WO2019103581A1

WO2019103581A1 - Double stranded oligonucleotide and method for manufacturing same

Info

Publication number: WO2019103581A1
Application number: PCT/KR2018/014742
Authority: WO
Inventors: 서민구; 윤상원; 고성렬; 이준원; 박병순; 최은욱
Original assignee: (주)프로스테믹스
Priority date: 2017-11-27
Filing date: 2018-11-27
Publication date: 2019-05-31
Also published as: KR20190062290A; KR102138495B1

Abstract

The present invention provides a miRNA polymer capable of being used for various purposes and a method for manufacturing same. More specifically, the present invention relates to a double stranded oligonucleotide which comprises: a first strand comprising a targeted first oligonucleotide and a first elongated oligonucleotide; and a second strand comprising a targeted second oligonucleotide and a second elongated oligonucleotide, wherein the first elongated oligonucleotide can be hybridized with the second oligonucleotide, and the second elongated oligonucleotide can be hybridized with the first oligonucleotide.

Description

Double stranded oligonucleotides and methods for their production

The present invention relates to a double-stranded oligonucleotide which can be used for various purposes, and a method for producing the same.

MicroRNAs (miRNAs) are small non-coding RNAs composed of 18-25 nucleotides (nt) that bind to the 3'-untranslated region (UTR) of the target gene to regulate gene expression (Bartel DP, et al., Cell 116: 281-297, 2004; Lewis BP, et al., Cell 120: 15-20, 2005), introns, exons or intergenic regions ) (Rodriguez A, et al., Genome Res 14: 1902-1910, 2004). First, miRNAs are transcribed by RNA polymerases into early miRNA molecules containing thousands of nucleotides (pri-miRNA). The pri-miRNA is then used as a microprocessor (DroshaRNase endonuclease and DiGeorge syndrome region gene 8 protein, DGCR8) to form approximately 70 nt trunk loop intermediates, known as miRNA precursors. (Lee Y, et al., EMBO J21: 4663-4670, 2000; Zeng Y, et al., Proc Natl Acad Sci USA A100: 9779-9784, 2003). The pre-miRNA is then transferred from the nucleus to the cytoplasm via exoportin-5 (Exportin-5, EXP5) and the cofactor Ran-GTP, where the pre-miRNA is expressed by RNase endonuclease Dicer 18-25 nt mature miRNA duplexes (Lee Y, et al., EMBO J23: 4051-4060, 2004; Shenouda SK, et al., Cancer Metastasis Rev 28: 369-378, 2009). Mature miRNA duplexes are integrated as single-stranded RNA with Argonaute protein into an RNA-induced silencing complex (RISC), which induces either truncation or translational inhibition of the target mRNA (Diederichs S, et al., Cell 131: 1097-1108, 2007; Hammond SM, et al., Nature 404: 293-296,2000; Martinez et al., Cell 110: 563-574, 2002).

The present invention provides double stranded oligonucleotides that can be used for various purposes and a method for producing the same.

As used herein, the term " hybridization " means that two single-stranded nucleic acids form a duplex structure by pairing complementary base sequences. Hybridization can occur either in perfect match between single strand nucleic acid sequences or in the presence of some mismatch nucleotides.

The term " complementary " as used herein means that both strands of an oligonucleotide can form base pairs. Both strands of complementary oligonucleotides form base pairs in the Watson-Crick fashion to form double strands. In the present invention, when the base U is mentioned, it is possible to substitute with the base T unless otherwise stated.

In the present invention, the " oligonucleotide " is a DNA, RNA or DNA / RNA hybrid molecule, more preferably an oligoribonucleotide which is an RNA molecule.

In the present invention, the oligonucleotides may contain naturally occurring or modified, non-naturally occurring bases and may contain modified sugars, phosphates, and / or ends. For example, in addition to phosphodiester linkages, phosphate modifications include, but are not limited to, methyl phosphonate, phosphorothioate, phosphoramidate (bridged or non-bridged), phosphotriester and phosphorodithioate And can be used in any combination. In some embodiments, the RNA oligonucleotides have a phosphorothioate linkage, a phosphodiester linkage alone, or a combination of phosphodiester and phosphorothioate linkages.

Amino-RNA analogs, 2'-fluoro-DNA, and 2'-alkoxy- or amino-RNA / DNA chimeras, as known in the art Others described may also be prepared and combined with any phosphate modification. Examples of base modifications include those for C-5 and / or C-6 of cytosines of the oligonucleotides (e.g., 5-bromocytosine, 5-chlorocytosine, 5-fluorocytosine, 5-iodocytosine) Addition of an electron-withdrawing moiety and C-5 of uracil (e.g., 5-bromouracil, 5-chlorouracil, 5-fluorouracil, 5-iodouracil) of the oligonucleotides of the present invention and / But is not limited to, the addition of an electron-attracting moiety to C-6. As mentioned above, the use of base modifications in the ordered sequence of the oligonucleotides should not interfere with the self-complementarity of the bases involved for Watson-Crick base pairing. However, outside of the conformational sequence, the modified base can be used without such limitation. For example, 2'-O-methyl-uridine and 2'-O-methyl-cytidine can be used outside of the rotatory sequence, while 5-bromo-2'-deoxycytidine It can be used both internally and externally. Other modified nucleotides that can be used both internally and externally in the translated sequence include 7-deaza-8-aza-dG, 2-amino-dA, and 2-thio-dT.

In the present invention, the oligonucleotides may comprise phosphate-modified oligonucleotides, some of which are known to stabilize oligonucleotides. Accordingly, some embodiments of the invention include stabilized oligonucleotides. The synthesis of oligonucleotides containing modified phosphate linkages or non-phosphate linkages is also known in the art (see, for example, Matteucci " Oligonucleotide Analogs: an Overview " in Oligonucleotides as Therapeutic Agents, (DJ Chadwick and G. Cardew, ed.) John Wiley and Sons, New York, NY, 1997). A phosphor derivative (or modified phosphate group) that may be attached to a sugar or sugar analog moiety at an oligonucleotide is a monophosphate, a diphosphate, a triphosphate, an alkylphosphonate, a phosphorothioate, a phosphorodithioate, Formamidate, and the like. The preparation of the above-mentioned phosphate analogs and their incorporation into nucleotides, modified nucleotides and oligonucleotides have already been described extensively on their own (see, for example, Peyrottes et al., Nucleic Acids Res, 24: 1841- Nucleic Acids Res, 24: 2318-2323, 1996; and Schultz et al., Nucleic Acids Res, 24: 2966-2973, 1996). For example, the synthesis of phosphorothioate oligonucleotides is similar to that described above for naturally occurring oligonucleotides, except that the oxidation step is replaced by a sulfation step (see Zon " Oligonucleoside Phosphorothioates " in Protocols for Oligonucleotides and Analogs, Synthesis and Properties (Agrawal, ed.) Humana Press, pp. 165-190, 1993).

In the present invention, the oligonucleotides may comprise one or more ribonucleotides (containing ribose as the sole or major sugar component), deoxyribonucleotides (containing deoxyribose as the major sugar component), modified sugars or sugar analogs. Thus, in addition to ribose and deoxyribose, the sugar moiety may be pentose, deoxypentose, hexose, deoxyhexose, glucose, arabinose, xylose, lactic acid, and sugar analog cyclopentyl groups. The sugar may be present in the form of a pyranosyl or furanosyl. In the oligonucleotides of the present invention, the sugar moiety is preferably a furanoside of ribose, deoxyribose, arabinose or 2'-O-alkyl (e.g., methyl, ethyl) ribose, Can be attached to the base in anomeric coordination. The sugar variants include, but are not limited to, 2'-alkoxy (e.g., methoxy, ethoxy) -RNA analogs, 2'- amino- RNA analogs, 2'-fluoro-RNA, 2'- Or amino-RNA / DNA chimeras. These sugars or sugar analogs and the preparation of each nucleoside in which such a sugar or analogue is itself attached to a heterocyclic base (nucleic acid base) are known and need not be described here. The sugar variants can also be prepared in the preparation of the oligonucleotides of the present invention and combined with any phosphate modification.

In the present invention, the heterocyclic bases or nucleic acid bases incorporated into the oligonucleotides are not limited to naturally occurring main purines and pyrimidine bases (i.e., uracil, thymine, cytosine, adenine and guanine as mentioned above) Naturally occurring and synthetic variants. Thus, the oligonucleotides of the present invention may include one or more of inosine, 2'-deoxyuridine and 2-amino-2'-deoxyadenosine.

Oligonucleotides of the present invention can be modified using a variety of strategies known in the art to produce various effects including, for example, improved in vitro and in vivo efficacy and stability. Among such strategies are artificial nucleic acids, such as 2'-O-methyl-substituted RNA; 2'-fluoro-2'deoxy RNA, peptide nucleic acid (PNA); Morpholino; A locked nucleic acid (LNA); Uncharged nucleic acid (UNA); A crosslinked nucleic acid (BNA); Glycolic acid (GNA); And TRNA nucleic acid (TNA); More generally, nucleic acid analogs, such as bicyclic and tricyclic nucleoside analogs, which are structurally similar to naturally occurring RNA and DNA, but which are modified in one or more of the phosphate backbone, sugar or nucleobase portions of the naturally occurring molecule Respectively. Typically, analogous nucleobases impart, among other things, different base pairing and base lamination properties. Examples thereof include universal bases capable of forming a pair with four kinds of canon bases. Examples of phosphate-sugar backbone analogs include PNA. Morpholino oligomeric compounds are described in Braasch et al., Biochemistry, 41 (14): 4503-4510 (2002) and U.S. Pat. Nos. 5,539,082, 5,714,331, 5,719,262 and 5,034,506.

In the present invention, the oligonucleotide can be modified by substitution at the terminal end with a chemical functional group. Substitution can be performed at the 3 'or 5' end of the oligonucleotide and is preferably performed at the 3 'end of both the sense and antisense strands of the monomer, but is not always limited thereto. The chemical functional group includes, for example, a sulfhydryl group (-SH), a carboxyl group (-COOH), an amine group (-NH ₂ ), a hydroxy group (-OH), a formyl group (-CHO) (-CO-), an ether group (-O-), an ester group (-COO-), a nitro group (-NO _2), azide group (-N ₃₎ or a sulfonic acid group include a (-SO ₃ H) .

According to one embodiment of the present invention, as a double stranded oligonucleotide,

A first strand comprising a first oligonucleotide of interest and a first stretch oligonucleotide; And

A second strand comprising the desired second oligonucleotide and a second elongated oligonucleotide,

Wherein the first elongated oligonucleotide is capable of hybridizing with the second oligonucleotide,

Wherein the second elongated oligonucleotide is capable of hybridizing with the first oligonucleotide.

In the present invention, the first oligonucleotide and the second oligonucleotide perform the desired function by regulating the expression of a target gene, and they may be the same or different, and the specific sequence is not particularly limited.

In the present invention, the first oligonucleotide comprises a full sequence or a fragment thereof of an miRNA (hereinafter, referred to as 'desired first miRNA') known to function as a target by regulating the expression of a target gene .

In the present invention, the second oligonucleotide may encode a full sequence or a fragment thereof of miRNA (hereinafter, referred to as 'target second miRNA') known to function as a target by controlling expression of a target gene .

In the present invention, as the desired miRNA of each of the first oligonucleotide and the second oligonucleotide, the desired first miRNA and the desired second miRNA may be the same or different from each other.

In the present invention, the length of the entire chain of each of the desired first miRNA and the desired second miRNA is not particularly limited, but is preferably 18 to 25 nucleotides (hereinafter referred to as 'nt') Lt; / RTI >

In the present invention, each of the first oligonucleotide and the second oligonucleotide may include a full-length miRNA precursor or a fragment thereof, but may be a miRNA precursor, a primary miRNA (pri-miRNA), or a plasmid. Lt; RTI ID = 0.0 > miRNA < / RTI > However, in the present invention, the nucleic acid molecule constituting the miRNA precursor or the primary miRNA may have a length of 50-100 nt, more preferably 65-95 nt, but is not limited thereto.

In the present invention, the miRNA fragment may contain a seed sequence of the desired miRNA or may contain at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95% , 96% or more, 97% or more, 98% or more, 99% or more, or 100% of the nucleotide sequence.

The term " seed sequence " in the present invention means a nucleotide sequence of a partial region of a miRNA that binds with complete complementarity when a miRNA recognizes a target, And is a region that has a substantially effective function.

In the present invention, the length of the miRNA fragment is not particularly limited, but is preferably 9 to 11 nt.

In the present invention, the miRNA fragment may be produced by cleaving a desired miRNA, or may be produced by digesting a desired miRNA, or may have 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more , 96% or more, 97% or more, 98% or more, 99% or more, or 100% of the nucleotide sequence.

In the present invention, the first elongated oligonucleotide may hybridize with the second oligonucleotide. The first elongated oligonucleotide may have an oligonucleotide complementary to the 3'-5 'direction of the second oligonucleotide, at least 90%, at least 91% , 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more or 100%

In the present invention, the first elongated oligonucleotide may have a bubble structure including the second oligonucleotide and one or more mis-matching nucleotides (i.e., non-complementary base pairs).

In the present invention, the mismatching can be performed by using a combination of G: G, G: A, G: U, G: T, A: A, A: C, C: C, , And U: T.

In the present invention, the second elongated oligonucleotide may hybridize with the first oligonucleotide. The second elongated oligonucleotide may have an oligonucleotide complementary to the 3'-5 'direction of the first oligonucleotide, at least 90%, at least 91% , 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more or 100%

In the present invention, the second elongated oligonucleotide may have a bubble structure including the first oligonucleotide and one or more mismatching nucleotides.

In the present invention, one end of the first elongated oligonucleotide may be connected to one terminal of the first oligonucleotide, and preferably, the 5'-terminal of the first elongated oligonucleotide is connected to the 3'- Or the 5'end of the first oligonucleotide may be connected to the 3'end of the first extended oligonucleotide.

In the present invention, one end of the second elongated oligonucleotide may be connected to one end of the second oligonucleotide, and preferably, the 5'-end of the second elongated oligonucleotide is linked to the 3 ' end of the second oligonucleotide. Terminal of the first oligonucleotide, or the 5 'end of the second oligonucleotide may be connected to the 3' end of the second elongated oligonucleotide.

