRNA. In other embodiments, Cpf-l or CAS from other bacteria, for example, can be similarly used. Using any of these systems, one can create DSBs at pre determined sites in cells expressing the genome editing constructs. In order for homologous recombination to occur, a DNA cassette homologous to the targeted site must be provided, preferably at a high concentration so that HR is favored or NHEJ. Multiple strategies are conceivable for realizing this, including template delivery using agrobacterium mediated transformation or particle bombardment of DNA templates, and one recently described method uses a modified viral genome to provide the double stranded DNA template. For example, Baltes et al. 2014 (Baltes, N.J., et al. (2014) Plant Cell 26, 151-163) recently demonstrated that an engineered geminivirus that was introduced into plant cells using Agrobacterium mediated transformation could be engineered to produce DNA recombination templates in cells where a ZFN was co-expressed.
[0092] In the CRISPR/Cas9 bacterial antiviral and transcriptional regulatory system, a complex of two small RNAs - the CRISPR-RNA (crRNA) and the trans-activating crRNA (tracrRNA) - directs the nuclease (Cas9) to a specific DNA sequence complementary to the crRNA (Jinek, M., et al. Science 337, 816-821 (2012)). Binding of these RNAs to Cas9 involves specific sequences and secondary structures in the RNA. The two RNA components can be simplified into a single element, the single guide-RNA (sgRNA), which is transcribed from a cassette containing a target sequence defined by the user (Jinek, M., et al. Science 337, 816-821 (2012)). This system has been used for genome editing in humans, zebrafish, Drosophila, mice, nematodes, bacteria, yeast, and plants (Hsu, P.D., et al, Cell 157, 1262- 1278 (2014)). In this system the nuclease creates double stranded breaks at the target region programmed by the sgRNA. These can be repaired by non-homologous recombination, which often yields inactivating mutations. The breaks can also be repaired by homologous recombination, which enables the system to be used for gene targeted gene replacement (Li, J.-F., et al. Nat. Biotechnol. 31, 688-691, 2013; Shan, Q., et al. Nat. Biotechnol. 31, 686-688, 2013). The OSD1, SPOl l-l, SPOl l-2, PRD1, PRD2, or PAIRl mutations described in this application can be introduced into plants using the CAS9/CRISPR system.
[0093] Accordingly, in some embodiments, instead of generating a transgenic plant, a native OSD1, SPOl 1-1, SPOl 1-2, PRD1, PRD2, or PAIR1 coding sequence in a plant or plant cell can be altered in situ to generate a plant or plant cell carrying a polynucleotide encoding a OSD1, SPOl l-l, SPOl l-2, PRD1, PRD2, or PAIR1 polypeptide having one or more deletion or other inactivating mutations. The CRISPR/Cas system has been modified for use in prokaryotic and eukaryotic systems for genome editing and transcriptional regulation. The“CRISPR/Cas” system refers to a widespread class of bacterial systems for defense against foreign nucleic acid. CRISPR/Cas systems are found in a wide range of eubacterial and archaeal organisms. CRISPR/Cas systems include type I, II, and III sub- types. Wild-type type II CRISPR/Cas systems utilize the RNA-mediated nuclease, Cas9 in complex with guide and activating RNA to recognize and cleave foreign nucleic acid. Cas9 homologs are found in a wide variety of eubacteria, including, but not limited to bacteria of the following taxonomic groups: Actinobacteria, Aquificae, Bacteroidetes-Chlorobi, Chlamydiae-Verrucomicrobia, Chlroflexi, Cyanobacteria, Firmicutes, Proteobacteria, Spirochaetes, and Thermotogae. An exemplary Cas9 protein is the Streptococcus pyogenes Cas9 protein. Additional Cas9 proteins and homologs thereof are described in, e.g.,
Chylinksi, et al., RNA Biol. 2013 May 1; 10(5): 726-737 ; Nat. Rev. Microbiol. 2011 June; 9(6): 467-477; Hou, et al, Proc Natl Acad Sci U S A. 2013 Sep 24;l 10(39): 15644-9;
Sampson et al, Nature. 2013 May 9;497(7448):254-7; and Jinek, et al, Science. 2012 Aug 17;337(6096):816-21.
As discussed above, in addition to th eplant comprising mutations to induce the MiMe phenotype, the plant will also express a BABYBOOM polypeptide in in egg cells. As explained in the Examples, this combination results in a parent plant that when self-fertilized generates clonal progeny.
[0094] Any naturally-or non-naturally-occurring active BABYBOOM polypeptide from a sexually reproducing plant can be expressed as described herein so long as the polypeptide (and/or RNA encoding the polypeptide) is expressed in egg cells in the plant. In some embodiments, the BABYBOOM polypeptide is from a species of plant of the genus
Abelmoschus, Allium, Apium, Amaranthus, Arachis, Arabidopsis, Asparagus, Atropa, Avena, Benincasa, Beta, Brassica, Cannabis, Capsella, Cica, Cichorium, Citrus, Citrullus,
Capsicum, Carthamus, Cocos, Coffea, Cucumis, Cucurbita, Cynasa, Daucus, Diplotaxis, Dioscorea, Elais, Eruca, Foeniculum, Fragaria, Glycine, Gossypium, Helianthus,
Heterocallis , Hordeum, Hyoscyamus, Ipomea, Lactuca, Lagenaria, Lepidium, Linum, Lolium, Luffa, Luzula, Lycopersicon, Malus, Manihot, Majorana, Medicago, Momodica, Musa, Nicotiana, Olea, Oryza, Panicum, Pastinaca, Pennisetum, Persea, Petroselinium, Phaseolus, Physalis, Pinus, Pisum, Populus, Pyrus, Prunus, Raphanus, Saccharum, Secale, Senecio, Sesamum, Sinapis, Solanum, Sorghum, Spinacia, Theobroma, Trichosantes , Trigonella, Triticum, Turritis, Valerianelle, Vitis, Vigna, or Zea. In some embodiments the
BABYBOOM polypeptide is identical or substantially identical to any of SEQ ID NOs: 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, or 41. In some embodiments, the BABYBOOM polypeptide comprises an amino acid sequence that is substantially identical to all of SEQ ID NOl, substantially identical to all of SEQ ID NO:3, or a first amino acid sequence substantially identical to SEQ ID NO: l and a second amino acid sequence substantially identical to SEQ ID NO:3, wherein the two sequences are separated by an AP2 domain-containing portion (e.g., substantially identical to SEQ ID NO:2). [0095] BABY BOOM polypeptides contain two conserved AP2 domains. They lack a miRl72 binding site (thereby distinguishing BABY BOOM polypeptides from many other AP2 domain proteins that contain a miRl72 binding site.
[0096] In some embodiments, the plant comprises heterologous expression cassette comprising a promoter that at least directs expression to egg cells operably linked to a
BABYBOOM polypeptide as described herein. In some embodiments, the promoter is egg cell-specific, meaning the promoter drives expression only or primarily in egg cells.
“Primarily” means that if there is expression in other tissue the levels are no more than 1/10 of the expression levels in egg cells as measured by quantitative RT-PCR. [0097] Exemplary promoters that drive expression in at least egg cells of a plant include, but are not limited to, the promoter of the egg-cell specific gene EC 1.1, EC 1.2, EC 1.3,
EC1.4, or EC1.5. See, e.g. Sprunck et al. Science, 338: 1093-1097 (2012); AT2G21740; Steffen et al. , Plant Journal 51: 281-292 (2007). In some embodiments, the
Arabidopsis DD45 promoter is used to express in rice egg cell (Ohnishi et al. Plant Physiology 165: 1533-1543 (2014). An exemplary DD45 promoter sequence is as follows:
Figure imgf000034_0001
[0098] Other promoters that are expressed in egg cells, but are not necessarily egg-cell specific, are described in, e.g., Anderson et al, The Plant Journal 76: 729-741 (2013). In some embodiments, the expression cassette further comprises a transcriptional terminator. Exemplary terminators can include, but are not limited to, the rbcS E9 or nos terminators. In some embodiments, the expression cassette will include an egg cell enhancer. Exemplary egg cell enhancers include, but are not limited to, the EC 1.2 enhancer or EASE enhancer (Yang et al, Plant Physiol. 139: 1421-32 (2005).
[0099] In other embodiments, mutations can be introduced into the native BABYBOOM promoter such that BABYBOOM is expressed in egg cells based from the modified native promoter. In such embodiments, one or more nucleotide of the BABYBOOM promoter is modified by non-natural substitution, deletion or insertion.
[0100] Manipulation of the native promoter can be achieved via site-directed to random mutagenesis. Methods for introducing genetic mutations into plant genes and selecting plants with desired traits are well known and can be used to introduce mutations into the
BABYBOOM promoter. For instance, seeds or other plant material can be treated with a mutagenic insertional polynucleotide (e.g., transposon, T-DNA, etc.) or chemical substance, according to standard techniques. Such chemical substances include, but are not limited to, the following: diethyl sulfate, ethylene imine, ethyl methanesulfonate and N-nitroso- N-ethylurea. Alternatively, ionizing radiation from sources such as, X-rays or gamma rays can be used. Plants having a mutated BABYBOOM promoter can then be identified, for example, by phenotype or by molecular techniques, including but not limited to TILLING methods. See, e.g., Comai, L. & Henikoff, S. The Plant Journal 45, 684-694 (2006).
[0101] Mutated BABYBOOM promoters can also be constructed in vitro by mutating the BABYBOOM promoter DNA sequence, such as by using site-directed or random
mutagenesis. Nucleic acid molecules comprising the BABYBOOM promoter can be mutated in vitro by a variety of polymerase chain reaction (PCR) techniques well-known to one of ordinary skill in the art. See, e.g., PCR Strategies (M. A. Innis, D. H. Gelfand, and J. J. Sninsky eds., 1995, Academic Press, San Diego, CA) at Chapter 14; PCR Protocols : A Guide to Methods and Applications (M. A. Innis, D. H. Gelfand, J. J. Sninsky, and T. J.
White eds., Academic Press, NY, 1990).
[0102] As a non-limiting example, mutagenesis may be accomplished using site-directed mutagenesis, in which point mutations, insertions, or deletions are made to a DNA template. Kits for site-directed mutagenesis are commercially available, such as the QuikChange Site- Directed Mutagenesis Kit (Stratagene). Briefly, a DNA template to be mutagenized is amplified by PCR according to the manufacturer's instructions using a high-fidelity DNA polymerase (e.g., Pfu Turbo™) and oligonucleotide primers containing the desired mutation. Incorporation of the oligonucleotides generates a mutated plasmid, which can then be transformed into suitable cells (e.g., bacterial or yeast cells) for subsequent screening to confirm mutagenesis of the DNA.
[0103] As another non-limiting example, mutagenesis may be accomplished by means of error-prone PCR amplification (ePCR), which modifies PCR reaction conditions (e.g., using error-prone polymerases, varying magnesium or manganese concentration, or providing unbalanced dNTP ratios) in order to promote increased rates of error in DNA replication.
Kits for ePCR mutagenesis are commercially available, such as the GeneMorph® PCR Mutagenesis kit (Stratagene) and Diversify® PCR Random Mutagenesis Kit (Clontech). Briefly, DNA polymerase (e.g., Taq polymerase), salt (e.g, MgCl2, MgS04, or MnS04), dNTPs in unbalanced ratios, reaction buffer, and DNA template are combined and subjected to standard PCR amplification according to manufacturer's instructions. Following ePCR amplification, the reaction products are cloned into a suitable vector to construct a mutagenized library, which can then be transformed into suitable cells (e.g., yeast or plant cells) for subsequent screening (e.g., via a two-hybrid screen) as described below.
[0104] Alternatively, mutagenesis can be accomplished by recombination (i.e. DNA shuffling). Briefly, a shuffled mutant library is generated through DNA shuffling using in vitro homologous recombination by random fragmentation of a parent DNA followed by reassembly using PCR, resulting in randomly introduced point mutations. Methods of performing DNA shuffling are known in the art (see, e.g., Stebel, S.C. et al, Methods Mol Biol 352: 167-190 (2007)).
[0105] Other mutation induction systems, such as genome editing methods, can be used to target mutations in the BABYBOOM promoter, having the advantages of increasing the frequency of single and multiple mutations at a defined target site (Lozano-Juste, J., and Cutler, S.R. (2014) Trends in Plant Science 19, 284-287). The sequence-specific introduction of a double stranded DNA break (DSB) in a genome leads to the recruitment of DNA repair factors at the breakage site, which then repair lesion by either the error-prone non- homologous end joining (NHEJ) or homologous recombination (HR) pathways. NHEJ repairs the breaks, but is imprecise and often creates diverse mutations at and around the DSB. In cells in which the HR machinery repairs the DSB, sequences with homology flanking the DSB, including exogenously supplied sequences, can be incorporated at the region of the DSB. DSBs can therefore be leveraged by geneticists to increase the frequency of mutations at defined sites, however intrinsic differences between the relative roles of HR and NHEJ can affect the mutation types at a targets locus. A number of technologies have been developed to create DSBs at specific sites including synthetic zinc finger nucleases (ZFNs), transcription activator-like endonucleases (TALENs) and most recently the clustered regularly interspaced short palindromic repeats (CRISPR)/ CRISPR-associated protein 9 (Cas9) system. This system is based on a bacterial immune system against invading bacteriophages in which a complex of 2 small RNAs, the CRISPR-RNA (crRNA) and the trans-activating crRNA (tracrRNA) directs a nuclease (Cas9) to a specific DNA sequence complementary to the crRNA. Using any of these systems, one can create DSBs at pre determined sites in cells expressing the genome editing constructs. In order for homologous recombination to occur, a DNA cassette homologous to the targeted site must be provided, preferably at a high concentration so that HR is favored or NHEJ. Multiple strategies are conceivable for realizing this, including template delivery using agrobacterium mediated transformation or particle bombardment of DNA templates, and one recently described method uses a modified viral genome to provide the double stranded DNA template. For example, Baltes et al. 2014 (Baltes, N.J., et al. (2014) Plant Cell 26, 151-163) recently demonstrated that an engineered geminivirus that was introduced into plant cells using Agrobacterium mediated transformation could be engineered to produce DNA recombination templates in cells where a ZFN was co-expressed.
