WO2019103984A1 - Compositions including fatp1, fatp3, fatp4, fatp5, and/or fatp6 inhibitors and uses thereof - Google Patents

Abstract

The present disclosure relates generally to methods for ameliorating or treating melanoma. In particular, the present technology relates to administering a therapeutically effective amount of one or more compositions that inhibit the FATP1, FATP3, FATP4, FATP5, and/or FATP6 transporter protein to a subject diagnosed with, or at risk for melanoma.

Description

COMPOSITIONS INCLUDING FATP1, FATP3, FATP4, FATP5, AND/OR FATP6 INHIBITORS AND USES THEREOF

CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of and priority to U.S. Provisional Patent Application No. 62/590,035, filed November 22, 2017, the entire contents of which are incorporated herein by reference.

TECHNIC AL FIELD

[0002] The present technology relates generally to compositions and methods for ameliorating or treating melanoma. In particular, the present technology relates to administering a therapeutically effective amount of one or more compositions that inhibit the FATP1, FATP3, FATP4, FATP5, and/or FATP6 transporter protein to a subject diagnosed with, or at risk for melanoma.

STATEMENT OF GOVERNMENT SUPPORT

[0003] This invention was made with government support under CA186572, awarded by the National Institutes of Health. The government has certain rights in the invention.

BACKGROUND

[0004] The follow ing description of the background of the present technology is provided simply as an aid in understanding the present technology and is not admitted to describe or constitute prior art to the present technology.

[0005] The tumor microenvironment (TME) is increasingly recognized to play an important role in cancer initiation and progression, acting in concert with genetic alterations in tumor cells to allow for a dynamic response to novel environments during tumor progression (D. F. Quail et al., Science 352: 3018 (2016)). Melanomas arise from neural crest-derived melanocytes (Kaufman et al., Science 351 : 2197 (2016), which are anatomically located at the dermal- epidermal junction of the skin. During the early stages of melanoma, referred to as a Clark’s level I tumor, melanoma cells interact with microenvironmental keratinocytes, which provide endothelins required for melanoma growth (Kim et al. , Nat. Commun. 8: 14343 (2017)). As melanoma progresses, tumor cells enter a vertical growth phase and grow past the dermis into subcutaneous tissue, which is largely populated with adipocytes. These advanced, Clark’s level V primary melanomas as well as subcutaneous in transit melanomas are at high risk of systemic metastasis. SUMMARY OF THE PRESENT TECHNOLOGY

[0006] In one aspect, the present disclosure provides a method for treating melanoma in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of at least one sgRNA that targets one or more genes selected from the group consisting of FATP1 and FATP5. In some embodiments, the at least one sgRNA comprises a nucleic acid sequence selected from the group consisting of: 5’ AACAGCACGTGTCGTCCACT 3’ (SEQ ID NO: 1), 5’ GCGGCGCTCGGCGTGTACGT 3’ (SEQ ID NO: 2), 5’

CCCTCTTCATCTATACCTCG 3^' (SEQ ID NO: 3), and 5’ GCCCTCTTCATCTATACCTC 3’ (SEQ ID NO: 4). In certain embodiments, the subject displays elevated expression levels of FATP 1 and/or FATP5 protein prior to treatment. In any of the above embodiments, the subject has been diagnosed as having melanoma.

[0007] In another aspect, the present disclosure provides a method for treating a disease characterized by elevated FATP5 or FATP1 levels in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of Lipofennata, wherein the disease characterized by elevated FATP5 or FATP1 levels is melanoma, ovarian cancer, breast cancer, prostate cancer, or renal cell carcinoma.

[0008] In one aspect, the present disclosure provides a method for treating a disease characterized by elevated FATP5 or FATP1 levels in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of at least one sgRNA that targets one or more genes selected from the group consisting of FATP 1 and FATP5, wherein the disease characterized by elevated FATP5 or FATP 1 levels is melanoma, ovarian cancer, breast cancer, prostate cancer, or renal cell carcinoma, and wherein the at least one sgRNA comprises a nucleic acid sequence selected from the group consisting of: 5’ AACAGCACGTGTCGTCCACT 3’ (SEQ ID NO: 1), 5’ GCGGCGCTCGGCGTGTACGT 3’ (SEQ ID NO: 2), 5’

CCCTCTTCATCTATACCTCG 3’ (SEQ ID NO: 3), and 5’ GCCCTCTTCATCTATACCTC 3’ (SEQ ID NO: 4).

[0009] Signs or symptoms of melanoma may comprise one or more of normal moles, new^r spots on the skin, a change in size, texture, shape or color of an existing mole, sores that do not heal, itchiness, tenderness, pain, redness or swelling that spreads outside the border of a spot to the surrounding skin, blurry vision, partial loss of sight, dark spots in the iris, scales, and oozing or bleeding from an existing mole.

[0010] Additionally or alternatively, in some embodiments of the methods disclosed herein, the subject harbors one or more point mutations in BRAF, or NRAS. The one or more point mutations in BIL4F or NBAS may be selected from the group consisting of BRAF V60QE and NBAS Q61R. In certain embodiments, the subject is human. In some embodiments, the at least one sgRNA or Lipofermata is administered orally, topically, intranasally, systemically, intravenously, subcutaneously, intraperitoneally, intradermally, intraocularly, iontophoretically, transmucosally, or intramuscularly.

[0011] Additionally or alternatively, in some embodiments, the method further comprises separately, sequentially or simultaneously administering one or more additional therapeutic agents to the subject. In some embodiments, the additional therapeutic agents are selected from the group consisting of GDC-0879, SB590885, Encorafenib, RAF265, TAK-632, PLX4720, CEP-32496, AZ628, Sorafenib Tosylate, Sorafenib, Vemurafenib (Zelboraf) and Dabrafenib (GSK2118436), MLN2480, Cobimetinib (GDC-0973), MEK 162, R05126766, GDC-0623, VTXl le, Selumetinib (AZD6244), PD0325901, Trametinib (GSK1120212), UOI26-EtOH,

PD 184352 (Cl- 1040), Refametinib, PD98059, BIX02189, Binimetinib, Pimasertib (AS-703026), SI .327. BIX02188, AZD8330, TAK-733, PD318088, SCH772984, FR 180204, ipilimumab, tremelimumab, MEDI4736, nivolumab, durvalumab, pembrolizumab, pidilizumab (CT-011), AMP-224, AMP-514 (MEDI0680), PDR001, BMS-936559 (MDX1105), atezolizumab

(Tecentriq^®, MPDL3280A), and avelumab (MSB0010718C).

[0012] In certain embodiments of the methods disclosed herein, the at least one sgRNA or Lipofermata is administered daily for 6 weeks or more. In other embodiments, the at least one sgRNA or Lipofermata is administered daily for 12 weeks or more.

[0013] In one aspect, the present disclosure provides a method for monitoring the therapeutic efficacy of a dosage of an inhibitor of FATP1/FATP5 in a subject diagnosed with melanoma comprising: (a) detecting FATP5 protein levels in a test sample obtained from the subject after the subject has been administered the dosage of the inhibitor of FATP1/FATP5 ; and (b) determining that the dosage of the inhibitor of FATP1/FATP5 is effective when the FATP5 protein levels in the test sample are reduced compared to that observed in a control sample obtained from the subject prior to administration of the inhibitor of FATP1/FATP5. In some embodiments, the inhibitor of FATP1/FATP5 is Lipofermata. In other embodiments, the inhibitor of FATP1/FATP5 is a sgRNA that comprises a nucleic acid sequence selected from the group consisting of: 5’ AACAGCACGTGTCGTCCACT 3^' (SEQ ID NO: 1), 5’

GCGGCGCTCGGCGTGTACGT 3 (SEQ ID NO: 2), 5’ CCCTCTTCATCTATACCTCG 3’ (SEQ ID NO: 3), and 5’ GCCCTCTTCATCTATACCTC 3’ (SEQ ID NO: 4).

[0014] In another aspect, the present disclosure provides a method for treating melanoma in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of an inhibitor of FATP 1/FATP5 and a therapeutically effective amount of a RAF/MEK/ERK inhibitor. In some embodiments, the inhibitor of FATP1/FATP5 is Lipofermata. In other embodiments, the inhibitor of FATP1/FATP5 is a sgRNA that comprises a nucleic acid sequence selected from the group consisting of: 5’ AACAGCACGTGTCGTCCACT 3’ (SEQ ID NO: 1), 5’ GCGGCGCTCGGCGTGTACGT 3’ (SEQ ID NO: 2), 5’

CCCTCTTCATCTATACCTCG 3’ (SEQ ID NO: 3), and 5’ GCCCTCTTCATCTATACCTC 3’ (SEQ ID NO: 4). Additionally or alternatively, in some embodiments, the RAF/MEK/ERK inhibitor is Trametinib or dabrafenib.

[0015] Also disclosed herein are methods for treating melanoma in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of at least one sgRNA that targets one or more genes selected from the group consisting of FATP3, FATP4 or FATP6. In certain embodiments, the subject displays elevated expression levels of FATP3, FAFP4 and/or FATP6 protein prior to treatment. In any of the above embodiments, the subject has been diagnosed as having melanoma.

[0016] In one aspect, the present disclosure provides a method for treating a disease characterized by elevated FATP3, FATP4 or FATP6 levels in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of at least one sgRNA that targets one or more genes selected from the group consisting of FATP3, FATP4 or FATP6, and wherein the disease characterized by elevated FATP3, FATP4 or FAFP6 levels is melanoma, ovarian cancer, breast cancer, prostate cancer, or renal cell carcinoma. In another aspect, the present disclosure provides a method for treating a disease characterized by elevated FAFP3, FATP4 or FAFP6 levels in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of Lipofermata, wherein the disease characterized by elevated FATP3, FATP4 or FAFP6 levels is melanoma, ovarian cancer, breast cancer, prostate cancer, or renal cell carcinoma.

[0017] In one aspect, the present disclosure provides a method for monitoring the therapeutic efficacy of a dosage of an inhibitor of FATP3, FAFP4 or FATP6 in a subject diagnosed with melanoma comprising: (a) detecting FATP5 protein levels in a test sample obtained from the subject after the subject has been administered the dosage of the inhibitor of FATP3, FAFP4 or FATP6; and (b) determining that the dosage of the inhibitor of FATP3, FAFP4 or FATP6 is effective when the FAFP5 protein levels in the test sample are reduced compared to that observed in a control sample obtained from the subject prior to administration of the inhibitor of FATP3, FATP4 or FAFP6. In some embodiments, the inhibitor of FAFP3, FATP4 or FAFP6 is Lipofermata. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1A shows the evaluation of melanoma metastasis using transplantation of melanoma cells into zebrafish embryos. ZMEL1-GFP cells were transplanted into the vasculature of an unirradiated embryo at 2 days post fertilization. After 3 weeks of growth, when fish had widespread tumor dissemination, GFP⁺ cells were isolated by fluorescence- activated cell sorting (FACS). Parental ZMEL1 -GFP cells maintained in culture were also subject to FACS sorting, and gene expression profiling was performed on the two cell populations.

[0019] Figure IB shows the Ingenuity Pathway Analysis of ZMELI-GFP cells after metastatic dissemination. Figure IB describes seven pathways that could mediate

microenvironmental effects on melanoma growth. P-values indicate estimated likelihood that the indicated pathway is altered in the RNA-seq data set.

[0020] Figure 1C shows the heatmap of RNA-seq gene expression with significant differential expression between zebrafish ZMELl cells grown either in culture or in disseminated transplants in zebrafish.

[0021] Figure ID shows LipidTOX staining on ZMELI-GFP cells that were transplanted subcutaneously into adult Casper fish for 5 or 21 DPT (days post transplant), then FACS isolated. Double positive cells (GFP^÷ and LipidTOX ) (arrow) demonstrate that tumor cells accumulated lipids. LipidTOX staining intensity was quantified and averaged over multiple fields (>10 fields for each condition), calculated as fold change of LipidTOX staining compared to cultured parental controls. Error bars indicate s.e.m. Two-tailed Student’s T-test, n=3 independent experiments. Scale bar is 20 pm.

[0022] Figure IE shows the results of BODIPY lipid staining of adult Casper fish 21 days after subcutaneous transplant of 3 x 10⁵ ZMELI-GFP cells. Fish were stained with BODIPY 558/568 to visualize lipids. Insets show BODIPY-labeled GFP cells (arrow heads), revealing a subset of tumor cells that are lipid-laden. Double positive cells were observed in 78% of all transplanted fish (n=21 fish). Scale bar is 50 pm.

[0023] Figure IF shows transmission electron microscopy (TEM) fixed tissue from an adult Casper fish at 21 days post transplant. ZMEL1 cells are identified by the presence of melanosomes (asterisk). Multiple lipid droplets (arrowheads) were also observed in ZMELs. Scale bar is 2 pm. [0024] Figure 1G shows a human melanocytic news that expresses BRAF V600E, MelanA and SoxlO. Hemotoxylin and eostn (H&E) staining reveals cells that have large cytoplasmic spaces characteristic of lipid-laden ceils (arrowhead, inset). Scale bar is 100 pm.

[0025] Figure 1H shows patient-derived subcutaneous acral melanoma metastasis stained with H&E and Oil Red O. Scale bar is 100 pm.

[0026] Figure 2A shows H&E staining on a subcutaneous metastases in a Casper transplanted fish at 21 DPT (left) and a human lung metastasis (right). Tumor (T) and adjacent adipocytes (A) are labeled (left). Scale bar is 200 pm.

[0027] Figure 2B shows a schematic of the adipocyte-melanoma co-culture system described herein.

[0028] Figure 2C shows LipidTOX staining on ZMEL1-GFP, SKMEL28-GFP and A375- GFP cells that were co-cultured with 3T3L1 adipocytes for 7 days and then FACS isolated. LipidTOX staining intensity was quantified and averaged over multiple fields (>10 fields for each condition), calculated as fold change of LipidTOX staining compared to monocultured controls. Error bars indicate s.e.m. Two-tailed Student’s T-test, n=3 independent experiments.

[0029] Figure 2D shows TEM of A375-GFP cells FACS-isolated after co-culture with 3T3L1 adipocytes for 7 days compared to monocultured controls. Lipid droplet number per cell and lipid droplet size were determined. Error bars indicate s.d. T-test with Welch correction, n=10 cells/condition. Scale bar is 2 pm.

[0030] Figure 2E shows the transfer of BODIPY fluorescent fatty acid from adipocytes to melanoma cells. 3T3L1 adipocytes were first grown alone and lipid droplets were labeled with BODIPY. After extracellular BODIPY was washed away, ZMEL1-GFP, SKMEL28-GFP or A375-GFP cells were plated on top and co-cultured w ith BODIPY -labeled adipocytes for 24 hours then fixed and imaged. Representative images shown, n=3 independent experiments.

Scale bars are 10 pm.

[0031] Figure 2F show's BODIPY staining of SKMEL28-GFP or A375-GFP cells co- cultured ith adipocytes. 3T3L1 adipocytes were first grown alone on the top portion of a Transwell, and lipid droplets were labeled with BODIPY. After extracellular BODIPY was washed away, Transwell insert containing adipocytes were transferred to a new well containing ZMEL1-GFP, SKMEL28-GFP or A375-GFP cells. Cells were co-cultured for 24 hours then fixed and imaged. Representative images show n, n=3 independent experiments. Scale bars are 10 pm. [0032] Figure 3A shows a gelatin degradation assay on FACS-isolated ZMEL1-GFP cells. Quantification of gelatin matrix degradation was calculated by ZMEL1-GFP cells in

monoculture or co-cultured with adipocytes for 7 days. Representative images are shown. Error bars indicate s.d. T-test with Welch correction, n=3 independent experiments. Scale bar is 10 pm.