In the present invention, preferably, the 5'end of the first elongated oligonucleotide is connected to the 3'end of the first oligonucleotide, and the 5'end of the second elongated oligonucleotide is connected to the 3'end of the second oligonucleotide Lt; / RTI >

In the present invention, preferably, the 5'end of the first oligonucleotide is connected to the 3'end of the first elongated oligonucleotide, and the 5'end of the second oligonucleotide is connected to the 3'end of the second elongated oligonucleotide Lt; / RTI >

Figure 1 illustrates the structure of a double stranded oligonucleotide according to one embodiment of the present invention wherein each of the two strands comprises a first oligonucleotide 10 and a second oligonucleotide 11, At the 3 'end of the nucleotide 10, the 5' end of the first elongating oligonucleotide 20 complementary to the 3'-5 'direction of the second oligonucleotide 11 is connected to form the first strand . The 5'end of the second extended oligonucleotide 21 complementary to the 3'-5 'direction of the first oligonucleotide 10 is connected to the 3'end of the second oligonucleotide 11, So that a second strand can be formed.

Figure 2 illustrates the structure of a double stranded oligonucleotide according to one embodiment of the present invention wherein each of the two strands comprises a first oligonucleotide 10 and a second oligonucleotide 11, The 5 'end of the first oligonucleotide 10 is connected to the 3' end of the first elongated oligonucleotide 20 complementary to the 3'-5 'direction of the nucleotide 11 to form the first strand have. The 5 'end of the second oligonucleotide (11) is connected to the 3' end of the second elongated oligonucleotide (21) complementary to the 3'-5 'direction of the first oligonucleotide (10) A second strand can be formed.

In the present invention, the first oligonucleotide and the first elongated oligonucleotide may be directly connected to each other, but may further include a first linker nucleotide or a first linker oligonucleotide as a first linker therebetween, Is not particularly limited and is a nucleotide whose base is adenine (A), a nucleotide whose base is uracil (U), a nucleotide whose base is guanine (G), a nucleotide whose base is cytosine (C) Or a combination thereof.

In the present invention, the second oligonucleotide and the second elongated oligonucleotide may be directly connected, but may further include, as a second linker, a second linker nucleotide or a second linker oligonucleotide, Is not particularly limited and is a nucleotide whose base is adenine (A), a nucleotide whose base is uracil (U), a nucleotide whose base is guanine (G), a nucleotide whose base is cytosine (C) Or a combination thereof.

In the present invention, when the first linker and the second linker are included, they may be disposed opposite to each other in the double strand.

Further, in the present invention, the first linker and the second linker may be complementary or non-complementary to each other, or some sequences may be mismatched to form a bubble structure.

FIG. 3 illustrates the structure of a double stranded oligonucleotide according to an embodiment of the present invention. The 5 'end of the first elongated oligonucleotide 20 is connected to the first oligonucleotide 10 And the 5'end of the second extended oligonucleotide 21 may be connected to the 3'end of the second oligonucleotide 11 through the second linker 300 '.

FIG. 4 illustrates the structure of a double stranded oligonucleotide according to an embodiment of the present invention. The 5 'end of the first oligonucleotide 10 is connected to a first extended oligonucleotide 20 And the 5'end of the second oligonucleotide 11 may be connected to the 3'end of the second elongated oligonucleotide 21 through the second linker 300 '.

In the present invention, at the 5 'end of the first strand, at the 5' end of the first oligonucleotide or at the 5 'end of the first elongated oligonucleotide, a first capnucleotide or a first cap oligonucleotide may be further included.

In the present invention, the sequence of the first capping nucleotide is not particularly limited, but the base may be a uracil (U) nucleotide or a first or second nucleotide from the 5 'end of the first miRNA of interest, It is not.

In the present invention, the sequence of the first cap oligonucleotide is not particularly limited. However, the base may include nucleotides of uracil (U), or the nucleotide sequence of the first to third But are not limited to, a contiguous oligonucleotide, or a first to a second contiguous oligonucleotide.

In the present invention, at the 5 'end of the second strand, at the 5' end of the second oligonucleotide or at the 5 'end of the second extended oligonucleotide, a second or a second cap oligonucleotide may be further included.

In the present invention, the sequence of the second capnucleotide is not particularly limited, but the base may be a uracil (U) nucleotide or a first or second nucleotide from the 5 'end of the desired second miRNA, It is not.

In the present invention, the sequence of the second cap oligonucleotide is not particularly limited. However, the base may include nucleotides of uracil (U), or the nucleotide sequence of the first to third But are not limited to, a contiguous oligonucleotide, or a first to a second contiguous oligonucleotide.

5 shows the structure of a double stranded oligonucleotide according to an embodiment of the present invention. In the 3'-5 'direction of the second oligonucleotide 11 at the 3' end of the first oligonucleotide 10 Of the first oligonucleotide (10) at the 3 'end of the second oligonucleotide (11) is connected to the 5' end of the first oligonucleotide (20) complementary to the sequence of the first oligonucleotide The 5 'end of the second elongated oligonucleotide 21 complementary to the sequence in the -5' direction may be connected to form a second strand. At this time, a first capnucleotide or a first cap oligonucleotide (100) is extended at the 5 'end of the first oligonucleotide (10) at the 5' end of the first strand and a second caponucleotide At the 5 'end of the oligonucleotide (11), a second or second cap oligonucleotide (100') may be extended.

FIG. 6 illustrates the structure of a double stranded oligonucleotide according to an embodiment of the present invention. The first extended oligonucleotide 20 complementary to the 3'-5 'direction sequence of the second oligonucleotide 11, Of the first oligonucleotide 10 is connected to the 3'end of the first oligonucleotide 10 to form a first strand and a second extended oligonucleotide complementary to the 3'-5 ' The 5 'end of the second oligonucleotide 11 may be connected to the 3' end of the first oligonucleotide 21 to form a second strand. At this time, the first capnucleotide or the first cap oligonucleotide (100) is extended at the 5 'end of the first extended oligonucleotide (20) at the 5' end of the first strand and the 5 ' At the 5 'end of the bi-extended oligonucleotide 21, a second or second cap oligonucleotide 100' may be extended.

In the present invention, a first terminal nucleotide or a first terminal oligonucleotide may be further included at the 3'-terminal of the first strand, the 3'-terminal of the first extended oligonucleotide, or the 3'-terminal of the first oligonucleotide.

In the present invention, the sequence of the first terminal nucleotide is not particularly limited, but it may be a nucleotide whose base is adenine (A) or the first or second nucleotide from the 3 'end of the desired first miRNA, But is not limited to.

In the present invention, the sequence of the first terminal oligonucleotide is not particularly limited, but it may include a nucleotide whose base is adenine (A), or a nucleotide sequence of the first to third , Or a first to second consecutive oligonucleotides, but is not limited thereto.

In the present invention, a second terminal nucleotide or a second terminal oligonucleotide may be further included at the 3 'end of the second strand, the 3' end of the second elongated oligonucleotide, or the 3 'end of the second oligonucleotide.

In the present invention, the sequence of the second terminal nucleotide is not particularly limited, but it may be a nucleotide whose base is adenine (A), or may be the first or second nucleotide from the 3 'end of the desired second miRNA, But is not limited to.

In the present invention, the sequence of the second terminal oligonucleotide is not particularly limited, but it may include a nucleotide whose base is adenine (A), or the nucleotide sequence of the first to third , Or a first to second consecutive oligonucleotides, but is not limited thereto.

FIG. 7 shows the structure of a double stranded oligonucleotide according to an embodiment of the present invention. In FIG. 7, the 3'-5 'direction of the second oligonucleotide 11 at the 3'end of the first oligonucleotide 10 Of the first oligonucleotide (10) at the 3 'end of the second oligonucleotide (11) is connected to the 5' end of the first oligonucleotide (20) complementary to the sequence of the first oligonucleotide The 5 'end of the second elongated oligonucleotide 21 complementary to the sequence in the -5' direction may be connected to form a second strand. At this time, a first terminal nucleotide or first terminal oligonucleotide (200) is extended to the 3'end of the first elongated oligonucleotide (20) which is the 3'end of the first strand, and a second terminal oligonucleotide A second terminal nucleotide or a second terminal oligonucleotide (200 ') may be extended at the 3' end of the extended oligonucleotide (21).

8 shows a structure of a double stranded oligonucleotide according to an embodiment of the present invention, wherein a first extended oligonucleotide 20 complementary to the 3'-5 'direction of the second oligonucleotide 11, Of the first oligonucleotide 10 is connected to the 3'end of the first oligonucleotide 10 to form a first strand and a second extended oligonucleotide complementary to the 3'-5 ' The 5 'end of the second oligonucleotide 11 may be connected to the 3' end of the first oligonucleotide 21 to form a second strand. At this time, a first terminal nucleotide or first terminal oligonucleotide (200) is extended to the 3 'end of the first oligonucleotide (10) at the 3' end of the first strand, and a second oligonucleotide A second terminal nucleotide or a second terminal oligonucleotide (200 ') may be extended to the 3' end of the nucleotide (11).

In the present invention, the first capping nucleotide or first capping oligonucleotide; And the second terminal nucleotide or the second terminal oligonucleotide, they can be arranged opposite to each other in the double strand.

Also, in the present invention, the first capping nucleotide or first capping oligonucleotide; And the second terminal nucleotide or the second terminal oligonucleotide may be complementary or non-complementary to each other, or some sequences may be mismatched to form a bubble structure.

Also, in the present invention, the second or second cap oligonucleotide; And the first terminal nucleotide or the first terminal oligonucleotide, they may be arranged opposite to each other in the double strand.

Also in the present invention, the second capping nucleotide or the second capping oligonucleotide; And the first terminal nucleotide or first terminal oligonucleotide may be complementary or non-complementary to each other, or some sequences may be mismatched to form a bubble structure.

FIG. 9 illustrates the structure of a double stranded oligonucleotide according to an embodiment of the present invention. In FIG. 9, the first oligonucleotide at the 5 'end of the first strand (10) A second or first cap oligonucleotide 100 may be extended at the 5 ' end of the second oligonucleotide 11 which is the 5 ' end of the second strand. Also, a first terminal nucleotide or first terminal oligonucleotide (200) is extended to the 3 'end of the first extended oligonucleotide (20) which is the 3' terminal of the first strand, and the 3 'terminal A second terminal nucleotide or a second terminal oligonucleotide (200 ') may be extended to the 3' end of the second elongated oligonucleotide (21). Wherein the first or second cap oligonucleotide 100 is positioned facing the second terminal nucleotide or second terminal oligonucleotide 200 'and the second or third cap oligonucleotide 100 May be disposed opposite to the first terminal nucleotide or the first terminal oligonucleotide 200.

FIG. 10 illustrates the structure of a double stranded oligonucleotide according to an embodiment of the present invention. In FIG. 10, a first capnucleotide or a second oligonucleotide at the 5 'end of a first extended oligonucleotide 20, 1 cap oligonucleotide 100 is extended and a second or second cap oligonucleotide 100 'is extended at the 5' end of the second extended oligonucleotide 21, which is the 5 'end of the second strand have. Also, a first terminal nucleotide or a first terminal oligonucleotide (200) is extended at the 3 'end of the first oligonucleotide (10) at the 3' end of the first strand, and the terminal end of the first strand A second terminal nucleotide or oligonucleotide (200 ') may be extended to the 3' end of the 2 oligonucleotide (11). Wherein the first or second cap oligonucleotide 100 is positioned facing the second terminal nucleotide or second terminal oligonucleotide 200 'and the second or third cap oligonucleotide 100 May be disposed opposite to the first terminal nucleotide or the first terminal oligonucleotide 200.

11 shows the structure of a double stranded oligonucleotide according to an embodiment of the present invention. At the 3'end of the first oligonucleotide 10, the 5'end of the first elongated oligonucleotide 20 1 linker 300 and the 5'end of the second extended oligonucleotide 21 is connected to the 3'end of the second oligonucleotide 11 through the second linker 300 ' So that a second strand can be formed. Also, a first capnucleotide or a first cap oligonucleotide (100) is extended at the 5 'end of the first oligonucleotide (10) at the 5' end of the first strand, 2 oligonucleotide (11) may be extended to the 5 'end thereof with a second or second cap oligonucleotide (100').

12 shows a structure of a double stranded oligonucleotide according to an embodiment of the present invention, wherein the 5 'end of the first oligonucleotide 10 at the 3' end of the first elongated oligonucleotide 20 is the first Linker 300 and the 5'end of the second oligonucleotide 11 is connected to the 3'end of the second elongated oligonucleotide 21 through the second linker 300 ' A second strand can be formed. Also, a first capnucleotide or a first cap oligonucleotide (100) is extended at the 5 'end of the first extended oligonucleotide (20) at the 5' end of the first strand, and the 5 ' , A second or second cap oligonucleotide (100 ') may be extended to the 5' end of the second elongated oligonucleotide (21).

FIG. 13 shows the structure of a double stranded oligonucleotide according to an embodiment of the present invention, wherein the 5 'end of the first elongated oligonucleotide 20 at the 3' end of the first oligonucleotide 10 is the first Linker 300 and the 5'end of the second extended oligonucleotide 21 is connected to the 3'end of the second oligonucleotide 11 through the second linker 300 ' A second strand can be formed. Also, a first terminal nucleotide or first terminal oligonucleotide (200) is extended to the 3 'end of the first extended oligonucleotide (20) which is the 3' terminal of the first strand, and the 3 'terminal A second terminal nucleotide or a second terminal oligonucleotide (200 ') may be extended to the 3' end of the second elongated oligonucleotide (21).

FIG. 14 illustrates the structure of a double stranded oligonucleotide according to an embodiment of the present invention, wherein the 5 'end of the first oligonucleotide 10 at the 3' end of the first elongated oligonucleotide 20 is the first Linker 300 to form the first strand and the 5'end of the second oligonucleotide 11 at the 3'end of the second elongated oligonucleotide 21 is connected to the 3'end of the second elongated oligonucleotide 21 through the second linker 300 ' So that a second strand can be formed. Also, a first terminal nucleotide or a first terminal oligonucleotide (200) is extended at the 3 'end of the first oligonucleotide (10) at the 3' end of the first strand, and the terminal end of the first strand A second terminal nucleotide or a second terminal oligonucleotide (200 ') may be extended to the 3' end of the 2 oligonucleotide (20).

15 shows the structure of a double stranded oligonucleotide according to an embodiment of the present invention, wherein the 5 'end of the first elongated oligonucleotide 20 at the 3' end of the first oligonucleotide 10 is the first Linker 300 to form the first strand and the 5'end of the second extended oligonucleotide 21 at the 3'end of the second oligonucleotide 11 is connected to the 3'end of the second oligonucleotide 11 via the second linker 300 ' So that a second strand can be formed. Also, a first capnucleotide or a first cap oligonucleotide (100) is extended at the 5 'end of the first oligonucleotide (10) at the 5' end of the first strand, 2 oligonucleotide (11) may be extended to the 5 'end thereof with a second or second cap oligonucleotide (100'). Also, a first terminal nucleotide or first terminal oligonucleotide (200) is extended to the 3 'end of the first extended oligonucleotide (20) which is the 3' terminal of the first strand, and the 3 'terminal A second terminal nucleotide or a second terminal oligonucleotide (200 ') may be extended to the 3' end of the second elongated oligonucleotide (21). Wherein the first or second capped oligonucleotide 100 is positioned facing the second terminal nucleotide or second terminal oligonucleotide 200 'and the second or third cap oligonucleotide 100' The first linker 300 'may be disposed opposite to the first terminal nucleotide or the first terminal oligonucleotide 200 and the first linker 300 may be disposed opposite to the second linker 300' .