[0106] In the CRISPR/Cas9 bacterial antiviral and transcriptional regulatory system, a complex of two small RNAs - the CRISPR-RNA (crRNA) and the trans-activating crRNA (tracrRNA) - directs the nuclease (Cas9) to a specific DNA sequence complementary to the crRNA (Jinek, M., et al. Science 337, 816-821 (2012)). Binding of these RNAs to Cas9 involves specific sequences and secondary structures in the RNA. The two RNA components can be simplified into a single element, the single guide-RNA (sgRNA), which is transcribed from a cassette containing a target sequence defined by the user (Jinek, M., et al. Science 337, 816-821 (2012)). This system has been used for genome editing in humans, zebrafish, Drosophila, mice, nematodes, bacteria, yeast, and plants (Hsu, P.D., et al, Cell 157, 1262- 1278 (2014)). In this system the nuclease creates double stranded breaks at the target region programmed by the sgRNA. These can be repaired by non-homologous recombination, which often yields inactivating mutations. The breaks can also be repaired by homologous recombination, which enables the system to be used for gene targeted gene replacement (Li, J.-F., et al. Nat. Biotechnol. 31, 688-691, 2013; Shan, Q., et al. Nat. Biotechnol. 31, 686-688, 2013). The BABYBOOM promoter mutations described in this application can be introduced into plants using the CAS9/CRISPR system. In addition, an RNA-guided CRISPR-Cas9 system can achieve the activation of genes without modifying the promoter sequence of the native gene. Such a system utilizes a deactivated Cas9 protein (dCas9) fused to a transcriptional activation domain (Lowder, L.G. et al. (2015), Plant physiology, 169, 971-985) and uses guide RNAs to activate a specific promoter in a genome. An exemplary transcriptional activation domain is VP64.
[0107] An exemplary dCas9 coding sequence is:
Figure imgf000038_0001
Figure imgf000039_0001
Figure imgf000040_0001
[0108] Accordingly, in some embodiments, instead of generating a transgenic plant, a BABYBOOM promoter sequence in a plant or plant cell can be altered in situ to generate a plant or plant cell carrying a polynucleotide encoding a modified BABYBOOM promoter linked to the native BABYBOOM coding sequence. CRISPR/Cas systems include type I, II, and III sub-types. Wild-type type II CRISPR/Cas systems utilize the RNA-mediated nuclease, Cas9 in complex with guide and activating RNA to recognize and cleave foreign nucleic acid. Cas9 homologs are found in a wide variety of eubacteria, including, but not limited to bacteria of the following taxonomic groups: Actinobacteria, Aquiflcae,
Bacteroidetes-Chlorobi, Chlamydiae-Verrucomicrobia, Chlroflexi, Cyanobacteria,
Firmicutes, Proteobacteria, Spirochaetes, and Thermotogae. An exemplary Cas9 protein is the Streptococcus pyogenes Cas9 protein. Additional Cas9 proteins and homologs thereof are described in, e.g., Chylinksi, et al., RNA Biol. 2013 May 1; 10(5): 726-737 ; Nat. Rev. Microbiol. 2011 June; 9(6): 467-477; Hou, et al., Proc Natl Acad Sci U S A. 2013 Sep 24;l 10(39): 15644-9; Sampson et al., Nature. 2013 May 9;497(7448):254-7; and Jinek, et al., Science. 2012 Aug 17;337(6096):816-21.
[0109] The plant described herein (e.g., having the MiMe phenotype and comprising the egg cell-expression promoter operably linked to the BABYBOOM coding sequence) can be any plant species. In some embodiments, the plant is a dicot plant. In some embodiments the plant is a monocot plant. In some embodiments, the plant is a grass. In some embodiments, the plant is a cereal (e.g., including but not limited to Poaceae, e.g., rice, wheat, maize). In some embodiments, the plant is a species of plant of the genus Abelmoschus, Allium, Apium, Amaranthus, Arachis, Arabidopsis, Asparagus, Atropa, Avena, Benincasa, Beta, Brassica, Cannabis, Capsella, Cica, Cichorium, Citrus, Citrullus, Capsicum, Carthamus, Cocos, Coffea, Cucumis, Cucurbita, Cynasa, Daucus, Diplotaxis, Dioscorea, Elais, Eruca,
Foeniculum, Fragaria, Glycine, Gossypium, Helianthus, Heterocallis, Hordeum,
Hyoscyamus, Ipomea, Lactuca, Lagenaria, Lepidium, Linum, Lolium, Luffa, Luzula, Lycopersicon, Malus, Manihot, Majorana, Medicago, Momodica, Musa, Nicotiana, Olea, Oryza, Panicum, Pastinaca, Pennisetum, Persea, Petroselinium, Phaseolus, Physalis, Pinus, Pisum, Populus, Pyrus, Prunus, Raphanus, Saccharum, Secale, Senecio, Sesamum, Sinapis, Solanum, Sorghum, Spinacia, Theobroma, Trichosantes , Trigonella, Triticum, Turritis, Valerianelle, Vitis, Vigna, or Zea.
EXAMPLES
Example 1
[0110] In most flowering plants, embryo development requires the fertilization of an egg cell by a sperm cell1. The molecular pathways that control the initiation of embryogenesis after fertilization, and prevent its occurrence without fertilization, are not well understood2. We show here that in rice, a key role is played by an AP2-family3 transcription factor BBM1 {BABY BOOM 1) expressed in sperm cells. Ectopic egg cell expression of BBM1 is sufficient to promote parthenogenesis and produce haploid plants, indicating that expression of a single wild-type gene can overcome the fertilization block. Zygotic expression of BBM1 is initially male-allele specific, but subsequently biparental, consistent with its observed auto-activation. Triple knockouts of BBM1 and two closely related genes result in embryo arrest and abortion, fully rescued by male-transmitted BBM1. These findings suggest that the fertilization requirement for embryogenesis might act in part through male-transmitted pluripotency factors. When egg cell expression of BBM1 is combined with genome editing to substitute mitosis for meiosis (MiMe) 5. clonal progeny are obtained from haploid as well as diploid parents. These results establish the feasibility of asexual reproduction in crops, for the maintenance of hybrids through seed propagation6·7.
BBM1 PROMOTES SOMATIC EMBRYOGENESIS
[0111] BABY BOOM lineage of genes belongs to the APETALA 2/ETHYLENE
RESPONSE FACTOR (AP2/ERF) domain transcription factors with two AP2 domains8. The overexpression of Arabidopsis thaliana and Brassica napus genes have been shown to induce somatic embryos on seedlings9. Although, A tBBM has been shown to express in later stage embryos, its gametic and zygotic expression have not been described 3. Our previous results10 showed that the expression of BBM- like genes in rice is induced very early in zygotes after fertilization, indicating they may have a potential role in initiation of embryogenesis (Table 1). We selected the highest expressing gene in zygotes, called BBMJ for ectopic expression in transgenic rice seedlings (FIG.FIG. 5a, b), and we observed somatic embryo-like structures arising from leaves (FIG. la, b). The embryonic identity of these structures was confirmed by the expression of embryo marker genes in rice (FIG.FIG. 5c).
[0112] In order to gain insights into the pathway by which BBM1 induces somatic embryogenesis in rice, we made a dexamethasone (DEX) inducible rat glucocorticoid receptor (GR) fusion of BBM1 (FIG.FIG. 6a). Two week old seedlings, both wild-type and transgenic for BBM1-GR, were treated for 6 hours with DEX or a protein synthesis inhibitor, cycloheximide (CYC) or a combination of both. We observed the expression of 162 DE genes induced in DEX treated BBM1-GR seedlings, after normalization with mock and wild- type controls (see methods) (FIG. lc). The expression of 138 of these genes is maintained in the presence of CYC, suggesting that they might be direct targets of BBM1 (FIG. lc; Table 4). Noteworthy among the directly regulated genes by BBM1, are members of the YUCCA family of auxin biosynthesis genes and some auxin response factors (Table 4). The up- regulation of expression of these YUCCA genes was confirmed by RT-qPCR (FIG. ld).
When one week old BBM1-GR seedlings were shifted to a DEX containing medium, they developed roots from aerial tissues (FIG.FIG. 6b, c). Moreover, BBM1-GR plants watered with DEX around the flowering transition developed awns from lemmas (FIG.FIG. 6d, e). These phenotypes together with the phenotypes observed on BBM1 overexpression
(FIG.FIG. 5d-o), have been shown to be associated with auxin accumulation11 , or transport and response12 13. Auxin treatment is required for induction of somatic embryogenesis during plant regeneration from somatic tissue14 . Since BBM1 overexpression led to somatic embryogenesis in the absence of auxin and we observe direct regulation of the expression of auxin biosynthesis, it likely controls somatic embryogenesis by controlling auxin
biosynthesis and response. In contrast, we could not identify any known cytokinin biosynthesis genes or cytokinin response transcription factors within the set of putative direct targets of BBM1 (Table 4). Of the 3 YUCCA genes upregulated by BBM1, YUCCA5 expression is de novo induced in rice zygotes after fertilization and peaks at 9 HAP which coincides with BBM1 expression10. Auxin biosynthesis genes have also been shown to be upregulated in maize zygotes after fertilization15 . These data suggest that the initiation of embryogenesis by BBM1 might involve the biosynthesis of auxin. [0113] Since expression of BBM1 is induced very early on in zygotes10 (Table 1), we investigated if its expression is also induced in leaves during somatic embryogenesis. We observed weak expression of the endogenous BBM1 allele in BBM1-GR plants at l2h after DEX treatment, becoming stronger at 24h after DEX induction (FIG. 6f-h)). This induction of endogenous BBM1 expression by BBM1-GR is maintained in the presence of CYC, indicating that BBM1 can directly activate its own expression (FIG. le). It has been shown previously that expression of Brassica napus BnBBM in Arabidopsis can induce expression of AtBBM16 . Thus, BBM auto-activation might be conserved across plant species.
BBM1 IS PREFERENTIALLY EXPRESSED FROM THE PATERNAL GENOME
[0114] Our previous analysis of rice zygote transcriptome10 found that although the bulk of the transcripts were derived from female genome, a few de novo expressed (TFs), including two BBM-like genes were initially expressed from the male genome, including BBM1 which was exclusively paternally expressed at the earliest stage examined analysis of single nucleotide polymorphisms (SNPs) from RNA-seq.
[0115] To further probe the role of parental expression of BBM1 in rice zygote and early embryo development, we examined BBM1 expression in rice hybrid zygotes. Rice cultivars Indica (IR50) md Japonica (Kitaake) were reciprocally crossed, and RT-PCR was carried out on RNA from these hybrid zygotes at 2.5 hours after pollination (HAP), as described previously10 . The sequence analysis of SNPs in the RT-PCR products showed that BBM1 is expressed only from the male genome in both types of crosses (FIG. 2d; FIG.FIG. 7a-d), confirming the previous conclusion from RNA-seq analysis10 . To investigate whether the male allele expression in hybrid zygotes is also observed in isogenic zygotes, the BBM1 genomic locus was translationally fused to GFP (BBM1-GFP) and transgenic plants were generated in the inbred Japonica ( Kitaake ) cultivar (FIG.FIG. 7e). The BBM1-GFP fusion plants were then reciprocally crossed to wild-type plants, and the GFP expression was probed in zygotes at 2.5 HAP. Due to the difficulty of isolating live rice zygotes for GFP
fluorescence imaging, we used antibodies against GFP to detect the expression in sectioned rice carpels. Specifically, 20 zygotes were analyzed for each reciprocal cross, and another 20 zygotes from the self-pollination of the BBM1-GFP parent. Since the BBM1-GFP transformant parent is hemizygous for the BBM 1 -GFP transgene, if there is no parental bias for BBM1 promoter expression, we expect that GFP expression will be detected in three fourths of the selfed zygotes, and in half of the zygotes from each cross. On the other hand, if BBM1-GFP expression is only from the male-allele, we expect that half of the selfed zygotes and half of the zygotes using BBM1-GFP as pollen donor will express GFP, and none of the zygotes using the wild-type plants as pollen donor will express GFP. In our study, GFP expression was detected in 11/20 zygotes in BBM1-GFP selfed progeny, in 9/20 zygotes when the BBM1-GFP plants were used as male parents, and in 0/20 zygotes when the BBM1- GFP plants were used as female parents crossed with wild-type pollen (FIG. 2b-d). Thus, in the isogenic Japonica cultivar, expression of GFP in 2.5 HAP zygotes was observed only when the BBM1-GFP plant was used as the male parent, and not if BBM1-GFP was used as the female parent. These results imply that BBM1 expression in early zygotes is only from the male allele, consistent with the previous results using hybrid zygotes. Subsequently, GFP expression can be detected from the female allele in 6.5 HAP zygotes, corresponding to mid to late G2 phase (FIG.FIG. 7f-h). Because BBM1 is capable of auto-activation of its own promoter, as observed in the BBM1-GR experiment described above (FIG. 1E), the late expression of BBM1 from the female allele might be the consequence of the earlier BBM1 expression from the male allele. BBM1 expression continues through the later stages of the developing rice embryo (FIG.FIG. 7i, j). We also investigated if BBM1 is expressed in rice gametes. BBM1 RNA can be detected in sperm cells by RT-PCR, but no expression is detected in egg cells (FIG.FIG. 7k), consistent with RNA-seq transcriptome data (Table 1).
PATERNAL EXPRESSION OF BBM1 DRIVES EMBRYO DEVELOPMENT IN RICE
[0116] Although egg cells in plants are in interphase, and metabolically active,
embryogenesis is not initiated until fertilized by a sperm cell. The molecular details of the block that prevents an egg from proceeding to embryo development are not known. The ability of BBM1 to induce somatic embryogenesis in heterologous tissues, the absence of its expression from egg cells, and its paternal expression during zygote development suggested that BBM1 expression from the male parent could be involved in initiation of the
embryogenesis pathway after fertilization (FIG.FIG. 8a). If that is the case, then expression of BBM1 in the unfertilized egg cell might possibly be able to able to induce embryo development without fertilization (parthenogenesis). To test this hypothesis, we expressed BBM1 in rice egg cells using the egg cell-specific promoter pDD45 fused to the wild-type BBM1 gene (FIG.FIG. 8b, c). Flowers from pDD45: :BBMl plants were emasculated around anthesis stage and grown for 9 days. We observed embryonic structures without endosperm development in 12 out of 98 emasculated ovules of pDD45::BBMl hemizygous plants, and in zero out of 109 control wild-type carpels (Fig 2e; FIG.FIG. 8d; red arrow). This indicates BBM1 egg cell specific expression can induce parthenogenesis in rice, however, fertilization is still required for the endosperm development for proper seed formation. In naturally apomictic Pennisetum squamulatum, an apospory specific locus has been shown to contain multiple copies of a BABY BOOMAi s gene expressed in egg cells before fertilization, and which can induce parthenogenesis17 . These studies combined with our analysis suggest that in nature, apomixis could evolve through altered expression of existing genes, rather than through evolution of novel genes or pathways.