[0033] Figure 3B shows Alexa546-labelled gelatin matrix degradation by A375-GFP only, compared with A375-GFP cultivated in 24 hrs adipocytes conditioned media or direct co-culture with adipocytes. Representative images are shown. Error bars indicate s.d. T-test with Welch correction, n=3 independent experiments. Scale bar is 10 pm.

[0034] Figure 3C shows the results of gene set enrichment analysis (GSEA) in A375 cells. GSEA shows a significant enrichment of the Hoek invasive signature in A375 cells co-cultured with 3T3L1 adipocytes.

[0035] Figure 3D shows the results of GSEA in A375 cells co-cultured with 3T3L1 adipocytes. GSEA show's a significant enrichment of the ER stress/Unfolded protein response in A375 cells co-cultured with 3T3L1 adipocytes.

[0036] Figure 3E shows spliced XBP 1 mRNA expression levels in A375 cells co-cultured with adipocytes for 7 days. Error bars indicate s.e.m. Two-tailed Student’s T-test, n=3 independent experiments.

[0037] Figure 3F shows CHOP signal intensity in A375 cells treated with adipocyte- conditioned maintenance media compared to control maintenance media. Error bars indicate s.d. T-test with Welch correction, n=3 independent experiments. Scale bar is 10 pm.

[0038] Figure 3G shows Venn diagram of lipid species that are increased in human A375 or zebrafish ZMEL1 cells grown in in vitro co-culture with adipocytes (compared to monoculture) and from zebrafish ZMEL1 cells grown in subcutaneous transplants (in vivo ) in zebrafish (compared to parental cells in culture).

[0039] Figure 3H show's a list of 12 lipid species that are commonly' increased in human A375 and zebrafish ZMEL1 cells co-cultured with adipocytes and from ZMEL1 cells grown in subcutaneous transplants (data shown for subcutaneously transplanted ZMEL1 cells). Two- tailed unpaired T-test, n=3, P<0.05.

[0040] Figure 31 shows the CHOP signal intensity in A375 cells treated with 0.25 inM stearic acid compared to vehicle control. Error bars indicate s.d. T-test with Welch correction, n=3 independent experiments.

! [0041] Figure 3J shows AXL staining i A375 ceils treated with 0.25 mM stearic acid and quantification of ¾AXL high cells. Error bars indicate s.e.m. Two-tailed Student’s T-test. n=3 independent experiments. Scale bar is 10 pm.

[0042] Figure 4A shows inimunohistochemistry images of endogenous FATP1 and FATP5 in a panel of 105 clinically defined human melanoma tumor samples. Representative images are shown. Score 0 represents no FATP staining, scores 1 and 2 represent low-medium FATP staining and score 3 represents high FATP staining. Scale bar is 100 pm.

[0043] Figure 4B shows QBT timed lipid uptake in A375 overexpressing FATPi or FATP5 compared to control cells. Graph represents mean from n=3 independent experiments. Area under the curve (AUC) was calculated for each curve and differences were compared by 95% confidence intervals.

[0044] Figure 4C shows the Lipid uptake assay in A375, SKMEL28 and ZMELl ceil lines treated with varying doses of Lipofennata.

[0045] Figure 4D show’s the results of the BODIPY lipid transfer assay in the presence of Lipofennata. 3T3L1 adipocytes were maintained on the top chamber of a Trans w'dl insert and intracellular lipid droplets were labeled with BODIPY. After labeling, Transwell inserts with 3T3L1 adipocytes were moved to another well containing SKMEL28-GFP cells and 2.5 pM Lipofennata for 24 hours. BODIPY signal intensity wns quantified by the fluorescence signal in GFP^: cells (>10 fields/conditions). Error bars are s.e.m. Two-tailed Student’s T-test, n=3 independent experiments. Scale bar is 10pm.

[0046] Figure 4E shows the results of a Transwnll migration assay using A375, A375 FATP5 sgRNAl and A375 FATP5 sgRNA2 cells. Error bars indicate s.d. T-test with Welch correction, n=3 independent experiments.

[0047] Figure 4F shows Alexa546 labelled gelatin matrix degradation by A375-GFP cells cultivated in adipocyte-conditioned media treated with DMSO or 1.5 pM Lipofennata.

Representative images are shown. Error bars indicate s.d. T-test with Welch correction, n=3 independent experiments. Scale bar is 10pm.

[0048] Figure 4G shows the chemical structure of Lipofennata.

[0049] Figure 4F1 shows the viability of A375, SKMEL28 and ZMELl cell lines treated with varying doses of Lipofennata. Human and zebrafish melanoma cells were seeded onto plates at low density and allowed to grow_’ for 72 hours in the presence of increasing concentrations of Lipofennata. Cell viability was measured using Cell Titer Glow. N= 3 independent experiments. [0050] Figures 4I-4J show the effects of Lipofemmta on tumor size. Adult Casper fish were transplanted with ZMEL-GFP cells. 3 pL of 5 mM Lipofermata or DMSO was injected into fish starting at 6 days post transplant. After 4 days of treatment, fish were imaged and GRP intensity' and area was measured. N=9 DMSO fish, n=7 Lipofermata fish .

[0051] Figure 5A shows RNA-seq analysis of human A375 melanoma cells in monoculture or co-culture with adipocytes. GSEA shows a significant enrichment of hallmarks of cholesterol homeostasis and fatty acid metabolism in A375 cells co-cultured with 3T3L1 adipocytes, with strong downregulation of genes regulating de novo lipogenesis.

[0052] Figure 5B shows a volcano plot depicting differentially expressed genes between A375 cells in monoculture and in co-culture with 3T3LI cells. Log2 fold change is shown on the x-axis and -loglO(pvalue) on the y-axis. Differentially expressed genes are shown in the labelled boxes (log2 fold change ± 1 , FDR 5%). Select lipid-related genes are indicated.

[0053] Figure 6A shows phosho-H3 staining in SKMEL28-GFP and A375-GFP cells co cultured w'ith adipocytes for 24 hours. % pFB w'as calculated by counting the number of pFI3⁺ nuclei over total number of GFP cells/field (>10 fields/condition). Error bars indicate s.e.m. Two-tailed Student’s T-test, n=3 independent experiments.

[0054] Figure 6B shows mitochondrial respiration of FACS-isolated A375-GFP cells in monoculture or after co-culture with 3T3L1 adipocytes for 7 days measured with the Seahorse XF96 Extracellular Flux Analyzer and Cell Mitochondrial Stress Test Kit from Seahorse Biosciences. Oxygen consumption rate (OCR) was measured under basal conditions followed by the sequential addition of oligomycin (1 mM), FCCP (4 mM), rotenone (1 pM) or antimycin A (1 pM). Individual parameters for basal respiration and maximal respiration are shown. Error bars indicate s.e.m, n=4 independent experiments.

[0055] Figure 7A show_’s heatmaps of lipidomics concentration z-scores from human A375 (left panel) or zebrafish ZMEL1 (center panel) cells grown either in monoculture or co-culture with adipocytes and from zebrafish ZMEL1 cells grown either in culture or in subcutaneous transplants in zebrafish (right panel). Lipid species that were not detected (ND) are indicated. Classes of lipid species are indicated on the left of each heatmap (n=3 biological replicates for each group).

[0056] Figure 7B show's Western blot results for GRP78 in A375 cells treated with isopropanol ( 1 : 100 or 1 :200), palmitic or stearic acid for 24 hours. Representative blot is shown, n=3 independent experiments. [0057] Figure 7C shows cell viability results with Cell Titer Glo assay in A375 cells treated with vehicle, 0.25 mM stearic acid, 0.25 mM oleic acid or 0.25mM stearic acid and 0.25 mM oleic acid. Error bars indicate s.e.m. Two-tailed Student’s T-test, n=3 independent experiments.

[0058] Figure 7D shows CHOP immunofluorescence signal intensity in A375 cells treated with vehicle or 0.25 mM stearic acid and 0.25 mM oleic acid. Error bars indicate s.d. T-test with Welch correction, n=3 independent experiments.

[0059] Figure 7E shows the quantitative summary of the observed fold change of certain lipid compositions in zebrafish ZMEL1 cells grown either in monoculture or co-culture with adipocytes.

[0060] Figure 7F show's the quantitative summary of the observed fold change of certain lipid compositions in human A375 ceils grown either in monoculture or co-culture with adipocytes.

[0061] Figure 8A shows immunohistochemistry of FATPI and FATP5 on human brain, liver, spleen and kidney tissues used as positive and negative controls for quantifying FATP1 and FATP5 IHC of tumor microarrays (TMAs) and patient-derived xenografts (PDXs). Scale bar is 100 pm.

[0062] Figure 8B show¾ immunohistochemistry of FATP1 , FATP5 and Oil Red O on 4 patient-derived xenograft samples. Scale bar is 50 pm.

[0063] Figure 9A shows QBT timed lipid uptake in A375 FATPi and A375 FATP5 CRISPR knockout cells compared to control cells. Graph represents mean from n=3 independent experiments. AUC was calculated for each curve and differences were compared by 95% confidence intervals.

[0064] Figure 9B shows QBT timed lipid uptake in Lipofermata-treated A375

overexpressing FATP i or FATP5 compared to control cells. Graph represents mean from n=3 independent experiments. Error bars are s.e.m. Area under the curve (AUC) was calculated for each curve and differences were compared by 95% confidence intervals.

[0065] Figure 9C shows Caspase 3/7 Glo assay results (for measurement of apoptosis) in A375 cells treated with 1 , 5 or 10 pM of Lipofermata for 24 hours. Error bars are s.e.m TWO- tailed Student’s T-test, n=3 independent experiments.

[0066] Figure 10A shows the effect of FATPI overexpression on lipid accumulation in vivo. N>27 fish per group (FATPI vs. control). [0067] Figure 10B shows the effect of FATPl overexpression on tumor growth in vivo.

N>27 fish per group (FATPl vs. control).

[0068] Figure IOC shows the effect of FATPl overexpression on tumor invasion in vivo.

[0069] Figure 11A shows the effects of Trametinib/Lipofermata combination therapy on cell proliferation in NRAS mutant cell line SKMEL2. n=l independent experiment with 3 replicates.

[0070] Figure 1 IB shows the effects of T rameti n i b/Lipofcrma ta/dabra fern b combination therapy on cell proliferation in BRAT mutant cell line A375. N= 3 independent experiments, each with 3 replicates.

[0071] Figure 12 shows the quantitative summary of RNA-seq gene expression data with significant differential expression between zebrafish ZMEL i ceils grown either in culture or in disseminated transplants in zebrafish for lipid genes.

[0072] Figure 13 shows the differences in survival outcomes in patients exhibiting elevated FATP5 mRNA levels versus patients that do not exhibit elevated FATP5 mRNA levels.

DETAILED DESCRIPTION

[0073] It is to be appreciated that certain aspects, modes, embodiments, variations and features of the present methods are described below in various levels of detail in order to provide a substantial understanding of the present technology.

[0074] In practicing the present methods, many conventional techniques in molecular biology, protein biochemistry, cell biology, immunology, microbiology and recombinant DNA are used. See, e.g., Sambrook and Russell eds. (2001 ) Molecular Cloning: A Laboratory Manual , 3rd edition; the series Ausubel et al. eds. (2007) Current Protocols in Molecular Biology; the series Methods in Enzymology (Academic Press, Inc., N.Y.); MacPherson et al. (1991) PCR 1: A Practical Approach (IRL Press at Oxford University Press); MacPherson et al. (1995) PCR 2: A Practical Approach: Harlow and Lane eds. (1999) Antibodies, A Laboratory Manual·, Freshney (2005) Culture of Animal Cells: A Manual of Basic Technique, 5th edition; Gait ed. (1984) Oligonucleotide Synthesis, U.S. Patent No. 4,683, 195; Hames and Ffiggins eds. (1984) Nucleic Acid Hybridization:, Anderson (1999) Nucleic Acid Hybridization, Hames and Higgins eds. (1984) Transcription anti Translation; Immobilized Cells and Enzymes (IRL Press (1986)); Perbal (1984) A Practical Guide to Molecular Cloning; Miller and Calos eds. (1987) Gene Transfer Vectors for Mammalian Cells (Cold Spring Harbor Laboratory); Makrides ed. (2003) Gene Transfer and Expression in Mammalian Cells; Mayer and Walker eds. (1987) Immunochemical Methods in Cell and Molecular Biolog g (Academic Press, London); and Herzenberg et al. eds (1996) Weir’s Handbook of Experimental Immunology . Definitions

[0075] Unless defined otherwise, all technical and scientific terms used herei generally have the same meaning as commonly understood by one of ordinary skill in the art to which this technology belongs. As used in this specification and the appended claims, the singular forms “a”,“an” and“the” include plural referents unless the content clearly dictates otherwise. For example, reference to“a cell” includes a combination of two or more cells, and the like.

Generally, the nomenclature used herein and the laboratory procedures in cell culture, molecular genetics, organic chemistry, analytical chemistry and nucleic acid chemistry and hybridization described below are those well-known and commonly employed in the art.

[0076] As used herein, the term“about” in reference to a number is generally taken to include numbers that fall within a range of 1%, 5%, or 10% in either direction (greater than or less than) of the number unless otherwise stated or otherwise evident from the context (except where such number would be less than 0% or exceed 100% of a possible value).

[0077] As used herein, the“administration” of an agent or drug to a subject includes any route of introducing or delivering to a subject a compound to perform its intended function. Administration can be carried out by any suitable route, including but not limited to, orally, intranasally, parenterally (intravenously, intramuscularly, intraperitoneally, or subcutaneously), rectally, intrathecally, intratumorally or topically. Administration includes self-administration and the administration by another.

[0078] The terms“complementary” or“complementarity” as used herein with reference to polynucleotides (i.e., a sequence of nucleotides such as an oligonucleotide or a target nucleic acid) refer to the base-pairing rules. The complement of a nucleic acid sequence as used herein refers to an oligonucleotide which, when aligned with the nucleic acid sequence such that the 5' end of one sequence is paired with the 3' end of the other, is in“antiparallel association.” For example, the sequence“5'-A-G-T-3'” is complementary' to the sequence“3'-T-C-A-5.” Certain bases not commonly found in naturally-occurring nucleic acids may be included in the nucleic acids described herein. These include, for example, inosine, 7-deazaguanine, Locked Nucleic Acids (LNA), and Peptide Nucleic Acids (PNA). Complementarity need not be perfect; stable duplexes may contain mismatched base pairs, degenerative, or unmatched bases. Those skilled in the art of nucleic acid technology can determine duplex stability empirically' considering a number of variables including, for example, the length of the oligonucleotide, base composition and sequence of the oligonucleotide, ionic strength and incidence of mismatched base pairs. A complementary sequence can also be an RNA sequence complementary to the DNA sequence or its complementary' sequence, and can also be a cDNA. [0079] As used herein, a "control" is an alternative sample used in an experiment for comparison purpose A control can be "positive" or "negative." For example, where the purpose of the experiment is to determine a correlation of the efficacy of a therapeutic agent for the treatment for a particular type of disease, a positive control (a compound or composition known to exhibit the desired therapeutic effect) and a negative control (a subject or a sample that does not receive the therapy or receives a placebo) are typically employed.

[0080] As used herein, the term“effective amount" refers to a quantity sufficient to achieve a desired therapeutic and/or prophylactic effect, e.g., an amount which results in the prevention of, or a decrease in a disease or condition described herein or one or more signs or symptoms associated with a disease or condition described herein. In the context of therapeutic or prophylactic applications, the amount of a composition administered to the subject will vary depending on the composition, the degree, type, and se verity of the disease and on the charac teristics of the individual, such as general health, age, sex, body weight and tolerance to drugs. The skilled artisan will be able to determine appropriate dosages depending on these and other factors. The compositions can also be administered in combination with one or more additional therapeutic compounds. In the methods described herein, the therapeutic

compositions may be administered to a subject having one or more signs or symptoms of melanoma. As used herein, a“therapeutically effective amount” of a composition refers to composition levels in which the physiological effects of a disease or condition are ameliorated or eliminated. A therapeutically effective amount can be given in one or more administrations.