16 shows the structure of a double stranded oligonucleotide according to an embodiment of the present invention. The 5 'end of the first oligonucleotide 10 at the 3' end of the first elongated oligonucleotide 20 is the first Linker 300 to form the first strand and the 5'end of the second oligonucleotide 11 at the 3'end of the second elongated oligonucleotide 21 is connected to the 3'end of the second elongated oligonucleotide 21 through the second linker 300 ' So that a second strand can be formed. Also, a first capnucleotide or a first cap oligonucleotide (100) is extended at the 5 'end of the first extended oligonucleotide (20) at the 5' end of the first strand, and the 5 ' A second capnucleotide or a second cap oligonucleotide (100 ') may be extended to the 5' end of the second elongated oligonucleotide (21). Also, a first terminal nucleotide or a first terminal oligonucleotide (200) is extended at the 3 'end of the first oligonucleotide (10) at the 3' end of the first strand, and the terminal end of the first strand A second terminal nucleotide or a second terminal oligonucleotide (200 ') may be extended to the 3' end of the 2 oligonucleotide (11). Wherein the first or second capped oligonucleotide 100 is positioned facing the second terminal nucleotide or second terminal oligonucleotide 200 'and the second or third cap oligonucleotide 100' The first linker 300 'may be disposed opposite to the first terminal nucleotide or the first terminal oligonucleotide 200 and the first linker 300 may be disposed opposite to the second linker 300' .

According to one embodiment of the present invention, as double stranded oligonucleotides,

a first strand comprising a first oligonucleotide consisting of a contiguous nucleotide sequence from the 5 'end of a miRNA of length m nucleotides (nt) in length to a pth contiguous nucleotide sequence and a first stretch oligonucleotide; And

a second strand comprising a second oligonucleotide consisting of a contiguous sequence of bth to qth nucleotides from the 5 'end of the miRNA of length n nucleotides (nt) and a second stretch oligonucleotide,

Wherein the first elongated oligonucleotide can be hybridized with the second oligonucleotide,

The second elongated oligonucleotide may be hybridized with the first oligonucleotide,

m and n are each independently an integer of 18 to 25,

a and b are each independently an integer of 1 to 3,

p is an integer of 10 to m,

and q is an integer of 10 to n.

In the present invention, each of the first oligonucleotide and the second oligonucleotide includes the entire chain or fragment thereof of the desired miRNA, and more specifically, a mature miRNA, a miRNA precursor, a primary miRNA a precursor of a miRNA precursor in the form of a pri-miRNA or a plasmid, or a fragment thereof.

In the present invention, the miRNA (desired first miRNA) of the m nucleotide (nt) length and the miRNA (desired second miRNA) of the n nucleotide (nt) length may be the same or different from each other.

In the present invention, the sequences of the first oligonucleotide and the second oligonucleotide may be the same or different from each other.

In the present invention, the first oligonucleotide may consist of the first to pth consecutive nucleotide sequences from the 5 'terminus of m nucleotides (nt) in length.

In the present invention, the first oligonucleotide may consist of the second to pth consecutive nucleotide sequences from the 5 'terminus of m nucleotides (nt) long.

In the present invention, the second oligonucleotide may consist of a sequence of consecutive nucleotides from the 5 'end of the miRNA having n nucleotides (nt) to the first to qth nucleotides.

In the present invention, the second oligonucleotide may consist of the second to qth consecutive nucleotide sequences from the 5 'end of the miRNA having n nucleotides (nt) in length.

In the present invention, the first elongated oligonucleotide may hybridize with the second oligonucleotide. The first elongated oligonucleotide may have an oligonucleotide complementary to the 3'-5 'direction of the second oligonucleotide, at least 90%, at least 91% , 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, or 100% have.

In the present invention, the first elongated oligonucleotide may have a bubble structure including the second oligonucleotide and one or more mismatching nucleotides.

In the present invention, the second elongated oligonucleotide may hybridize with the first oligonucleotide. The second elongated oligonucleotide may have an oligonucleotide complementary to the 3'-5 'direction of the first oligonucleotide, at least 90%, at least 91% , 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, or 100% have.

Also, in the present invention, the first elongated oligonucleotide may have 90% or more, 91% or more, 92% or more, 90% or more, 90% or more, , 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, or 100% of the nucleotide sequence shown in SEQ ID NO:

In addition, in the present invention, the first elongated oligonucleotide may have at least 90%, at least 91%, at least 90%, at least 90%, at least 90%, at least 90%, at least 90% , More preferably 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, or 100% .

In the present invention, the second elongated oligonucleotide has 90% or more, 91% or more, 92% or more, 90% or more, 90% or more, , 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, or 100% of the nucleotide sequence shown in SEQ ID NO:

In addition, in the present invention, the second elongated oligonucleotide may have 90% or more, 91% or more, 90% or more, 90% or more, 90% or more, , More preferably 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, or 100% .

In the present invention, the first oligonucleotide and the first elongated oligonucleotide may be directly connected to each other, but a first linker between the first oligonucleotide and the first elongated oligonucleotide, a first linker nucleotide or a first linker oligo- Nucleotides. &Lt; / RTI > The specific sequence is not particularly limited and includes nucleotides wherein the base is adenine (A), the nucleotide whose base is uracil (U), the nucleotide whose base is guanine (G), the base is cytosine Nucleotides, or combinations thereof.

In the present invention, the first linker nucleotide may be a (p + 1) th nucleotide from the 5 'end of the m nucleotide (nt) length miRNA. Here, p may be an integer of 10 to m-1.

In the present invention, the first linker oligonucleotide may be an oligonucleotide consisting of p + 1-th to p + r-th consecutive nucleotide sequences from the 5 'end of the m nucleotide (nt) length miRNA. Here, r may be an integer of 2 to 4. Here, p is an integer of 10 or more, and its maximum value may be an integer of m-4 to m-2.

In the present invention, the second oligonucleotide and the second elongated oligonucleotide may be directly connected to each other, but a second linker between the second oligonucleotide and the second elongated oligonucleotide, and a second linker nucleotide or second linker oligo- Nucleotides. &Lt; / RTI > The specific sequence is not particularly limited and includes nucleotides wherein the base is adenine (A), the nucleotide whose base is uracil (U), the nucleotide whose base is guanine (G), the base is cytosine Nucleotides, or combinations thereof.

In the present invention, the second linker nucleotide may be a (q + 1) th nucleotide from the 5 'end of the miRNA having the length of n nucleotides (nt). Here, the q may be an integer of 10 to n-1.

In the present invention, the second linker oligonucleotide may be an oligonucleotide consisting of consecutive base sequences of (q + 1) th through (q + s) th nucleotides from the 5 'end of the n nucleotide (nt) length miRNA. Here, s may be an integer of 2 to 4. Here, q is an integer of 10 or more, and its maximum value may be an integer of n-4 to n-2.

The present invention may further comprise a first capnucleotide or a first cap oligonucleotide at the 5 'end of the first strand, the 5' end of the first oligonucleotide or the 5 'end of the first extended oligonucleotide, Wherein the first oligonucleotide comprises a second to pth consecutive nucleotide sequence or a third to pth consecutive nucleotide sequence from the 5 'terminus of the m nucleotide (nt) length of the miRNA, The oligonucleotide may further comprise a first capping nucleotide or a first capping oligonucleotide at the 5 ' end of the oligonucleotide.

In the present invention, the sequence of the first capping nucleotide is not particularly limited, but may be a nucleotide whose nucleotide is uracil (U), a first nucleotide from the 5 'end of the m nucleotide (nt) But is not limited thereto.

In the present invention, the sequence of the first cap oligonucleotide is not particularly limited, but the base may include a nucleotide of uracil (U), or the nucleotide sequence of m nucleotides (nt) Th to third consecutive oligonucleotides, or first to second consecutive oligonucleotides, but are not limited thereto.

In the present invention, a second or third cap oligonucleotide may be further included at the 5 'end of the second strand, the 5' end of the second oligonucleotide or the 5 'end of the second extended oligonucleotide, Wherein said second oligonucleotide consists of a contiguous nucleotide sequence from the 5 'end of the miRNA of length n nucleotides (nt) to the contiguous nucleotide sequence from the 2 nd to q th contiguous nucleotides or from the 3 rd to q th contiguous nucleotide sequence, And may further comprise a second capping nucleotide or a second capping oligonucleotide at the 5 ' end of the oligonucleotide.

In the present invention, the sequence of the second capnucleotide is not particularly limited, but may be a nucleotide whose nucleotide is uracil (U), a first nucleotide from the 5 'end of the n nucleotide (nt) But is not limited thereto.

In the present invention, the sequence of the second cap oligonucleotide is not particularly limited, but the base may include a uracil (U) nucleotide, or the nucleotide sequence of the n nucleotide (nt) Th to third consecutive oligonucleotides, or first to second consecutive oligonucleotides, but are not limited thereto.

In the present invention, at least one of the first and second capnucleotides is a nucleotide whose base is uracil (U), which can increase mutual binding ability with a target gene.

In the present invention, at least one of the first cap oligonucleotide and the second cap oligonucleotide includes a nucleotide whose nucleotide sequence is uracil (U), thereby enhancing mutual binding ability with a target gene.

In the present invention, a first terminal nucleotide or a first terminal oligonucleotide may be further included at the 3 'end of the first strand, the 3' end of the first extended oligonucleotide or the 3 'end of the first oligonucleotide.

In the present invention, the sequence of the first terminal nucleotide is not particularly limited, but it may be a nucleotide whose base is adenine (A) or the mth nucleotide of the m nucleotide (nt) long miRNA.

In the present invention, the sequence of the first terminal oligonucleotide is not particularly limited, but includes nucleotides whose bases are adenine (A), mc to m (m) from the 5 'end of the m nucleotide (nt) Th < / RTI > contiguous base sequence. Here, c may be an integer of 1 to 3, or an integer of 1 or 2.

In the present invention, it may further comprise a second terminal nucleotide or a second terminal oligonucleotide at the 3 'end of the second strand, the 3' end of the second extended oligonucleotide, or the 3 'end of the second oligonucleotide.

In the present invention, the sequence of the second terminal nucleotide is not particularly limited, but may be a nucleotide whose base is adenine (A) or the nth nucleotide of the miRNA having the length of n nucleotides (nt).

In the present invention, the sequence of the second terminal oligonucleotide is not particularly limited, but includes nucleotides whose bases are adenine (A), nth nucleotides from the 5 'terminal of the n nucleotide (nt) Th < / RTI > contiguous base sequence. Here, d may be an integer of 1 to 3, or an integer of 1 or 2.

According to another embodiment of the present invention, as a double stranded oligonucleotide,

A first strand comprising a first fragment of a first miRNA precursor of interest and a first strand comprising a second strand of a first oligonucleotide;

A second strand comprising a second fragment of the second miRNA precursor and a second fragment of the second miRNA precursor;

A third strand comprising the < RTI ID = 0.0 > 1-3 < / RTI > oligonucleotide which is another fragment of the desired first miRNA precursor;

And a fourth strand comprising a second fragment of the second miRNA precursor of interest, the second strand of the second oligonucleotide,

Wherein one end of the first strand is connected to one end of the second strand or the fourth strand,

Wherein one end of the third strand is connected to one end of the fourth strand or the second strand.

In the present invention, the first miRNA precursor and the second miRNA precursor are precursors of a miRNA (hereinafter, referred to as 'desired miRNA') known to function as a target by regulating the expression of a target gene, But may be in the form of a hairpin. The nucleic acid molecule constituting it may have a length of 50 to 150 nt, preferably 60 to 100 nt, more preferably 65 to 95 nt.

In the present invention, the first miRNA precursor and the second miRNA precursor may be the same or different.

In the present invention, each of said first 1-1 oligonucleotide, first 1-2 oligonucleotide and first 1-3 oligonucleotide is an arbitrary fragment of said first miRNA precursor and these sequences are completely different from each other, And the sequence thereof is not particularly limited.

However, in the present invention, the 1-1 oligonucleotide and the 1-2 oligonucleotide are contiguous to the first miRNA precursor, and any two fragments that can be cleaved by the action of a dicer .

Preferably, the 1-1 oligonucleotide of the present invention may include a full sequence or a seed sequence of a miRNA that regulates the expression of a target gene in the human body to perform a desired function.

In the present invention, the 2-1 oligonucleotides, the 2-2 oligonucleotides and the 2-3 oligonucleotides are each an arbitrary fragment of the second miRNA precursor, and these sequences may be completely different from each other, And their sequences are not particularly limited.

However, in the present invention, the 2-1 oligonucleotide and the 2-2 oligonucleotide may be any two fragments that are arranged contiguously to the second miRNA precursor and can be cleaved by the action of a dicer.

In the present invention, the 2-1 oligonucleotide may include a full sequence or a seed sequence of a miRNA that regulates expression of a target gene in the human body to perform a desired function.

Figures 17-24 illustrate the effect of the first miRNA precursor 50a, the 1-2 oligonucleotide 50b, and the 1-3 oligonucleotide 50c on the first miRNA precursor in the form of a hairpin in accordance with one embodiment of the present invention. Wherein each of the first 1-1 oligonucleotide 50a, the 1-2 oligonucleotide 50b and the 1-3 oligonucleotide 50c comprises 5'-3 of the first miRNA precursor Direction or in the 3'-5 'direction. Herein, the 1-1 oligonucleotide may include a full sequence or a seed sequence of a miRNA which cleaves from the first miRNA precursor in the human body and regulates the expression of a target gene to perform a desired function. Also, the first 1-2 oligonucleotide is a fragment disposed adjacent to the first oligonucleotide in the first miRNA precursor, but not limited thereto, 1 < / RTI > oligonucleotides. In addition, the first and second oligonucleotides and the first to third oligonucleotides may be any two fragments located in a loop in the first miRNA in the shape of a hair pin, although not limited thereto.