[0117] Although BBM genes have been isolated from several plant species, and their capability to induce somatic embryogenesis has been demonstrated9 , their function in early embryogenesis has been uncharacterized, in part because loss of function mutants in
Arabidopsis and related plants have no phenotypes. We investigated the consequences of BBM1 loss of function in rice by constructing an RNAi mutant (BBM I -RNA\): however, no obvious phenotypes were observed. As noted previously, there are multiple BBM- like genes in rice, of which at least 3 are expressed in early zygotes, suggesting that redundancy might mask the function of BBM1. Using the CRISPR-Cas9 system to simultaneously knockout BBM1 BBM2 and BBM3, we failed to regenerate any transgenic plants in tissue culture, suggesting that the triple knockout might be lethal. Therefore, we then used the CRISPR- Cas9 system to target the BBM1 and BBM3 loci, and separately target the BBM2 and BBM3 loci. We successfully recovered a bbml bbm3 double mutant, as well as a bbm2 bbm3 double mutant. Although both of the double mutants carried null mutations in the targeted genes, no obvious phenotypic defects were observed in either bbml bbm2 or bbm2 bbm3 mutants, and both the double mutant plants appeared to be fully fertile. We next crossed the bbml bbm2 mutants with the bbml bbm3 mutants, and selfed the progeny. No bbml bbm2 bbm3 triple homozygous plants were recovered in F2 generation, again suggesting that the triple mutants might not be viable. However, progeny which were heterozygous for BBM1 but homozygous mutant for bbm.2 and bbm3 could be recovered, and appeared fertile, therefore the progeny of these plants were analyzed in detail (FIG.FIG. 9a). Of the total 297 progeny seeds, 106 (~36 %) failed to germinate (Table 2). The genetic segregation ratios derived from genotyping of the germinated seedlings suggests that the viability of the bbml bbm2 bbm3 triple mutant seeds is severely affected, and that the viability of bbml/BBMl bbm2/bbm2 bbm3/bbm3 heterozygous progeny is also reduced (Table 2). Consistent with this conclusion, genotyping of a subset of the non-germinating seeds was attempted using the endosperm, and they were determined to be either homozygous for the bbml allele (6/8), or were heterozygous for bbml (2/8), but not homozygous ΐoc BBMI (FIG.FIG. 9b). Of the 170 control seeds derived from sibling plants that were wild-type for BBM1 (+/+) and also homozygous null for bbm.2 and bbm.3, all (100%) germinated, indicating that in contrast to the bbml bbm.2 bbm.3 triple mutants, the bbm2 bbm3 double mutants are fully viable.
[0118] The reduced frequency of viable heterozygous bbml! BBM1 progeny, together with the previously observed bias in the parental allele expression of BBM1 in zygotes, suggested that the parental origin of the BBM1 gene might account for the reduced frequency of viable heterozygotes. To investigate this possibility, we made reciprocal crosses of BBM1 +/+ bbm2, bbm3 to BBM1 -/+ bbm2, bbm3 plants (FIG.FIG. 9e). Approximately 50 % of the progeny seeds failed to germinate, when they inherited mutant BBM1 allele from a male parent (Table 3 A), whereas 100% of the progeny germinated if the wild-type BBM1 allele was inherited from the male parent (Table 3B). These data show that viability of rice seeds depends upon a functional BBM1 allele from the male parent, consistent with the male- specific expression of BBM1 in rice zygotes. Next, we investigated the embryo phenotypes of the bbm2 bbm3 mutants that were either homozygous or heterozygous for the bbml mutation. In rice embryos, organ morphogenesis starts at 4 days after pollination (DAP) and by 5 DAP the first leaf primordium is recognizable18 (FIG. 3a). In 5 DAP bbml, bbm2 , bbm.3 triple homozygous plants; however, embryos were either arrested early, after a few divisions, or underwent a large number of divisions but without any corresponding developmental patterning or morphogenesis (FIG. 3b, c). Rice embryo development is considered complete by 10 DAP18 (FIG. 3d). Similar to 5 DAP embryos, 10 DAP bbml, bbm2, bbm3 triple homozygous embryos were either arrested early at a few cell stage (24 out of 82 analyzed), or had kept dividing without any organ formation (50/82) (FIG. 3e, f). Embryos from selfed plants that are heterozygous for BBM1 but mutant for bbm.2 and bbm3, showed a range of phenotypes. Most of the embryos had normal development (n=38/53; FIG. 3g), while others were delayed (n=8/53; FIG. 3h). Some of these embryos, like the bbml bbm2 bbm3 triple homozygotes, were arrested after undergoing a few initial divisions (n=4/53; FIG. 3i), or kept dividing without forming any organs (n=3/53; FIG.FIG. 9d). It is possible that the delayed BBM1 heterozygous embryos are rescued by the late expression of the female BBM1 allele.
In addition, a fourth BBM- like gene, BBM4 (LOC_Os04g42570; Table 1), that was not mutated, may be providing residual function in the zygote which is sufficient for
embryogenesis in some cases. The recovery of two bbml, bbm2, bbm3 triple homozygous plants out of 297 total progeny is consistent with the hypothesis of residual BBM function provided by BBM4 (Table 2). BBM4 expression in the zygotes was not detectable in the RNA-seq transcriptome data, indicating that any BBM4 expression is much lower than BBM1. However, low level expression of BBM4 was detected in rice sperm cells (Table 1), suggesting that similar to the two other BBM genes, BBM4 is also active in the male gametes. Taken together, these data suggest that male-genome derived expression of BBM! . acting redundantly with other BBM genes triggers the initiation of embryogenesis in the fertilized egg cell. Concomitantly, activation of expression from the female BBM1 allele by male allele BBM1 results in bi-allelic BBM1 expression before the first embryonic division, with both parental alleles subsequently contributing to embryo patterning and organ morphogenesis (FIG.FIG. 10).
INDUCTION OF HAPLOIDS BY BBM1
[0119] Haploid plants contain only one set of chromosomes, either maternal or paternal depending on the gamete that gives rise to them or the technique used to produce them. This makes them efficient tools to reduce the time for new cultivar release in crops. Homozygous isogenic lines can be produced in one generation after chromosome doubling, bypassing the several generations it takes by inbreeding procedures19 . As described earlier, BBM1 egg cell specific expression can induce parthenogenesis in rice (FIG. 2e). However, parthenogenesis in emasculated DD45:BBMl flowers did not result in autonomous endosperm development, and the seeds aborted. Therefore, we analyzed self-pollinated Tl progeny from these transgenic plants to determine whether endosperm development by fertilization of the central cell could produce viable seeds containing parthenogenetically developing embryos. About 10 % (6 haploids out of total 57 plants) of the segregating hemizygous Tl progeny appeared to be haploid based on their appearance and sterility (FIG. 4a-c). Since haploids have defective meiosis, they are sterile (FIG. 4a; FIG.FIG. 11 a, b, f to i). They are short and have smaller floral organs compared to wild-type or diploid siblings (FIG. 4a, FIG.FIG. l lc to e). The ploidy of the putative haploid plants (n=6) was confirmed by flow cytometry (FIG. 4f-h). The haploid induction frequency increased to about 29% (93 haploids out of total 321 plants) in a homozygous T2 line #8C. The haploid inducer line was propagated by selecting diploid progeny, and has continued to produce a high frequency of haploids (about 30%) even after 6 generations of propagation. Our method presents a very efficient and clean way of producing haploids in rice. Other methods like androgenesis involves laborious tissue culturing and some rice cultivars are recalcitrant to andreogensis. The methods which involve genome eliminations need crossing with haploid inducer line and often result in aneuploids rather than pure haploids20 . Besides they have not been shown to work in a crop plants yet. ASEXUAL PROPAGATION THROUGH SEEDS BY EGG CELL-EXPRESSED BBM1 AFTER GENOME EDITING FOR MIME
[0120] Crop yields can be improved markedly by the use of hybrid plants that exhibit enhanced vigor (“hybrid vigor”). However, high-yielding hybrid plants produce progeny that give variable yields, due to segregation of multiple genetic factors in the next (F2) generation. For this reason, hybrid seeds need to be bought afresh every season and are consequently underutilized. However, if meiosis and fertilization, the two fundamental processes of sexual reproduction are bypassed, hybrids can be propagated through seeds. Engineering apomixis in crop plants has been described as“the holy grail of agriculture”6 . Although natural apomixis is known in over 300 angiosperm species21·22 , it has not been reported in a crop plant with the exception of a few forage grasses and fruit trees that are minor crops23 .
Engineering apomixis in crop plants will ensure fixation of hybrid vigor, stabilization of superior heterozygous genotypes for faster breeding programs and improve yield, quality and exchange of virus free vegetatively propagated true seed crops24 .
[0121] A genetic approach called MiMe, that skips recombination and substitutes mitosis for meiosis, has been reported in Arabidopsis4 and more recently in rice5 . In MiMe, by combining null mutations in three meiotic genes, REC8, PA1R1 and OSD I . unrecombined diploid male and female gametes are produced. We tested the possibility that combining BBMl-induced parthenogenesis in rice with MiMe could result in asexual propagation through seeds (FIG.FIG. l3b). The three rice MiMe genes5 were genome edited using CRISPR-Cas9 in haploid plants carrying the pDD45::BBMl transgene that results in egg cell expression of BBM1 (FIG.FIG. l2a, b). Since meiosis is omitted in MiMe plants, we obtained fertile haploid plants which have viable pollen (FIG.FIG. l2e to g) and seed set comparable to control diploid MiMe plants (FIG.FIG. l2c, d). While wild-type haploids do not undergo anthesis (FIG. 4c), MiMe haploids show normal anthesis (FIG. 4b, d). Self-pollination of MiMe plants results in doubling of the chromosome number25 , so that the progeny of haploid MiMe plants are expected to be diploid. However, because these MiMe haploid plants also carried the egg cell promoter fusion ior BBMl (pDD45::BBMl), we expected to also produce haploid progeny by parthenogenesis, that would then be genetically identical to the parent.
We examined by flow cytometry Tl progeny grown from the seeds one of these haploid MiMe plants and found 3 haploid progeny, as well as 6 diploid progeny out of 9 total plants analyzed; the ratio of haploids (33%) being in line with the -30% rate of haploid induction observed in the progenitor haploid inducer line (see above). These results show that haploid plants can be propagated through seeds when MiMe is combined with BBM1 -induced parthenogenesis. We then repeated the genome editing by CRISPR-Cas9 of the three rice MiMe genes5 in diploid plants carrying the pDD45::BBMl transgene. The frequency of success in generating fertile MiMe plants is lower for diploids as compared to haploids, because both alleles of all three MiMe genes have to be simultaneously mutated to null alleles; double mutant combinations of the MiMe genes result in sterile plants and cannot be propagated. Nevertheless, one fertile diploid was recovered from the transformants that was found to have the requisite six null mutations generated by CRISPR-Cas9, consisting of different biallelic mutations in PA1R1 and REC8 and the same null mutation in both alleles of OSD1. This diploid MiMe plant with egg cell-expressed BBM1 can be expected to yield progeny that are either tetraploid due to fertilization by the diploid gametes, or diploid due to asexual reproduction arising from parthenogenesis of the diploid egg cell. Flow cytometry analysis of 13 progeny from this plant showed that 2 progeny were indeed diploid as expected from asexual propagation, while the rest were tetraploid. Progeny from a control MiMe diploid plant (n=l39) were all tetraploid. The mother plants and Tl diploid progeny were genotyped for 3 MiMe genes as PAIR1 and REC8 mutations are bi-allelic, to test if the progeny are clones or segregate in Tl generation. The Tl diploid progeny have identical mutations as that of the mother plant indicating there was no segregation or recombination (FIG.FIG. 14). Thus, these results show, both haploid and diploid progeny obtained from these haploid and diploid apomictic plants respectively are clones of the parental lines. The double haploid progeny from haploid apomixis mother plants also yielded diploid and tetraploid plants in the T2 generation. This is a proof of concept that apomixis can be engineered in rice, for clonal propagation of hybrids through seeds. Since homologous BBM- like genes are found in other cereal crops17 , our method of haploid induction and synthetic apomixis should be extendible to these crops as well.
1 Russell, S. D. in Plant Developmental Biology - Biotechnological Perspectives Vol.
1 Ch. 283, 283-300 (2010).
2 Palovaara, I, de Zeeuw, T. & Weijers, D. Tissue and Organ Initiation in the Plant Embryo: A First Time for Everything. Annual review of cell and developmental biology 32, 47-75, doi: 10. H46/annurev-cellbio-l 11315-124929 (2016). 3 Horstman, A., Willemsen, V., Boutilier, K. & Heidstra, R. AINTEGUMENTA- LIKE proteins: hubs in a plethora of networks. Trends in plant science 19, 146-157, doi: 10. l0l6/j.tplants.20l3.10.010 (2014).
4 d'Erfurth, I. el al. Turning meiosis into mitosis. PLoS biology 7, el000l24, doi: 10. l37l/joumal.pbio.1000124 (2009).
5 Mieulet, D. et al. Turning rice meiosis into mitosis. Cell research 26, 1242-1254, doi: l0. l038/cr.20l6. H7 (2016).
6 Sailer, C., Schmid, B. & Grossniklaus, U. Apomixis Allows the Transgenerational Fixation of Phenotypes in Hybrid Plants. Current biology : CB 26, 331-337,
doi: 10. l0l6/j.cub.20l5.12.045 (2016).
7 Calzada, J.-P. V., Crane, C. F. & Stelly, D. M. Apomixis— The Asexual Revolution. Science 274, 1322-1323, doi: l0. H26/science.274.529l. l322 (1996).
8 Kim, S., Soltis, P. S., Wall, K. & Soltis, D. E. Phylogeny and domain evolution in the APETALA2-like gene family. Molecular biology and evolution 23, 107-120, doi: l0.l093/molbev/msj0l4 (2006).
9 Boutilier, K. et al. Ectopic expression of BABY BOOM triggers a conversion from vegetative to embryonic growth. The Plant cell 14, 1737-1749 (2002).
10 Anderson, S. N. et al. The Zygotic Transition Is Initiated in Unicellular Plant Zygotes with Asymmetric Activation of Parental Genomes. Developmental cell 43, 349-358 e344, doi: l0 0l6/j.devcel.20l7. l0.005 (2017).
11 Mignolli, F., Mariotti, L., Picciarelli, P. & Vidoz, M. L. Differential auxin transport and accumulation in the stem base lead to profuse adventitious root primordia formation in the aerial roots (aer) mutant of tomato (Solanum lycopersicum L.). Journal of plant physiology 213, 55-65, doi: l0. l0l6/j.jplph.20l7.02.0l0 (2017).