[0081] As used herein, the term“elevated expression levels” of FATP1, FATP3, FATP4, FATP5, or FATP6 refers to FATP1, FATP3, FATP4, FATP5, or FATP6 mRNA or protein expression level that is 2 standard deviations above the mean level of expression of a cohort of melanoma patients.

[0082] As used herein,“expression” includes one or more of the following: transcription of the gene into precursor RNA; splicing and other processing of the precursor mRNA to produce mature mRNA; mRNA stability; translation of the mature mRNA into protein (including codon usage and tRNA availability); and glycosylation and/or other modifications of the translation product, if required for proper expression and function.

[0083] As used herein, the term“gene” means a segment of DNA that contains all the information for the regulated biosynthesis of an RNA product, including promoters, exons, introns, and other untranslated regions that control expression. [0084] As used herein, the terms“individual”,“patient”, or“subject” can be an individual organism, a vertebrate, a mammal, or a human. In some embodiments, the individual, patient or subject is a human.

[0085] As used herein, the term“pharmaceutically-acceptabie carrier” is intended to include any and all solvents, dispersion media, coatings, antibacterial and antifungal compounds, isotonic and absorption delaying compounds, and the like, compatible with pharmaceutical administration. Pharmaceutically-acceptabie carriers and their formulations are known to one skilled in the art and are described, for example, in Remington's Pharmaceutical Sciences (20^th edition, ed. A. Gennaro, 2000, Lippincott, Williams & Wilkins, Philadelphia, Pa.).

[0086] As used herein,“prevention” or“preventing” of a disorder or condition refers to a compound that, in a statistical sample, reduces the occurrence of the disorder or condition in the treated sample relative to an untreated control sample, or delays the onset of one or more symptoms of the disorder or condition relative to the untreated control sample. As used herein, preventing a disorder or condition, includes preventing or delaying the initiation of symptoms of a disorder or condition. As used herein, prevention of a disorder or condition also includes preventing a recurrence of one or more signs or symptoms of a disorder or condition.

[0087] As used herein, the term“sample” means biological sample material derived from living cells of a subject. Biological samples may include tissues, cells, protein or membrane extracts of cells, and biological fluids (e.g., ascites fluid or cerebrospinal fluid (CSF)) isolated from a subject, as well as tissues, cells and fluids (blood, plasma, saliva, urine, serum etc.) present within a subject.

[0088] As used herein, the term“separate” therapeutic use refers to an administration of at least two active ingredients at the same time or at substantially the same time by different routes.

[0089] As used herein, the term“sequential” therapeutic use refers to administration of at least two active ingredients at different times, the administration route being identical or different. More particularly, sequential use refers to the whole administration of one of the active ingredients before administration of the other or others commences. It is thus possible to administer one of the active ingredients over several minutes, hours, or days before

administering the other active ingredient or ingredients. There is no simultaneous treatment in this case.

[0090] As used herein, the term“simultaneous” therapeutic use refers to the administration of at least two active ingredients by the same route and at the same time or at substantially the same time. [0091] As used herein, the term“therapeutic agent” is intended to mean a compound that, when present in an effective amount, produces a desired therapeutic effect on a subject in need thereof (e.g, ameliorating or treating a disorder or condition disclosed herein).

[0092] “Treating” or“treatment” as used herein covers the treatment of a disease or disorder described herein, in a subject, such as a human, and includes: (I) inhibiting a disease or disorder, i.e., arresting its development; (ii) relieving a disease or disorder, i.e., causing regression of the di sorder; (iii) slowing progression of the disorder; and/or (iv) inhibiting, relieving, or slowing progression of one or more symptoms of the disease or disorder. In some embodiments, treatment means that the symptoms associated with the disease are, e.g., alleviated, reduced, cured, or placed in a state of remission.

[0093] It is also to be appreciated that the various modes of treatment of disorders as described herein are intended to mean“substantial,” which includes total but also less than total treatment, and wherein some biologically or medically relevant result is achieved. The treatment may be a continuous prolonged treatment for a chronic disease or a single, or few time administrations for the treatment of an acute condition.

FATP1/FATP3/FATP4/FATP5/FATP6 Inhibitors

[0094] In one aspect, the present disclosure provides inhibitory RNAs (e.g., sgRNAs, antisense RN As or shRNAs) that target at least one of FATP1 and FATP5. Examples of such inhibitory RNAs include those with sequences comprising 5’ AACAGCACGTGTCGTCCACT 3’ (SEQ ID NO: 1), 5’ GCGGCGCT C GGC GT GTAC GT 3’ (SEQ ID NO: 2), 5’

CCCTCTTCATCTATACCTCG 3’ (SEQ ID NO: 3), 5’ GCCCTCTTCATCTATACCTC 3’ (SEQ ID NO: 4), or any complementary_' sequences thereof.

[0095] In one aspect, the present disclosure provides inhibitory RNAs (e.g., sgRNAs, antisense RNAs or shRNAs) that target at least one of FATP3, FATP4 and FATP6.

[0096] The present disclosure also provides pharmacological inhibitors of FATP1, FATP3, FATP4, FATP5 and/or FATP6, including but not limited to Lipofermata (See Figure 4G).

Therapeutic Methods

[0097] The following discussion is presented by way of example only, and is not intended to be limiting.

[0098] One aspect of the present technology includes methods of treating a di sease or condition characterized by elevated expression levels and/or increased activity of FATP1 aiui/or FATP5 protein such as melanoma, ovarian cancer, breast cancer, prostate cancer and renal cell carcinoma. Additionally or alternatively, in some embodiments, the present technology includes methods of treating melanoma. In one aspect, the present disclosure provides a method for inhibiting melanoma proliferation and/or invasion in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of at least one inhibitor of FATP1/FATP5, wherein the at least one inhibitor is Lipofermata or a sgRNA that comprises a nucleic acid sequence selected from the group consisting of: 5’

AACAGCACGT GT CGTC C A CT 3’ (SEQ ID NO: 1), 5’ GCGGCGCTCGGCGTGTACGT 3’ (SEQ ID NO: 2), 5’ CCCTCTT CATCTATACCTCG 3’ (SEQ ID NO: 3), and 5’

GCCCTCTTCATCTATACCTC 3’ (SEQ ID NO: 4), and wherein the subject suffers from a disease or condition characterized by elevated expression levels and/or increased activity of FATP 1 and/or FATP5 protein.

[0099] In some embodiments, the subject is diagnosed as having, suspected as having, or at risk of having a disease or condition characterized by elevated expression le vels and/or increased activity of FATP 1 and/or FATP5 protein Additionally or alternatively, in some embodiments, the subject is diagnosed as having melanoma, ovarian cancer, breast cancer, prostate cancer, or renal cell carcinoma.

[00100] Also disclosed herein are methods for treating melanoma or inhibiting melanoma proliferation and/or invasion in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of at least one sgRNA that targets one or more genes selected from the group consisting of FATP3, FATP4 or FATP6. In certain embodiments, the subject displays elevated expression levels of FATP3, FATP4 and/or FATP6 protein prior to treatment. In any of the above embodiments, the subject has been diagnosed as having melanoma.

[00101] In one aspect, the present disclosure provides a method for treating a disease characterized by elevated FATP3, FATP4 or FATP6 levels in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of at least one sgRNA that targets one or more genes selected from the group consisting of FATP3, FATP4 or FATP6, and wherein the disease characterized by elevated FATP3, FATP4 or FATP6 levels is melanoma, ovarian cancer, breast cancer, prostate cancer, or renal cell carcinoma. In another aspect, the present disclosure provides a method for treating a disease characterized by elevated FATP3, FATP4 or FATP6 levels in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of Lipofermata, wherein the disease characterized by elevated FATP3, FATP4 or FATP6 levels is melanoma, ovarian cancer, breast cancer, prostate cancer, or renal cell carcinoma.

[00102] In therapeutic applications, compositions or medicaments comprising a FATP 1 , FATP3, FATP4, FATP5 and/or FATP6 inhibitor disclosed herein are administered to a subject suspected of, or already suffering from such a disease or condition (such as, a subject diagnosed with a disease or condition characterized by elevated expression levels and/or increased activity of FATP1, FATP3, FATP4, FATP5 and/or FATP6 protein, and/or a subject diagnosed with melanoma, ovarian cancer, breast cancer, prostate cancer or renal cell carcinoma), in an amount sufficient to cure, or at least partially arrest, the symptoms of the disease, including its complications and intermediate pathological phenotypes in development of the disease.

[00103] Subjects suffering from a disease or condition characterized by elevated expression levels and/or increased activity of FATPl, FATP3, FATP4, FATP5 and/or FATP6 protein, and'or a subject diagnosed with melanoma, ovarian cancer, breast cancer, prostate cancer or renal cell carcinoma can be identified by any or a combination of diagnostic or prognostic assays known in the art. For example, typical symptoms of melanoma include, but are not limited to, normal moles, new spots on the skin, a change in size, texture, shape or color of an existing mole, sores that do not heal, itchiness, tenderness, pain, redness or swelling that spreads outside the border of a spot to the surrounding skin, blurry vision, partial loss of sight, dark spots in the iris, scales, and oozing or bleeding from an existing mole.

[00104] In some embodiments, the subject may exhibit one or more point mutations in BRAF, NRAS, CDKN2A, c-KIT or NFL In some embodiments, the point mutation is BRAF V600E, NRAS Q61R, or CDKN2A E61 nonsense mutations.

[00105] In some embodiments, subjects with a disease or condition characterized by elevated expression levels and/or increased activity of FATPl, FATP3, FATP4, FATP5 and/or FATP6 protein, and/or subjects suffering from melanoma that are treated with the FATPl, FATP3, FATP4, FATP5 and/or FATP6 inhibitor of the present technology will show_' amelioration or elimination of one or more of the following symptoms: normal moles, new spots on the skin, a change in size, texture, shape or color of an existing mole, sores that do not heal, itchiness, tenderness, pain, redness or swelling that spreads outside the border of a spot to the surrounding skin, blurry vision, partial loss of sight, dark spots in the iris, scales, and oozing or bleeding from an existing mole.

[00106] In certain embodiments, subjects with a disease or condition characterized by elevated expression levels and/or increased activity of FATPl, FATP3, FATP4, FATP5 and/or FATP6 protein, and/or subjects suffering from melanoma, ovarian cancer, breast cancer, prostate cancer or renal cell carcinoma that are treated with the FATPl, FATP3, FATP4, FATP5 and/or FATP6 inhibitor disclosed herein will show reduced cancer cell pro I i fc rat ion/in va s i on and/or increased survival compared to untreated subjects suffering from melanoma, ovarian cancer, breast cancer, prostate cancer or renal cell carcinoma. In certain embodiments, subjects with a disease or condition characterized by elevated expression levels and/or increased activity of FATP1 , FATP3, FATP4, FATP5 and/or FATP6 protein, and/or subjects suffering from melanoma, ovarian cancer, breast cancer, prostate cancer or renal cell carcinoma that are treated with the FATPI, FATP3, FATP4, FATP5 and/or FATP6 inhibitor of the present technology will show reduced FATPI, FATP3, FATP4, FATP5 and/or FATP6 expression levels compared to untreated subjects suffering from melanoma, ovarian cancer, breast cancer, prostate cancer or renal cell carcinoma.

[00107] In one aspect, the present disclosure provides a method for monitoring the therapeutic efficacy of a dosage of an inhibitor of FATPI /FATP5 in a subject diagnosed with melanoma comprising: (a) detecting FATPI or FATP5 protein levels in a test sample obtained from the subject after the subject has been administered the dosage of the inhibitor of FATP1/FATP5, wherein the inhibitor of FATPI /FATP5 is Lipofermata or a sgRNA that comprises a nucleic acid sequence selected from the group consisting of: 5’ AACAGCACGTGTCGTCCACT 3’ (SEQ ID NO: 1), 5’ GCGGCGCTCGGCGTGTACGT 3’ (SEQ ID NO: 2), 5’

CCCTCTTCATCTATACCTCG 3’ (SEQ ID NO: 3), and 5’ GCCCTCTTCATCTATACCTC 3’ (SEQ ID NO: 4); and (b) determining that the dosage of the inhibitor of FATPI /FATP5 is effective when the FATPI or FATP5 protein levels in the test sample are reduced compared to that observed in a control sample obtained from the subject prior to administration of the inhibitor of FATP1/FATP5. In another aspect, the present disclosure provides a method for monitoring the therapeutic efficacy of a dosage of an inhibitor of FATP3, FATP4 or FATP6 in a subject diagnosed with melanoma comprising: (a) detecting FATP5 protein levels in a test sample obtained from the subject after the subject has been administered the dosage of the inhibitor of FATP3, FATP4 or FATP6; and (b) determining that the dosage of the inhibitor of FATP3, FATP4 or FATP6 is effective when the FATP5 protein levels in the test sample are reduced compared to that observed in a control sample obtained from the subject prior to administration of the inhibitor of FATP3, FATP4 or FATP6. In some embodiments, the inhibitor of FATP3, FATP4 or FATP6 is Lipofermata. The test sample may be tissues, cells or biological fluids (blood, plasma, saliva, urine, serum etc.) present within a subject.

Prophylactic Methods

[00108] In one aspect, the present technology provides a method for preventing or delaying the onset of a disease or condition characterized by elevated expression levels and/or increased activity of FATPI , FATP3, FATP4, FATP5 and/or FATP6 protein. Additionally or alternatively, in some aspects, the present technology^ provides a method for preventing or delaying the onset of melanoma, ovarian cancer, breast cancer, prostate cancer or renal cell carcinoma.

[00109] Subjects at risk or susceptible to a disease or condition characterized by elevated expression levels and/or increased activity of FATP1 , FATP3, FATP4, FATP5 and/or FATP6 protein and/or subjects at risk or susceptible to melanoma, ovarian cancer, breast cancer, prostate cancer or renal cell carcinoma include those that exhibit one or more point mutations in BRAF, NRAS, CDKN2A, c-KIT or NFL In some embodiments, the point mutation is BRAF V60QE, NRAS Q61R, or CDKN2A E61 nonsense mutations. Such subjects can be identified by, e.g., any or a combination of diagnostic or prognostic assays known in the art.

[00110] In prophylactic applications, pharmaceutical compositions or medicaments comprising a FATP1/FATP3/FATP4/FATP5/FATP6 inhibitor disclosed herein are administered to a subject susceptible to, or otherwise at risk of a disease or condition characterized by elevated expression levels and/or increased activity of FATP1, FATP3, FATP4, FATP5 and/or FATP6 protein, and/or a subject susceptible to, or otherwise at risk of melanoma, ovarian cancer, breast cancer, prostate cancer or renal cell carcinoma in an amount sufficient to eliminate or reduce the risk, or delay the onset of the disease, including biochemical, histologic and/or behavioral symptoms of the disease, its complications and intermediate pathological phenotypes presenting dining development of the disease. Administration of a prophylactic

FATP1/FATP3/FATP4/FATP5/FATP6 inhibitor disclosed herein can occur prior to the manifestation of symptoms characteristic of the disease or disorder, such that the disease or disorder is prevented or, alternatively, delayed in its progression.