Although not shown in the drawings in the present invention, the 2-1 oligonucleotides, the 2-2 oligonucleotides and the 2-3 oligonucleotides are also attached to the 5'-3 'or 3'-5' direction of the second miRNA precursor And may be any three intercepts arranged in succession. Here, the 2-1 oligonucleotide may include a full sequence or a seed sequence of a miRNA that cleaves from the second miRNA precursor in the human body and regulates expression of a target gene to perform a desired function. The 2-2 oligonucleotide may also be a fragment located adjacent to the 2-1 oligonucleotide in the second miRNA precursor, but not limited thereto, by the action of a dicer, the 2- 1 < / RTI > oligonucleotides. In addition, the 2-2 oligonucleotide and the 2-3 oligonucleotide may be any two fragments located in a loop in the first miRNA in the form of a hair pin, although not limited thereto.

In the present invention, the 1-1 oligonucleotide and the 2-1 oligonucleotide may be the same or different from each other.

In the present invention, the 1-2 oligonucleotide and the 2-2 oligonucleotide may be the same or different from each other.

In the present invention, the first to third oligonucleotides and the second to third oligonucleotides may be the same or different from each other.

In the first strand of the present invention, one end of the first oligonucleotide may be connected to one end of the first oligonucleotide, and preferably the 5 < th > end of the first oligonucleotide May be linked to the 3 ' end of the 1-1 oligonucleotide, or the 5 ' end of the 1-1 oligonucleotide may be linked to the 3 ' end of the 1-2 oligonucleotide.

In the present invention, the 1-1 oligonucleotide and the 1-2 oligonucleotide may be directly linked, or may be a 1-1 linker between the 1-1 oligonucleotide and the 1-2 oligonucleotide, 1-1 linker nucleotides or 1-1 linker oligonucleotides. The specific sequence is not particularly limited and includes nucleotides wherein the base is adenine (A), the nucleotide whose base is uracil (U), the nucleotide whose base is guanine (G), the base is cytosine Nucleotides, or combinations thereof.

Also, in the second strand of the present invention, one end of the 2-1 oligonucleotide may be connected to one terminal of the 2-2 oligonucleotide, and preferably 5 < th > oligonucleotide of the 2-1 oligonucleotide Terminus of the second oligonucleotide may be connected to the 3'end of the second oligonucleotide, or the 5'end of the second oligonucleotide may be connected to the 3'end of the second oligonucleotide.

In the present invention, the 2-2 oligonucleotide and the 2-1 oligonucleotide can be directly linked, or the 2-2 oligonucleotide and the 2-1 oligonucleotide can be linked as a 2-1 linker, 2 < / RTI > linker nucleotides or second-1 linker oligonucleotides. The specific sequence is not particularly limited and includes nucleotides wherein the base is adenine (A), the nucleotide whose base is uracil (U), the nucleotide whose base is guanine (G), the base is cytosine Nucleotides, or combinations thereof.

Further, in the present invention, the third strand may further comprise a first extended oligonucleotide.

In the present invention, the first extended oligonucleotide may be hybridized with the first oligonucleotide.

In the present invention, the first elongated oligonucleotide has 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, , 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, or 100% of the nucleotide sequence shown in SEQ ID NO:

In the present invention, the first elongated oligonucleotide may include the first oligonucleotide and one or more mismatching nucleotides to form a bubble structure.

In the present invention, in the third strand, one end of the first oligonucleotide may be connected to one end of the first elongated oligonucleotide, and preferably, the 5'- May be linked to the 3 ' end of the first oligonucleotide, or the 5 ' end of the first oligonucleotide may be connected to the 3 ' end of the first elongated oligonucleotide.

In the present invention, the first to third oligonucleotides and the first elongated oligonucleotide can be directly linked, or alternatively, as the first to second linker between the first to third oligonucleotides and the first elongated oligonucleotide, 2 linker nucleotide or a 1-2 linker oligonucleotide. The specific sequence is not particularly limited and includes nucleotides wherein the base is adenine (A), the nucleotide whose base is uracil (U), the nucleotide whose base is guanine (G), the base is cytosine Nucleotides, or combinations thereof.

In the present invention, in the case of including the 1-1 linker and the 1-2 linker, they may be disposed facing each other in the double strand.

Further, in the present invention, the 1-1 linker and the 1-2 linker may be complementary or non-complementary to each other, or some sequences may be mismatched to form a bubble structure.

In the present invention, the first to third oligonucleotides and the first to third oligonucleotides may be complementary or non-complementary to each other, or some sequences may be mismatched to form a bubble structure.

In addition, in the present invention, the fourth strand may further comprise a second extended oligonucleotide.

In the present invention, the second elongated oligonucleotide may be hybridized with the second oligonucleotide.

In the present invention, the second elongated oligonucleotide has 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, , 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, or 100% of the nucleotide sequence shown in SEQ ID NO:

In the present invention, the second elongated oligonucleotide may have a bubble structure including the second-1 oligonucleotide and one or more mismatching nucleotides.

In the present invention, one end of the second elongated oligonucleotide may be connected to one end of the second oligonucleotide, and preferably, the 5 'end of the second elongated oligonucleotide is linked to the second oligonucleotide Terminal of the second elongated oligonucleotide, or the 5 'end of the second oligonucleotide may be connected to the 3' end of the second elongated oligonucleotide.

In the present invention, the second extended oligonucleotide and the second-3 < th > oligonucleotide can be directly linked, or the second extended oligonucleotide and the second-3 & 2 linker nucleotides or a 2-2 linker oligonucleotide. The specific sequence is not particularly limited and includes nucleotides wherein the base is adenine (A), the nucleotide whose base is uracil (U), the nucleotide whose base is guanine (G), the base is cytosine Nucleotides, or combinations thereof.

In the present invention, when the second-1 linker and the second-2 linker are included, they may be disposed facing each other in the double strand.

In the present invention, the 2-1 linker and the 2-2 linker may be complementary or non-complementary to each other, or a part of the sequences may be mismatched to form a bubble structure.

In the present invention, the 2-2 oligonucleotide and the 2-3 oligonucleotide may be complementary or non-complementary to each other, or some sequences may be mismatched to form a bubble structure.

In the present invention, one end of the first strand may be connected to one end of the second strand or the fourth strand. Preferably, the 3 'end of the first strand is connected to the 5' end of the second strand, or the 3 'end of the first strand is connected to the 5' end of the fourth strand, The 3 'end of the strand may be connected to the 5' end of the first strand, or the 3 'end of the fourth strand may be connected to the 5' end of the first strand.

In the present invention, one end of the third strand may be connected to one end of the fourth strand or the second strand. Preferably, the 3 'end of the fourth strand is connected to the 5' end of the third strand, or the 3 'end of the second strand is connected to the 5' end of the third strand, The 3 'end of the strand may be connected to the 5' end of the fourth strand, or the 3 'end of the third strand may be connected to the 5' end of the second strand.

25 shows the structure of a double-stranded oligonucleotide according to an embodiment of the present invention. At the 3 'end of the first oligonucleotide 50a, the 5'-end of the first oligonucleotide 50b And the 5'end of the 2-1 oligonucleotide 60a is connected to the 3'end of the 2-2 oligonucleotide 60b to form the second strand. The 5'end of the first elongated oligonucleotide 70 complementary to the 3'-5 'direction of the first oligonucleotide 50a at the 3'end of the first oligonucleotide 50c Is attached to the 3'-end of the second elongated oligonucleotide (71), which is complementary to the 3'-5 'direction of the second oligonucleotide (60a) The 5'end of the second strand 60b may be connected to form the fourth strand. At this time, the 5 'end of the 2-2 oligonucleotide (60b) at the 5' end of the second strand is connected to the 3 'end of the 1-2 oligonucleotide (50b) at the 3' end of the first strand Can be formed. Also, the 5'-end of the 3 < th > end of the 3 < rd > oligonucleotide 60c of the fourth strand is connected to the 5 & .

Figure 26 shows the structure of a double stranded oligonucleotide according to an embodiment of the present invention, wherein the 5'end of the 1-2 oligonucleotide (50b) at the 3'end of the 1-1 oligonucleotide (50a) And the 5'end of the second oligonucleotide 60b is connected to the 3'end of the second oligonucleotide 60a to form the second strand. The 5'end of the first elongated oligonucleotide 70 complementary to the 3'-5 'direction of the first oligonucleotide 50a at the 3'end of the first oligonucleotide 50c Is linked to form a third strand and a second extended oligonucleotide complementary to the 3'-5 'direction of the second oligonucleotide (60a) at the 3'end of the second oligonucleotide (60c) And the 5 'end of the first strand 71 may be connected to form the fourth strand. At this time, the 5 'terminus of the second to third oligonucleotide (60c) at the 5' end of the fourth strand is connected to the 3 'end of the first to third oligonucleotide (50b) Can be formed. The 5'-terminal of the 3 < rd > oligonucleotide (50c) which is the 5'-end of the third strand is attached to the 3'-end of the 2-2 oligonucleotide (60b) It can be connected to form another strand.

27 shows the structure of a double-stranded oligonucleotide according to an embodiment of the present invention. The 5'-end of the first oligonucleotide 50a at the 3'end of the 1-2 oligonucleotide 50b And the 5'end of the 2-1 oligonucleotide 60a is connected to the 3'end of the 2-2 oligonucleotide 60b to form the second strand. The 3'-end of the first elongated oligonucleotide 70 complementary to the 3'-5 'direction of the first oligonucleotide 50a is linked to the 5'end of the first oligonucleotide 50c At the 3 'end of the second elongated oligonucleotide (71), which is complementary to the 3'-5' direction of the second oligonucleotide (60a), and a second oligonucleotide The 5'-end of the second strand 60c may be connected to form the fourth strand. At this time, the 5'-terminal of the 1-2 oligonucleotide (50b) at the 5'-end of the first strand is connected to the 3'-terminal of the 3'-terminal oligonucleotide (60c) So that one strand can be formed. The 5'-terminal of the 2-2 oligonucleotide (60b) at the 5 'end of the second strand is connected to the 3'-terminal of the 1-3 oligonucleotide (50c) at the 3' end of the third strand It can be connected to form another strand.

a first 1-1 oligonucleotide consisting of a consecutive base sequence of the A-th to B-th nucleotides from the 5 'end or the 3' end of the first miRNA precursor of t nucleotide (nt) A first strand comprising a 1-2 oligonucleotide consisting of a contiguous base sequence;

a second-1 oligonucleotide consisting of a C-th to D-th consecutive nucleotide sequence from the 5 'end or the 3' end of a u mi nucleotide (nt) long second miRNA precursor, and D + A second strand comprising the 2-2 oligonucleotide consisting of the nucleotide sequence;

A third strand comprising a first to third oligonucleotide consisting of a B + wth to B + xth consecutive nucleotide sequence from the 5'end or the 3'end of the first miRNA precursor of the t nucleotide (nt) length; And

A fourth strand comprising a second to third oligonucleotide consisting of D + y-th to D + z-th consecutive nucleotide sequences from the 5'end or 3'end of the second miRNA precursor of the u nucleotide (nt) Including,

Wherein one end of the third strand is connected to one end of the fourth strand or the second strand,

T and u are each independently an integer of 60 to 150,

A and C are each independently an integer of 1 to 10,

B and D are each independently an integer of 18 to 25,

Each of e and g is independently an integer of 1 to 5,

F and h are each independently an integer of 5 to 57,

W and y are each independently an integer of 6 to 62,

Each of x and z may be an integer of 11 to 119 independently.

However, in the present invention, the first 1-1 oligonucleotide and the first 1-2 oligonucleotide may be any two fragments that are arranged contiguously to the first miRNA precursor and can be cleaved by the action of a dicer.

In the first strand of the present invention, one end of the first oligonucleotide may be connected to one end of the first oligonucleotide, and preferably the 5 < th > end of the first oligonucleotide May be linked to the 3 'end of the 1-1 oligonucleotide, or the 5' end of the 1-1 oligonucleotide may be connected to the 3 'end of the 1-2 oligonucleotide.

In the present invention, the third strand may further comprise a first elongated oligonucleotide.

In the present invention, one end of the first to third oligonucleotides may be connected to one end of the first extending oligonucleotide, and preferably, the 5 'end of the first extending oligonucleotide is linked to the first to third oligonucleotides. Terminal of the first oligonucleotide, or the 5'end of the first oligonucleotide may be connected to the 3'end of the first elongated oligonucleotide.

In the present invention, the fourth strand may further comprise a second extended oligonucleotide.

According to another embodiment of the present invention, there is provided a method for producing a double stranded oligonucleotide,

Preparing a desired first oligonucleotide and a second oligonucleotide;

Synthesizing a first elongated oligonucleotide capable of hybridizing with the second oligonucleotide; And

And synthesizing a second elongated oligonucleotide capable of hybridizing with the first oligonucleotide.

In the present invention, the first oligonucleotide may include a full-length chain of a desired first miRNA or a fragment thereof, which is known to have a desired function by regulating the expression of a target gene.

In the present invention, the second oligonucleotide may include the entire chain of the desired second miRNA or a fragment thereof, which is known to function as a target by regulating the expression of the target gene.

In the present invention, the length of the entire chain of each of the desired first miRNA and the desired second miRNA is not particularly limited, but may be a length of 18 to 25 nucleotides.

Also, in the present invention, each of the first oligonucleotide and the second oligonucleotide may be a mature miRNA as described above, but may be a miRNA precursor, a primary miRNA (pri-miRNA) or a miRNA precursor in the form of a plasmid &Lt; / RTI > or a fragment thereof. However, in the present invention, the nucleic acid molecule constituting the miRNA precursor or the primary miRNA may have a length of 50 to 100 nt, more preferably 65 to 95 nt.

In the present invention, the miRNA fragment may comprise the nucleotide sequence of the desired miRNA or a nucleotide sequence having 90% or more homology with the seed sequence.

In the present invention, one end of the first elongated oligonucleotide can be connected to one end of the first oligonucleotide, and preferably, the 5 'end of the first elongated oligonucleotide can be linked to the 3' end of the first oligonucleotide. Terminus of the first oligonucleotide, or the 5 'end of the first oligonucleotide may be linked to the 3' end of the first elongated oligonucleotide.

In the present invention, one end of the second elongated oligonucleotide may be connected to one end of the second oligonucleotide, and preferably, the 5 'end of the second elongated oligonucleotide may be linked to the 3' end of the second oligonucleotide. Terminus of the second oligonucleotide, or the 5 'end of the second oligonucleotide may be linked to the 3' end of the second elongated oligonucleotide.

In the present invention, preferably, the 5'end of the first elongated oligonucleotide is connected to the 3'end of the first oligonucleotide, and the 5'end of the second elongated oligonucleotide is ligated to the 3'end of the second oligonucleotide .