12 Toriba, T. & Hirano, H. Y. The DROOPING LEAF and OsETTIN2 genes promote awn development in rice. The Plant journal : for cell and molecular biology 77, 616-626, doi: 10.111 l/tpj .12411 (2014).
13 Cardarelli, M. & Cecchetti, V. Auxin polar transport in stamen formation and development: how many actors? Frontiers in plant science 5, 333,
doi: l0.3389/fpls.2014.00333 (2014). 14 Perianez-Rodriguez, J., Manzano, C. & Moreno-Risueno, M. A. Post-embryonic organogenesis and plant regeneration from tissues: two sides of the same coin? Frontiers in plant science 5, 219, doi: l0.3389/fpls.20l4.002l9 (2014).
15 Chen, J. et al. Zygotic Genome Activation Occurs Shortly after Fertilization in Maize. The Plant cell 29 , 2106-2125, doi: 10. H05/tpc.17.00099 (2017).
16 Passarinho, P. et al. BABY BOOM target genes provide diverse entry points into cell proliferation and cell growth pathways. Plant molecular biology 68, 225-237, doi: 10.1007/s 11103-008-9364-y (2008).
17 Conner, J. A., Mookkan, M., Huo, H., Chae, K. & Ozias-Akins, P. A
parthenogenesis gene of apomict origin elicits embryo formation from unfertilized eggs in a sexual plant. Proceedings of the National Academy of Sciences of the United States of America 112, 11205-11210, doi: 10. l073/pnas.1505856112 (2015).
18 Itoh, J. et al. Rice plant development: from zygote to spikelet. Plant & cell physiology 46, 23-47, doi: l0.l093/pcp/pci50l (2005).
19 Murovec, J. & Bohanec, B. Haploids and Doubled Haploids in Plant Breeding. (2012).
20 Marimuthu, M. P. et al. Synthetic clonal reproduction through seeds. Science 331, 876, doi: 10. H26/science.1199682 (2011).
21 Khush GS, B. D., Bennett J, Virmani SS. . Apomixis for rice improvement. In Apomixis: Exploiting Hybrid Vigour in Rice 15-21 (1994).
22 G., C. J. Asynchronous expression of duplicate genes in angiosperms may cause apomixis, bispory, tetraspory, and polyembryony. Biological Journal of the Linnean Society 61, 51-94 (1997).
23 Barcaccia, G. & Albertini, E. Apomixis in plant reproduction: a novel perspective on an old dilemma. Plant reproduction 26, 159-179, doi: l0. l007/s00497-0l3-0222-y (2013).
24 Spillane, C., Curtis, M. D. & Grossniklaus, U. Apomixis technology development- virgin births in farmers' fields? Nature biotechnology 22, 687-691, doi: l0. l038/nbt976 (2004). 25 Cifuentes, M., Rivard, M., Pereira, L., Chelysheva, L. & Mercier, R. Haploid meiosis in Arabidopsis: double-strand breaks are formed and repaired but without synapsis and crossovers. PloS one 8, e7243l, doi: l0. l37l/joumal.pone.007243l (2013).
METHODS
PLANT MATERIALS AND GROWTH CONDITIONS.
[0122] Rice cultivar Kitaake ( Oryza sativa L. subsp .japonicd) was used for
transformations for raising transgenic lines and as a wild-type control. Wild-type, mutant and transgenic seeds were germinated on half strength Murashige and Skoog’s medium26 containing 1% sucrose and 0.3% phytagel in a growth chamber for 12 days under 16 h light: 8 h dark cycle at 28 °C and 80% relative humidity. Seedlings were then transferred to greenhouse and grown under natural light conditions at Davis, California.
CHEMICAL TREATMENTS.
[0123] Two-week-old wild-type and BBMTGR seedlings were treated with 0.1% ethanol as mock, 10 mM dexamethasone (dex) (Sigma), 10 mM cycloheximide (eye) (Sigma) alone, or in combination with 10 mM dex in liquid half strength MS26 salts. Seedlings which had similar size and same number of leaves were selected for treatments. Tissues samples from same leaf and roughly the same size from 4 plants, to make one biological replicate, were harvested for RNA isolation at 6h, l2h and 24 h. Cyc treatments were started 30 minutes before the dex treatment in samples which were treated with both the chemicals. For dex induced phenotypes (FIG.FIG. 6b, c), one-week-old BBMTGR seedlings were transferred to half strength MS media either mock treated or containing 10 pM dex and grown for one more week. For phenotypes observed in (FIG.FIG. 6d, e), plants started receiving either mock or 10 pM dex water around flowering transition (45 days after germination) till the panicles completely emerged.
[0124] Plasmid constructs: Full length open reading frame (ORF) of BBM1 was amplified from cDNAs made from rice calli using two sets of primers (KitBlFl 5’- CGGATCC ATGGCCTCCATC ACC-3’, KitBlRl 5’-CCTTCGACCCCATCCCAT-3’ and KitBlF2 5’ -GGATGGGATGGGGTCGAAG-3’ , KitBlR2 3’-
GGTACC AGACTGAGAAC AGAGGC-3’). The two fragments were fused together by an overlap PCR. Overexpression construct (BBMl-ox) was created by cloning BBM1 ORF in pUN vector27 (FIG.FIG. 5a). For creating BBM1-GR plasmid (FIG.FIG. 6a), BBM1 ORF without stop codon was cloned in pUGN vector27 for translational fusion with rat glucocorticoid receptor28. The whole BBM1 locus, roughly 3kb upstream sequences and transcribed region till stop codon were PCR amplified in two fragments from genomic DNA using 2 primer pairs pBlFl 5 -CTCGAGGTCAACACCAACGCCATC -3’, pBlRl 5’- GAAGTCCTCCAGCTTCGGCGC -3’ and, pBlF2 5’- TT GATT GT GTT GAT GT GC AGAGT GGGG -3’ and pBlR2 5’- CTCGAGCGGTGTCGGCAAAACC -3’. The two fragments were joined at a unique restriction enzyme site, No! I. present downstream of start codon in the sequence. The whole locus was moved to a pCAMBIAl300 vector already harboring Arabidopsis histone H2B, eGFP and Nopaline Synthase NOS gene terminator (FIG.FIG. 7e). Construct for egg cell specific expression of BBM1 was made by cloning BBM1 downstream to Arabidopsis DD45 promoter29 and upstream of the NOS terminator (FIG.FIG. 8b) in pCAMBIAl300.
[0125] RNAi knockdown construct for BBM1 (BBMl-RNAi) was designed by amplifying a 600 bp gene specific fragment from 3’ UTR with BlRNAi F 5’- CCTCGAGCAACTATGGTTCGCAGC -3’ and BlRNAi R 5’- GATATC
CCAGACTGAGAACAGAGGC -3’ primers from calli cDNAs and cloned as an inverted repeat separated by a 760 bp spacer fragment in pUN binary vector as described in27. For genome editing BBM1, BBM2 and BBM3 genes, single guide RNA (gRNA) sequences 5’- GGAGGACTTCCTCGGCATGC -3’, 5’- GTATGCAATATACTCCTGCC -3’ and 5’- GACGGCGGGAGCTGATCCTG -3’ respectively were designed by using the web tool https://www.genome.arizona.edu/crispr/ as per30. The gRNAs were cloned in pENTR-sgRNA entry vector. The binary vectors for plant transformations (pCRISPR BBM1+BBM3, pCRISPR BBM2+BBM3 and pCRISPR BBM1+ BBM2+BBM3) were constructed by Gateway LR clonase (Life Technologies) recombination with pUbi-Cas9 destination vector as described in31. Three candidate genes ( OsOSDl, Os02g37850; OsPAIRl, 0s03g0l590 and OsREC8, 0s05g504l0) for creating MiMe mutations in rice were selected as per5 and gRNAs sequences 5 -GCGCTCGCCGACCCCTCGGG -3’, 5’- GGTGAGGAGGTTGTCGTCGA - 3’ and 5’- GTGTGGCGATCGTGTACGAG -3’ respectively for CRISPR-Cas9 based knockout were designed as described by30. Vector pCAMBIA2300 MiMe CRISPR-Cas9 (FIG.FIG. l2a) for plant transformations was constructed as per31 except the resistance marker in the destination vector pUbi-Cas9 was changed to Kanamycin ( Neomycin
Phosphotransferase IP). pC A B I A2300 MiMe CRISPR-Cas9 was transformed in embryogenic calli derived from pDD45::BBMl#8c haploid inducer lines (FIG.FIG. 8b). Rice transformations were carried out as per32 at UC Davis plant transformation facility. TO plants were grown in green house and screened for MiMe mutations. Tl plants obtained from seeds were subjected to ploidy determination and genotyping for MiMe mutations.
GENOTYPING
[0126] Genotyping of BBM1, BBM2 and BBM3 mutants was carried out by PCR amplifying DNA at the mutation site with primers BBM1 SeqF 5’-
TTGATTGTGTTGATGTGC -3’ BBM1 SeqR 5’- gagagacgacctacttggtgac -3’; BBM2 SeqF 5’ -T AGCT AGCTT GTT AAT AGATC ATAG -3’, BBM2 SeqR 5’-
TCATATCTCAGTGTGATAGTCTG -3’ ; BBM3 SeqF 5’- ATGCTGCTGCTCCGAGAAG -3’ and BBM3 SeqR 5’- GCTTAGTGCTCCAAACCTCTC -3’. Sanger sequencing33 of the three PCR amplicons of 464 bp, 262 bp and 547 bp respectively for the three genes was carried out at UC Davis DNA sequencing facility. Since 1 bp deletion mutation in BBM1 disrupted a Sphl restriction enzyme site (FIG.FIG. 9a), all the further genotyping of BBM1 for mutational analysis were done with restriction digestion of the PCR amplicon with Sphl (FIG.FIG. 9b). For genotyping developing seeds of 5 DAP onwards, endosperm was used for genotyping and embryos were collected for mutant phenotype analysis. DNA fragments at the mutation sites of three MiMe genes were PCR amplified with primers OSD1F 5'- TTACTTGGAAGAGGCAGGAGCC -3', OSD1 R 5'- ACCTTGACGACTGACGTGATGTC -3'; PAIR1 F 5'- GTGGTGTGGTGTGTTCAGGAG -3', PAIR1 R 5'- T GGAATCCC C AAT C AGT AAGGC AC -3'; REC8 F 5'- GCACTAAGGCTCTCCGGAATTCTC -3' and REC8 R 5'-
AATGGATCAAGGAGGAGGCACC -3'. PCR amplicons of 364 bp, 344 bp and 326 bp for OsOSDJ OsPAIRl and OsREC8 respectively, were subjected to Sanger sequencing33 (Sanger et al, 1977) for mutation analysis.
CROSSES AND POLLINATIONS:
[0127] Flowers from pDD45::BBMl TO transgenic rice lines were emasculated around the anthesis stage, bagged and let to grow for another 9 days after emasculation (DAE). Carpels were harvested and fixed for analysis. For zygote analysis, flowers from wild-type or BBMTGFP transgenic plants were hand pollinated around the anthesis stage and carpels were harvested after 2.5 h and 6.5 hours after pollination (HAP). For embryos, self-pollinated flowers from mutant plants were marked the anthesis day and carpels harvested 5 or 10 days after pollination (DAP). For crossing bbml bbm3 with bbm2 bbm3 and reciprocal crosses between BBM1-/+ bbm2 bbm3 and BBM1+/+ bbm2 bbm3, panicles used as females were emasculated and bagged with pollen donor panicles. The bags were gently finger tapped for next three days and left bagged to make seeds. Fl seeds (FIG.FIG. 9e) were harvested 4 weeks after pollination. For bbml bbm3 and bbm2 bbm3 crosses, Tl or T2 progeny plants in which CRISPR-Cas9 transgene had already segregated out were used as male or female parents.
[0128] Immunohistochemistry and toluidine blue staining: Harvested carpels were fixed in FAA [formaldehyde (10%) - acetic acid (5%) - ethanol (50%)]. Tissue embedding and sectioning was done as per34. Immunohistochemistry was carried out as per 35 except an antigen retrieval step was also included. Antigen retrieval was done by microwaving the slides in 10 mm sodium citrate buffer (pH 6.0) for 10 mins. Rabbit anti-GFP antibody ab6556 (Abeam) was used as primary antibody and goat anti-rabbit alkaline phosphatase conjugate A9919 (Sigma) was used as secondary antibody. After rehydration, sections crossbnked to glass slides were stained with 0.01% toluidine blue for 30 seconds.
[0129] Flow cytometry: Nuclei for Fluorescence-Activated Cell Sorting (FACS) analysis were isolated by leaf chopping method as described by36. The isolated nuclei were stained with propidium iodide at 40 pg/ml concentration in Galbraith’s buffer. FACS analysis and DNA content estimation was done with Becton Dickinson FACScan system as per37·38.
[0130] Alexander staining of pollen grains: Stamens were harvested just before anthesis. Anthers were put on a glass slide in a drop of Alexander’s stain containing 40 pl of glacial acetic acid per milliliter of stain39. Anthers were covered with a cover slip and slides were heated at 55 °C on a heating block, till the visible staining of pollen was observed.
LIBRARY PREPARATION AND SEQUENCING
[0131] RNA isolation, quality assessment, quantification and library preparations were done as described in10 with some modifications. Libraries were prepared from two biological replicates for each sample with 80 ng of input RNA, using NuGEN Ovation RNA-seq Systems 1-16 for Arabidopsis following manufacturer instructions. Samples were multiplexed and 8 libraries per lane were run on Illumina HiSeq platforms at UC Davis, Genome Center.
RNA-SEQ ANALYSIS
[0132] Cutadapt40 was used to remove 3’ adapters and quality -trim reads at a Phred quality threshold of 13. High-quality reads were then mapped to the Oryza sativa Nipponbare reference genome41 (MSU v7.0) using Tophat242 with the minimum and maximum intron sizes set at 20 and 15000 bases and the microexon search switched on. Mapped reads were assigned to the MSU v7.0 gene models (Phytozome release 323) using HTSeq. Differential expression analysis was performed using the edgeR package43. Effective library sizes were calculated using the trimmed mean of M-values (TMM) method and a quasi-likelihood (QL) negative binomial generalized linear model was fitted to the data44 (Chen 2016). The contrasts of DEX, DEX and CYC, and CYC with their respective mock samples were created for both wild-type and BBM1-GR. For each contrast, a QL F-test was performed to detect differentially expressed genes (FDR < 0.05). Genes induced by dex or eye treatments in wild- type were subtracted from the respective treatments in BBM1-GR samples. Code for different analysis is available from corresponding author upon request for noncommercial use.
RT-PCR AND RT-QPCR
[0133] All the cDNAs were synthesized using the iScript cDNA synthesis kit (BioRad) as per manufacturer instructions. RT-PCRs were done with MyTaq® Red Mix (Bioline) and RT- qPCRs with iTaq™ universal SYBR® Green supermix (BioRad) using CFX96 Touch™ realtime PCR system (BioRad). OsUbiquitin5 (Os03gl3l70) was used as internal control and fold changes in the relative abundance of transcripts were calculated as described by45. RT- qPCR amplifications for each gene were performed in two biological replicates and each biological replicate was repeated in technical replicates for each sample. All the primers used are listed here.
SNP ANALYSIS
[0134] PCRs were done with hybrid, 2.5 HAP zygote cDNAs from reciprocally crossed rice japonica cultivar Kitaake and indica cultivar IR50 as described in10. Primers BlRNAi F and BlRNAi R which amplified a gene specific fragment of ~ 600 bp of BBM1 contains 5 SNPs between Kitaake and IR50 (FIG. 2a; FIG.FIG. 7a-d). The PCR amplicons were Sanger sequenced33 and chromatograms were analyzed for SNPs.
METHODS REFERENCES
26 Murashige, T. & Skoog, F. A Revised Medium for Rapid Growth and Bio Assays with Tobacco Tissue Cultures. Physiologia Plantarum 15, 473-497, doi: 10.111 l/j.1399- 3054. l962.tb08052.x (1962).
27 Khanday, I., Yadav, S. R. & Vijayraghavan, U. Rice LHSl/OsMADSl controls floret meristem specification by coordinated regulation of transcription factors and hormone signaling pathways. Plant physiology 161, 1970-1983, doi: 10. H04/pp.112.212423 (2013). 28 Aoyama, T. & Chua, N. H. A glucocorticoid-mediated transcriptional induction system in transgenic plants. The Plant journal : for cell and molecular biology 11, 605-612 (1997).
29 Steffen, J. G., Kang, I. H., Macfarlane, J. & Drews, G. N. Identification of genes expressed in the Arabidopsis female gametophyte. The Plant journal : for cell and molecular biology 51, 281-292, doi: 10.111 l/j .1365-313X.2007.03137.x (2007).