[00111] In some embodiments, treatment with the FATPI/FATP3/FATP4/FATP5/FATP6 inhibitor will prevent or delay the onset of one or more of the following symptoms: normal moles, new spots on the skin, a change in size, texture, shape or color of an existing mole, sores that do not heal, itchiness, tenderness, pain, redness or swelling that spreads outside the border of a spot to the surrounding skin, blurry vision, partial loss of sight, dark spots in the iris, scales, and oozing or bleeding from an existing mole. In certain embodiments, (a) subjects with a disease or condition characterized by elevated expression levels and/or increased activity of FATP1, FATP3, FATP4, FATP5 and/or FATP6 protein, and/or (b) subjects with melanoma, ovarian cancer, breast cancer, prostate cancer or renal cell carcinoma that are treated with the FATP1/FATP3/FATP4/FATP5/FATP6 inhibitor will show' FATP1 , FATP3, FATP4, FATP5 and/or FATP6 expression levels that resemble those observed in healthy control subjects.

[00112] For therapeutic and/or prophylactic applications, a composition comprising a FATP1 , FATP3, FATP4, FATP5 and/or FATP6 inhibitor disclosed herein, is administered to the subject. In some embodiments, the FATPl, FATP3, FATP4, FATP5 and/or FATP6 inhibitor of the present technology is administered one, two, three, four, or five times per day. In some embodiments, the FATPl, FATP3, FATP4, FATP5 and/or FATP6 inhibitor of the present technology is administered more than five times per day. Additionally or alternatively, in some embodiments, the FATPl , FATP3, FATP4, FATP5 and/or FATP6 inhibitor of the present technology is administered every day, every other day, every third day, every fourth day, every fifth day, or every sixth day. In some embodiments, the FATPl, FATP3, FATP4, FATP5 and/or FATP6 inhibitor of the present technology is administered weekly, bi-weekly, tri-weekly, or monthly. In some embodiments, the FATPl, FATP3, FATP4, FATP5 an 'or FATP6 inhibitor of the present technology is administered for a period of one, two, three, four, or five weeks. In some embodiments, the FATPl , FATP3, FATP4, FATP5 and/or FATP6 inhibitor of the present technology is administered for six weeks or more. In some embodiments, the FATPl , FATP3, FATP4, FATP5 and/or FATP6 inhibitor of the present technology is administered for twelve weeks or more. In some embodiments, the FATPl, FATP3, FATP4, FATP5 and/or FATP6 inhibitor of the present technology is administered for a period of less than one year. In some embodiments, the FATPl , FATP3, FATP4, FATP5 and'or FATP6 inhibitor of the present technology is administered for a period of more than one year. In some embodiments, the FATPl, FATP3, FATP4, FATP5 and/or FATP6 inhibitor of the present technology_' is administered throughout the subject’s life,

[00113] In some embodiments of the methods of the present technology_', the FATPl , FATP3, FATP4, FATP5 and/or FATP6 inhibitor of the present technology is administered daily for 1 week or more. In some embodiments of the methods of the present technology, the FATPl, FATP3, FATP4, FATP5 and/or FATP6 inhibitor of the present technology' is administered daily for 2 weeks or more. In some embodiments of the methods of the present technology, the FATPl, FATP3, FATP4, FATP5 and/or FATP6 inhibitor of the present technology' is administered daily' for 3 weeks or more. In some embodiments of the methods of the present technology, the FATPl , FATP3, FATP4, FATP5 and/or FATP6 inhibitor of the present technology is administered daily for 4 weeks or more. In some embodiments of the methods of the present technology, the FATPl, FATP3, FATP4, FATP5 and/or FATP6 inhibitor of the present technology is administered daily for 6 weeks or more. In some embodiments of the methods of the present technology, the FATPl, FATP3, FATP4, FATP5 and/or FATP6 inhibitor of the present technology is administered daily for 12 weeks or more. In some embodiments, the FATPl, FATP3, FATP4, FATP5 and'or FATP6 inhibitor of the present technology is administered daily throughout the subject’s life. Determination of the Biological Effect of FATP1, FATP3. FATP4, FATP5 and/or FATP6 Inhibitors of the Present Technolo2v

[00114] In various embodiments, suitable in vitro or in vivo assays are performed to determine the effect of a specific inhibitor of FATP1/FATP3/FATP4/FATP5/FATP6 and whether its administration is indicated for treatment. In various embodiments, in vitro assays can be performed with representative animal models, to determine if a given inhibitor of

FATP1/FATP3/FATP4/FATP5/FATP6 exerts the desired effect on reducing or eliminating signs and/or symptoms of melanoma, ovarian cancer, breast cancer, prostate cancer or renal cell carcinoma. Compounds for use in therapy can be tested in suitable animal model systems including, but not limited to rats, mice, chicken, cows, monkeys, rabbits, and the like, prior to testing in human subjects. Similarly, for in vivo testing, any of the animal model system known in the art can be used prior to administration to human subjects. In some embodiments, in vitro or in vivo testing is directed to the biological function of one or more inhibitors of

FATP1/FATP3/FATP4/FATP5/FATP6.

[00115] Animal models of melanoma, ovaria cancer, breast cancer, prostate cancer or renal cell carcinoma may be generated using techniques known in the art. Such models may be used to demonstrate the biological effect of inhibitors of FATP1/FATP3/FATP4/FATP5/FATP6 in the prevention and treatment of conditions arising from disruption of a particular gene, and for determining what comprises a therapeutically effective amount of the one or more inhibitors of FATP1/FATP3/FATP4/FATP5/FATP6 disclosed herein in a given context.

Modes of Administration and Effective Dosages

[00116] Any method known to those in the art for contacting a cell, organ or tissue with one or more inhibitors of FATP1/FATP3/FATP4/FATP5/FATP6 disclosed herein may be employed. Suitable methods include in vitro , ex vivo, or in vivo methods. In vivo methods typically include the administration of one or more inhibitors of FATPI/FATP3/FATP4/FATP5/FATP6 to a mammal, suitably a human. When used in vivo for therapy, the one or more inhibitors of FATP1/FATP3/FATP4/FATP5/FATP6 described herein are administered to the subject in effective amounts (i.e., amounts that have desired therapeutic effect). The dose and dosage regimen will depend upon the degree of the disease state of the subject, the characteristics of the particular inhibitor of FATP1/FATP3/FATP4/FATP5/FATP6 used, e.g., its therapeutic index, and the subject’s history.

[00117] The effective amount may be determined during pre-clinical trials and clinical trials by methods familiar to physicians and clinicians. An effective amount of one or more inhibitors of FATP 1 /FATP3/FATP4/F ATP5/FATP6 useful in the methods may be administered to a mammal in need thereof by any of a number of well-known methods for administering pharmaceutical compounds. The inhibitors may be administered systemically or locally.

[00118] The one or more inhibitors ofFATPl/FATP3/FATP4/FATP5/FATP6 described herein can be incorporated into pharmaceutical compositions for administration, singly or in combination, to a subject for the treatment or prevention of a disease or condition disclosed herein. Such compositions typically include the active agent and a pharmaceutically acceptable carrier. As used herein the term“pharmaceutically acceptable carrier” includes saline, solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration. Supplementary active compounds can also be incoiporated into the compositions.

[00119] Pharmaceutical compositions are typically formulated to be compatible with its intended route of administration. Examples of routes of administration include parenteral (e.g., intravenous, intradermal, intraperitoneal or subcutaneous), oral, inhalation, transdermal (topical), intraocular, iontophoretic, and transmucosal administration. Solutions or suspensions used for parenteral, intradermal, or subcutaneous application can include the following components: a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerine, propylene glycol or other synthetic solvents; antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid; buffers such as acetates, citrates or phosphates and agents for the adjustment of tonicity such as sodium chloride or dextrose. pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide. The parenteral preparation can be enclosed in ampoules, disposable syringes or multiple dose vials made of glass or plastic. For convenience of the patient or treating physician, the dosing formulation can be provided in a kit containing all necessary equipment (e.g. , vials of drug, vials of diluent, syringes and needles) for a treatment course (e.g., 7 days of treatment).

[00120] Pharmaceutical compositions suitable for injectable use can include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, CREMOPHOR EL™ (BASF, Parsippany, N. J.) or phosphate buffered saline (PBS). In all cases, a composition for parenteral administration must be sterile and should be fluid to the extent that easy syringability exists. It should be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi. [00121] The pharmaceutical compositions having one or more inhibitors of F A T P 1 / F A T P 3 / F A T P4/ F A T P 5 / F A T P 6 disclosed herein can include a carrier, which can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol, and the like), and suitable mixtures thereof.

The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thiomerasol, and the like. Glutathione and other antioxidants can be included to prevent oxidation. In many cases, it will be advantageous to include isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, or sodium chloride in the composition. Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent that delays absorption, for example, aluminum monostearate or gelatin.

[00122] Sterile injectable solutions can be prepared by incorporating the active compound in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle, which contains a basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, typical methods of preparation include vacuum drying and freeze drying, which can yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile-frltered solution thereof.

[00123] Oral compositions generally include an inert diluent or an edible carrier. For the purpose of oral therapeutic administration, the active compound can be incorporated with excipients and used in the form of tablets, troches, or capsules, e.g., gelatin capsules. Oral compositions can also be prepared using a fluid carrier for use as a mouthwash.

Pharmaceutically compatible binding agents, and/or adjuvant materials can be included as part of the composition. The tablets, pills, capsules, troches and the like can contain any of the following ingredients, or compounds of a similar nature: a binder such as microcrystailine cellulose, gum tragacanth or gelatin; an excipient such as starch or lactose, a disintegrating agent such as alginic acid, Primogel, or corn starch; a lubricant such as magnesium stearate or Sterotes; a glidant such as colloidal silicon dioxide; a sweetening agent such as sucrose or saccharin; or a flavoring agent such as peppermint, methyl salicylate, or orange flavoring.

15 [00124] For administration by inhalation, the compounds can be delivered in the form of an aerosol spray from a pressurize container or dispenser, which contains a suitable propellant, e.g. , a gas such as carbon dioxide, or a nebulizer. Such methods include those described in U.S. Pat. No. 5,468,798.

[00125] Systemic administration of a therapeutic compound as described herein can also be by transmucosal or transdermal means. For transmucosal or transdermal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art, and include, for example, for transmucosal administration, detergents, bile salts, and fusidic acid derivatives. Transmucosal administration can be accomplished through the use of nasal sprays. For transdermal administration, the active compounds are formulated into ointments, salves, gels, or creams as generally known in the art. In one embodiment, transdermal administration may be performed by iontophoresis.

[00126] A therapeutic agent can be formulated in a carrier system. The carrier can be a colloidal system. The colloidal system can be a liposome, a phospholipid bilayer vehicle. In one embodiment, the therapeutic agent is encapsulated in a liposome while maintaining the agent’s structural integrity_'. One skilled in the art would appreciate that there are a variety of methods to prepare liposomes. (See Lichtenberg, et al. Methods Biochem. Anal., 33:337-462 (1988);

Anselem, et al, Liposome Technology , CRC Press (1993)). Liposomal formulations can delay' clearance and increase cellular uptake (See Reddy, Ann. Pharmacother., 34(7-8):915-923 (2000)). An active agent can also be loaded into a particle prepared from pharmaceutically acceptable ingredients including, but not limited to, soluble, insoluble, permeable, impermeable, biodegradable or gastroretentive polymers or liposomes. Such particles include, but are not limited to, nanoparticles, biodegradable nanoparticles, microparticles, biodegradable microparticles, nanospheres, biodegradable nanospheres, microspheres, biodegradable microspheres, capsules, emulsions, liposomes, micelles and viral vector systems.

[00127] The carrier can also be a polymer, e.g., a biodegradable, biocompatible polymer matrix. In one embodiment, the therapeutic agent can be embedded in the polymer matrix, while maintaining the agent’s structural integrity. The polymer may be natural, such as polypeptides, proteins or polysaccharides, or synthetic, such as poly a-hydroxy acids. Examples include carriers made of, e.g. , collagen, fibronectin, elastin, cellulose acetate, cellulose nitrate, polysaccharide, fibrin, gelatin, and combinations thereof. In one embodiment, the polymer is poly-lactic acid (PLA) or copoly lactic/glycolic acid (PGLA). The polymeric matrices can be prepared and isolated in a variety of forms and sizes, including microspheres and nanospheres. Polymer formulations can lead to prolonged duration of therapeutic effect. (See Reddy, Ann. Pharmacother. , 34(7-8):915-923 (2000)). A polymer formulation for human growth hormone (hGH) has been used in clinical trials. (See Kozarich and Rich, Chemical Biology’, 2:548-552 (1998)).

[00128] Examples of polymer microsphere sustained release formulations are described in PCT publication WO 99/15154 (Tracy, et al), U.S. Pat. Nos. 5,674,534 and 5,716,644 (both to Zaie, et al). PCT publication WO 96/40073 (Zaie, et al), and PCT publication WO 00/38651 (Shah, et al). U.S. Pat. Nos. 5,674,534 and 5,716,644 and PCT publication WO 96/40073 describe a polymeric matrix containing particles of erythropoietin that are stabilized against aggregation with a salt.

[00129] In some embodiments, the therapeutic compounds are prepared with earners that will protect the therapeutic compounds against rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery' systems. Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and poiylactic acid. Such formulations can be prepared using known techniques. The materials can also be obtained commercially', e.g., from Alza Corporation and Nova Pharmaceuticals, Inc. Liposomal suspensions (including liposomes targeted to specific cells w ith monoclonal antibodies to cell-specific antigens) can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, for example, as described in U.S. Pat. No. 4,522,811.

[00130] The therapeutic compounds can also be formulated to enhance intracellular delivery. For example, liposomal delivery' systems are known in the art, see, e.g. , Chonn and Cullis, “Recent Advances in Liposome Drug Delivery Systems,” Current Opinion in Biotechnology 6:698-708 (1995); Wei tier,“Liposomes for Protein Delivery': Selecting Manufacture and Development Processes,” Immunomethods , 4(3):201-9 (1994); and Gregoriadis,“Engineering Liposomes for Drug Delivery: Progress and Problems,” Trends Biotechnol, 13(12):527-37 (1995). Mizguchi, et al , Cancer Lett., 100:63-69 (1996), describes the use of fusogenic liposomes to deliver a protein to cells both in vivo and in vitro.

[00131] Dosage, toxicity and therapeutic efficacy of any therapeutic agent can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the LD50 (the dose lethal to 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD50/ED50. Compounds that exhibit high therapeutic indices are advantageous. WTiile compounds that exhibit toxic side effects may be used, care should be taken to design a delivery system that targets such compounds to the site of affected tissue in order to minimize potential damage to uninfected cells and, thereby, reduce side effects.

[00132] The data obtained from the cell culture assays and animal studies can be used in formulating a range of dosage for use in humans. The dosage of such compounds may be within a range of circulating concentrations that include the ED50 with little or no toxicity. The dosage may vary within this range depending upon the dosage form employed and the route of administration utilized. For any compound used in the methods, the therapeutically effective dose can be estimated initially from cell culture assays. A dose can be formulated in animal models to achieve a circulating plasma concentration range that includes the IC50 (i.e., the concentration of the test compound which achieves a half-maximal inhibition of symptoms) as determined in cell culture. Such information can be used to determine useful doses in humans accurately. Levels in plasma may be measured, for example, by high performance liquid chromatography.