In the present invention, preferably, the 5 'end of the first oligonucleotide is connected to the 3' end of the first elongating oligonucleotide, and the 5 'end of the second oligonucleotide is connected to the 3' end of the second elongating oligonucleotide .

In the present invention, a first capping nucleotide or a first capping oligonucleotide may be further extended at the 5 'end of the first strand, the 5' end of the first oligonucleotide or the 5 'end of the first extending oligonucleotide.

In the present invention, a second or second cap oligonucleotide may be further extended at the 5 'end of the second strand, the 5' end of the second oligonucleotide or the 5 'end of the second extended oligonucleotide.

In the present invention, the first oligonucleotide can be directly linked to the first elongated oligonucleotide, but the first linker nucleotide or the first linker oligonucleotide can be further included as a first linker therebetween. The specific sequence is not particularly limited and includes nucleotides wherein the base is adenine (A), the nucleotide whose base is uracil (U), the nucleotide whose base is guanine (G), the base is cytosine Nucleotides, or combinations thereof.

In the present invention, the second oligonucleotide can be directly linked to the second elongated oligonucleotide, but a second linker, a second linker nucleotide or a second linker oligonucleotide can be further included between the second oligonucleotide and the second elongated oligonucleotide. The specific sequence is not particularly limited and includes nucleotides wherein the base is adenine (A), the nucleotide whose base is uracil (U), the nucleotide whose base is guanine (G), the base is cytosine Nucleotides, or combinations thereof.

In the present invention, a first terminal nucleotide or a first terminal oligonucleotide may be further extended at the 3 'end of the first strand, the 3' end of the first elongated oligonucleotide or the 3 'end of the first oligonucleotide.

In the present invention, the sequence of the first terminal nucleotide is not particularly limited, but the nucleotide may be a nucleotide which is adenine (A) or a first or second nucleotide from the 3 'end of the desired first miRNA, It is not.

In the present invention, the sequence of the first terminal oligonucleotide is not particularly limited, but it may include a nucleotide whose base is adenine (A), or a nucleotide sequence of the first to third But are not limited to, a contiguous oligonucleotide, or a first to a second contiguous oligonucleotide.

In the present invention, a second terminal nucleotide or a second terminal oligonucleotide can be further extended at the 3 'end of the second strand, the 3' end of the second extended oligonucleotide, or the 3 'end of the second oligonucleotide.

In the present invention, the sequence of the second terminal nucleotide is not particularly limited, but it may be a nucleotide whose base is adenine (A) or a first or second nucleotide from the 3 'end of the desired second miRNA, It is not.

In the present invention, the sequence of the second terminal oligonucleotide is not particularly limited. However, the base may include nucleotides of adenine (A), or the nucleotide sequence of the first to third But are not limited to, a contiguous oligonucleotide, or a first to a second contiguous oligonucleotide.

In the present invention, the first capping nucleotide or first capping oligonucleotide; And when extending the second terminal nucleotide or second terminal oligonucleotide, they can be placed facing each other within the double strand.

Also, in the present invention, the second or second cap oligonucleotide; And when extending the first terminal nucleotide or first terminal oligonucleotide, they may be placed opposite each other within the double strand.

However, the order of synthesizing each oligonucleotide in the production method of the present invention and the order of linking each synthesized oligonucleotide are not particularly limited.

According to one embodiment of the present invention, there is provided a method for producing a double stranded oligonucleotide,

preparing a first oligonucleotide consisting of a consecutive nucleotide sequence from the a-th to the p-th nucleotide sequence from the 5 'end of the miRNA of length m nucleotides (nt);

preparing a second oligonucleotide consisting of a contiguous base sequence of the b-th to q-th nucleotides from the 5 'end of the miRNA of length n nucleotides (nt);

And synthesizing a second elongated oligonucleotide capable of hybridizing with the first oligonucleotide,

M and n are each independently an integer of 18 to 25,

a and b are each independently an integer of 1 to 3,

P is an integer of 10 to m,

And q is an integer of 10 to n.

In the present invention, each of the first oligonucleotide and the second oligonucleotide is a full sequence of miRNA or a fragment thereof, wherein mRNAs of miRNAs, miRNA precursors, primary miRNAs (pri-miRNAs) or plasmids And may include a full sequence of the precursor or a fragment thereof.

In the present invention, the miRNA having the length of m nucleotides (nt) and the miRNA having the length of n nucleotides (nt) may be the same or different from each other.

In the present invention, the first elongated oligonucleotide may hybridize with the second oligonucleotide. The first elongated oligonucleotide may hybridize with the oligonucleotide capable of hybridizing with the 3'-5 'direction base sequence of the second oligonucleotide by 90% or more, 91 Or more, more preferably 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, or 100% Can be produced.

In the present invention, the second elongated oligonucleotide may hybridize with the first oligonucleotide. The second elongated oligonucleotide may have 90% or more, 91% or more, , 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, or 100% have.

In the present invention, the first elongated oligonucleotide may have 90% or more, 91% or more, 92% or more, 90% or more, 90% or more, , And more preferably 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more or 100%

In the present invention, the first elongated oligonucleotide has 90% or more, 91% or more, 92% or more, 90% or more, 90% or more, , 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, or 100% of the nucleotide sequence shown in SEQ ID NO:

In the present invention, preferably, the 5 'end of the first elongated oligonucleotide may be linked to the 3' end of the first oligonucleotide, and the 5 'end of the second elongated oligonucleotide may be linked to the 3' Quot; terminal. &Lt; / RTI >

In the present invention, preferably, the 5'end of the first oligonucleotide may be connected to the 3'end of the first elongated oligonucleotide, and the 5'end of the second oligonucleotide may be linked to the 3'end of the second elongated oligonucleotide. Quot; terminal. &Lt; / RTI >

Further, in the present invention, a first capnucleotide or a first cap oligonucleotide may be further extended at the 5 'end of the first strand, the 5' end of the first oligonucleotide, or the 5 'end of the first extended oligonucleotide have.

In the present invention, a second or second cap oligonucleotide may be further extended at the 5'-end of the second strand, the 5'-end of the second oligonucleotide, or the 5'-end of the second extended oligonucleotide.

In the present invention, it is preferable that, prior to connecting the 5 'end of the first elongated oligonucleotide to the 3' end of the first oligonucleotide, the 3'end of the first oligonucleotide or the 5'end of the first elongated oligonucleotide A first linker nucleotide or a first linker oligonucleotide. The specific sequence is not particularly limited and includes nucleotides wherein the base is adenine (A), the nucleotide whose base is uracil (U), the nucleotide whose base is guanine (G), the base is cytosine Nucleotides, or combinations thereof.

In the present invention, the first linker oligonucleotide may be an oligonucleotide consisting of p + 1-th to p + r-th consecutive nucleotide sequences from the 5 'end of the m nucleotide (nt) length miRNA. Here, r may be an integer of 2 to 4. Herein, p is at least 10, and the maximum value thereof may be an integer of m-4 to m-2.

Also, in the present invention, before the 5'end of the second elongated oligonucleotide is linked to the 3'end of the second oligonucleotide, the 3'end of the second oligonucleotide, or the 5'end of the second elongated oligonucleotide, A second linker nucleotide or a second linker oligonucleotide may be further included at the end. The specific sequence is not particularly limited and includes nucleotides wherein the base is adenine (A), the nucleotide whose base is uracil (U), the nucleotide whose base is guanine (G), the base is cytosine Nucleotides, or combinations thereof.

In the present invention, the second linker oligonucleotide may be an oligonucleotide consisting of consecutive base sequences of (q + 1) th through (q + s) th nucleotides from the 5 'end of the n nucleotide (nt) length miRNA. Here, s may be an integer of 2 to 4. Here, p is at least 10, and the maximum value thereof may be an integer of n-4 to n-2.

Further, in the present invention, a first terminal nucleotide or a first terminal oligonucleotide can be further extended at the 3 'end of the first strand, the 3' end of the first elongated oligonucleotide or the 3 'end of the first oligonucleotide .

In the present invention, a second terminal nucleotide or a second terminal oligonucleotide can be further extended at the 3 'end of the second strand, the 3' end of the second elongated oligonucleotide or the 3 'end of the second oligonucleotide .

Preparing a first strand comprising a first fragment of a first miRNA precursor of interest and a first strand comprising a second strand of a first oligonucleotide;

Preparing a second strand comprising a first fragment of a desired second miRNA precursor and a second strand comprising a second strand of the second strand and a second strand of the second strand;

Preparing a third strand comprising the < RTI ID = 0.0 > 1-3 < / RTI > oligonucleotide which is another fragment of the desired first miRNA precursor;

Preparing a fourth strand comprising a second fragment of the desired second miRNA precursor, a second strand of the second strand, And

Connecting one end of the first strand to one end of the second strand or the fourth strand and connecting one end of the third strand to one end of the fourth strand or the second strand . &Lt; / RTI >

In the present invention, the first miRNA precursor and the second miRNA precursor are precursors of the desired miRNA, and the shape thereof is not particularly limited, but may be a hairpin shape. The nucleic acid molecule constituting it may have a length of 50 to 150 nt, preferably 60 to 100 nt, more preferably 65 to 95 nt.

Preferably, the 1-1 oligonucleotide of the present invention may include a seed or a full-length sequence of a miRNA that regulates the expression of a target gene in the human body to perform a desired function.

In the first strand of the present invention, one end of the first oligonucleotide may be connected to one end of the first oligonucleotide, and preferably, the 5 < th > Terminus of the first oligonucleotide may be linked to the 3'end of the first oligonucleotide or the 5'end of the first oligonucleotide may be ligated to the 3'end of the first oligonucleotide.

In the present invention, before one end of the first oligonucleotide is connected to one end of the first oligonucleotide, the first oligonucleotide is added to the first oligonucleotide, As the 1-1 linker, a 1-1 linker nucleotide or a 1-1 linker oligonucleotide can be further included. The specific sequence is not particularly limited and includes nucleotides wherein the base is adenine (A), the nucleotide whose base is uracil (U), the nucleotide whose base is guanine (G), the base is cytosine Nucleotides, or combinations thereof.

Further, in the second strand of the present invention, one terminal of the second oligonucleotide may be connected to one terminal of the second oligonucleotide, preferably, the second terminal of the second oligonucleotide Terminus of the second oligonucleotide may be linked to the 3 'end of the second oligonucleotide, or the 5' terminus of the second oligonucleotide may be ligated to the 3 'terminus of the second oligonucleotide .

In the present invention, it is preferable that, at one end of the second oligonucleotide, one end of the second oligonucleotide is linked to the second oligonucleotide before the other end of the second oligonucleotide, -1 linker, the second-1 linker nucleotide or the second-1 linker oligonucleotide. The specific sequence is not particularly limited and includes nucleotides wherein the base is adenine (A), the nucleotide whose base is uracil (U), the nucleotide whose base is guanine (G), the base is cytosine Nucleotides, or combinations thereof.

The third strand of the present invention may further comprise a first extended oligonucleotide.

In the present invention, the first elongated oligonucleotide may be hybridized with the first oligonucleotide. The first elongated oligonucleotide may have an oligonucleotide complementary to the 3'-5 'direction of the first oligonucleotide and at least 90% , 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% Can be synthesized and manufactured.

Also, in the present invention, the first elongated oligonucleotide may have a bubble structure including the first oligonucleotide and one or more mismatching nucleotides.

In the present invention, in the third strand, one end of the first elongated oligonucleotide may be connected to one end of the first oligonucleotide, preferably, the 5'end of the first elongated oligonucleotide May be linked to the 3 'end of the first oligonucleotide, or the 5' end of the first oligonucleotide may be linked to the 3 'end of the first elongated oligonucleotide.

In the present invention, prior to connecting one end of the first elongated oligonucleotide to one end of the first oligonucleotide, the first elongated oligonucleotide is hybridized with the first elongated oligonucleotide and the first elongated oligonucleotide, 2 linker, a 1-2 linker nucleotide or a 1-2 linker oligonucleotide can be further included. The specific sequence is not particularly limited and includes nucleotides wherein the base is adenine (A), the nucleotide whose base is uracil (U), the nucleotide whose base is guanine (G), the base is cytosine Nucleotides, or combinations thereof.

The fourth strand of the present invention may further comprise a second elongated oligonucleotide.

In the present invention, the second elongated oligonucleotide may hybridize with the second oligonucleotide, and the second oligonucleotide may hybridize with the oligonucleotide complementary to the nucleotide sequence in the 3'-5 'direction of the second oligonucleotide by 90% or more , 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% Can be synthesized and manufactured.

Also, in the present invention, the second elongated oligonucleotide may have a bubble structure including the second-1 oligonucleotide and one or more mismatching nucleotides or mismatching oligonucleotides.

In the present invention, in the fourth strand, one end of the second elongated oligonucleotide may be connected to one end of the second oligonucleotide, preferably, the 5'-end of the second oligonucleotide To the 3'end of the second elongated oligonucleotide, or the 5'end of the second elongated oligonucleotide to the 3'end of the second elongated oligonucleotide.

In the present invention, prior to connecting one end of the second oligonucleotide to one end of the second elongated oligonucleotide, the second elongated oligonucleotide is linked to the second elongated oligonucleotide, 2 linker nucleotide or a second 2-linker oligonucleotide may be further included as the first linker, the second linker nucleotide or the second linker oligonucleotide. The specific sequence is not particularly limited, and the nucleotide whose base is adenine (A) uracil, U) nucleotide, a nucleotide whose base is guanine (G), a nucleotide whose base is cytosine (C), or a combination thereof.

a first 1-1 oligonucleotide consisting of a consecutive base sequence of the A-th to B-th nucleotides from the 5 'end or the 3' end of the first miRNA precursor of t nucleotide (nt) Preparing a first strand comprising the 1-2 oligonucleotide consisting of a contiguous nucleotide sequence;

a second-1 oligonucleotide consisting of a C-th to D-th consecutive nucleotide sequence from the 5 'end or the 3' end of a u mi nucleotide (nt) long second miRNA precursor, and D + Preparing a second strand comprising the second oligonucleotide comprising the nucleotide sequence;

A third strand comprising the first to third oligonucleotides consisting of the B + wth to B + xth consecutive nucleotide sequences from the 5'end or the 3'end of the first miRNA precursor of the t nucleotide (nt) Preparing;

A fourth strand comprising a second to third oligonucleotide consisting of D + y-th to D + z-th consecutive nucleotide sequences from the 5'end or 3'end of the second miRNA precursor of the u nucleotide (nt) Preparing; And

Connecting one end of the first strand to one end of the second strand or the fourth strand and connecting one end of the third strand to one end of the fourth strand or the second strand , &Lt; / RTI >

T and u are each independently an integer of 60 to 150,

A and C are each independently an integer of 1 to 10,

B and D are each independently an integer of 18 to 25,

Each of e and g is independently an integer of 1 to 5,

F and h are each independently an integer of 5 to 57,

W and y are each independently an integer of 6 to 62,

Each of x and z may be an integer of 11 to 119 independently.