30 Xie, K., Zhang, J. & Yang, Y. Genome-wide prediction of highly specific guide RNA spacers for CRISPR-Cas9-mediated genome editing in model plants and major crops. Molecular plant 7, 923-926, doi: l0. l093/mp/ssu009 (2014).
31 Zhou, H., Liu, B., Weeks, D. P., Spalding, M. H. & Yang, B. Large chromosomal deletions and heritable small genetic changes induced by CRISPR/Cas9 in rice. Nucleic acids research 42, 10903-10914, doi: l0. l093/nar/gku806 (2014).
32 Hiei, Y. & Komari, T. Agrobacterium-mediated transformation of rice using immature embryos or calli induced from mature seed. Nature protocols 3, 824-834, doi: l0. l038/nprot.2008.46 (2008).
33 Sanger, F., Nicklen, S. & Coulson, A. R. DNA sequencing with chain-terminating inhibitors. Proceedings of the National Academy of Sciences of the United States of America 74, 5463-5467 (1977).
34 Javelle, M., Marco, C. F. & Timmermans, M. In situ hybridization for the precise localization of transcripts in plants. Journal of visualized experiments : JoVE, e3328, doi: 10.3791/3328 (2011).
35 Sessions, A. Immunohistochemistry on sections of plant tissues using alkaline- phosphatase-coupled secondary antibody. CSH protocols 2008, pdb.prot4946,
doi : 10.1101 /pdb. prot4946 (2008).
36 Galbraith, D. W. et al. Rapid flow cytometric analysis of the cell cycle in intact plant tissues. Science 220, 1049-1051, doi: l0. H26/science.220.4601.1049 (1983).
37 Dolezel, J., Greilhuber, J. & Suda, J. Estimation of nuclear DNA content in plants using flow cytometry. Nature protocols 2, 2233-2244, doi: l0.l038/nprot.2007.3l0 (2007).
38 Cousin, A., Heel, K., Cowling, W. A. & Nelson, M. N. An efficient high-throughput flow cytometric method for estimating DNA ploidy level in plants. Cytometry. Part A : the journal of the International Society for Analytical Cytology 75, 1015-1019, doi: l0. l002/cyto.a.208l6 (2009).
39 Alexander, M. P. Differential staining of aborted and nonaborted pollen. Stain technology 44, 117-122 (1969).
40 Martin, M. Cutadapt removes adapter sequences from high-throughput sequencing reads. EMBnet.journal; Vol 17, No 1: Next Generation Sequencing Data Analysis (2011).
41 Kawahara, Y. el al. Improvement of the Oryza sativa Nipponbare reference genome using next generation sequence and optical map data. Rice (New York, N. Y.) 6, 4, doi: 10.1186/1939-8433-6-4 (2013).
42 Kim, D. et al. TopHat2: accurate alignment of transcriptomes in the presence of insertions, deletions and gene fusions. Genome biology 14, R36, doi: 10.1 l86/gb-20l3-l4-4- r36 (2013).
43 Robinson, M. D., McCarthy, D. J. & Smyth, G. K. edgeR: a Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics (Oxford, England) 26, 139-140, doi: l0. l093/bioinformatics/btp6l6 (2010).
44 Chen, Y., Lun, A. T. & Smyth, G. K. From reads to genes to pathways: differential expression analysis of RNA-Seq experiments using Rsubread and the edgeR quasi-likelihood pipeline. FlOOOResearch 5, 1438, doi:l0. l2688/fl000research.8987.2 (2016).
45 Livak, K. J. & Schmittgen, T. D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods (San Diego, Calif) 25, 402-408, doi: 10. l006/meth.2001.1262 (2001).
Example 2
[0135] A major unresolved problem in plant development is the molecular pathway underlying the initiation of embryogenesis by a fertilized egg cell (Palovaara, J., de Zeeuw,
T. & Weijers, D Annual review of cell and developmental biology 32, 47-75,
doi: 10. H46/annurev-cellbio-l 11315-124929 (2016)). In animals, the initiation of embryogenesis depends upon defined maternal factors (Lee, M. T. et al, Annual review of cell and developmental biology 30, 581-613, doi: l0. H46/annurev-cellbio-l009l3-0l3027 (2014)). In plants, contrasting models have proposed that the two parental genomes contribute equally (Nodine, M. D. & Bartel, D. P., Nature 482, 94-97, doi: l0. l038/naturel0756 (2012)) vs. the maternal genome plays the primary role in early embryogenesis (Autran, D. et ctl, Cell 145, 707-719, doi: 10. l0l6/j. cell.2011.04.014 (2011); Del Toro-De Leon, G., Garcia- Aguilar, M. & Gillmor, C. S., Nature 514, 624-627, doi: l0. l038/naturel3620 (2014)). The identity and parental origin of the specific factors in plants triggering zygotic development are as yet undetermined.
[0136] We have previously used rice to elucidate transcriptome dynamics during the zygotic transition (Anderson, S. N. et al, Developmental Cell 43, 349-358 e344, doi: 10. l0l6/j.devcel.20l7.10.005 (2017)) and found that BABY BOOM {BBM) like transcription factors, of the APETALA 2/ETHYLENE RESPONSE FACTOR (AP2/ERF) superfamily (Kim, S. et al, Molecular biology and evolution 23, 107-120,
doi: l0.l093/molbev/msj0l4 (2006)), are expressed in zygotes after fertilization suggesting a potential role in initiating embryogenesis (Extended Data Table la). BBM genes from Arabidopsis thaliana and Brassica napus can ectopically induce somatic embryos (Boutilier, K. et al, The Plant cell 14, 1737-1749 (2002)); however, a role in initiation of zygotic embryos has not been established (Horstman, A. et al, Trends in plant science 19, 146-157, doi: 10. l0l6/j.tplants.2013.10.010 (2014)). We first determined that ectopic expression of BBMJ a rice zygote-expressed BBM- like gene, also resulted in somatic embryos, both by morphology and using embryo marker genes (FIG. 18 a-d). Since BBM1 expression increases with zygote age (Anderson, S. N. et al, Developmental Cell 43, 349-358 e344,
doi: 10. l0l6/j.devcel.2017.10.005 (2017)) (Table 5a), we investigated whether its expression is autoregulated, by dexamethasone (DEX)-induction of a constitutive BBM 1 -Glucocorticoid Receptor (GR) fusion in somatic tissues (FIG. l8e). Using RT-qPCR with allele-specific primers, expression of endogenous BBM! . but not the BBM1-GR fusion transgene, was found to be highly induced after 24h of DEX treatment (FIG. l8f-h). This expression was maintained in the presence of the protein biosynthesis inhibitor cycloheximide (CYC), indicating that BBM1 auto-activation is likely to be direct (FIG. l8h). Auto-activation might be a conserved feature of BBM genes, since B. napus BABY BOOM (/riiBBM) can activate expression of Arabidopsis AtBBM (Passarinho, P. et al. , Plant molecular biology 68, 225- 237, doi: 10. l007/sl 1 l03-008-9364-y (2008)).
[0137] Our previous study of hybrid zygote transcriptomes (Anderson, S. N. et al, Developmental Cell 43, 349-358 e344, doi: l0. l0l6/j.devcel.2017.10.005 (2017)) indicated that although most zygotic transcripts were from the female genome, a few de novo transcription factors, including BBM1, had male-derived transcripts. By RT-PCR amplification across single nucleotide polymorphisms (SNPs) in BBM I . we confirmed that at 2.5 hours after pollination (HAP) (corresponding to karyogamy), only the male BBM1 allele is expressed in reciprocal crosses of indica and japonica cultivars (Anderson, S. N. et ah, Developmental Cell 43, 349-358 e344, doi: 10. l0l6/j.devcel.20l7.10.005 (2017)) (FIG. l9a). These results were confirmed in isogenic zygotes in japonica
[0138] Kitaake cultivar. We reciprocally crossed wild-type plants to transgenic plants carrying a translational fusion of the BBM1 genomic locus to GFP ( BBM1-GFP ) (FIG. l9b). Zygotes at 2.5 HAP displayed GFP expression only if the BBM1-GFP transgene was transmitted from the male parent (FIG. l5a). Consistent with this observation, in BBM1-GFP selfed progeny, GFP was detected in about half the zygotes, instead of the three-fourths ratio expected if there is no parent-of-origin bias (FIG. l5a). Subsequently, GFP expression can be detected from the female allele in 6.5 HAP zygotes, corresponding to mid to late G2 phase (FIG. l9c, d). Because BBM1 is capable of auto-activation of its own promoter (FIG. l8h), the late expression of BBM1 from the female allele might result from earlier male BBM1 allele expression. Other redundantly acting BBM genes might also contribute to this delayed activation (see below). BBM1 expression continues through later stages of embryo development (FIG. l9e). In gametes, BBM1 RNA can be detected by RT-PCR in sperm cells but not in egg cells (FIG. l9f), consistent with RNA-seq data (Anderson, S. N. et al, The Plant journal 76, 729-741, doi: 10.111 l/tpj .12336 (2013)) (Table 5a). Furthermore, the BBM1-GFP fusion protein was expressed in sperm cells, suggesting that both transcription and translation of BBM1 can occur in male gametes before fertilization (FIG. l9g).
[0139] The male genome-specific expression of BBM1 after fertilization, together with its somatic embryogenesis capability, suggested that BBM1 could be a trigger of embryo development in the zygote (FIG. l7a). In naturally apomictic (asexually reproducing) Pennisetum squamulatum, an apospory specific locus contains multiple copies of a BABY BOOMAiks gene which is expressed in egg cells before fertilization and induces
parthenogenesis (Conner, J. A., Proceedings of the National Academy of Sciences of the United States of America 112, 11205-11210, doi: 10. l073/pnas.1505856112 (2015); Conner, J. A., Podio, M. & Ozias-Akins, P., Plant reproduction 30, 41-52, doi:l0T007/s00497-0l7- 0298-x (2017)). However, it is not known if the BBM protein from the apomict has evolved novel capability in functional domains and interactions with other factors(Conner, J. A., Proceedings of the National Academy of Sciences of the United States of America 112,
11205-11210, doi: 10. l073/pnas.1505856112 (2015); Conner, J. A., Podio, M. & Ozias- Akins, P., Plant reproduction 30, 41-52, doi:l0. l007/s00497-0l7-0298-x (2017)), or if parthenogenesis might simply be a consequence of the expression pattern. To test whether wild-type rice BBM1 could initiate embryo development without fertilization, we ectopically expressed BBM1 gene under an Arabidopsis egg cell-specific promoter (pDD45 ) (Steffen, J. G. et al, The Plant Journal 51, 281-292, doi:l0.l l l l/j. l365-3l3X.2007.03l37.x (2007)) previously shown to confer egg cell expression in rice (Ohnishi, Y., Hoshino, R. & Okamoto, T Plant physiology 165, 1533-1543, doi: 10. H04/pp.114.236059 (2014)) (FIG. 20b, c). In emasculated flowers, we observed embryonic structures without endosperm development (Fig 15b) in -12% (n=98) of ovules of pDD45: :BBMl transformants (henceforth referred to as BBMI-QQ, for BBMI-egg cell expressed), that are absent in wild-type ovules (n=l09). Thus, expression of a single wild-type transcription factor BBM1 can overcome the fertilization requirement for embryo initiation by an egg cell. The observation that a wild- type gene from a sexually reproducing plant is sufficient to induce parthenogenesis when mis-expressed suggests that asexual reproduction could potentially evolve from altered expression of existing genes within the sexual pathway.
[0140] Loss of function mutants of BBM- like genes in Arabidopsis and related plants have no embryonic phenotypes, consequently their functions in early embryogenesis are as yet undefined (Horstman, A. et al, Trends in plant science 19, 146-157,
doi: 10. l0l6/j.tplants.2013.10.010 (2014)). Of the multiple BBM-Ytke genes in rice, at least three, BBM1, BBM2 md BBM3 (Osl lgl9060, 0s02g40070 and OsOlg674lO respectively), are consistently expressed in early zygotes (Extended Data Table la). We used the CRISPR- Cas9 system to generate bbml bbm3 and bbm.2 bbm3 double mutants (FIG. 21 a, b), which were both fully fertile. Crossing the double mutants and selfing (FIG. 2lc; see Methods), yielded no bbml bbm2 bbm3 triple homozygous plants (n=52). However, BBMl/bbml bbm2/bbm2 bbm3/bbm3 plants were recovered and selfed (FIG. 21 d). Analysis of the progeny showed -36 % failed to germinate (Table 5b). Genotyping of the germinated seedlings suggest that the viability of the bbml bbm2 bbm3 triple mutant seeds is severely affected (2/191 vs. expected 48/191; Table 5b). BBMl/bbml bbm2/bbm2 bbm3/bbm3 seedlings were also under-represented, suggesting that the viability of this genotype is also compromised (Table 5b). A subset of the non-germinating seeds could be genotyped using their endosperm, and found to be either homozygous or heterozygous for bbml, but not homozygous ΐoc BBMI (FIG. 2le). The two bbml bbm2 bbm3 triple homozygotes showed normal growth with no obvious vegetative or floral defects, and produced normal seed sets, indicating that the BBM1-3 genes are not required for post-embryonic development.
However, their progeny seeds failed to germinate (FIG. 2lf), confirming the requirement of BBM1-3 genes for seed viability.
[0141] To test whether the parent of origin affects seed viability, we performed reciprocal crosses of BBMl/bbml bbm2/bbm2 bbm3/bbm3 to BBM1/BBM1 bbm2/bbm2 bbm3/bbm3 plants. When the mutant bbml allele was provided by the male parent, -31% of the bbml/BBMl progeny seeds failed to germinate (Extended Data Table lc), whereas all progeny germinated if the bbml allele was inherited from the female parent (Extended Data Table ld). Thus, seed viability depends upon a functional BBM1 allele from the male parent, consistent with male-specific expression of BBM1 in zygotes. Next, we investigated the embryo phenotypes of bbm2 bbm3 progeny seeds segregating for the bbml mutation. The bbml bbm2 bbm3 embryos were either arrested early or underwent growth by cell division without any corresponding developmental patterning (FIG. l6a). In contrast, embryos that were heterozygous BBMl/bbml bbm2/bbm2 bbm3/bbm3 showed a range of phenotypes, from normal to delayed development (FIG. l6b), as well as the early arrest or unstructured growth phenotypes observed in the triple mutant (FIG. l6b; FIG. 2lg). This range of phenotypes might occur by partial rescue from late expression of the female BBM1 allele. Additionally, BBM4 (Os04g42570), a fourth BBM- like gene that also shows detectable expression in male gametes (Table 5 a), might provide sufficient residual function for partial rescue. The recovery of bbml bbm2 bbm3 triple homozygous plants at -0.7% is consistent with the hypothesis of residual BBM function provided by BBM4 (Table 5b).
[0142] Taken together, these data suggest that male-genome derived expression of BBM1, acting redundantly with other BBM genes, triggers the embryonic program in the fertilized egg cell. Subsequent activation of expression from the female BBM1 allele by the male BBM1 results in bi-allelic expression, with both parental alleles eventually contributing to embryo patterning and organ morphogenesis (FIG. l6c). BBM- like genes have been shown to promote regeneration from tissue culture, implying that they act as pluripotency factors (Lowe, K. et al., The Plant Cell, doi: 10. H05/tpc.16.00124 (2016)). Our study supports a model in which the requirement of fertilization to initiate embryogenesis in rice arises from the dependency of the zygote on the male gamete, for the expression of pluripotency factors after fertilization. This is in contrast to embryogenesis in vertebrate animals, where pluripotency factors are maternally provided (Lee, M. T. et al., Annual review of cell and developmental biology 30, 581-613, doi: l0. H46/annurev-cellbio-l009l3-0l3027 (2014)). As demonstrated below, the fertilization requirement can therefore be bypassed by driving expression of one such factor from the female gamete.