[00133] Typically, an effective amount of the one or more inhibitors of

FATP1/FATP3/FATP4/FATP5/FATP6 disclosed herein sufficient for achieving a therapeutic or prophylactic effect, range from about 0.000001 mg per kilogram body weight per day to about 10,000 mg per kilogram body weight per day. Suitably, the dosage ranges are from about 0.0001 mg per kilogram body weight per day to about 100 mg per kilogram body weight per day. For example dosages can be 1 mg/kg body weight or 10 mg/kg body weight every day, every two days or every three days or within the range of 1-10 mg/kg every week, every two weeks or every three weeks. In one embodiment, a single dosage of the therapeutic compound ranges from 0.001-10,000 micrograms per kg body weight. In one embodiment, one or more

FATP1/FATP3/FATP4/FATP5/FATP6 inhibitor concentrations in a carrier range from 0.2 to 2000 micrograms per delivered milliliter. An exemplary treatment regime entails administration once per day or once a week. In therapeutic applications, a relatively high dosage at relatively short interv als is sometimes required until progression of the disease is reduced or terminated, or until the subject shows partial or complete amelioration of symptoms of disease. Thereafter, the patient can be administered a prophylactic regime.

[00134] In some embodiments, a therapeutically effective amount of one or more inhibitors of FATP1/FATP3/FATP4/FATP5/FATP6 may be defined as a concentration of inhibitor at the target tissue of 10 ³² to 10 ⁶ molar, e.g., approximately 10 ⁷ molar. This concentration may be delivered by systemic doses of 0.001 to 100 mg/kg or equivalent dose by body surface area. The schedule of doses would be optimized to maintain the therapeutic concentration at the target tissue, such as by single daily or weekly administration, but also including continuous administration (e.g. , parenteral infusion or transdermal application).

[00135] The skilled artisan will appreciate that certain factors may influence the dosage and timing required to effectively treat a subject, including but not limited to, the severity of the disease or disorder, previous treatments, the general health and/or age of the subject, and other diseases present. Moreover, treatment of a subject with a therapeutically effective amount of the therapeutic compositions described herein can include a single treatment or a series of treatments.

[00136] The mammal treated in accordance with the present methods can be any mammal, including, for example, farm animals, such as sheep, pigs, cows, and horses; pet animals, such as dogs and cats; laboratory animals, such as rats, mice and rabbits. In some embodiments, the mammal is a human.

Combination Therapy

[00137] In some embodiments, one or more inhibitors of

FATP1/FATP3/FATP4/FATP5/FATP6 disclosed herein may be combined with one or more additional therapies for the prevention or treatment of a disease or condition disclosed herein (e.g., melanoma, ovarian cancer, breast cancer, prostate cancer or renal cell carcinoma).

Additional therapeutic agents include, but are not limited to, BRAl· inhibitors, and

RAF/MEK/ERK inhibitors, anti-CTLA4 agents, and anti-PDl/anti-PDLl agents.

[00138] Examples of BRAF inhibitors include, but are not limited to GDC-0879, SB590885, Encorafenib, RAF265, TAK-632, PLX4720, CEP-32496, AZ628, Sorafenib Tosylate, Sorafenib, Vemurafenib (Zelboraf) and Dabrafenib (GSK2118436).

[00139] Examples of RAF/MEKERK inhibitors include, but are not limited to Vemurafenib (Zelboraf) and Dabrafenib (GSK21 18436), Encorafenib, TAK-632, PLX4720, MLN2480, Cobimetinib (GDC-0973), MEK 162, R05126766, GDC-0623, VTXl le, Selumetinib

(AZD6244), PD0325901 , Trametinib (GSK1 120212), U0126-EtOH, PD184352 (CI-1040), Refametinib, PD98059, BIX02189, Binimetinib, Pimasertib (AS-703026), SL327, BIX02188, AZD8330, TAK-733, PD318088, SCH772984, and FR 180204.

[00140] Examples of anti-CTLA4 agents include, but are not limited to, ipilimumab ( a.k.a .,

MDX-010, MDX-CTLA-4, MDX-101 and BMS-734016), or tremelimumab (a.k.a., ticilimumab or CP-675,206).

[00141] Examples of anti-PDl/anti-PDLl agents include, but are not limited to, MEDI4736, nivolumab (a.k.a., Opdivo^®, BMS-936558, MDX1106), durvalumab (MEDI4736), pembrolizumab (a.ka, Keytruda^® MK-3475, or lambrolizumab), pidilizumab (CT-011), AMP- 224, AMP-514 (MEDI0680), PDR001, BMS-936559 (MDX1105), atczolizumab (Tecentriq^®) MPDL3280A), and avelumab (MSB0010718C).

[00142] In some embodiments, the one or more inhibitors of

FATP1/FATP3/FATP4/FATP5/FATP6 disclosed herein may be separately, sequentially or simultaneously administered with at least one additional therapeutic agent selected from the group consisting of GDC-0879, SB590885, Encorafenib, RAF265, TAK-632, PLX472Q, CEP- 32496, AZ628, Sorafenib Tosylate, Sorafenib, Vemurafenib (Zelboraf) and Dabrafenib

(GSK2118436), MLN2480, Cobimetinib (GDC-0973), MEK 162, RG5126766, GDC -0623, VTXl le, Selumetinib (AZD6244), PD0325901 , Trametinib (GSKI 120212), U0126-EtOH,

PD 184352 (Cl- 1040), Refametinib, PD98059, BIX02189, Binimetinib, Pimasertib (AS-703026), SL327, BIX02188, AZD8330, TAK-733, PD318088, SCH772984, FR 180204, ipilimumab, tremelimumab, MED14736, nivoiumab. durvalumab, pembrolizumab, pidilizumab (CT-011), AMP-224, AMP-514 (MEDI0680), PDR001, BMS-936559 (MDX1 105), atczolizumab

(Tecentriq^®, MPDL3280A), and avelumab (MSB0010718C).

[00143] In certain embodiments, an additional therapeutic agent is administered to a subject in combination with the one or more inhibitors of FATP1/FATP3/FATP4/FATP5/FATP6 disclosed herein such that a synergistic therapeutic effect is produced. For example, administration of one or more inhibitors of FATP1/FATP3/FATP4/FATP5/FATP6 with one or more additional therapeutic agents for the prevention or treatment of melanoma will have greater than additive effects in the prevention or treatment of the disease. For example, lower doses of one or more of the therapeutic agents may be used in treating or preventing melanoma resulting in increased therapeutic efficacy and decreased side-effects. In some embodiments, the one or more inhibitors of FATP1/FATP3/FATP4/FATP5/FATP6 disclosed herein are administered in combination with any of the at least one additional therapeutic agents described above, such that a synergistic effect in the prevention or treatment of melanoma results.

[00144] In any case, the multiple therapeutic agents may be administered in any order or even simultaneously. If simultaneously, the multiple therapeutic agents may be provided in a single, unified form, or in multiple forms (by way of example only, either as a single pill or as two separate pills). One of the therapeutic agents may be given in multiple doses, or both may be given as multiple doses. If not simultaneous, the timing between the multiple doses may vary from more than zero weeks to less than four weeks. In addition, the combination methods, compositions and formulations are not to be limited to the use of only tw o agents. Kits

[00145] The present disclosure also provides kits for the treatment of melanoma, ovarian cancer, breast cancer, prostate cancer or renal cell carcinoma comprising one or more inhibitory RNAs comprising a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1- 4 and/or Lipofermata. Optionally, the above described components of the kits of the present technology are packed in suitable containers and labeled for the prognosis of melanoma.

[00146] The above-mentioned components may be stored in unit or multi-dose containers, for example, sealed ampoules, vials, bottles, syringes, and test tubes, as an aqueous, preferably sterile, solution or as a lyophilized, preferably sterile, formulation for reconstitution. The kit may further comprise a second container which holds a diluent suitable for diluting the pharmaceutical composition towards a higher volume. Suitable diluents include, but are not limited to, the pharmaceutically acceptable excipient of the pharmaceutical composition and a saline solution. Furthermore, the kit may comprise instructions for diluting the pharmaceutical composition and/or instructions for administering the pharmaceutical composition, whether diluted or not. The containers may be formed from a variety of materials such as glass or plastic and may have a sterile access port (for example, the container may be an intravenous solution bag or a vial having a stopper which may be pierced by a hypodermic injection needle). The kit may further comprise more containers comprising a pharmaceutically acceptable buffer, such as phosphate-buffered saline, Ringer's solution and dextrose solution. It may further include other materials desirable from a commercial and user standpoint, including other buffers, diluents, filters, needles, syringes, culture medium for one or more of the suitable hosts. The kits may optionally include instructions customarily included in commercial packages of therapeutic or diagnostic products, that contain information about, for example, the indications, usage, dosage, manufacture, administration, contraindications and/or warnings concerning the use of such therapeutic or diagnostic products.

[00147] The kit can also comprise, e.g., a buffering agent, a preservative or a stabilizing agent. The kit can also contain a control sample or a series of control samples, which can be assayed and compared to the test sample. Each component of the kit can be enclosed within an individual container and all of the various containers can be within a single package, along with instructions for interpreting the results of the assays performed using the kit. The kits of the present technology may contain a written product on or in the kit container. The written product describes how to use the reagents contained in the kit. In certain embodiments, the use of the reagents can be according to the methods of the present technology. EXAMPLES

[00148] The present technology is further illustrated by the following Examples, which should not be construed as limiting in any way. The following Examples demonstrate the preparation, characterization, and use of illustrative compositions of the present technology that inhibit the FATP1, FATP3, FATP4, FATP5, and''or FATP6 transporter protein.

Example 1: Experimental Materials and Methods

[00149] Animal Husbandry. All zebrafish were housed in a temperature (28.5 °C) and light- controlled (14h on, lOh off) room. Fish were initially housed at a density of 5-10 fish per liter, and fed 3 times per day using brine shrimp and pelleted zebrafish food. After transplantation, the fish were housed in individual chambers for serial imaging. All anesthesia was done using Tricaine (Western Chemical Incorporated, Ferndale WA) with a stock of 4g/L (protected for light), which was diluted until the fish was immobilized.

[00150] ZMEL1-GFP Adult Transplants. Adult casper fish between 4-9 months old were anesthesized with Tricaine and transplanted with 5 x I0⁵ ZMEL1 cells suspended in 3 pi PBS in the subcutaneous tissue directly before the anal fin on the lateral side of the fish using a

Hamilton 26s gauge, bevel tip syringe (Sigma, St. Louis MO). After the transplant procedure, the fish were returned to water to recover and maintained on system for indicated times.

[00151] 3T3L1 Maintenance and Differentiation into Adipocytes . 3T3L1 cells were obtained from Zen-Bio Inc.(Researeh Triangle Park, NC) and culture and differentiation were performed according to manufacturer’s instructions. Briefly, cells were grown on various culture dishes until 2 days post-100% confluency in preadipocyte media (Zen-Bio Inc., Research Triangle Park, NC). At 2 days post confluency, media was changed to differentiation medium (Zen-Bio Inc., Research Triangle Park, NC) and incubated for 5 days. Ceils were then maintained in their adipocytic, differentiated state with maintenance media (Zen-Bio Inc., Research Triangle Park, NC). Adipocyte maintenance media (Zen-Bio Inc., Research Triangle Park, NC) was used for all co-culture experiments.

[00152] Quantitative RT-PCR. Total RNA was isolated directly from cultured cells using the Quick-RNA Miniprep Kit (Zymo Research, Inane, CA). Reverse transcription w'as performed with Superscript III First-Strand Synthesis System (Thermo-Fisher Scientific, Waltham, MA). Spliced XBP1 mRNA levels were measured with 5’-CTGAGTCCGAATCAGGTGCAG-3’

(SEQ ID NO: 5) and 5 -A T CC AT GGGG AG ATGTTCTGG- 3 ^' (SEQ ID NO: 6) primers using the iQ SYBR Green Supermix (Biorad, Hercules, CA) on a BioRad CFX384-Touch System (BioRad, Hercules, CA). Relative expression levels w'ere normalized to beta-actin. [00153] I. ive Staining and Imaging ofZehrafish with BODIPY. To image melanoma lipids in vivo, fish bearing ZMELl-GFP tumors were stained with BODIPY as previously described (Minchin J. et al. , Methods Ceil Biol. 105: 63-86 (201 1)}. Briefly, at 21 days post transplant (DPT) fish were stained with BODIPY 558/568 at a working concentration of 2 pg/mL in fish water for 1 hour in the dark. Fish were rinsed briefly in fresh fish water, then placed on system with running water for 2 hours. After staining, fish were anesthetized with Tricaine and placed onto a petri dish. The fish were imaged from above using a Zeiss Axio Zoom VI 6 Fluorescence Stereo Zoom Microscope with a 0.6x or 1 6> adjustable objective lens. Each fish was successively imaged using brightfield, GFP, and tdTomato filter sets on both sides.

[00154] LipidTOX Staining and Quantification. To measure total lipid content in ZMEL 1 -

GFP cells in vivo , fish were transplanted as described herein and then allowed to grow to 5 or 21DPT. ZMELl-GFP cells were then FACS isolated. To measure total lipid content in melanoma cells after co-culture, GFP⁺ human and fish melanoma cells were cultured with 3T3L1 adipocytes for 7 days, and then FACS-isolated. Post-FACS, cells in all conditions were washed l x with PBS, then stained with LipidTOX-red (Invitrogen) at a 1: 125 dilution in DMEM-10 for 30 min at room temperature protected from light. Cells were washed 2x with PBS, then diluted to similar concentrations in PBS and mounted in a disposable hemocytometer for imaging. >10 fields per condition were imaged with a Zeiss Axiolmager with a 20x fixed objective in the GFP and mCherry channels. Signal intensity' of Lipi dTOX-RED was measured in each field in GFP cells.

[00155] Transmission Electron Microscopy. For human cell lines, FACS-isolated melanoma cells wore grown in co-culture with 3T3L1 adipocytes for 7 days using 4% paraformaldehyde, 2.5% glutaraldehyde, 0.002% picric acid in 0.1M sodium cacodylate buffer, pH 7.3 for transmission electron microscopy (12000-15000x). For EM in fish, ZMELl-GFP cells wore transplanted into adult casper fish and grown until 21 DPT, when they wore sacrificed in an ice bath. Tumors were resected from the fish and fixed in fix solution described herein, and then processed for imaging. Imaging was performed on the JEOL JSM 1400, operated at lOOKv. Images wore captured on a Veleta 2K x2K Ccd camera (EM-SIS). Quantification of lipid droplet number and size were performed using ImageJ software with 10 cells/condition.

[00156] Proliferation Assays. To measure cell proliferation after Lipofermata (ChemBridge Corp., San Diego, CA; MolPort, Riga, Latvia) treatment SKMEL28, A375 and ZMELl ceils were plated at a density of 4,000-20,000 cells per well in a 96 woll plate in lOOpL of DMEM/10. Cells wore allowod to adhere for 24 hours, and then media changed to fresh media containing either DMSO or Lipofermata at the indicated doses. The final concentration of all wells contained equivalent amounts of DMSO solvent (1%). After 48 hours of Lipofermata treatment. Cell Titer Glo reagent (Promega, Madison WI) was added to cells per manufacturer’s instructions and luminescence was read using a BioTek Synergy 96-well plate reader. All values were normalized to the DMSO control well, and done in triplicate for all cell lines.

[00157] For phospho-Histone H3 staining, 3T3L1 cells were seeded and differentiated onto 4- or 8-well MilliCell slides (EMD Millipore, Billerica, MA). Once 3T3L1 cells were fully differentiated into adipocytes, 10,000-20,000 A375-GFP or SKMEL28-GFP cells were plated in either DMEM-10 or DMEM-0 media. Cells were fixed in fresh 4% paraformaldehyde and stained with a phopho-Histone H3 primary antibody (1 : 1000, EMD Millipore, Billerica, MA) and AlexaFluor-594-conjugated anti-mouse secondary antibody (1 :1000, Thermo Fisher Scientific, Waltham, MA). Slides were imaged on an Zeiss Axiolmager inverted widefield fluorescence microscope. More than 10 images were acquired for all conditions. The number of mitotic cells were quantified by calculating double-positive cells (GFP ^: , AlexaFluor594⁺) as a fraction of the total number of GFP⁺ cells in each field.