In the present invention, prior to connecting one end of the first oligonucleotide to one end of the first oligonucleotide, the second oligonucleotide is preferably inserted between the first oligonucleotide and the second oligonucleotide The 1-1 linker may further comprise a 1-1 linker nucleotide or a 1-1 linker oligonucleotide. The specific sequence is not particularly limited and includes nucleotides wherein the base is adenine (A), the nucleotide whose base is uracil (U), the nucleotide whose base is guanine (G), the base is cytosine Nucleotides, or combinations thereof.

Also, in the second strand of the present invention, one end of the second oligonucleotide may be connected to one terminal of the second oligonucleotide, preferably, the second oligonucleotide Terminus of the second oligonucleotide may be linked to the 3 'end of the second oligonucleotide, or the 5' terminus of the second oligonucleotide may be ligated to the 3 'terminus of the second oligonucleotide .

In the present invention, prior to connecting one end of the second oligonucleotide to one end of the second oligonucleotide, the second oligonucleotide is added to the second oligonucleotide, The 2-1 linker may further include a 2-1 linker nucleotide or a 2-1 linker oligonucleotide. The specific sequence is not particularly limited and includes nucleotides wherein the base is adenine (A), the nucleotide whose base is uracil (U), the nucleotide whose base is guanine (G), the base is cytosine Nucleotides, or combinations thereof.

In the present invention, a first extended oligonucleotide may be further extended at one end of the first to third oligonucleotides in the third strand.

In the third strand of the present invention, one end of the first elongated oligonucleotide may be connected to one end of the first oligonucleotide, preferably, the 5'end of the first elongated oligonucleotide May be linked to the 3'end of the first oligonucleotide or the 5'end of the first oligonucleotide may be ligated to the 3'end of the first extended oligonucleotide.

In the present invention, prior to connecting one end of the first elongated oligonucleotide to one end of the first oligonucleotide, the first elongated oligonucleotide is inserted between the first oligonucleotide and the first elongated oligonucleotide, -2 linker, the 1-2 linker nucleotide or the 1-2 linker oligonucleotide can be further included. The specific sequence is not particularly limited and includes nucleotides wherein the base is adenine (A), the nucleotide whose base is uracil (U), the nucleotide whose base is guanine (G), the base is cytosine Nucleotides, or combinations thereof.

In the present invention, a second extended oligonucleotide may be further extended at either end of the second to third extended oligonucleotides in the fourth strand.

In the present invention, the second elongated oligonucleotide may be hybridized with the second oligonucleotide. The second elongated oligonucleotide may be at least 90% identical to the oligonucleotide complementary to the 3'-5 'direction of the first oligonucleotide , 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% Can be synthesized and manufactured.

In the present invention, in the fourth strand, one end of the second oligonucleotide may be connected to one end of the second elongated oligonucleotide, preferably, the 5'-end of the second oligonucleotide To the 3'end of the second elongated oligonucleotide, or the 5'end of the second elongated oligonucleotide to the 3'end of the second elongated oligonucleotide.

In the present invention, prior to connecting one end of the second oligonucleotide to one end of the second elongated oligonucleotide, the second elongated oligonucleotide is linked to the second elongated oligonucleotide, -2 linker, a second-2 linker nucleotide or a second-2 linker oligonucleotide. The specific sequence is not particularly limited and includes nucleotides wherein the base is adenine (A), the nucleotide whose base is uracil (U), the nucleotide whose base is guanine (G), the base is cytosine Nucleotides, or combinations thereof.

The double-stranded oligonucleotides provided in the present invention can regulate the expression of a target gene so that the miRNA having the desired function, its precursor or a fragment thereof can be simultaneously contained in the double stranded form so that they can maintain a stable double stranded form, The miRNA of the present invention can significantly increase the efficiency of transfer to the target site and give a synergistic effect to the expression of the function.

FIG. 1 illustrates the structure of a double stranded oligonucleotide according to an embodiment of the present invention.

Figure 2 illustrates the structure of a double stranded oligonucleotide according to one embodiment of the invention.

Figure 3 illustrates the structure of a double stranded oligonucleotide according to one embodiment of the present invention.

Figure 4 illustrates the structure of a double strand of oligonucleotides according to one embodiment of the present invention.

Figure 5 illustrates the structure of a double stranded oligonucleotide according to one embodiment of the present invention.

Figure 6 illustrates the structure of a double stranded oligonucleotide according to one embodiment of the present invention.

Figure 7 illustrates the structure of a double strand of oligonucleotides according to one embodiment of the invention.

Figure 8 illustrates the structure of a double stranded oligonucleotide according to one embodiment of the present invention.

9 shows the structure of a double stranded oligonucleotide according to an embodiment of the present invention.

10 illustrates the structure of a double stranded oligonucleotide according to an embodiment of the present invention.

11 shows the structure of a double stranded oligonucleotide according to an embodiment of the present invention.

12 shows the structure of a double stranded oligonucleotide according to an embodiment of the present invention.

Figure 13 shows the structure of a double stranded oligonucleotide according to an embodiment of the present invention.

Figure 14 shows the structure of a double stranded oligonucleotide according to one embodiment of the present invention.

Figure 15 shows the structure of a double stranded oligonucleotide according to one embodiment of the present invention.

16 illustrates the structure of a double stranded oligonucleotide according to an embodiment of the present invention.

Fig. 17 shows an arrangement structure of a first-1 oligonucleotide, a first-second oligonucleotide and a first-third oligonucleotide in a hairpin-shaped first miRNA precursor according to an embodiment of the present invention.

Fig. 18 shows an arrangement structure of the 1-1 oligonucleotide, the 1-2 oligonucleotide and the 1-3 oligonucleotide in the first miRNA precursor in the form of a hair pin, according to an embodiment of the present invention.

FIG. 19 shows the arrangement structure of the 1-1 oligonucleotide, the 1-2 oligonucleotide and the 1-3 oligonucleotide in the first miRNA precursor in the form of a hair pin, according to an embodiment of the present invention.

Fig. 20 shows an arrangement structure of the 1-1 oligonucleotide, the 1-2 oligonucleotide and the 1-3 oligonucleotide in the first miRNA precursor in the form of a hair pin, according to an embodiment of the present invention.

Figure 21 is an embodiment of the present invention, showing the arrangement structure of the 1-1 oligonucleotide, the 1-2 oligonucleotide and the 1-3 oligonucleotide in the first miRNA precursor in the form of a hair pin.

FIG. 22 shows an arrangement structure of the 1-1 oligonucleotide, the 1-2 oligonucleotide and the 1-3 oligonucleotide in the first miRNA precursor in the form of a hair pin, according to one embodiment of the present invention.

FIG. 23 shows an arrangement structure of the 1-1 oligonucleotide, the 1-2 oligonucleotide and the 1-3 oligonucleotide in the first miRNA precursor in the form of a hair pin in one embodiment of the present invention.

FIG. 24 shows an arrangement structure of the 1-1 oligonucleotide, the 1-2 oligonucleotide and the 1-3 oligonucleotide in the first miRNA precursor in the form of a hair pin, according to an embodiment of the present invention.

25 shows the structure of a double stranded oligonucleotide according to an embodiment of the present invention.

Figure 26 shows the structure of a double stranded oligonucleotide according to an embodiment of the present invention.

27 shows the structure of a double stranded oligonucleotide according to an embodiment of the present invention.

28 shows the structure of a double stranded oligonucleotide according to an embodiment of the present invention.

29 shows the structure of a double stranded oligonucleotide according to an embodiment of the present invention.

Figure 30 shows the structure of a double stranded oligonucleotide according to an embodiment of the present invention.

31 shows the structure of a double stranded oligonucleotide according to an embodiment of the present invention.

Figure 32A illustrates the structure of a double stranded oligonucleotide according to an embodiment of the present invention.

32B is a schematic view illustrating a process for preparing a double stranded oligonucleotide according to an embodiment of the present invention.

In FIGS. 28 to 32, PSI-502 corresponds to hsa-miR-6514-5p miRNA, and PSI-503 corresponds to hsa-miR-503-3p miRNA.

FIG. 33 is a graph showing the results of measuring the cell survival rate of the cancer cells after treating the double-stranded oligoribonucleotides of the present invention with SK-MEL28 cancer cells according to an embodiment of the present invention.

FIG. 34 is a graph showing the results of measurement of changes in the number of colonies after treatment of SK-MEL28 cancer stem cells with the double-stranded oligoribonucleotide according to the present invention in one embodiment of the present invention.

FIG. 35 is a graph showing the results of analyzing the cell infiltration ability of the cancer stem cells after treating the double stranded oligoribonucleotides according to the present invention in SK-MEL28 cancer stem cells according to an embodiment of the present invention.

FIG. 36 is a graph showing the expression levels of Nanog, a gene related to the stemness of cancer stem cells, after treatment of SK-MEL28 cancer stem cells according to the present invention with double-stranded oligoribonucleotides according to the present invention The results of the analysis are shown in the graph.

FIG. 37 is a graph showing the change in the expression level of TYRP1, a gene whose expression is suppressed in the cancer stem cells, after treating the double-stranded oligoribonucleotide according to the present invention with SK-MEL28 cancer stem cells according to an embodiment of the present invention The results are shown graphically.

FIG. 38 is a graph showing the results of treatment of SK-MEL28 cancer cells with double stranded oligoribonucleotides according to the present invention and measuring the concentration (GI ₅₀ ) at which 50% The results are shown graphically.

FIG. 39 is a graph showing the results of treatment of Malme-3m cancer cells according to the present invention by measuring double-stranded oligoribonucleotides according to the present invention and measuring the concentration (GI ₅₀ ) The results are shown graphically.

40 is a graph showing the results of measuring the concentration (GI ₅₀ ) at which the death of 50% cancer cells can be induced after treating the double stranded oligoribonucleotide according to the present invention with A549 cancer cells according to an embodiment of the present invention, As shown in the graph.

FIG. 41 is a graph showing the results obtained by treating the NCI-H460 cancer cells according to the present invention with a double-stranded oligoribonucleotide according to an embodiment of the present invention, measuring the concentration (GI ₅₀ ) The results are shown graphically.

Hereinafter, the present invention will be described in more detail with reference to Examples. It will be apparent to those skilled in the art that these embodiments are only for describing the present invention in more detail and that the scope of the present invention is not limited by these embodiments in accordance with the gist of the present invention .

실시예Example

[준비예 1] 목적하는 miRNA 전구체의 준비[Preparation Example 1] Preparation of desired miRNA precursor

Hsa-miR-6514-5p miRNA and hsa-miR-503-3p miRNA comprising the nucleotide sequences shown in Table 1 below and their precursors were prepared.

miRNA 종류miRNA type	염기서열Base sequence
hsa-miR-6514-5p miRNAhsa-miR-6514-5p miRNA	uauggaguggacuuucagcuggc (서열번호 3)uauggaguggacuuucagcuggc (SEQ ID NO: 3)
hsa-miR-503-3p miRNAhsa-miR-503-3p miRNA	gggguauuguuuccgcugccagg (서열번호 4)gggguauuguuuccgcugccagg (SEQ ID NO: 4)
hsa-miR-6514-5p miRNA 전구체hsa-miR-6514-5p miRNA precursor	uauggaguggacuuucagcuggcauuuacgagucagaguucuuacagagcugccuguucuuccacuccag(서열번호 35)uauggaguggacuuucagcuggcauuuacgagucagaguucuuacagagcugccuguucuuccacuccag (SEQ ID NO: 35)
hsa-miR-503-3p miRNA 전구체hsa-miR-503-3p miRNA precursor	ugcccuagcagcgggaacaguucugcagugagcgaucggugcucugggguauuguuuccgcugccagggua(서열번호 36)ugcccuagcagcgggaacaguucugcagugagcgaucggugcucugggguauuguuuccgcugccagggua (SEQ ID NO: 36)

[실시예 1] 이중 가닥의 올리고뉴클레오티드의 제작(PSI-50B-2.3)[Example 1] Production of double-stranded oligonucleotides (PSI-50B-2.3)

A double stranded oligonucleotide shown in Fig. 28 was prepared. More specifically, the hsa-miR-6514-5p miRNA represented by SEQ ID NO: 3 and the hsa-miR-503-3p miRNA represented by SEQ ID NO: 4 were prepared as a first oligonucleotide and a second oligonucleotide, respectively. Thereafter, a first elongated oligonucleotide represented by SEQ ID NO: 5, which is complementary to the 3'-5 'direction of the hsa-miR-503-3p miRNA, is synthesized and ligated from the 3' end of the first oligonucleotide Respectively. Further, a second extended oligonucleotide represented by SEQ ID NO: 6, which is complementary to the 3'-5 'direction of the hsa-miR-6514-5p miRNA, is synthesized and linked from the 3' end of the second oligonucleotide Respectively. The first strand of the thus synthesized double stranded oligonucleotide is represented by SEQ ID NO: 1, and the second strand is represented by SEQ ID NO: 2 (Table 2).

miRNA 종류miRNA type	염기서열Base sequence
제1 가닥First strand	uauggaguggacuuucagcuggcccuggcagcggaaacaauacccc (서열번호 1)uauggaguggacuuucagcuggcccuggcagcggaaacaauacccc (SEQ ID NO: 1)
제2 가닥Second strand	gggguauuguuuccgcugccagggccagcugaaaguccacuccaua (서열번호 2)gggguauuguuuccgcugccagggccagcugaaaguccacuccaua (SEQ ID NO: 2)

[실시예 2] 이중 가닥의 올리고뉴클레오티드의 제작(PSI-50A-2.3)[Example 2] Construction of double stranded oligonucleotide (PSI-50A-2.3)

A double-stranded oligonucleotide shown in Fig. 29 was prepared. More specifically, a first oligonucleotide corresponding to a miRNA fragment consisting of the first to eleventh nucleotide sequences (SEQ ID NO: 9) from the 5 'end of the hsa-miR-6514-5p miRNA was prepared and hsa-miR-503 A second oligonucleotide corresponding to the miRNA fragment consisting of the 1 st to 12 th nucleotide sequence (SEQ ID NO: 10) from the 5 'end of the -3p miRNA was prepared. Then, a first elongated oligonucleotide of SEQ ID NO: 11, which is complementary to the nucleotide sequence in the 3'-5 'direction of the second oligonucleotide, was synthesized and extended at the 3' end of the first oligonucleotide. Also, a second extended oligonucleotide of SEQ ID NO: 12, which is complementary to the 3'-5 'direction of the first oligonucleotide, was synthesized and extended at the 3' end of the second oligonucleotide. The first strand and the second strand of the thus synthesized double stranded oligonucleotides are represented by SEQ ID NO: 7 and SEQ ID NO: 8, respectively (Table 3).