[0143] Haploid plants are efficient tools to accelerate plant breeding, as homozygous isogenic lines can be produced in one generation after chromosome doubling (Murovec, J. & Bohanec, B., Haploids and Doubled Haploids in Plant Breeding (2012)). Egg cell expression of BBM1 initiated parthenogenesis in emasculated flowers (FIG. l5b), but the seeds aborted without endosperm (FIG. 20d). Self-pollinated Tl progeny from BBMI-ee transgenic plants were analyzed to determine whether endosperm development by fertilization could produce viable seeds containing parthenogenetically derived haploid embryos. We identified haploids by small size vs. diploid siblings, as well as sterile flowers due to defective meiosis
(Cifuentes, M. et al., PloS one 8, e7243l, doi: l0. l37l/joumal.pone.007243l (2013)) (FIG. l6d, e; FIG. 22a to d). The ploidy of haploid Tl plants was confirmed by flow cytometry (FIG. 16f). The haploid induction frequency was 5-10% (Tl plants), reaching -29% in homozygous T2 line #8C, that was maintained through multiple generations (Table 6a). Thus, mis-expression of the wild-type BBM1 gene in the egg cell is sufficient for production of haploid plants.
[0144] Crop yields can be improved markedly by the use of Fl hybrid plants that exhibit enhanced vigor (“hybrid vigor”). If meiosis and fertilization are bypassed, hybrids could be propagated through seeds without segregation. Asexual propagation through seeds, known as apomixis, is known to occur naturally in >400 species but not in the major crop plants (Hand, M. L. & Koltunow, A. M. et al., Genetics 197, 441-450, doi: 10.1534/genetics.114.163105 (2014); Ozias-Akins, P. & van Dijk, P. J., Annual Review of Genetics 41, 509-537, doi: 10.1 l46/annurev.genet.40.110405.090511 (2007)). Developing a method to introduce apomixis into crop plants has been described as“the holy grail of agriculture” (Sailer, C. et al., Current biology : CB 26, 331-337, doi: 10.1016/j . cub.2015.12.045 (2016)) as it can enable fixation of hybrid vigor and stabilization of superior heterozygous genotypes in breeding programs (Calzada, J.-P. V. et al., Science 274, 1322-1323,
doi: 10.1 l26/science.274.5291.1322 (1996); Khush, G. S. Apomixis: exploiting hybrid vigor in rice. (International Rice Research Institute, 1994)).
[0145] A genetic approach called MiMe, that eliminates recombination and substitutes mitosis for meiosis (FIG. l7c, d), has been reported in Arabidopsis (d'Erfurth, I. et al, PLoS biology 7, el000l24, doi: l0T37l/joumal.pbio. l000l24 (2009)) and rice (Mieulet, D. et al, Cell research 26, 1242-1254, doi: l0. l038/cr.20l6. H7 (2016)). In MiMe, a triple knockout of meiotic genes REC8, PAIR1 and OSDI. produces unrecombined diploid male and female gametes. We tested the possibility that BBM1-QQ induced parthenogenesis in rice combined with MiMe could result in asexual propagation through seeds (FIG. 22f). The three rice MiMe genes (Mieulet, D. et al, Cell research 26, 1242-1254, doi: l0. l038/cr.20l6. H7 (2016)) were genome edited by were genome edited by CRISPR-Cas9, in haploid and diploid plants carrying the BBM1-QQ transgene (FIG. 23a). Unlike BBMl-ee haploids, the MiMe + BBM1-QQ haploids were fertile (FIG. 23c, d) with normal anther development (FIG. l7a), suggesting that meiosis was successfully replaced by mitosis. Self-pollination of MiMe plants invariably results in doubling of the chromosome number (Cifuentes, M. el al., PloS one 8, e7243l, doi: l0. l37l/joumal.pone.007243l (2013)), so the progeny of haploid MiMe plants should be diploid (double haploid). However, we obtained haploid progeny from two MiMe + BBM1-QQ (henceforth referred to as S-Apo, for Synthetic-Apomictic ) haploid mother plants at frequencies of 26% and 15%, due to parthenogenesis (FIG. l7e, upper panel, Table 6b).
These haploid induction frequencies were maintained for the next two generations (Table 6b). These results show that haploid S-Apo plants can be propagated asexually through seeds. Additionally, the sexual Tl double-haploid (2n) progeny from the haploid S-Apo plants yielded both diploid and tetraploid plants in the T2, T3 and T4 generations; the former class is expected from successful asexual propagation of double-haploids (Table 6b).
[0146] For clonal propagation of diploid S-Apo plants, we obtained two fertile
transformants with the requisite six null mutations in three MiMe genes (FIG. 24a, b). Diploid MiMe rice plants have been previously shown, even with reduced seed sets, to produce exclusively tetraploid progeny by sexual reproduction and no diploids (Mieulet, D. et al, Cell research 26, 1242-1254, doi: l0.l038/cr.20l6.H7 (2016)) (FIG. 23c). However, we obtained diploid progeny at 11% and 29% frequency (Table 6b) from two MiMe + BBM1-QQ (i.e., diploid S-Apo) transformants (FIG. l7b-e, FIG. 23e). The diploid progeny are expected only from parthenogenesis of the diploid egg cell. The rest of the progeny were tetraploid (FIG. l7e). Progeny from a control MiMe diploid plant were all determined to be tetraploid (FIG. 23b, c,). Since Tl diploid progeny from diploid S-Apo parents arise from parthenogenesis of unreduced female gametes, they are predicted to be clonal with the parent, with no genetic segregation. The Tl diploids were propagated, and two more generations (T2 and T3) of diploid clones were identified by flow cytometry screening. [0147] To demonstrate clonal propagation, we performed whole genome sequencing on a diploid TO S-Apo mother plant (line#l), two diploid Tl progeny, two T2 diploid progeny of diploid Tl plants, and a control untransformed wild-type plant. Analysis for sequence variants identified 57 heterozygous SNPs in unique sequences distributed over the genome in the TO mother plant (FIG. l7f, Table 7), that are non-variant in the wild-type plant (see Methods). These 57 SNPs were determined to be heterozygous in all four Tl and T2 diploid progeny sequenced. The probability of any single progeny retaining heterozygosity by random segregation for just 22 unlinked SNPs on different chromosome arms is P ~ 2.4e-7. The maintenance of heterozygosity at all 57 loci for two generations confirms that the diploid progeny are clonally generated by asexual reproduction. The TO mother (line #1) is also biallelic for mutations in the PAIR1 and REC8 genes, as were all Tl, T2 and two T3 diploid progeny tested (FIG. 24a). For SNP validation, eleven randomly selected SNPs were amplified by PCR followed by Sanger (Sanger, F., Nicklen, S. & Coulson, A. R.,
Proceedings of the National Academy of Sciences of the United States of America 74, 5463- 5467 (1977)) sequencing and found to be conserved in TO mother plant and all the Tl, T2 and T3 progeny tested (FIG. 25). The second diploid S-Apo transformant (line #5) is biallelic for all three MiMe genes (FIG. 24b) and also heterozygous for one of the 11 SNPs confirmed by PCR for line#l. Five Tl diploid progeny carried the identical set of alleles as the TO mother (FIG. 24b). The probability that all 5 progeny would inherit heterozygosity at these 4 loci by random segregation is P~l.8e-5. These findings from an independently generated apomictic parent provide further support for successful clonal propagation.
[0148] This study demonstrates that asexual propagation without genetic segregation can be engineered in a sexually reproducing plant and illustrates the feasibility of clonal propagation of hybrids through seeds in rice. Seed formation in this system still requires fertilization to make endosperm (FIG. 22f). This endosperm is expected to be hexaploid due to fertilization of a tetraploid central cell by a diploid sperm cell, whereas the parthenogenetic embryo is diploid, giving a 3: 1 ploidy ratio. This deviation from the normal 3:2 ploidy ratio of endosperm to embryo does not appear to be consequential for viability or seed size (FIG. 23f, g). Importantly, the clonally propagated seeds preserve the 2: 1 maternal to paternal genome ratio in endosperm required for seed viability (Lafon-Placette, C. & Kohler, C., Molecular ecology 25, 2620-2629, doi: l 0.11 l l/mec. l 3552 (2016); Sekine, D. et al, The Plant Journal 76, 792-799, doi: 10.111 l/tpj.12333 (2013)). Engineering a completely asexual system involving autonomous endosperm formation may not be straightforward in a sexually reproducing crop, nor is it essential as many natural apomicts also form seeds with fertilized endosperm (Hand, M. L. & Koltunow, A. M. et al, Genetics 197, 441-450,
doi: 10.1534/genetics.114.163105 (2014)). The efficiency of clonal propagation in our system is in part limited by the frequency of parthenogenesis, which could potentially be improved in the future, e.g., with different promoters. An important factor to be considered for future rice breeding strategies is that genome wide heterozygosity may be less critical for yield than the incorporation of specific alleles that exhibit full or partial dominance (Hua, J. et al,
Proceedings of the National Academy of Sciences of the United States of America 100, 2574- 2579, doi: 10. l073/pnas.0437907100 (2003); Huang, X. et al, Nature 537, 629-633, doi: l0. l038/naturel9760 (2016)). Nevertheless, hybrids can provide a rapid route to higher yields from favorable gene combinations, and have been extensively exploited in maize.
Since homologous BBM- like and MiMe genes are found in other cereal crops including maize (Horstman, A. et al, Trends in plant science 19, 146-157, doi: 10. l0l6/j.tplants.2013.10.010 (2014); Lowe, K. et al, The Plant Cell, doi: 10. H05/tpc.16.00124 (2016)), the methods described here for asexual propagation through synthetic apomixis should be generally extendible to most cereal crops.
Methods
[0149] Plant materials and growth conditions: Rice cultivar Kitaake ( Oryza sativa L. subsp. japonicd) was used for transformations for raising transgenic lines and as a wild-type control. Wild-type, mutant and transgenic seeds were germinated on half strength Murashige and Skoog’s medium (Murashige, T. & Skoog, F., Physiologia Plantarum 15, 473-497, doi: l0. l l l l/j. l399-3054. l962.tb08052.x (1962)) containing 1% sucrose and 0.3% phytagel in a growth chamber for 12 days under 16 h light: 8 h dark cycle at 28 °C and 80% relative humidity. Seedlings were then transferred to a greenhouse and grown under natural light conditions at Davis, California.
[0150] Chemical treatments: Two-week-old wild-type and BBM1-GR seedlings were treated with 0.1% ethanol as mock, 10 mM dexamethasone (DEX) (Sigma), 10 pM cycloheximide (CYC) (Sigma) alone, or in combination with 10 pM DEX in liquid half strength MS (Murashige, T. & Skoog, F ., Physiologia Plantarum 15, 473-497,
doi: l0. l l l l/j. l399-3054. l962.tb08052.x (1962)) salts. Seedlings which had similar size and same number of leaves were selected for the treatments. Individual biological replicates were constructed using similar leaf samples collected from four different plants, harvested for RNA isolation after 24 h. CYC treatments were started 30 minutes before the DEX treatment in the samples that were treated with both reagents.
[0151] Plasmid constructs: Full length coding sequence (CDS) of BBM1 was amplified from cDNAs made from rice calli using two sets of primers (KitBlFl 5’- CGGATCC ATGGCCTCCATC ACC-3’, KitBlRl 5’-CCTTCGACCCCATCCCAT-3’ and KitBlF2 5’ -GGATGGGATGGGGTCGAAG-3’ , KitBlR2 3’-
GGTACC AGACTGAGAAC AGAGGC-3’). The two fragments were fused together by an overlap PCR. Overexpression construct ( BBMl-ox ) was created by cloning BBM1 CDS in pUN vector (Khanday, I., Yadav, S. R. & Vijayraghavan, U., Plant physiology 161, 1970- 1983, doi: 10. H04/pp.112.212423 (2013)) (FIG. l8a). For creating BBM1-GR plasmid (Extended Data FIG. l8e), BBM1 CDS without stop codon was cloned in pUGN vector (Khanday, I., Yadav, S. R. & Vijayraghavan, U., Plant physiology 161, 1970-1983, doi: l0. H04/pp.112.212423 (2013)) for translational fusion with rat glucocorticoid receptor (Aoyama, T. & Chua, N. H., The Plant journal : for cell and molecular biology 11, 605-612 (1997)). The whole BBM1 locus, roughly 3kb upstream sequences and transcribed region till stop codon were PCR amplified in two fragments from genomic DNA using 2 primer pairs pBlFl 5 -CTCGAGGTCAACACCAACGCCATC -3’, pBlRl 5’- GAAGTCCTCCAGCTTCGGCGC -3’ and, pBlF2 5’- TT GATT GT GTT GAT GT GC AGAGT GGGG -3’ and pBlR2 5’- CTCGAGCGGTGTCGGCAAAACC -3’. The two fragments were joined at a unique restriction enzyme site, Noll, present downstream of start codon in the sequence. The whole locus was moved to a pCAMBIAl300 vector already harboring Arabidopsis histone H2B, eGFP and nopaline synthase (NOS) gene terminator (FIG. l9b). Construct for egg cell specific expression of BBM1 was made by cloning BBM1 downstream to Arabidopsis DD45 promoter (Steffen, J. G. et al., The Plant Journal 51, 281-292, doi: 10.111 l/j.1365- 313X.2007.03137. x (2007)) and upstream of the NOS terminator (FIG. 20b) in
pCAMBIAl300.
[0152] For genome editing BBM I . BBM2 and BBM3 genes, single guide RNA (gRNA) sequences 5’-GGAGGACTTCCTCGGCATGC -3’, 5’- GTATGCAATATACTCCTGCC -3’ and 5’- GACGGCGGGAGCTGATCCTG -3’ respectively were designed by using the web tool https://www.genome.arizona.edu/crispr/ as described (Xie, K., Zhang, J. & Yang, Y., Molecular plant 7, 923-926, doi: l0. l093/mp/ssu009 (2014)). The gRNAs were cloned in pENTR-sgRNA entry vector. The binary vectors for plant transformations (pCRISPR BBM1+BBM3, pCRISPR BBM2+BBM3 and pCRISPR BBM1+ BBM2+BBM3) were constructed by Gateway LR clonase (Life Technologies) recombination with pUbi-Cas9 destination vector as described (Zhou, H. et al., Nucleic acids research 42, 10903-10914, doi: l0.l093/nar/gku806 (2014)). Three candidate genes (OSl) I . Os02g37850; PAIR/.
0s03g0l590 and RI/CH. 0s05g504l0) for creating MiMe mutations in rice were selected as per (Mieulet, D. et al, Cell research 26, 1242-1254, doi: l0. l038/cr.20l6. H7 (2016)) and gRNAs sequences 5 -GCGCTCGCCGACCCCTCGGG -3’, 5’- GGTGAGGAGGTTGTCGTCGA -3’ and 5’- GTGTGGCGATCGTGTACGAG -3’ respectively for CRISPR-Cas9 based knockout were designed as described (Xie, K., Zhang,
J. & Yang, Y Molecular plant 7, 923-926, doi: l0. l093/mp/ssu009 (2014)). Vector pCAMBIA23()() MiMe CRISPR-Cas9 (FIG. 23a) for plant transformations was constructed as described (Zhou, H. et al, Nucleic acids research 42, 10903-10914, doi:l0T093/nar/gku806 (2014)) except the resistance marker in the destination vector pUbi-Cas9 was changed to Kanamycin (Neomycin Phosphotransferase II). pCAMBIA2300 MiMe CRISPR-Cas9 was transformed in embryogenic calli derived from pDD45: :BBMl#8c haploid inducer lines (FIG. 20b). Rice transformations were carried out as describe previously (Hiei, Y. & Komari, T., Nature protocols 3, 824-834, doi: l0. l038/nprot.2008.46 (2008)) at UC Davis plant transformation facility. TO plants were grown in green house and screened for MiMe mutations. Tl plants obtained from seeds were subjected to ploidy determination and genotyping for MiMe mutations.