[00158] Lipid Uptake Assays. SKMEL28, A375 and ZMEL1 cells were seeded at a density of 10,000-20,000 cells per well in a 96-well plate in 100 pL DMEM-10 Cells were allowed to adhere and grow to 95-100% confluence for 2 days. To test the effect of Lipofermata, cells were starved for 1 hour in DMEM-0. After 1 hour, media was removed and replaced with fresh DMEM- 10 media with either DMSO or Lipofermata at the indicated doses. After treatment for one hour, fatty acid transport kinetics were evaluated via the method outlined by C. Ahowesso et ah, Biochem Pharmacol. 98: 167-181 (2015)). Briefly, after 1 hour of Lipofermata treatment C1-BODIPY-C12 uptake was measured using a BioTek Synergy plate reader immediately after adding the C1-BODIPY-C12 substrate to cells. Die substrate was presented to the cells as a complex with fatty acid-free BSA to give BODIPY-FA to BSA ratios of 4: 1 (100 mM Cl- BODIPY-C12 and 5 mM BSA). Non-cell associated fluorescence was quenched with trypan blue. Uptake w^ras measured at 485 nm excitation and 528 nm emission. For the timed measurement of fatty acid uptake in FATP-overexpressing and FATP CR1SPR cells, cells were seeded into 96-well plates and grown as described above. Lipid uptake was measured with the QBT Fatty Acid Uptake Assay (Molecular Devices, Sunnyvale, CA) using the BioTek Synergy plate reader. Fluorescence at 485 nm excitation and 528 nm emission was measured every 50 seconds for 1-2 hours. For the timed measurement of fatty acid uptake in FATP-overexpressing treated with Lipofermata, cells were seeded into 96-w'ell plates and grown as described above.

To test the effect of Lipofermata, cells were starved for 1 hour in fresh DMEM-10 with either DMSO or Lipofermata at the indicated doses. After treatment, lipid uptake was measured with the QBT Fatty Acid Uptake Assay (Molecular Devices, Sunnyvale, CA) every 50 seconds for 1- 2 hours.

[00159] Lipid Transfer Experiments. 3T3L1 cells were seeded onto 4-well EZ MilliCell slides (EMD Millipore, Billerica, MA) and differentiated according to manufacturer’s instructions (Zen-Bio Inc., Research Triangle Park, NC). Lipids in adipocytes were labeled with 5 mM BODIPY 558/568 C-12 in adipocyte maintenance media (Zen-Bio Inc., Research Triangle Park, NC) for 4 hours. After 4 hours, extracellular BODIPY was removed from the cells by washing three times with lx Hank’s balanced salt solution (HBSS) with 0.2% faty-acid free BSA. After washing, GFP human and zebrafish melanoma cells were seeded on top of labeled adipocytes for 24 hours. Cells were then fixed and imaged on a Zeiss Axiolmager, here BODIPY -laden GFP melanoma cells could be observed. To test wliether lipid transfer required direct cell-cell contact and the effect of Lipofermata on lipid uptake, 3T3L1 cells were grown and differentiated on the top chamber of a transwell system (Coming Inc., Coming, NY) and labeled with BODIPY as described herein. In a separate well, GFP ^: melanoma cells were plated onto a 12 nun circular coverslip in a separate well and allowed to adhere. After 4 hours of BODIPY labeling, 3T3L1 adipocytes were washed as described above and the tran swells containing BODIPY-labeled adipocytes were transferred to wells containing GFP⁺ melanoma cells on a coverslip. The melanoma cells on the bottom of the well on a coverslip were co cultured with the adipocytes on the top, separated by the transwell, for 24 hours, in either the presence of 2.5mM Lipofermata or DMSO. Melanoma cells were then fixed and mounted onto slides. Slides were imaged on an Zeiss Axiolmager inverted widefield fluorescence microscope. More than 10 images were acquired for all conditions. Quantification of BODIPY in melanoma cells was performed using ImageJ software by calculating the total fluorescence intensity in GFP cells in control versus Lipofermata-treated samples.

[00160] RNA-seq of ZMEL1. The zebrafish ZMEL1 data was adapted from our previous publication ( Kim et al., Nat. Commun. 8: 14343 (2017)). Total RNA was isolated using the Zymo RNA isolation kit (Zymo Research, Irvine, CA) after FACS sorting. Because the amount of starting material was limited, RNA was amplified using the NuGEN RNA kit (NuGEN Technologies, San Carlos, CA), after which the samples were sequenced on an Illumina HiSeq2500. Samples were sequenced using the HiSeq2500 with approximately 20 million reads per sample, using 50bp single end reads. Reads from each RNA-Seq run were mapped to the zebrafish reference genome version danRer? from the UCSC Genome Browser using GSNAP and quantified on the gene level using HTSeq and Ensembl version 75. Differential expression analysis was performed using DESeq2. The zebrafish gene symbols were mapped to their human orthologs using the DIOPT tool (Harvard Medical School, Boston, MA). Genes with a corrected p value of less than 0.05 were considered significant. To generate heatmaps, Log- transformed normalized counts were generated using the“rlog” transformation in the R package DESeq2 and plotted as mean-subtractecl values for each gene using MATLAB (MathWorks, Natick, MA). Pathway analysis was done using Ingenuity Pathway Analysis software (Qiagen, Hilden, Germany) using log2FC and FDR<0.05.

[00161] RNA-seq of A375 Cells. A375-GFP cells were either grown in monoculture or in co- culture with 3T3L1 adipocytes for 7 days in adipocyte maintenance medium (Zen-Bio Inc., Research Triangle Park, NC). Melanoma cells were then FACS isolated and processed for RNA sequencing. Total RNA was isolated using the Zymo RNA kit (Zymo Research, Irvine, CA), and used for cDNA synthesis and barcoding with Illumina adapters, followed by Sequencing on the Illumina HiSeq2500. RNA-seq reads were mapped to a concatenated human (hg 19) and mouse (mm 10) genome. This approach was used to filter out any contaminating mouse reads from the co-culture setting. The combined mapping was performed with STAR (v2.5.0a) using default parameters and the parameter outFilterMismatchNmax 0”. Gene counts were assessed using the quantMode GeneCounts” parameter in STAR with a custom gff file combining the mmiO and hgl9 genomes. The subsequent count matrix was subset for human genes, and used as an input for the R package DESeq2 for normalization and differential gene expression.

Default parameters were used in DESeq2 and differentially expressed genes were called using a base mean of 15, log2 fold change of ± 1 and a false discovery rate (FDR) of 5%. Volcano plots were generated with the R package‘ggplot2’ and the heatmap in Figure 3E was generated using the package‘pheatmap.’

[00162] Gene Set Enrichment Analysis. Because GSEA is not optimized for RNA-seq data, we used the alternative GSAA software package GSAASeqSP. Human gene symbols, along with normalized read counts, were used as input, along with the gene sets obtained either from the Broad MSigDB Hallmarks dataset or from the Hoek ( Cancer Res. 68: 650-656 (2008)) or Aerts ( Nat Commiin . 6:6683 (2015)) invasive/proliferative gene signature. Each of these genesets were run across the human datasets using the default parameters, and output and normalized enrichment scores obtained directly from the GSAA package.

[00163] Lipidomics. For human melanoma lipidomics, A375-GFP ceils were either grown in monoculture or in co-culture with 3T3L1 adipocytes for 7 days in adipocyte maintenance medium (Zen-Bio Inc., Research Triangle Park, NC). Melanoma cells were then FACS isolated and processed for lipidomics. For i vivo lipidomics on fish melanoma cells, ZMEL1-GFP cells were transplanted into adult Casper zebrafish and grown for 21 days, when tumor-bearing fish were sacrificed and ZMEL1-GFP cells were FACS isolated and processed for lipidomies.

[00164] Global lipidomic profiling was performed by Metabolon (Morrisvilie, NC). Lipids were extracted from samples using dichloromethane and methanol in a modified Bligh-Dyer extraction in the presence of internal standards with the lower, organic, phase being used for analysis. The extracts were concentrated under nitrogen and reconstituted in 0.25 mL of dichloromethane.methanol (50:50) containing lOmM ammonium acetate. The extracts were placed in vials for infusion-MS analyses, performed on a SelexION equipped Sciex 5500 QTRAP using both positive and negative mode electrospray. Each sample was subjected to 2 analyses, with IMS-MS conditions optimized for lipid classes monitored in each analysis. The 5500 QTRAP was operated in MRM mode to monitor the transitions for over 1 ,100 lipids from up to 14 lipid classes. Individual lipid species were quantified based on the ratio of signal intensity for target compounds to the signal intensity for an assigned internal standard of known concentration. Lipid class concentrations were calculated from the sum of all molecular species within a class, and fatty acid compositions were determined by calculating the proportion of individual fatty acids within each class. Fold-change compared to the control situation was calculated by dividing the average of the (experimental/control) value, and statistical differences analyzed using a two-tailed unpaired T-test.

[00165] Gelatin Degradation Assays Coverslips were coated with Alexa 546-gelatin (Img/ml), crosslinked with 0.5% glutaraldehyde (Sigma, St. Louis, MO), and washed three times with IX sterile PBS. A layer of collagen I (0.5 mg/ml) was polymerized on top of the gelatin matrix, 4 hrs at 37°C. A375-GFP were starved 4hrs before seeding on matrix with DMEM 4.5g glucose L-glutamine, 0.8% BSA and 0.5% FBS. Conditioned media from adipocytes cultivated 24 hrs in serum free maintenance media (Zen-Bio Inc., Research Triangle Park, NC) supplemented with 0.8% BSA and 0.5% FBS was collected and centrifuged for 5 min at 1000 xg to remove cells debris. 30,000 melanoma cells were seeded on coated coverslips and incubated with adipocyte starvation media or conditioned media or 30,000 adipocytes overnight, before fixation and staining. To test Lipofermata effect on matrix degradation, melanoma cells were seeded on the matrix as previously described herein for 4 hrs before adding DMSO or 1.5mM Lipofermata and incubated overnight before fixation and staining. Coverslips were stained for DAPI to localize adipocytes. Microscopy was performed on LEICA DM5500 B with a LEICA DFC345 FX camera and a 100X oil objective. Matrix degradation was quantified with Image! software as previously described in A. Juin et al, J Cell Biol. 207:517-533 (2014). [00166] For ZMEL1 gelatin degradation assay, cells were grown in monoculture or in coculture with 3T3L1 adipocytes for 7 days in adipocyte maintenance media (Zen-Bio Inc., Research Triangle Park, NC), then FACS- isolated for GFP and plated onto gelatin-Cy3-coated coverslips crossiinked with 0.5% glutaraldehyde supplied in the QCM Gelatin Degradation Assay Kit (EMD Millipore, Billerica, MA) and incubated for 24 hours in DMEM-10 before fixation and staining.

[00167] Extracellular Flux Analysis of Melanoma Cells. Mitochondrial function of melanoma cells previously co-cultured with adipocytes for 7 days was determined through real-time measurement of the oxygen consumption rate (OCR) and extracellular acidification rate (ECAR) using the XF96 Extracellular Flux Analyzer (Seahorse Bioscience, North Billerica, MA), according to the manufacturer’s instructions. Briefly, FACS-isolated melanoma cells were seeded into XFp 96-well microplate wells at a density of 40,000 cells/well and incubated overnight to allow the cells to adhere. For measurement of OCR and ECAR, assay medium was supplemented with 2.5M glucose, 1 mM pyruvate and 1 mM glutamine. OCR and ECAR was quantified following consecutive treatment of melanoma cells with four treatments: (1) assay medium alone, (2) 2 mM oligomycin, (3 ) 1 uM FCCP and (4) 5 mM rotenone and antimycin A. For measurement of ECAR, assay medium w as supplemented with Glutamine (1 mM). For each assay, four individual basal measurements were taken, followed by consecutive injection of treatments. Three measurements were recorded after each injection, with each measurement consisting of 10 s mixing and 3 min measurement period.

[00168] IHC and Oil Red O for cr_\>opreser\>ed tumors and PDXs. Fresh tumors or patient- derived xenograft tumor samples were obtained in PBS and immediately frozen in OCT in cryomolds. Serial 4 pm sections from each sample w ere cut using a cryostat (Leica Biosystems, Wetzlar, Germany). Immunohistochemistry was performed by HistoWiz Inc. (Brooklyn, NY) on a Bond Rx autostainer (Leica Biosystems, Wetzlar, Germany). Each sample was stained for Oil Red O, FATP1 (1 : 100, Biorbyt, Cambridge UK), and FATP5 (1 :200, Abeam, Cambridge, MA and Thermo Fisher Scientific, Waltham, MA). All primary antibodies were detected using Polymer- HRP followed by DAB. Ail the sections were then counterstained with hematoxycilin, dehydrated and film-coverslipped using a TissueTek-Prisma and Coverslipper (Sakura, Leiden, Netherlands). Whole slide scanning (40x) was performed on an Aperio AT2 (Leica Biosystems, Wetzlar, Germany).

[00169] IHC on Tumor Microarrays. Tumor microarrays (TMAs) were obtained from the MSKCC TMA Database and US Biomax (Rockwille, MD). Immunohistochemistry was performed by HistoWiz Inc. (Brooklyn, NY) on a Bond Rx autostainer (Leica Biosystems, Wetzlar, Germany). Each sample was stained for FATP1 (1 :100, Biorbyt, Cambridge UK), and FATP5 (1:500, Abeam, Cambridge, MA and Thermo Fisher Scientific, Waltham, MA). Primary antibodies were detected using Poiymer-HRP followed by AP. All the sections were then counterstained, dehydrated, film-coverslipped and scanned as described herein.

[00170] TMA and PDX Scoring. FATP1 and FATP5 staining was quantified by evaluating staining intensity (0-3 scale) and % positive cells (1 : 1-24%, 2:25-49%, 3:50-74%, 4:75-100%). The two values were multiplied together to obtain an integrated score ranging from 0 to 12.

Each sample received a final score (depicted in Figure 3A) based on the integrated score. Final scores reflect integrated scores as follows:

[00171] 0=integrated score 0;

[00172] 1= integrated score 1-3

[00173] 2= integrated score 4-7

[00174] 4= integrated score 8-12

[00175] C ^'aspase 3/7 Assay. Cells were plated onto 96-well plates at a seeding density of

20,000 eeils/well and grown for 2 days until confluent. 1.5mM, 5mM and 10mM Lipofermata or DMSO was added to cells for 24 hours. Caspase 3/7 reagent (Promega, Madison, WI) was then added to cells and luminescence was read out on a Synergy HI plate reader according to manufacturer’s instructions.

[00176] Generation of FATP-overexpressing Cell Lines. A375 -FATP 1 -mCherry, A375- FATP5-mCherry and A375-mCherry cells were generated via viral transduction. To generate lentiviruses, viral expression plasmids containing CMV-FATPl -mCherry or FATP5-mCherry fusion or CMV -mCherry alone were transfected into HEK293T cells at 90% confluency in 10 cm dishes along with pMDG2 and psPAX2 packaging plasmids using Lipofectamine 2000. 6 hours after transfection, the media was replaced with 6 mL of DMEM-30. Virus-containing supernatants were collected 24 hours later and passed through a 0.45-j.mi filter to eliminate cells and debris. A375 cells at 80% confluency in 6- well plates in the presence of 1 pg/mL polybrene (EMD Millipore, Billerica, MA) were infected with 100 pL virus in a total of 1 mL media volume. 24 hours after transduction, virus-containing media was removed and cells were maintained for two passages. mCherry positive cells were selected using FACS with the same gates to ensure similar mCherry expression.