miRNA 종류miRNA type	염기서열Base sequence
제1 가닥First strand	uauggaguggaaaacaauacccc (서열번호 7)uauggaguggaaaacaauacccc (SEQ ID NO: 7)
제2 가닥Second strand	gggguauuguuuuccacuccaua (서열번호 8)gggguauuguuuuccacuccaua (SEQ ID NO: 8)

[실시예 3] 이중 가닥의 올리고뉴클레오티드의 제작(PSI-50C-2.3)[Example 3] Construction of double-stranded oligonucleotides (PSI-50C-2.3)

A double-stranded oligonucleotide shown in Fig. 30 was prepared. More specifically, a first oligonucleotide represented by SEQ ID NO: 15, which is an miRNA fragment consisting of the 2nd to 11th nucleotide sequences from the 5 'end of hsa-miR-6514-5p miRNA, is prepared, The nucleotides were extended with uracyl nucleotides as the capped nucleotides. In addition, a second oligonucleotide represented by SEQ ID NO: 16, which is an miRNA fragment consisting of the 2nd to 12th nucleotide sequences from the 5 'end of hsa-miR-503-3p miRNA, was prepared, and a second oligonucleotide Nucleotides in which the base was uracil was further extended. Also, a first extension nucleotide represented by SEQ ID NO: 17, which is complementary to the base sequence in the 3'-5 'direction of the second oligonucleotide, is synthesized and extended at the 3'end of the first oligonucleotide, At the 3 'end of the nucleotide, a nucleotide which is a base adenine complementary to the second capping nucleotide was further extended as a first terminal nucleotide. Also, a second elongated oligonucleotide represented by SEQ ID NO: 18, which is complementary to the nucleotide sequence in the 3'-5 'direction of the first oligonucleotide, is synthesized and extended at the 3'end of the second oligonucleotide, A nucleotide which is a base adenine complementary to said first capping nucleotide was further extended at the 3 'end of the second extended oligonucleotide. The first strand and the second strand of the thus synthesized double stranded oligonucleotides are represented by SEQ ID NO: 13 and SEQ ID NO: 14, respectively (Table 4).

miRNA 종류miRNA type	염기서열Base sequence
제1 가닥First strand	uauggaguggaaaacaauaccca (서열번호 13)uauggaguggaaaacaauaccca (SEQ ID NO: 13)
제2 가닥Second strand	uggguauuguuuuccacuccaua (서열번호 14)uggguauuguuuuccacuccaua (SEQ ID NO: 14)

[실시예 4] 이중 가닥의 올리고뉴클레오티드의 제작(PSI-50D-2.3)[Example 4] Production of double strand oligonucleotide (PSI-50D-2.3)

The double-stranded oligonucleotides shown in Fig. 31 were prepared. More specifically, a first oligonucleotide represented by SEQ ID NO: 21, which is an miRNA fragment consisting of the second to eleventh nucleotide sequences from the 5 'end of hsa-miR-6514-5p miRNA, is prepared, The nucleotides were extended with uracyl nucleotides as the capped nucleotides. In addition, a second oligonucleotide represented by SEQ ID NO: 22, which is an miRNA fragment consisting of the 2nd to 11th nucleotide sequences from the 5 'end of the hsa-miR-503-3p miRNA, was prepared, and a second oligonucleotide Nucleotides in which the base was uracil was further extended. Then, the 12th nucleotide from the 5 'end of the hsa-miR-6514-5p miRNA was further extended to the 3' end of the first oligonucleotide as a first linker nucleotide, and then the second oligonucleotide The first elongated oligonucleotide of SEQ ID NO: 23, which is complementary to the first to ninth nucleotide sequences in the 3'-5 'direction of the nucleotide, was synthesized and extended. The 3 ' end of the first elongated oligonucleotide is fused to the 22 < th > to 23 < th > (first to second from the 3 ' end) consecutive oligonucleotides from the 5 ' end of the hsa-miR-6514-5p miRNA to the first terminal oligonucleotide . Further, a 12th nucleotide from the 5 'end of the hsa-miR-503-3p miRNA was further extended to the 3' end of the second oligonucleotide with a second linker nucleotide, and the second linker nucleotide was followed by the first oligonucleotide A second extended oligonucleotide represented by SEQ ID NO: 24, which is complementary to the first to ninth nucleotide sequences in the 3'-5 ' The 3'-end of the second elongated oligonucleotide is fused with a contiguous oligonucleotide of the 22th to 23rd (1 to 2'th from the 3'end) from the 5'end of the hsa-miR-503-3p miRNA to a second terminal oligonucleotide . The first strand and the second strand of the thus synthesized double stranded oligonucleotides are represented by SEQ ID NO: 19 and SEQ ID NO: 20, respectively (Table 5).

miRNA 종류miRNA type	염기서열Base sequence
제1 가닥First strand	uauggaguggacaacaauaccgc (서열번호 19)uauggaguggacaacaauaccgc (SEQ ID NO: 19)
제2 가닥Second strand	uggguauuguuuuccacuccagg (서열번호 20)uggguauuguuuuccacuccagg (SEQ ID NO: 20)

[실시예 5] 이중 가닥의 올리고뉴클레오티드의 제작(PSI-50E-2.3)[Example 5] Preparation of double-stranded oligonucleotides (PSI-50E-2.3)

The double-stranded oligonucleotides shown in Fig. 32 were prepared. More specifically, a first oligonucleotide consisting of a first to a 23rd nucleotide sequence (SEQ ID NO: 27) from the 5'end of the hsa-miR-6514-5p miRNA precursor and a second oligonucleotide comprising a 24th to 34th nucleotide sequence No. 28) was prepared, and the 5'-end of the 1-2 oligonucleotide was ligated to the 3 'end of the 1-1 oligonucleotide. The said 1-1 oligonucleotide can be separated from the hsa-miR-6514-5p miRNA precursor by a dicer functional group. The 2-1 oligonucleotide consisting of the 4-26th nucleotide sequence (SEQ ID NO: 30) from the 3'end of the hsa-miR-503-3p miRNA precursor and the 2-1 oligonucleotide consisting of the 27th to 33st nucleotide sequence (SEQ ID NO: 31) After preparing the second oligonucleotide, the 5 'end of the second oligonucleotide was ligated to the 3' end of the second oligonucleotide. Wherein said second-1 oligonucleotide can also be isolated from the hsa-miR-503-3p miRNA precursor by a dicer functional group. (SEQ ID NO: 29) from the 5'-end of the hsa-miR-6514-5p miRNA precursor to prepare the hsa-miR-503-5p miRNA precursor. 3p oligonucleotide consisting of the 37th to 45th consecutive nucleotide sequences (SEQ ID NO: 32) from the 3'end of the 3p miRNA precursor was prepared. Next, a first extended oligonucleotide represented by SEQ ID NO: 33, which is complementary to the 3'-5 'direction of the nucleotide sequence of the first oligonucleotide at the 3'end of the first oligonucleotide, Respectively. In addition, a second extended oligonucleotide represented by SEQ ID NO: 34, which is complementary to the 3'-5 'direction of the second oligonucleotide in the 5'-terminus of the second oligonucleotide, Respectively. Then, the 5'end of the second oligonucleotide is ligated to the 3'end of the first oligonucleotide to synthesize an oligonucleotide of the single strand represented by SEQ ID NO: 25, and the second oligonucleotide of the second oligonucleotide Stranded oligonucleotide of SEQ ID NO: 26 was synthesized by connecting the 5'end of the first oligonucleotide to the 3'end (Table 6). The oligonucleotide of SEQ ID NO: 25 and the oligonucleotide of SEQ ID NO: 26 may be hybridized to each other to form a double strand.

miRNA 종류miRNA type	염기서열Base sequence
제1 가닥+제2 가닥First strand + second strand	uauggaguggacuuucagcuggcauuuacgagucgugcucugggguauuguuuccgcugccagg(서열번호 25)uauggaguggacuuucagcuggcauuuacgagucgugcucugggguauuguuuccgcugccagg (SEQ ID NO: 25)
제3 가닥+제4 가닥Third strand + fourth strand	ccuggcagcggaaacaauaccccagugagcgaguucuuacagagccagcugaaaguccacuccaua(서열번호 26)ccuggcagcggaaacaauaccccagugagcgaguucuuacagagccagcugaaaguccacuccaua (SEQ ID NO: 26)

[준비예 2] 암 세포 및 암 줄기세포의 준비[Preparation Example 2] Preparation of cancer cells and cancer stem cells

SK-MEL28, MALME-3M, A549 and NCI-H460 cancer cell lines were purchased from ATCC and cultured. SK-MEL28 cancer cell lines were cultured in DMEM / F12 medium supplemented with B27 supplement and growth factors (FGF and EGF 20 ng / mL) to induce cancer stem cells. Only cells expressing the cancer stem cell marker CD44 + were selected and cultured for about 2 weeks.

[실험예 1] 암 세포 및 암 줄기세포의 생존율 평가[Experimental Example 1] Evaluation of survival rate of cancer cells and cancer stem cells

Five kinds of double stranded oligoribonucleotides prepared in Examples 1 to 5 were introduced into SK-MEL28 cancer cells and cancer stem cells prepared in Preparation Example 2 using lipofectamine for 9 days, The change in survival rate is shown in Fig.

As shown in FIG. 33, it was confirmed that the survival rate of the cancer cells and cancer stem cells was significantly reduced by treating the cancer cells and cancer stem cells with the oligoribonucleotides according to the present invention.

Thus, the double-stranded oligoribonucleotides according to the present invention have the effect of inhibiting proliferation and inducing the death of cancer cells and cancer stem cells.

[실험예 2] 암 줄기세포의 증식 억제 평가[Experimental Example 2] Evaluation of proliferation inhibition of cancer stem cells

In the same manner as in Experimental Example 1, five kinds of double-stranded oligoribonucleotides of Examples 1 to 5 were introduced into SK-MEL28 cancer cells and cancer stem cells prepared in Preparation Example 2, The comparison is shown in Fig.

As shown in FIG. 34, when the oligoribonucleotides of the present invention were treated with cancer cells and cancer stem cells, the number of colonies of cancer cells and cancer stem cells was significantly reduced.

As a result, the double stranded oligoribonucleotides according to the present invention have excellent effects of inhibiting proliferation and inducing apoptosis of cancer cells and cancer stem cells.

[실험예 3] 암 줄기세포의 전이 억제 평가[Experimental Example 3] Evaluation of inhibition of metastasis of cancer stem cells

In the same manner as in Experimental Example 1, SK-MEL28 cancer cells and cancer stem cells prepared in Preparation Example 2 were inoculated with 5 double-stranded oligoribonucleotides obtained in Examples 1 to 5, Is shown in Fig. 35

As shown in FIG. 35, it was confirmed that the cancer infiltration ability of cancer stem cells was significantly reduced by treating the cancer cells and cancer stem cells with the oligoribonucleotides according to the present invention.

Thus, it can be seen that the double-stranded oligoribonucleotides according to the present invention can effectively inhibit the cell infiltration ability of cancer cells and cancer stem cells.

[실험예 4] 암 줄기세포의 분화 유도 평가[Experimental Example 4] Evaluation of differentiation induction of cancer stem cells

The oligo ribonucleotides of Examples 1 to 5 were introduced into SK-MEL28 cancer cells and cancer stem cells prepared in Preparative Example 2, respectively, in the same manner as in Experimental Example 1, and cancer stem cells into which oligo ribonucleotides were introduced The cDNAs were synthesized by harvesting RNA, and the real-time amplification cycles of the Nanog and TYRP1 genes were quantified and quantified by the qPCR method using the primers shown in Table 7 below. The results are shown in Figs. 36 and 37.

프라이머 이름Name of the primer	프라이머 서열Primer sequence
NanogNanog	ForwardForward	CCCCAGCCTTTACTCTTCCTACCCCAGCCTTTACTCTTCCTA
NanogNanog	ReverseReverse	CCAGGTTGAATTGTTCCAGGTCCCAGGTTGAATTGTTCCAGGTC
TYRP1TYRP1	ForwardForward	TGGCCAAGTCGGGAGTTTAGTGGCCAAGTCGGGAGTTTAG
TYRP1TYRP1	ReverseReverse	CATACTGCGTCTGGCACGAACATACTGCGTCTGGCACGAA
GAPDHGAPDH	ForwardForward	AATCCCATCACCATCTTCCAAATCCCATCACCATCTTCCA
GAPDHGAPDH	ReverseReverse	TGGACTCCACGACGTACTCATGGACTCCACGACGTACTCA

As shown in FIG. 36, when the oligo ribonucleotides according to the present invention were treated with SK-MEL28 cancer stem cells, the expression level of Nanog, a gene related to stemness, was remarkably reduced.

On the other hand, as shown in FIG. 37, the level of expression of TYRP1, whose expression is suppressed in cancer stem cells, is increased.

Thus, it can be seen that the double-stranded oligoribonucleotide according to the present invention has an effect of losing the stemness of cancer stem cells.

[실험예 5] 암 세포의 증식 억제 평가[Experimental Example 5] Evaluation of proliferation inhibition of cancer cells

Five double stranded oligoribonucleotides of Examples 1 to 5 were added to each of SK-MEL28, Malme-3m, A549 and NCI-H460 cancer cells prepared in Preparation Example 2 using lipofectamine (0.01, 1, 10, 100, 1000, 10000 nM), and the change in cell viability was measured. The results are shown in FIGS. 38 to 41, respectively.

As shown in FIG. 38 to FIG. 41, it was confirmed that the cancer cell was treated with the oligoribonucleotide according to the present invention, and the concentration of the cancer cell was reduced to about 50%.

As a result, the double stranded oligoribonucleotides according to the present invention are excellent in inhibiting proliferation and inducing the death of cancer cells.