[0153] Generating bbmlbbm2 bbm3 mutants: Rice embryogenic calli were transformed with pCRISPR BBM1+BBM3, or pCRISPR BBM2+BBM3. The transformants that carried the bbml bbm3 and bbm.2 bbm3 double mutations generated by genome editing (FIG. 2 la, b) did not show any phenotypic abnormality and were fertile. The two double mutants were crossed and selfed; however, no bbml bbm2 bbm3 triple homozygous plants were recovered in the F2 generation (FIG. 21 c). However, plants heterozygous for BBM I (bbml/BBMl) but homozygous mutant for both bbm2 and bbm3 could be recovered, and their progeny were analyzed in detail (FIG. 21 d).
[0154] Genotyping: Genotyping of BBM1, BBM2 and BBM3 mutants was carried out by PCR amplifying DNA at the mutation site with primers BBM1 SeqF 5’- TTGATTGTGTTGATGTGC -3’ BBM I SeqR 5’- GAGAGACGACCTACTTGGTGAC -3’; BBM2 SeqF 5’-TAGCTAGCTTGTTAATAGATCATAG -3’, BBM2 SeqR 5’- TCATATCTCAGTGTGATAGTCTG -3’ ; BBM3 SeqF 5’- AT GCT GCT GCTCC GAGAAG -3’ and BBM3 SeqR 5’- GCTTAGTGCTCCAAACCTCTC -3’. Sanger sequencing (Sanger, F., Nicklen, S. & Coulson, A. R., Proceedings of the National Academy of Sciences of the United States of America 74, 5463-5467 (1977)) of the three PCR amplicons of 464 bp, 262 bp and 547 bp respectively for the three genes was carried out at UC Davis DNA sequencing facility. Since 1 bp deletion mutation in BBM1 disrupted an Sphl restriction enzyme site (FIG. 21 d), all the further genotyping of BBM1 for mutational analysis were done with restriction digestion of the PCR amplicon with Sphl (FIG. 21 e). For genotyping developing seeds of 5 DAP onwards, endosperm was used for genotyping and embryos were collected for mutant phenotype analysis. DNA fragments at the mutation sites of three MiMe genes were PCR amplified with primers OSD I F 5'- TTACTTGGAAGAGGCAGGAGCC -3',
OSD1 R 5'- ACCTTGACGACTGACGTGATGTC -3'; PAIR I F 5'- GT GGT GT GGT GT GTT C AGGAG -3', PAIR I R 5'- TGGAATCCCCAATCAGTAAGGCAC -3'; REC8 F 5'- GC ACT AAGGCT CTCC GGAATT CTC -3' and REC8 R 5'-
AATGGATCAAGGAGGAGGCACC -3'. PCR amplicons of 364 bp, 344 bp and 326 bp for OSD1, PAIR1 and REC8 respectively, were subjected to Sanger sequencing (Sanger, F., Nicklen, S. & Coulson, A. R., Proceedings of the National Academy of Sciences of the United States of America 74, 5463-5467 (1977)) for mutation analysis.
[0155] Emasculation, crosses and pollinations: Flowers from BBM1-QQ TO transgenic rice lines were emasculated around the anthesis stage, bagged and let to grow for another 9 days after emasculation (DAE). Carpels were harvested and fixed for analysis in FAA
[formaldehyde (10%) - acetic acid (5%) - ethanol (50%)]. A translational fusion consisting of the BBM1 genomic locus to GFP (BBM1-GFP; FIG. l9b) was introduced into the inbred japonica (Kitaake) cultivar by transformation. Plants hemizygous for the BBM1-GFP transgene were then reciprocally crossed to wild-type plants. Flowers from wild-type or BBM1-GFP transgenic plants were hand pollinated around the anthesis stage and carpels were harvested after 2.5 and 6.5 hours after pollination (HAP).
[0156] For phenotypic analysis of mutant embryos, self-pollinated flowers from mutant plants were scored for anthesis, and harvested 5 or 10 days after pollination (DAP). For crosses of bbml bbm3 and bbm2 bbm3 plants, only T2 progeny plants in which the CRISPR- Cas9 transgene had already segregated out were used as parents. For all crosses of bbml bbm3 with bbm2 bbm3 plants, and for the reciprocal crosses between BBMl!bbml bbm2/bbm2 bbm3/bbm3 and BBM1IBBM1 bbm2/bbm2 bbm3/bbm3 plants, panicles used as females were emasculated and bagged with pollen donor panicles. The bags were gently finger tapped (twice a day) for next two days. Male panicles were removed, and female panicles were left bagged to make seeds. Fl seeds were harvested 4 weeks after pollination.
[0157] Immunohistochemistry and toluidine blue staining: Due to the difficulty of imaging GFP fluorescence in early rice zygotes through the carpel tissue, we used antibodies against GFP to detect zygote expression in sectioned rice carpels. Harvested carpels were fixed in FAA [formaldehyde (10%) - acetic acid (5%) - ethanol (50%)]. Tissue embedding and sectioning was done as described previously (Javelle, M., Marco, C. F. & Timmermans, M., Journal of visualized experiments : JoVE, e3328, doi: 10.3791/3328 (2011)).
Immunohistochemistry was carried out using standard protocols (Sessions, A., CSH protocols 2008, pdb.prot4946, doi: l0.H0l/pdb.prot4946 (2008)) except an antigen retrieval step was also included. Antigen retrieval was done by microwaving the slides in 10 mm sodium citrate buffer (pH 6.0) for 10 mins. Rabbit anti-GFP antibody ab6556 (Abeam) was used as primary antibody and goat anti-rabbit alkaline phosphatase conjugate A9919 (Sigma) was used as secondary antibody. For toluidine blue staining, after rehydration, sections crosslinked to glass slides were stained with 0.01% toluidine blue for 30 seconds.
[0158] Flow cytometry: Nuclei for Fluorescence-Activated Cell Sorting (FACS) analysis were isolated by a leaf chopping method described previously (Galbraith, D. W. et al,
Science 220, 1049-1051, doi: l0. H26/science.220.460l. l049 (1983)). The isolated nuclei were stained with propidium iodide at 40 pg/ml concentration in Galbraith’s buffer. FACS analysis and DNA content estimation was done with Becton Dickinson FACScan system using standard protocols (Dolezel, I, Greilhuber, J. & Suda, I, Nature protocols 2, 2233- 2244, doi: l0. l038/nprot.2007.3l0 (2007); Cousin, A. et al, Cytometry. Part A : the journal of the International Society for Analytical Cytology 75, 1015-1019, doi: l0. l002/cyto.a.208l6 (2009)). DNA histograms were gated out for the initial debris.
[0159] Alexander staining of pollen grains: Stamens were harvested just before anthesis. Anthers were put on a glass slide in a drop of Alexander’s stain containing 40 pl of glacial acetic acid per milliliter of stain (Alexander, M. P., Stain technology 44, 117-122 (1969)). Anthers were covered with a cover slip and slides were heated at 55 °C on a heating block, untill the visible staining of pollen was observed.
[0160] Library preparation and sequencing: PCR-free DNA libraries were prepared from a wild-type Kitaake control plant, the TO S-Apo line#l mother plant, two Tl and two T2 progeny clones from S-Apo line# 1 with 500 ng of input DNA, using NuGEN Celero™ DNA- Seq kit, following manufacturer instructions. Samples were multiplexed and 6 libraries per lane were run on Illumina HiSeq platforms at UC Davis, Genome Center.
[0161] Whole genome DNA-seq and statistical analysis: Adaptor removal and quality trimming of 150 bp paired end reads was done using Trimmomatic 0.38 (Bolger, A. M., Lohse, M. & Usadel, B., Bioinformatics (Oxford, England) 30, 2114-2120,
doi: l0.l093/bioinformatics/btul70 (2014)) resulting in 13-16 Gbases of sequence for each library. The reads were aligned to the Oryza sativa reference genome (Nipponbare, Release 7.0) (Kawahara, Y. et al., Rice (New York, NY.) 6, 4, doi: 10.1186/1939-8433-6-4 (2013)) using bwa mem (Li, H. & Durbin, R., Bioinformatics (Oxford, England) 25, 1754-1760, doi: l0.l093/bioinformatics/btp324 (2009)). To discover variants that were heterozygous in TO mother plant (line#l), the variant finder GATK4.0 HaplotypeCaller was used in single sample mode (Van der Auwera, G. A. et al, Current protocols in bioinformatics 43, 11 10 11-33, doi: 10.1002/0471250953. bil 1 l0s43 (2013)) and selecting only for SNPs. Repeated elements of the genome were masked from analysis using annotated repeats from
www.phytozome.org (Osativa_323_v7.0.repeatmasked_assembly_v7.0.gff3). Variants were retained for analysis after filtering on the basis of mapping quality (MQ=60), QualByDepth (QD>2), StrandOddsRatio (SOR<l.8), unfiltered read depth (l0<DP<40) and fraction of the alternate allele (0.4<DP<0.6), with the expectation that a truly heterozygous locus should show roughly equal numbers of reads counts for each allele. In order to increase certainty that the set of loci included only true heterozygous SNPs, loci which were called heterozygous in the WT sample were also discarded. This strategy guards against instances where incorrect read mapping over multicopy regions lead to spurious designation of loci as heterozygous, even though it is likely that we also discarded true heterozygous loci in the process. A final list of 60 high quality heterozygous SNPs at 57 loci were analyzed for segregation in the four progeny clones (Tl Clone# A, Tl Clone#B, T2 Clone#7 and T2 Clone#2l). All SNPs were called heterozygous by HaplotypeCaller in all the progeny samples (Supplementary Table 1).
[0162] For statistical analysis of genetic ratios: Either a Chi-square goodness-of-fit test, or a two tailed Fisher's exact test, was carried out wherever applicable, and the result specified in the legend of the relevant figure or table.
[0163] RT-PCR and RT-qPCR: All the cDNAs were synthesized using the iScript cDNA synthesis kit (BioRad) as per manufacturer instructions. RT-PCRs were performed with MyTaq® Red Mix (Bioline) and RT-qPCRs with iTaq™ universal SYBR® Green supermix (BioRad) using CFX96 Touch™ real-time PCR system (BioRad). UBIQUITIN5
(Os03gl3l70) was used as internal control and fold changes in the relative abundance of transcripts were calculated as described previously (Livak, K. J. & Schmittgen, T. D., Methods (San Diego, Calif.) 25, 402-408, doi: l0. l006/meth.200l.l262 (2001)). RT-qPCR amplifications for each gene were performed in two biological replicates and each biological replicate was repeated in three technical replicates for each sample. For BBM1, BBM1 RT F 5’- TACTACCTTTCCGAGGGTTCG-3’ was used in combination with BlRNAi R 5’- GATATC CCAGACTGAGAACAGAGGC -3’ to detect endogenous transcript and with GR RT R 5’- TCTTGTGAGACTCCTGCAGTG-3’ to detect BBM1-GR transgenic transcript in RT-qPCRS. ASMiintronF 5’ -GTGGCAGGAAACAAGGATCTG-3’ with BlRNAi R which span an intron were used in RT-PCRs. For other genes tested in this study, following primer combinations were used LEC1A F 5’-GACAGGTGATCGAGCTCGTC-3’, LEC1A R 5’- CTCTTTCGATGAAACGGTGGC-3’; LEC1B F 5’-ACAGC AGCAGAATGGCGATC-3’ , LEC1B R 5’-CTCATCGATCACTACCTGAACG-3’; GE Y 5’- C AGGAGC AC AAGGCGAAGCG-3’ , GA R 5’- CTTCGCCTGGATCTCCGGGTG-3’ ; OSH I F 5’-GAGATTGATGCACATGGTGTG-3’, OSH I R-2n 5’- CGAGGGGTAAGGCC ATTTGTA-3’ ; UBIQ UITIN5 F 5’ -
ACCACTTCGACCGCC ACT-3’ and UBIQUITIN5 R 5’-ACGCCTAAGCCTGCTGGTT-3’.
[0164] SNP analysis: Detection of SNPs in BBM1 transcripts from hybrid zygotes was performed by PCR of 2.5 HAP zygote cDNAs from reciprocally crossed rice japonica cultivar Kitaake and indica cultivar IR50 as described previously (Anderson, S. N. et al, Developmental Cell 43, 349-358 e344, doi: l0. l0l6/j.devcel.2017.10.005 (2017)). Primers BlRNAi F 5’- CCTCGAGCAACTATGGTTCGCAGC -3’ and BlRNAi R which amplified a gene specific fragment of - 600 bp of BBM1 contains 5 SNPs between Kitaake and IR50 (FIG. l9a). The PCR amplicons were Sanger sequenced (Sanger, F., Nicklen, S. & Coulson, A. R., Proceedings of the National Academy of Sciences of the United States of America 74, 5463-5467 (1977)) and chromatograms were analyzed for SNPs. For detection of heterozygous SNPs present in the S-Apo mother plants and their progeny, 50 ng of input DNA was used for each PCR reaction. Sanger (Sanger, F., Nicklen, S. & Coulson, A. R., Proceedings of the National Academy of Sciences of the United States of America 74, 5463- 5467 (1977)) sequenced PCR chromatograms were analyzed for presence of SNPs. The primers for 11 SNPs analyzed are 1 Chr2 F 5’ - TGG GTG CCA CGT TAT CTA GG-3’ , 1 Chr2 R 5’- GGA TTT GGC TAC CCT CAA GCT-3’; 2 Chr2 F 5’-GAA TGG GCA ACT AAC AAC CGT G-3’, 2 Chr2 R 5 -ACCGTG GAAAGGAAC AGCTG-3’ ; 1 Chr3 F 5’-TGC TGA AGG TGA CGT TGA TCT G-3’, 1 Chr3 R 5 -CGA CGC CAA CGA GAA GGA-3’; 2 Chr3 F 5’-GCT CCA GTG CTA GAG AGA CAT C-3\ 2 Chr3 R 5’- AGCCACCCAGTAACCGTTG-3’; Chr4 F 5’-GAT TGG CAA ACC AGC TAC TGC-3’, Chr4 R 5’ -CTGATGGCAAGCTGTTGGC-3’ ; Chr5 F 5’-ATG ATC TGC TGC TTGTTT CAATGC-3’, Chr5 R 5’-TATCCTTCAAGCACCACTGCC-3’; Chr6 F 5’-ACT AAT GGG ACC ACT TGA CAG C-3’, Chr6 R 5’-TCAGCCTGAGATGGCTTGG-3’ ; Chr8 F 5 -CAG ACT GTG GGA CGC TAC ATG-3’, Chr8 R 5’ -AGAAGATCTGGGCAGCAGTC-3’ ; Chr9 F 5’ -GCT GCA CCT GTT AGC TAT GTG A-3’ , Chr9 R 5’ -
AGCATCCCAAAAGCACACATG-3’; ChrlO F 5’-TCA GCA GCC TAA GGT TGA AGG- 3’, ChrlO R 5’ -CTGCTGCTGCTTC ATGATCAC-3’ and Chrl l F 5 -GCA GGA ACT ATT GCC TCT CAT GA-3’, Chrl l R 5 -TCAGTCTCATAGCGCACCAC-3’.
[0165] Code availability: Codes for the different analyses are available from the corresponding author upon request for noncommercial use.
[0166] Data availability Whole genome DNA sequencing data for S-Apo line#l mother plant, the four progeny clones from two generations, and the Kitaake wild type control are available from National Center for Biotechnology Information (NCBI) BioProject #
PRJNA496208. RNA-seq data from previously published datasets (Anderson, S. N. et al. Developmental Cell 43, 349-358 e344, (2017); Anderson, S. N. et al. The Plant journal 76, 729-741), are available from the NCBI Short Read Archive as Project # SRP119200 and NCBI Gene Expression Omnibus accession number GSE50777.
[0167] It is understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and purview of this application and scope of the appended claims. All publications, patents, and patent applications cited herein are hereby incorporated by reference in their entirety for all purposes. TABLE 1
Figure imgf000074_0001
TABLE 2
Figure imgf000074_0002
*The Chi-square goodness of fit test value between expected and observed values is 68.623 and the P-value is < 0.001.
TABLE 3A
Figure imgf000074_0003
*The two-tailed Fisher's exact test P- value is 0.001.
TABLE 3B
Figure imgf000074_0004
Figure imgf000075_0001
Figure imgf000076_0001
Figure imgf000077_0001
Figure imgf000078_0001
Figure imgf000079_0001
Figure imgf000080_0001
Figure imgf000081_0001
Figure imgf000082_0001
Figure imgf000083_0001
Figure imgf000084_0001
Figure imgf000085_0001
Figure imgf000086_0001
Figure imgf000087_0001
Figure imgf000088_0001
Figure imgf000089_0001
Figure imgf000090_0001
Figure imgf000091_0001
Figure imgf000092_0001
Figure imgf000093_0001
Figure imgf000094_0001
Figure imgf000095_0001
Figure imgf000096_0001
Figure imgf000097_0001
Figure imgf000098_0001
Figure imgf000099_0001
Figure imgf000100_0001
Figure imgf000101_0001
Figure imgf000102_0001
Figure imgf000103_0001
Figure imgf000104_0001
Figure imgf000105_0001
Figure imgf000106_0001
Figure imgf000107_0001
Figure imgf000108_0001
Figure imgf000109_0001
Figure imgf000110_0001
Figure imgf000111_0001
Figure imgf000112_0001
Figure imgf000113_0001
Figure imgf000114_0001
Figure imgf000115_0001
Figure imgf000116_0001
Figure imgf000117_0001
Figure imgf000118_0001
Figure imgf000119_0001
Figure imgf000120_0001
Figure imgf000121_0001
Figure imgf000122_0001
Figure imgf000123_0001