[00177] Generation of FATP CRISPR Knockout Cells. Two sgRNA expression constructs were generated for each FATP. Oligonucleotides for top and bottom strands of the sgRNA w¾re phosphorylated with T4 PNK (NEB, Ipswich, MA), annealed, and then cloned into the dual Cas9/sgRNA expression vector pSpCas9n(BB)-2A-GFP (Add gene, Cambridge, MA). Validated expression constructs were transfected into A375 cells with Lipofectamine 2000 (Thermo Fisher Scientific, Waltham MA). GFP cells were FACS isolated and plated as single cells into 96- well plates to generate single cell clones. To identify clones that were successfully edited, genomic DNA was isolated from each clone and the genomic region targeted by each sgRNA was amplified via PCR, cloned into pCRII-TOPO via TOPO-TA cloning (Thermo Fisher Scientific, Waltham, MA), and then Sanger sequenced. Two cell lines each were identified for FATP1 and FATP5, both with insertions or deletions near the predicted PAM site that lead to frame-shift mutations.

[00178] Transwell Migration Assay. 10,000 A375 control, FATP1 sgRNAl, FATP1 sgRNA2, FATP5 sgRNAl and FATP5 sgRNA2 cells were seeded in triplicate into a 6.5 mm, 0.8 pm pore Transwell insert (Coming, Corning, NY) in a well of a 24- ell plate containing 600 pL of DMEM10. After 24 hours, cells remaining on the top layer of the transwell were brushed away with a cotton swab. The cells remaining on the underside of the transwell were stained with Hoescht 33342 (Thermo Fisher Scientific, Waltham, MA), imaged and quantified.

[00179] GRP78 Western Blot after Treatment with Fatty Acids. A375 cells were treated with isopropanol (vehicle control), or 0.25mM or 0.5mM of palmitic or stearic acid. After 24 hours, cells were pelleted after trypsinizing, washed 1 x with PBS then lysed in RIPA buffer containing 1 x HALT protease inhibitor (Thermo Fisher Scientific, Waltham, MA) for 30 min at 4°C. Cell lysates were clarified by centrifugation at 21,000 xg for 15 min at 4°C. Protein concentration w¾s measured with Bradford reagent and resolved by 4-15% SDS-PAGE gels. ECL Prime (Amersham, GE Healthcare Life Sciences, Chicago, IL) was used as the developing agent.

[00180] AXL Immunofluorescence . 20,000 A375 cells were seeded onto each well of an 8- well EZ MilliCell slide (EMD Millipore, Billerica, MA) and were allowed to attach overnight. The next day, cells were treated with vehicle (100% isopropanol) or 0.25mM stearic acid in DMEM containing 10% FBS and 1% fatty acid free BSA. After 24 hours of treatment, cells were fixed with 4% paraformaldehyde and stained with an antibody against AXL (1 : 100, Cell Signaling Technology, Danvers, MA) and AlexaFluor-488-conj ugated anti-rabbit secondary antibody (1 :500, Thermo Fisher Scientific, Waltham, MA). Nuclei were also stained with Floescht 33342 (Thermo Fisher Scientific, Waltham, MA). Slides were imaged on an Zeiss Axiolmager inverted widefieid fluorescence microscope. For each experiment, >10 images were acquired for each condition. The number of cells expressing high levels of AXL was quantified by calculating the number of AlexaFluor488⁺ cells with a signal intensity above a preset threshold as a fraction of the total number of cells in each field.

[00181] CHOP Immunofluorescence (IF) after Treatment with Adipocyte-conditioned Media. 5,000 A375 cells were seeded onto each well of an 4-well EZ MilliCell slide (EMD Millipore, Billerica, MA) and allowed to attach overnight. The next day, media was replaced with adipocyte conditioned maintenance media or control media. Media was changed every_' 3 days and cells were allowed to grow for 7 days. After 7 days, cells were fixed with 4%

paraformaldehyde and stained with an antibody against CHOP (1 :500, Cell Signaling

Technology, Danvers, MA) and AlexaFluor-488-conjugated anti-mouse secondary antibody (1 : 1000, Thermo Fisher Scientific, Waltham, MA). Nuclei were also stained with Hoescht 33342 (Thermo Fisher Scientific, Waltham, MA). Slides were imaged on an Zeiss Axiolmager inverted widefield fluorescence microscope. For each experiment, >10 images were acquired. Nuclei were identified with through Hoescht staining and used as a mask to measure nuclear CHOP signal intensity in the field.

[00182] CHOP IF after Treatment with Fatty Acids. 20,000 A375 cells were seeded onto each well of an 8-well EZ MilliCell slide (EMD Millipore, Billerica, MA) and allowed to attach overnight. The next day, cells were treated with vehicle (100% isopropanol) or 0.25mM stearic acid alone, 0.25mM oleic acid alone, 0.25mM stearic acid and 0.25mM oleic acid in DMEM containing 10% FBS and 1% fatty_' acid free BSA. After 24 hours, cells were fixed with 4% paraformaldehyde and stained and analysed as detailed above. [00183] Statistical Analysis and Data Reproducibility·. All statistical analysis was performed using GraphPad Prism Pro5 unless otherwise noted. Data are presented as mean ± standard error (s.e.m.) or standard deviation (s.d.), as indicated in each figure legend. P < 0.05 was considered statistically significant. All experiments, including those in zebrafish, were repeated in at least triplicate to ensure enough variation and numbers to measure significance by unpaired t -tests unless otherwise noted in the legends. To ensiue randomization of measurements used in image analysis, >10 fields/condition were acquired. For zebrafish experiments, all fish were analysed, with no randomization or blinding. Sex of fish was randomized.

Example 2: Increased Intracellular Livid Deposition During Early Melanoma Metastases

[00184] A zebrafish model of melanoma that drives melanocyte-specific expression of the human BRAFY 600E via the MITF promoter (R. M. White et al, Nature 471 : 518-522 (201 1) was used. The ZMEL1-GFP cell line was generated from de novo transgenic melanomas that arose in one of the zebrafish model animals (S. Heilmann et al., Cancer Res 75: 4272-4282 (2015)) and was transplanted it into the circulation of the zebrafish. ZMEL1-GFP ceils reliably home to subcutaneous sites (Figure 1 A), mimicking a Clark’s level V or subcutaneous metastatic melanoma.

[00185] To identify the factors promoting growth in these subcutaneous sites, RN A-seq analysis was performed on the disseminated melanoma cells. Figure IB and Figure 12 demonstrates that alterations in lipid biology accounted for 3 of the top 7 dysregulated pathways (arrows). As shown in Figure 1C, there was a strong downreguiation of genes required for de novo fatty acid synthesis (e.g., ELOVL5, ACSLJ ) and cholesterol synthesis (e.g., HMGCR ,

MVD), along with an increase in fatty acid transport proteins SLC27A2 (also known as FATP2) and SLC27A6 (also known as FATP6), along with the CD36 co-receptor.

[00186] Without wishing to be bound by theory, it is believed that the observed

downreguiation of lipogenesis in the disseminated ZMEL1 cells was due to an excess of cytosolic lipids from extrinsic sources because de novo lipid synthesis is tightly regulated via a negative feedback loop.

[00187] ZMEL1-GFP zebrafish melanoma cells were transplanted into the subcutaneous tissues of adult Casper zebrafish to mimic in-transit metastasis. By 21 days post-transplant, there was a significant increase in total lipid stores as measured by LipidTox-RED staining (Figure ID). Tins was visually confirmed by in vivo staining with the fluorescent fatty acid analogue BODIPY-RED an fluorescence microscopy, in which 78% of fish by 21 DPT had visible lipid- filled cells within the GFF⁺ tumor mass (Figure IE). Electron microscopy (EM) confirmed the presence of lipid droplets in these transplanted tumor cells (Figure IF, arrows).

[00188] Figures 1G-1H demonstrate that human nerd, patient-derived subcutaneous xenografts and metastases were lipid-laden, confirming that these effects were not confined to the zebrafish and extend to human disease. Collectively, these data indicate that melanoma cells accumulate large deposits of cytosolic lipid after spreading to deep subcutaneous sites.

[00189] Histological examination of zebrafish melanomas in both transgenic and the transplanted animals demonstrate that tumor cells grew in the direct vicinity of subcutaneous adipocytes (Figure 2A, left panel), while advanced Clark’s level V human melanomas (Figure 2A, right panel) or metastases in-transit had expanded into the subcutaneous tissue, surrounded by lipid-laden adipocytes. 3T3L1 adipocytes were co-cultured with melanoma cells (Figure 2B), and tumor cells were isolated using fluorescence activated cell sorting (FACS). As shown in Figure 2C, melanoma cells co-cultured with adipocytes for 7 days exhibited a significant increase in lipid content, as determined by LipidTOX-RED staining. Electron microscopy confirmed that human A375 melanoma cells cocultured with 3T3L1 adipocytes contained significantly more and larger lipid droplets (Figure 2D).

[00190] To distinguish whether this observed increase in lipid content was due to direct lipid transfer from adipocytes or from adipocyte-stimulated de novo lipid synthesis in the melanoma cells, lipid“pulse-chase” experiments (Figure 2E, top) in which 3T3-L1 adipocytes were pre labelled with BODIPY -RED fatty acid were performed. Labeled adipocytes were then co- cultured with GFP^: human and zebrafish melanoma cells. After 24 hours of co-culture, BODIPY-RED fatty acids originating from the adipocytes were observed in the melanoma cells, thus demonstrating direct transfer of lipids from the adipocytes to melanoma cells (Figure 2E, bottom). This effect did not require direct cell-cell contact, as lipid transfer still occurred after separating the two cell types by a Transwell membrane (Figure 2F). Taken together, these data demonstrate that adipocytes were the source of extrinsic lipids in the melanoma cells.

[00191] Transcriptomic analysis of human A375 melanoma cells with or without adipocytes was performed. Figures 5A-5B show that de novo cholesterol and fatty_' acid synthesis genes were significantly downregulated in the co-cultured melanoma cells, which resembled the results observed in the in vivo subcutaneous metastases and is consistent with the scenario that the cells were accumulating extrinsic lipids. Taken together, these data demonstrate that

microenvironmental adipocytes are a donor source of lipids that are taken up by nearby melanoma cells, leading to sustained increases in cytosolic lipid pools in the tumor cells. [00192] The effects of adipocyte-derived lipids on melanoma progression and behavior were assessed. Proliferation of melanoma cells in monoculture was compared to melanoma cells cocultured with 3T3L1 adipocytes. Melanoma cell lines exhibited an increase proliferation in tire presence of adipocytes, especially in cells grown in nutrient-depleted conditions. As shown in Figure 6A, while serum starvation resulted in a significant growth arrest of A375 ceils, co culturing with adipocytes rescued the proliferative capacity of A375 cells in serum free media to levels observed under nutrient-replete conditions. Increases in proliferative capacity were likely due to mitochondrial energy production, as co-cultured cells exhibited increased basal and maximal mitochondrial respiration relative to that observed in monoculture (Figure 6B). This demonstrates that melanoma cells are capable of utilizing exogenous adipocyte-derived lipids to fuel tumor cell proliferation.

[00193] The invasive capacities of melanoma cells were assessed using a gelatin degradation assay. Co-cultured melanoma cells (Figures 3A-3B) and cells treated with adipocyte- conditioned media (Figure 3B) were significantly more efficient at gelatin degradation, demonstrating a greater capacity for invasion. Consistent with this, RNA-seq analysis of monocultured or co-cultured A375 cells showed a significant enrichment of the melanoma gene invasion signature after co-culture, typified by increased expression of AXL and SOX9, two major drivers of melanoma invasion (Figure 3C).

[00194] To investigate the mechanism for this increased invasion, the RNA-seq dataset was analyzed using Gene Set Enrichment Analysis (GSEA) to identity dysregulated pathways in the melanoma cells after exposure to adipocytes. Of the major Hallmark Gene Sets from the MSigDB database, the co-cultured melanoma cells had a significant enrichment of genes involved in the endoplasmic reticulum/unfolded protein (ER/UPR) stress response pathway (Figure 3D). Without wishing to be bound by theory, it is believed that (a) ER stress pathway genes such as XBP1 and ATF4 can lead to the acquisition of the AXL HI /invasive state and (b) lipids, especially saturated fatty acids, can directly activate the ER stress response by saturating the ER membrane, even in the absence of protein misfolding.

[00195] To determine whether the adipocyte derived lipids were activating the melanoma invasion program via ER stress, the expression of ER stress/unfolded protein response genes was assessed. The ER stress pathway consists of three inter-related signaling/transcriptional arms consisting of PERK/ATF4/CHOP, IREla/XBPl and ATF6a. After ER stress induction, IREla leads to splicing of a 26 nt fragment from XBP1, yielding the active transcriptional factor XBPls. XBP1 levels in melanoma cells grown either alone or after co-culture with adipocytes for 7 days was assessed. Figure 3E demonstrates that melanoma cells co-cultured with adipocytes showed a significant induction in the spliced form of XBP1 , which is capable of inducing downstream genes in the ER stress response pathway, including AXL. Moreover, Figure 3F demonstrates that adipocyte conditioned media increased expression of CHOP, a major component of downstream ER stress signaling that acts in concert with ATF4 to induce target gene expression.

[00196] To determine the specific lipids that could induce the ER stress response, quantitative iipidomic analysis of melanoma cells after exposure to adipocytes was performed, both in vitro and in vivo (Figure 3G). Human A375 or zebrafish ZMEL1 melanoma cells were grown in monoculture or in co-culture with 3T3-L1 adipocytes, FACS-isolated, and then analyzed for fatty acids, sterols, phospholipids and sphingolipids. Figure 7A show's a highly significant increase in multiple lipid species including triacylglycerols, diacyglycerols and cholesterol esters in both the zebrafish and human melanoma cells after coculture with adipocytes. See also Figures 7E-7F.

[00197] To confirm that these Iipidomic results could be extended in vivo , ZMEL1 cells were transplanted into the subcutaneous layer of fish near endogenous adipocytes, and were permitted to grow for 21 days. Melanoma cells were isolated using FACS and iipidomic analyses was performed. Consistent with the in vitro results, an increase in tri- and diacylglycerols was observed in the melanoma cells post-transplant. Across the in vitro and in vivo experiments, 12 lipid species were identified as being consistently upregulated in the melanoma cells after exposure to the adipocytes (Figure 3H).

[00198] To assess the role of stearic acid on ER stress, A375 cells were treated with stearic acid for 24 hours. As shown in Figure 31, a significant increase in the ER stress marker CHOP was observed. Figure 7B demonstrates that addition of stearic acid as well as palmitic acid to A375 cells resulted in increased expression of GRP78, another ER stress marker correlated with worse surv ival in melanoma. High levels of ER stress is associated with cytoprotective autophagy, but when unchecked can lead to apoptotic ceil death in melanoma. Indeed, Figure 7C demonstrates that high levels of stearic acid could induce lipotoxicity in melanoma cells.

[00199] Without wishing to be bound by theory, it is believed that this effect coul be limited by adjusting the balance of saturatedamsaturated fatty' acid. Whi le oleic acid itself did not induce ER stress in A375 cells, adding a 1 : 1 ratio of stearic acid:oleic acid reduced lipotoxicity (Figure 7C) yet still induced an ER stress response (Figure 7D). Further, A375 melanoma cells treated with stearic acid for 24 hours exhibited induction of AXL expression as well as a significant redistribution of AXL to the plasma membrane (Figure 3J), w'here it is capable of transducing extracellular signals to induce melanoma cell invasion. Taken together, this data demonstrates that saturated fatty acids from adipocytes can induce an ER stress and invasion program.

Example 3: Effects of FATP Inhibition on Fatty Acid Uptake and Apoptosis in Melanoma Cells

[00200] This Example demonstrates that genetic and pharmacological inhibition of lipid uptake via FATP1 or FATP5 are useful in methods for treating melanoma.