[Description of Symbols]

10: first oligonucleotide

11: Second oligonucleotide

20: first extended oligonucleotide

21: second extended oligonucleotide

50a: 1-1 oligonucleotide

50b: the 1-2 oligonucleotide

50c: 1st to 3rd oligonucleotides

60a: the 2-1 oligonucleotide

60b: 2-2 oligonucleotide

60c: 2nd to 3rd oligonucleotides

70: first elongated oligonucleotide

71: second extended oligonucleotide

100: a first capping nucleotide or a first capping oligonucleotide

100 ': a second capping nucleotide or a second capping oligonucleotide

200: first terminal nucleotide or first terminal oligonucleotide

200 ': a second terminal nucleotide or a second terminal oligonucleotide

300: first linker

300 ': the second linker

SEQ ID NO: 1: first strand

5'-uauggaguggacuuucagcuggcccuggcagcggaaacaauacccc-3 '

SEQ ID NO: 2: second strand

5'-gggguauuguuuccgcugccagggccagcugaaaguccacuccaua-3 '

SEQ ID NO: 3: first oligonucleotide

5'-uauggaguggacuuucagcuggc-3 '

SEQ ID NO: 4: Second oligonucleotide

5'-gggguauuguuuccgcugccagg-3 '

SEQ ID NO: 5: first extended oligonucleotide

5'-ccuggcagcggaaacaauacccc-3 '

SEQ ID NO: 6: Second extended oligonucleotide

5'-gccagcugaaaguccacuccaua-3 '

SEQ ID NO: 7: first strand

5'-uauggaguggaaaacaauacccc-3 '

SEQ ID NO: 8: Second strand

5'-gggguauuguuuuccacuccaua-3 '

SEQ ID NO: 9: First oligonucleotide

5'-uauggagugga-3 '

SEQ ID NO: 10: Second oligonucleotide

5'-gggguauuguuu-3 '

SEQ ID NO: 11: first extended oligonucleotide

5'-aaacaauacccc-3 '

SEQ ID NO: 12: Second extended oligonucleotide

5'-uccacuccaua-3 '

SEQ ID NO: 13: first strand

5'-uauggaguggaaaacaauaccca-3 '

SEQ ID NO: 14: Second strand

5'-uggguauuguuuuccacuccaua-3 '

SEQ ID NO: 15: First oligonucleotide

5'-auggagugga-3 '

SEQ ID NO: 16: Second oligonucleotide

5'-ggguauuguuu-3 '

SEQ ID NO: 17: first extended oligonucleotide

5'-aaacaauaccc-3 '

SEQ ID NO: 18: Second extended oligonucleotide

5'-uccacuccau-3 '

SEQ ID NO: 19: first strand

5'-uauggaguggacaacaauaccgc-3 '

SEQ ID NO: 20: Second strand

5'-uggguauuguuuuccacuccagg-3 '

SEQ ID NO: 21: first oligonucleotide

5'-auggagugga-3 '

SEQ ID NO: 22: Second oligonucleotide

5'-ggguauuguu-3 '

SEQ ID NO: 23: first extended oligonucleotide

5'-aacauauac-3 '

SEQ ID NO: 24: second extended oligonucleotide

5'-uccacucca-3 '

SEQ ID NO: 25

5'-uauggaguggacuuucagcuggcauuuacgagucgugcucugggguauuguuuccgcugccagg-3 '

SEQ ID NO: 26

5'-ccuggcagcggaaacaauaccccagugagcgaguucuuacagagccagcugaaaguccacuccaua-3 '

SEQ ID NO: 27: 1-1 oligonucleotide

5'-uauggaguggacuuucagcuggc-3 '

SEQ ID NO: 28: oligonucleotides 1-2

5'-auuuacgaguc-3 '

SEQ ID NO: 29: 1st to 3rd oligonucleotides

5'-guucuuacaga-3 '

SEQ ID NO: 30: 2-1 oligonucleotide

5'-gggguauuguuuccgcugccagg-3 '

SEQ ID NO: 31: 2-2 oligonucleotide

5'-gauge-3 '

SEQ ID NO: 32: 2nd to 3rd oligonucleotide

5'-agugagcga-3 '

SEQ ID NO: 33: first extended oligonucleotide

5'-gccagcugaaaguccacuccaua-3 '

SEQ ID NO: 34: second extended oligonucleotide

5'-ccuggcagcggaaacaauacccc-3 '

SEQ ID NO: 35: hsa-miR-6514-5p miRNA precursor

5'-uauggaguggacuuucagcuggcauuuacgagucagaguucuuacagagcugccuguucuuccacuccag-3 '

SEQ ID NO: 36: hsa-miR-6514-5p miRNA precursor

5'-ugcccuagcagcgggaacaguucugcagugagcgaucggugcucugggguauuguuuccgcugccagggua-3 '

Claims

As double stranded oligonucleotides,

A first strand comprising a first oligonucleotide of interest and a first stretch oligonucleotide; And

A second strand comprising the desired second oligonucleotide and a second elongated oligonucleotide,

Wherein the first elongated oligonucleotide can be hybridized with the second oligonucleotide,

Wherein said second elongated oligonucleotide is capable of hybridizing with said first oligonucleotide.
The method according to claim 1,

The oligonucleotide is a double-stranded oligonucleotide that is a DNA, RNA or DNA / RNA hybrid molecule.
The method according to claim 1,

The oligonucleotide may be,

The phosphorus backbone structure may be a monophosphate, a diphosphate, a triphosphate, an alkylphosphonate, a phosphorothioate, Phosphorodithioate, a form that includes a phosphoramidate structure;

DNA, PNA, LNA, UNA, bridged nucleic acid, GNA, or TNA (threose nucleic acid) molecules; or

Wherein the 2 ' hydroxyl group of the sugar is a methyl, ethyl, methoxy, ethoxy, amino or fluoro group.
The method according to claim 1,

Wherein said first oligonucleotide or said second oligonucleotide comprises a precursor of a mature miRNA, a miRNA precursor, a primary miRNA (pri-miRNA), a miRNA precursor in the form of a plasmid, or a fragment thereof &Lt; / RTI > double stranded oligonucleotides.
The method according to claim 1,

Wherein the first oligonucleotide and the second oligonucleotide are the same or different from each other, a double stranded oligonucleotide.
The method according to claim 1,

Wherein the length of the first oligonucleotide or the second oligonucleotide is 18 to 25 nt.
The method according to claim 1,

Wherein the length of the first oligonucleotide or the second oligonucleotide is 9 to 11 nt.
As double stranded oligonucleotides,

a first strand comprising a first oligonucleotide consisting of a contiguous nucleotide sequence from the 5 'end of a miRNA of length m nucleotides (nt) in length to a pth contiguous nucleotide sequence and a first stretch oligonucleotide; And

a second strand comprising a second oligonucleotide consisting of a contiguous sequence of bth to qth nucleotides from the 5 'end of the miRNA of length n nucleotides (nt) and a second stretch oligonucleotide,

Wherein the first elongated oligonucleotide can be hybridized with the second oligonucleotide,

The second elongated oligonucleotide may be hybridized with the first oligonucleotide,

m and n are each independently an integer of 18 to 25,

a and b are each independently an integer of 1 to 3,

p is an integer of 10 to m,

and q is an integer from 10 to n, the double stranded oligonucleotide.
9. The method of claim 8,

Wherein said first oligonucleotide or said second oligonucleotide comprises a precursor of a miRNA precursor in the form of a mature miRNA, a miRNA precursor, a primary miRNA (pri-miRNA) or a plasmid, or a fragment thereof &Lt; / RTI > double stranded oligonucleotides.
9. The method of claim 8,

Wherein the first oligonucleotide consists of a contiguous sequence of the first through pth nucleotides from the 5 'end of the miRNA of m nucleotide length.
9. The method of claim 8,

Wherein the first oligonucleotide consists of a contiguous nucleotide sequence from the 2 < nd > to p < th > nucleotides from the 5 'end of the miRNA of m nucleotide length.
9. The method of claim 8,

Wherein the second oligonucleotide consists of a contiguous sequence of the first to qth nucleotides from the 5 'end of the miRNA of length n nucleotides.
9. The method of claim 8,

Wherein the second oligonucleotide consists of a contiguous nucleotide sequence from the 5 ' end of the miRNA of length n nucleotides (nt) in length to the 2 < nd > to qth consecutive nucleotides.
9. The method of claim 8,

Wherein the first elongated oligonucleotide comprises a sequence complementary to the first to q-bth nucleotide sequences of the 3'-5 'direction of the second oligonucleotide.
9. The method of claim 8,

Wherein the second elongated oligonucleotide comprises a sequence complementary to a first to p-a base sequence of a base sequence in the 3'-5 'direction of the first oligonucleotide.
9. The method of claim 8,

Further comprising a first capping nucleotide or a first capping oligonucleotide at the 5 ' end of the first strand.
17. The method of claim 16,

Wherein the first capped nucleotide is the first or second nucleotide from the 5 'end of the m nucleotide (nt) long miRNA, or the nucleotide is a uracil (U) nucleotide.
17. The method of claim 16,

Wherein the first cap oligonucleotide comprises a nucleotide sequence that is a nucleotide of uracil U or is a first to second consecutive oligonucleotides from the 5'end of the m nucleotide (nt) Lt; / RTI >
9. The method of claim 8,

And a second capping nucleotide at the 5 ' end of the second strand.
20. The method of claim 19,

Wherein the second capping nucleotide is the first or second nucleotide from the 5 'end of the n nucleotide (nt) long miRNA, or the nucleotide is a uracil (U) nucleotide.
20. The method of claim 19,

Wherein the second cap oligonucleotide comprises a nucleotide sequence that is a nucleotide of uracil U or a nucleotide sequence complementary to the double stranded nucleotide sequence of the nucleotide sequence of the first nucleotide (nt) Lt; / RTI >
9. The method of claim 8,

Further comprising a first linker nucleotide or first linker oligonucleotide between said first oligonucleotide and said first elongated oligonucleotide.
23. The method of claim 22,

Wherein the first linker nucleotide is a p + 1 th nucleotide from the 5 'end of the m nucleotide (nt) length of the miRNA, and p is an integer from 10 to m-1.
23. The method of claim 22,

Wherein the first linker oligonucleotide is an oligonucleotide consisting of consecutive base sequences from p + 1 to p + rth from the 5 'end of the m nucleotide (nt) length of the m nucleotide, r is an integer of 2 to 4 , And the maximum value of p is an integer of m-4 to m-2.
9. The method of claim 8,

Further comprising a second linker nucleotide or a second linker oligonucleotide between said second oligonucleotide and said second elongated oligonucleotide.
26. The method of claim 25,

Wherein the second linker nucleotide is a q + 1 th nucleotide from the 5 'end of the miRNA of the n nucleotide (nt) length, and q is an integer from 10 to n-1.
26. The method of claim 25,

The second linker oligonucleotide is an oligonucleotide consisting of a sequence sequence of q + 1 th through q + s th successive nucleotides from the 5 'end of the n nucleotide (nt) long miRNA, and s is an integer of 2 to 4 And the maximum value of q is an integer of n-4 to n-2.
9. The method of claim 8,

Wherein the first strand further comprises a first terminal nucleotide or a first terminal oligonucleotide at the 3 ' end of the first strand.
29. The method of claim 28,

Wherein the first terminal nucleotide is a nucleotide whose base is adenine (A) or is the mth nucleotide of the miRNA of length m nucleotides (nt) in length, the double-stranded oligonucleotide.
29. The method of claim 28,

Wherein the first terminal oligonucleotide consists of m-cth through mth consecutive nucleotide sequences from the 5 'end of the m nucleotide (nt) length of the miRNA, and wherein c is from 1 to 3, the double-stranded oligonucleotide.
9. The method of claim 8,

Further comprising a second terminal oligonucleotide or a second terminal oligonucleotide at the 3 ' end of the second strand.
32. The method of claim 31,

Wherein said second terminal nucleotide is a nucleotide whose base complementary to said first nucleotide is adenine (A) or is the nth nucleotide of said n nucleotide (nt) long miRNA.
32. The method of claim 31,

Wherein the second terminal oligonucleotide consists of the n-dth to nth consecutive nucleotide sequences from the 5 'end of the n nucleotide (nt) length of the miRNA, and d is from 1 to 3, the double stranded oligonucleotide.
As double stranded oligonucleotides,

A first strand comprising a first fragment of a first miRNA precursor of interest and a first strand comprising a second strand of a first oligonucleotide;

A second strand comprising a second fragment of the second miRNA precursor and a second fragment of the second miRNA precursor;

A third strand comprising the < RTI ID = 0.0 > 1-3 < / RTI > oligonucleotide which is another fragment of the desired first miRNA precursor;

And a fourth strand comprising a second fragment of the second miRNA precursor of interest, the second strand of the second oligonucleotide,

Wherein one end of the first strand is connected to one end of the second strand or the fourth strand,

Wherein one end of said third strand is connected to either end of said fourth strand or said second strand.
35. The method of claim 34,

Wherein one end of said first oligonucleotide is connected to one end of said first oligonucleotide.
35. The method of claim 34,

Wherein one end of said 2-1 oligonucleotide is connected to either end of said 2-2 oligonucleotide.
35. The method of claim 34,

Wherein the third strand further comprises a first elongated oligonucleotide capable of hybridizing with the < RTI ID = 0.0 > 1-1 < / RTI > oligonucleotide.
35. The method of claim 34,

Wherein said fourth strand further comprises a second extending oligonucleotide capable of hybridizing with said second-1 oligonucleotide.
39. The method of claim 37,

Wherein one end of said first oligonucleotide is connected to one end of said first elongated oligonucleotide.
39. The method of claim 37,

Wherein one end of said second 2-3 oligonucleotide is connected to one end of said second elongated oligonucleotide.
As double stranded oligonucleotides,

a first 1-1 oligonucleotide consisting of a consecutive A to B nucleotide sequence from the 5 'end of a first miRNA precursor of length t nucleotides (nt) and a second nucleotide sequence consisting of a sequence of B + e th to B + f consecutive nucleotides Lt; / RTI >oligonucleotides;

a 2-1 oligonucleotide consisting of a C-th to D-th contiguous nucleotide sequence from the 3 'end of a second miRNA precursor having a length of u nucleotides (nt) and a nucleotide sequence consisting of D + g to D + A second strand comprising the 2-2 oligonucleotide;

A third strand comprising a first to third oligonucleotide consisting of a sequence of B + wth to B + xth consecutive nucleotides from the 5 'end of said first miRNA precursor of said t nucleotide (nt) length; And

And a fourth strand comprising a second to third oligonucleotide consisting of a sequence of D + y-th to D + z-th consecutive nucleotides from the 5 'end of the second miRNA precursor having a length of u nucleotides (nt)

Wherein one end of the first strand is connected to one end of the second strand or the fourth strand,

Wherein one end of the third strand is connected to one end of the fourth strand or the second strand,

T and u are each independently an integer of 60 to 150,

A and C are each independently an integer of 1 to 10,

B and D are each independently an integer of 18 to 25,

Each of e and g is independently an integer of 1 to 5,

F and h are each independently an integer of 5 to 57,

W and y are each independently an integer of 6 to 62,

Wherein x and z are each independently an integer from 11 to 119. < RTI ID = 0.0 > 16. < / RTI >