Claims

WHAT IS CLAIMED IS:
1. A plant that produces clonal progeny, wherein the plant comprises inhibited or mutated gene products that induce a mitosis instead of meiosis (MiME) phenotype and further expresses a BABYBOOM polypeptide in egg cells.
2. The plant of claim 1, wherein the plant is a cereal monocot plant.
3. The plant of claim 1, wherein the plant is a rice plant.
4. The plant of any of claims 1-3, wherein the inhibited or mutated gene products comprise (i) OSD1 or an ortholog thereof, (ii) ATREC8 or an ortholog thereof, and (iii) ATSPOl 1 or an ortholog thereof.
5. The plant of any of claims 1-3, wherein the inhibited or mutated gene products comprise (i) OSD1 or an ortholog thereof, (ii) REC8 or an ortholog thereof, and (iii) PAIR1 or an ortholog thereof.
6. The plant of any of claims 1-5, wherein at least one or all of the gene products is inhibited.
7. The plant of any of claims 1-5, wherein at least one or all of the gene products is mutated to be inactive.
8. The plant of any of claims 1-7, wherein the plant is haploid or diploid.
9. The plant of any of claims 1-8, wherein the BABYBOOM polypeptide is at least 70% (e.g., 75, 80, 85, 90, 95, 98, or 99%) identical to any of SEQ ID Nos: 1-3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, or 41.
10. A method of making clonal progeny, the method comprising, allowing the plant of any of claims 1-8 to self-fertilize; and
collecting clonal progeny from the plant.
PCT/US2018/062663 2017-11-27 2018-11-27 Synthetic apomixis in a crop plant WO2019104346A1 (en)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
PCT/US2017/063249 WO2018098420A1 (en) 2016-11-28 2017-11-27 Induction of haploid plants using baby boom1 gene
USPCT/US2017/063249 2017-11-27
US201862678169P 2018-05-30 2018-05-30
US62/678,169 2018-05-30

Publications (1)

Publication Number Publication Date
WO2019104346A1 true WO2019104346A1 (en) 2019-05-31

Family

ID=66630814

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2018/062663 WO2019104346A1 (en) 2017-11-27 2018-11-27 Synthetic apomixis in a crop plant

Country Status (1)

Country Link
WO (1) WO2019104346A1 (en)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110423768A (en) * 2019-07-02 2019-11-08 湖南杂交水稻研究中心 Pass through the method for the fixed rice heterosis of adventitious embryo mode
CN114507671A (en) * 2020-11-16 2022-05-17 湖南杂交水稻研究中心 Nucleic acid molecule, vector and cell, application thereof and efficient screening of plant apomixis clone seeds through asexual embryos and embryo-free seeds
US20220290171A1 (en) * 2021-03-12 2022-09-15 University Of North Texas Methods for increasing tissue storage lipids by disrupting plant lipid regulatory suppressor gene
WO2023205668A3 (en) * 2022-04-19 2023-12-07 Pioneer Hi-Bred International, Inc. Parthenogenesis methods and compositions

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20110119795A1 (en) * 2006-05-17 2011-05-19 Pioneer Hi Bred International Inc Artificial plant minichromosomes
US20160194659A1 (en) * 2011-04-15 2016-07-07 Pioneer Hi-Bred International Inc. Self-Reproducing Hybrid Plants
US20160304901A1 (en) * 2013-10-21 2016-10-20 University Of Georgia Research Foundation, Inc. Gene for induction of parthenogenesis, a component of apomictic reproduction
WO2018015957A1 (en) * 2016-07-21 2018-01-25 Kaiima Bio Agritech Ltd. Compositions and methods for generating a haploid of a target plant

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20110119795A1 (en) * 2006-05-17 2011-05-19 Pioneer Hi Bred International Inc Artificial plant minichromosomes
US20160194659A1 (en) * 2011-04-15 2016-07-07 Pioneer Hi-Bred International Inc. Self-Reproducing Hybrid Plants
US20160304901A1 (en) * 2013-10-21 2016-10-20 University Of Georgia Research Foundation, Inc. Gene for induction of parthenogenesis, a component of apomictic reproduction
WO2018015957A1 (en) * 2016-07-21 2018-01-25 Kaiima Bio Agritech Ltd. Compositions and methods for generating a haploid of a target plant

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
D'ERFURTH ET AL.: "Turning Meiosis into Mitosis", PLOS BIOLOGY, vol. 7, no. 6, 9 June 2009 (2009-06-09), pages 1 - 10, XP002575074 *
MIEULET ET AL.: "Turning rice meiosis into mitosis", CELL RESEARCH, vol. 26, no. 11, 21 October 2016 (2016-10-21), pages 1242 - 1254, XP055615404 *

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110423768A (en) * 2019-07-02 2019-11-08 湖南杂交水稻研究中心 Pass through the method for the fixed rice heterosis of adventitious embryo mode
CN110423768B (en) * 2019-07-02 2023-06-13 湖南杂交水稻研究中心 Method for fixing rice heterosis by adventitious embryo mode
CN114507671A (en) * 2020-11-16 2022-05-17 湖南杂交水稻研究中心 Nucleic acid molecule, vector and cell, application thereof and efficient screening of plant apomixis clone seeds through asexual embryos and embryo-free seeds
US20220290171A1 (en) * 2021-03-12 2022-09-15 University Of North Texas Methods for increasing tissue storage lipids by disrupting plant lipid regulatory suppressor gene
WO2023205668A3 (en) * 2022-04-19 2023-12-07 Pioneer Hi-Bred International, Inc. Parthenogenesis methods and compositions

Similar Documents

Publication Publication Date Title
Golden et al. SHORT INTEGUMENTS1/SUSPENSOR1/CARPEL FACTORY, a Dicer homolog, is a maternal effect gene required for embryo development in Arabidopsis
US20220186238A1 (en) Diplospory gene
ES2883229T3 (en) Gene for the induction of parthenogenesis, a component of apomictic reproduction
WO2019104346A1 (en) Synthetic apomixis in a crop plant
JP2012514467A (en) Plants producing 2n gametes or apomyotic gametes
BR112017025961B1 (en) VECTOR COMPRISING ISOLATED DNA AND ANTHER-SPECIFIC EXPRESSION PROMOTER
US20220106607A1 (en) Gene for parthenogenesis
US20220154202A1 (en) Gene Regulating Seed Weight in Improving Seed Yield in Soybean
CN111988988A (en) Method for identifying, selecting and producing bacterial blight resistant rice
Liu et al. Genome-wide analysis of the citrus B3 superfamily and their association with somatic embryogenesis
WO2019129145A1 (en) Flowering time-regulating gene cmp1 and related constructs and applications thereof
WO2015007241A1 (en) Molecular marker
Watts et al. Brassica juncea lines with substituted chimeric GFP-CENH3 give haploid and aneuploid progenies on crossing with other lines
US20230383308A1 (en) Modified promoter of a parthenogenesis gene
US20150024388A1 (en) Expression of SEP-like Genes for Identifying and Controlling Palm Plant Shell Phenotypes
US20220275383A1 (en) Sterile genes and related constructs and applications thereof
US20180105824A1 (en) Modulation of dreb gene expression to increase maize yield and other related traits
CN112204144B (en) Abiotic stress tolerant plants and methods of use
CN110959043A (en) Method for improving agronomic traits of plants by using BCS1L gene and guide RNA/CAS endonuclease system
WO2024043238A1 (en) Ultra-chasmogamous wheat, method for producing ultra-chasmogamous wheat, and method for evaluating ultra-chasmogamous wheat
US20240060079A1 (en) Methods for producing vanilla plants with improved flavor and agronomic production
Chahal Evaluation of Phylogenetically Distant Baby Boom Genes for Their Ability to Induce Parthenogenesis in Rice
JP2011155966A (en) Method for determination of hybrid weakness in rice

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 18882138

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 18882138

Country of ref document: EP

Kind code of ref document: A1