[00201] As noted above, zebrafish melanoma cells showed aberrant upregulation of both FATP2 and FATP6 ( a.k.a . SLC27A2 and SLC27A6) in vivo (Figure 1C), suggesting that these transporters are present on the tumor cells and may mediate lipid transfer from the adipocytes to the melanoma cells. A375 and SKMEL28 cells showed low expression levels of both FATP2 and FATP6 and high expression levels of FATP1 and FATP5. Additionally, FATP5 levels were increased after adipocyte co-culture.

[00202] To examine FATP1 and FATP5 protein expression levels, immunohistochemistry was performed across a series of 109 human melanoma samples by both tissue microarray biopsies (n=105) and patient-deri ved xenografts (PDX, n=4). Antibodies to both of these proteins were validated using human control tissues such as liver, spleen and kidney (Figure 8A). As shown in Figure 4A and Figure 8B, >90% of the human melanomas stained positive for FATP1, with 14% exhibiting the highest (Score 3) staining intensity. For FATP5, the overall positivity was >50% with 4% showing highest level staining. All four patient-derived xenografts were positive for Oil Red O (Figure 8B).

[00203] To determine if these FATP proteins were sufficient for lipid transport into cells, melanoma cells overexpressing human FATP 1 or FATP5 were generated, and the rate of lipid uptake in these cells compared to wildtype cells was measured using a fatty acid uptake assay. Overexpression of either FATP1 or FATP5 in A375 cells led to significantly increased rates of fatty acid uptake (Figure 4B). Taken together, these data indicate that human melanomas express high levels of FATP1/FATP5 proteins, which are capable of mediating fatty acid transport.

[00204] To determine whether FATP1 and FATP5 transporters were necessary' for lipid- mediated invasion phenotypes in melanoma, multiple A375 CRISPR clones against both FATP1 and FATP5 were generated and lipid uptake was measured over time. Depletion of either FATP1 and FATP5 abrogated fatty acid uptake into the melanoma cells (Figure 9A). Further, Lipofermata also inhibited both FATP1 and FATP5 (Figure 9B). Lipofermata led to a dose- dependent inhibition of lipid uptake (Figure 4C) and a dose dependent reduction in viability (Figure 4H) in both human and zebrafish melanoma cells, consistent with the CRISPR knockout clones. Moreover, Lipofemiata blocked lipid transfer from adipocytes to melanoma cells in pulse-chase assay experiments (Figure 4D) at low concentrations that do not cause cytotoxicity to the melanoma cells (Figure 9C). Finally, melanoma invasion was measured after melanoma cells were deprived of lipids either genetically or pharmacologically. FATP5 CRISPR knockout cells showed markedly decreased migratory capacity (Figure 4E). Treatment with Lipofermata entirely abrogated the increases in invasion observed in melanoma cells grown in adipocyte- conditioned media (Figure 4F).

[00205] To determine whether these transporter proteins were important for tumor growth in vivo, a transgenic MiniCoopr fish (BRAF\ 600E; p537 ) that overexpresses FATPI in a melanocyte-specific manner was generated. Tumor onset and behavior was compared between Mitfp-BRAF V600E; p537 vs. Mhfp-BRAF V600E; p537 ; FATP I ^: animals. Animals were screened at early time points (~3 months) before the BR.AF N 600E; p537 control animals usually exhibit tumors. FATPI overexpressing fish developed tumors more rapidly (Figure 10B) and appeared to be lipid laden as evidenced by increased BODIPY staining (Figure 10A). H&E staining also revealed highly invasive tumors from FATPI overexpressing fish. See Figure IOC. Whereas the BRAF V600E; p537 control animals typically exhibited one modest sized tumor, the BRA l V600E; p537 ;FATPl⁺ animals developed highly invasive, multifocal tumors that are lipid laden. Adult Casper fish that were transplanted with ZMEL-GFP cells and treated with Lipofermata exhibited a reduction in tumor size. See Figures 4I-4J. These data demonstrate that fatty acids from adipocytes drive an AXL invasion program in melanoma cells, and that this behavior can be abrogated by blocking lipid transport through the FATP1/FATP5 transport proteins.

[00206] Human melanoma cells ( BRAF and NRAS mutants) were seeded onto plates at low density an allow ed to grow' for 72 hours in the presence of 3 mM of Lipofermata, Trametnib 2 nM, Dabrafenib 10 nM or combinations of the 3 drugs (as indicated). Cell viability was measured using Cell Titer Glow. As shown in Figure 1 1 A, combination therapy with Trametinib and Lipofermata led to a synergistic reduction in melanoma proliferation in NRAS mutant cells compared to that observed with treatment with Trametinib or Lipofermata alone. No synergistic reduction in melanoma proliferation was observed in A375 cells. See Figure 1 IB.

[00207] Accordingly, the FATP1/FATP5 inhibitors disclosed herein are useful in methods for inhibiting melanoma proliferation or invasion and treating melanoma in a subject in need thereof. Example 4: Effects of Inhibition of FATP 3. FATP4. or FATP6 on Melanoma

[00208] This Example demonstrates that genetic and pharmacological inhibition of lipid uptake via FATP3, FATP4 or FATP6 are useful in methods for treating melanoma.

[00209] FATP CRISPR knockouts, FATP overexpression cell lines, and LipidTOX staining will be performed in accordance with the methods described in Example 1. To determine whether FATP3, FATP4 or FATP6 transporters are necessary for lipid-mediated invasion phenotypes in melanoma, multiple A375 CRISPR clones against FATP3, FATP4 or FATP6 will be generated and lipid uptake will be measured over time. It is anticipated that genetic depletion of FATP3, FATP4 or FATP6 will abrogate fatty acid uptake into the melanoma cells and/or decrease migratory' capacity of melanoma cells grown in adipocyte-conditioned media.

[00210] To determine if FATP3, FATP4 or FATP6 are sufficient for lipid transport into cells, melanoma cells overexpressing human FATP3, FATP4 or FATP6 will be generated, and the rate of lipid uptake in these cells compared to wildtype cells will be measured using a fatty acid uptake assay. It is expected that overexpression of FATP3, FATP4 or FATP6 in A375 cells will result in an increase in fatty acid uptake. It is also anticipated that treatment ith Lipofermata will inhibit fatty acid uptake and/or reduce viability in melanoma cell lines that overexpress FATP3, FATP4 or FATP6 in a dose dependent manner.

[00211] These results demonstrate that genetic and pharmacological inhibition of lipid uptake via FATP3, FATP4 or FATP6 are useful in methods for treating melanoma. Accordingly, the FATP3, FATP4 or FATP6 inhibitors disclosed herein are useful in methods for inhibiting melanoma proliferation or invasion and treating melanoma in a subject in need thereof.

Example 5: FATP 5 as Predictor for Melanoma Prognosis

[00212] This Example demonstrates that detection of FATP5 levels are useful in methods for predicting the prognosis of patients suffering from or diagnosed with melanoma.

[00213] mRNA expression of the FATP5 gene was analyzed using the publicly available dataset from The Cancer Genome Atlas melanoma cohort. The analysis was conducted using cBIO portal software. In this analysis, the survival of patients expressing the highest levels of FATP5 was compared to the rest of the cohort. As shown in Figure 13, the subset of patients that exhibited elevated FATP5 expression levels had significantly poor survival outcomes compared to the rest of the cohort of melanoma patients (p<0.05, log rank).

[00214] These results demonstrate that detection of FATP5 levels are useful in methods for predicting the prognosis of patients suffering from or diagnosed with melanoma. Accordingly, the detection of FATP5 expression levels is useful in methods for monitoring the therapeutic efficacy of a dosage of an inhibitor of FATP1/FATP5 in a subject diagnosed with melanoma.

EQUIVALENTS

[00215] The present technology is not to be limited in terms of the particular embodiments described in this application, which are intended as single illustrations of individual aspects of the present technology. Many modifications and variations of this present technology can be made without departing from its spirit and scope, as will be apparent to those skilled in the art. Functionally equivalent methods and apparatuses within the scope of the present technology, in addition to those enumerated herein, will be apparent to those skilled in the art from the foregoing descriptions. Such modifications and variations are intended to fail within the scope of the present technology. It is to be understood that this present technology is not limited to particular methods, reagents, compounds compositions or biological systems, which can, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting.

[00216] In addition, where features or aspects of the disclosure are described in terms of Markush groups, those skilled in the art will recognize that the disclosure is also thereby described in terms of any individual member or subgroup of members of the Markush group.

[00217] As will be understood by one skilled in the art, for any and ail purposes, particularly in terms of providing a written description, all ranges disclosed herein also encompass any and all possible subranges and combinations of subranges thereof. Any listed range can be easily recognized as sufficiently describing and enabling the same range being broken down into at least equal halves, thirds, quarters, fifths, tenths, etc. As a non-limiting example, each range discussed herein can be readily broken down into a lower third, middle third and upper third, etc. As will also be understood by one skilled in the art all language such as“up to,”“at least,” “greater than,”“less than,” and the like, include the number recited and refer to ranges winch can be subsequently broken down into subranges as discussed above. Finally, as will be understood by one skilled in the art, a range includes each individual member. Thus, for example, a group having 1-3 cells refers to groups having 1 , 2, or 3 cells. Similarly, a group having 1-5 cells refers to groups having 1, 2, 3, 4, or 5 cells, and so forth.

[00218] All patents, patent applications, provisional applications, and publications referred to or cited herein are incorporated by reference in their entirety, including all figures and tables, to the extent they are not inconsistent with the explicit teachings of this specification.

Claims

1. A method for treating melanoma in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of at least one sgRNA that targets one or more genes selected from the group consisting of FATP1 and FATP5.

2. The method of claim 1, wherein the at least one sgRNA comprises a nucleic acid sequence selected from the group consisting of: 5’ AACAGCACGTGTCGTCCACT 3’ (SEQ ID NO: 1), 5’ GCGGCGCTCGGCGTGTACGT 3’ (SEQ ID NO: 2), 5’

CCCTCTTCATCTATACCTCG 3’ (SEQ ID NO: 3), and 5’ GCCCTCTTCATCTATACCTC 3’ (SEQ ID NO: 4).

3. The method of any one of claims 1-2, wherein the subject displays elevated expression levels ofFATPl and/or FATP5 protein prior to treatment.

4. The method of any one of claims 1-3, wherein the subject has been diagnosed as having melanoma.

5. A method for treating a disease characterized by elevated FATP5 or FATPi levels in a subject in need thereof, comprising administering to the subject a therapeutically' effective amount of Lipofermata, wherein the disease characterized by elevated FATP5 or FATPI levels is melanoma.

6. A method for treating a disease characterized by elevated FATP5 or FATPi levels in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of at least one sgRNA that targets one or more genes selected from the group consisting of FATPI and FATP5, wherein the disease characterized by elevated FATP5 or FATPI levels is melanoma and wherein the at least one sgRNA comprises a nucleic acid sequence selected from the group consisting of: 5’ AACAGCACGTGTCGTCCACT 3’ (SEQ ID NO: I), 5’

GCGGCGCTCGGCGTGTACGT 3’ (SEQ ID NO: 2), 5’ CCCTCTTCATCTATACCTCG 3’ (SEQ ID NO: 3), and 5’ GCCCTCTTCATCTATACCTC 3’ (SEQ ID NO: 4).

7. The method of any' one of claims 1-6, wherein the signs or symptoms of melanoma comprise one or more of normal moles, new spots on the skin, a change in size, texture, shape or color of an existing mole, sores that do not heal, itchiness, tenderness, pain, redness or swelling that spreads outside the border of a spot to the surrounding skin, blurry' vision, partial loss of sight, dark spots in the iris, scales, and oozing or bleeding from an existing mole.

8. The method of any one of claims 1-7, wherein the subject harbors one or more point mutations in BRAF, or NR.AS.

9. The method of claim 8, wherein the one or more point mutations in BRAF or NRAS is selected from the group consisting of BRA1- V600E and NRAS Q61 R.

10. The method of any one of claims 1-9, wherein the subject is human.

11. The method of any one of claims 1-10, wherein the at least one sgRNA or Lipofermata is administered orally, topically, intranasally, systemicaily, intravenously, subcutaneously, intraperitoneally, intradermaliy, intraocuiarly, iontophoretieally, transmucosally, or

intramuscularly.

12. The method of any one of claims 1-11, further comprising separately, sequentially or simultaneously administering one or more additional therapeutic agents to the subject.

13. The method of claim 12, wherein the additional therapeutic agents are selected from the group consisting of GDC-0879, SB590885, Encorafenib, RAF265, TAK-632, PLX4720, CEP- 32496, AZ628, Sorafenib Tosylate, Sorafenib, Vemurafenib (Zelboraf) and Dabrafenib

(GSK2118436), MLN2480, Cobimetinib (GDC-0973), MEK 162, R05126766, GDC-0623, VTXl le, Selumetinib (AZD6244), PD0325901, Trametinib (GSK1120212), U0126-EtOH, PD184352 (CI-1040), Refametinib, PD98059, BIX02189, Binimetinib, Pimasertib (AS-703026), SL327, BIX02188, AZD8330, TAK-733, PD318088, SCH772984, FR 180204, ipilimumab, tremelimumab, MEDI4736, nivolumab, durvalumab, pembrolizumab, pidilizumab (CT-011), AMP-224, AMP-514 (MEDI0680), PDR001, BMS-936559 (MDX1105), atezolizumab

(Tecentriq* MPDL3280A), and avelumab (MSB0010718C).

14. The method of any one of claims 1-13, wiierein the at least one sgRNA or Lipofermata is administered daily for 6 w¾eks or more.

15. The method of any one of claims 1-14, wherein the at least one sgRNA or Lipofermata is administered daily for 12 weeks or more.

16. A method for monitoring the therapeutic efficacy of a dosage of an inhibitor of

FATP1/FATP5 in a subject diagnosed with melanoma comprising:

(a) detecting FATP5 protein levels in a test sample obtained from the subject after the subject has been administered the dosage of the inhibitor of FATP1/FATP5 ; and

(b) determining that the dosage of the inhibitor of FATP1/FATP5 is effective when the FATP5 protein levels in the test sample are reduced compared to that observed in a control sample obtained from the subject prior to administration of the inhibitor of FATP1/FATP5.

17. The method of claim 16, wherein the inhibitor of FATP1/FATP5 is Lipofermata.

18. The method of claim 16, wherein the inhibitor of FATP1/FATP5 is a sgRNA that comprises a nucleic acid sequence selected from the group consisting of: 5’

AAC AGC ACGT GT CGT CC ACT 3’ (SEQ ID NO: 1), 5’ GCGGCGCTCGGCGTGTACGT 3’ (SEQ ID NO: 2), 5’ CCCTCTTCATCTATACCTCG 3’ (SEQ ID NO: 3), and 5’

GCCCTCTTCATCTATACCTC 3’ (SEQ ID NO: 4).

19. A method for treating melanoma in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of an inhibitor of FATP1/FATP5 and a therapeutically effective amount of a RAF/MEKJERK inhibitor.

20. The method of claim 19, wherein the inhibitor of FATP1/FATP5 is Lipofermata.

21. The method of claim 19, wherein the inhibitor of FATP1/FATP5 is a sgRNA that comprises a nucleic acid sequence selected from the group consisting of: 5’

A AC AGC ACGT GT CGTCCACT 3’ (SEQ ID NO: 1), 5 GCGGCGCTCGGCGTGTACGT 3’ (SEQ ID NO: 2), 5’ CCCTCTTCATCTATACCTCG 3’ (SEQ ID NO: 3), and 5’

GCCCTCTTCATCTATACCTC 3’ (SEQ ID NO: 4).

22. The method of claim 19, wherein the RAF/MEICERK inhibitor is Trametinib or dabrafenib.